- Email: [email protected]
miRNA expression patterns in chemoresistant breast cancer tissues
G Model
BIOPHA-3454; No. of Pages 8 Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Available online at
ScienceDirect www.sciencedirect.com
Original article
miRNA expression patterns in chemoresistant breast cancer tissues Jianxin Lv b,1, Kai Xia c,1, Pengfei Xu a, Erhu Sun a, Jingjing Ma a, Sheng Gao a, Qian Zhou a, Min Zhang a, Fengliang Wang a, Fei Chen a, Ping Zhou a, Ziyi Fu a,*, Hui Xie a,* a
Nanjing Maternity and Child Health Medical Institute, Affiliated Nanjing Maternal and Child Health Hospital, Nanjing Medical University, 210004 Nanjing, China b Yangzhou Maternal and Child Health Hospital, Affiliated with Yangzhou Medical University, 225002 Yangzhou, China c The Affiliated Jiangyin Hospital of Southeast University Medical College, 214400 Jiangyin, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 August 2014 Accepted 21 September 2014
Background/aims: Breast cancer chemoresistance is a major obstacle to the successful treatment of patients. miRNAs perform critical roles in biological processes, including tumorigenesis and chemoresistance. However, little clinical data are available regarding the relationship between miRNA expression patterns and breast cancer chemoresistance. Methods: We created a doxorubicin-resistant MCF-7 (MCF-/Adr) cell line using a pulse-selection method; then verified the resistance of the MCF-7/Adr cell line to doxorubicin by using the methyl thiazolyl tetrazolium (MTT) assay, terminal deoxyribonucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) staining, and Intracellular doxorubicin accumulation assay. Then, we performed qRTPCR to detect the expression patterns of 14 selected miRNAs (which are related to breast cancer resistance) in both cell lines. Subsequently, we performed a bioinformatics analysis, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses, to determine the putative functions of 13 differentially expressed miRNA-targeted genes. Finally, we tested the expression levels of these 13 miRNAs in 10 chemotherapy non-responder breast cancer tissues and 29 responder tissues. All statistical analyses were performed by a two-tailed Student’s t-test, and a P value less than 0.05 was considered statistically significant. Results: The results of the MTT assay showed that the MCF-7/Adr cell line was significantly more resistant to doxorubicin compared to the MCF-7 cells The results of the TUNEL assay indicated that doxorubicin induced an increase in the number apoptotic cells in the MCF-7 group. Additionally, the accumulation of doxorubicin was higher in MCF-7 cells compared to MCF-7/Adr cells, which was consistent with the MTT and TUNEL results. The qRT-PCR results demonstrated that compared to the parental MCF-7 cell line, miR-200a, miR141, miR-200c, miR-31, miR-429, and miR-196b were over-expressed, and let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760 were significantly down-regulated in MCF-7/Adr cells. The GO analysis results revealed that the predicted target genes of these 14 miRNAs primarily regulated protein binding, zinc ion binding, DNA binding, and transcription factor activity. The KEGG data demonstrated that these target genes are mainly involved in the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, and other signaling pathways. Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). Conclusion: In this study, we identified 10 dysregulated miRNAs in both breast cancer cells and chemoresistant tissues, which might be biomarkers for the prognosis of breast cancer chemoresistance. Our study contributes to a comprehensive understanding of prognostic biomarkers during clinical treatment, and we hypothesize that the miRNA signatures of drug-resistant carcinoma tissues could be useful for developing new strategies for targeted therapies in patients with chemoresistant breast cancer. ß 2014 Published by Elsevier Masson SAS.
Keywords: miRNA Breast cancer Chemoresistance
* Corresponding authors. Nanjing Maternal and Child Health Medical Institute, Affiliated Nanjing Maternal and Child Health Hospital, Nanjing Medical University, 123 Mochou road, 210004 Nanjing, China. Tel.: +86 25 52226159; fax: +86 25 84460507. E-mail address: [email protected] (Z. Fu). 1 Jianxin Lv and Kai Xia contributed equally to this work. http://dx.doi.org/10.1016/j.biopha.2014.09.011 0753-3322/ß 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 2
J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
1. Introduction Breast cancer is the most common malignancy in women, with 234,580 estimated new cases and 40,030 estimated deaths in the United States in 2013 [1]. Although early detection methods and treatment options have greatly improved due to a better understanding of the underlying molecular mechanisms, approximately 50% of patients with breast cancer will either fail to respond to initial chemotherapy or will rapidly acquire resistance to chemotherapeutic agents [2,3]. Drug resistance remains a major clinical obstacle to the successful treatment of patients with breast cancer, and a better understanding of the drug resistance mechanisms is needed to improve the current chemotherapy regimens [4]. The molecular mechanisms of breast cancer cell resistance to chemotherapeutic agents are very complex and involve multiple processes, including gene mutation, gene amplification, epigenetic changes, and microRNA expression [5]. MicroRNAs (miRNAs) are 19–25 nucleotide-long regulatory non-coding RNA molecules that regulate the expression of a wide variety of genes by sequence-specific base pairing to the 3’untranslated region (3’-UTR) of the target mRNAs, resulting in the degradation of target mRNAs or the inhibition of translation [6]. Greater than 50% of miRNA genes are located in cancerassociated genomic regions or in fragile sites, indicating that miRNAs may play important roles in tumorigenesis [7]. miRNAs are phylogenetically conserved and have a variety of functions in biological processes, including the regulation of cellular proliferation, differentiation and cell death [7–9]. miRNAs are also closely associated with drug resistance, and previous studies have shown that miRNAs can modulate the sensitivity of breast cancer cells to chemotherapeutic drugs and therefore contribute to the acquisition of chemoresistance [10–14]. Although miRNAs are becoming increasingly recognized as regulatory molecules in breast cancer cell lines, limited data have been reported regarding the relationship between miRNA expression signatures and breast cancer chemoresistance. A recent study suggested that 181 human miRNAs were differentially expressed between a chemoresistant cell line MCF-7/ Adr and the parental cell line MCF-7. Compared to MCF-7 cells, 16 miRNAs were down-regulated, and 165 miRNAs were upregulated in MCF-7/Adr cells [8]. However, this study included little information about the relationship between miRNA expression and breast cancer chemoresistance. Therefore, in our study, we aimed to identify differentially expressed miRNAs in chemoresistant breast cancer tissues. Our study contributes to a comprehensive understanding of prognostic biomarkers during clinical treatment, and we hypothesize that the miRNA signatures of drug-resistant carcinoma tissues could be used to develop new strategies for targeted therapies in patients with chemoresistant breast cancer.
2. Material and methods 2.1. Cell culture Human breast cancer MCF-7 cells were obtained from ATCC. Cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% (v/v) fetal bovine serum (Gibco), 100 U/mL streptomycin (Gibco), and 100 U/mL penicillin (Gibco) at 37 8C in a humidified atmosphere containing 5% carbon dioxide. MCF-7 cells were pulseselected with doxorubicin (10 pulses once a week for 4 h with 1 mM ADR) for six months to generate MCF-7/Adr cells [15]. The pulse concentrations were chosen based on changes in cell morphology and the clinical doxorubicin plasma concentration. MCF-7/Adr cells were cultured in the continuous presence of
doxorubicin (1 mg/mL) to maintain the drug resistance phenotype and in drug-free medium for more than 2 weeks before subsequent experiments. 2.2. Patients and samples Patients were identified through electronic records obtained from Nanjing Maternity and Child Health Hospital, and tissue samples were collected between 2008 and 2009. Clinical and ultrasound measurements were recorded before treatment, every two cycles during neoadjuvant chemotherapy (NAC), and at the end of NAC before surgery. The clinical response was evaluated by the decrease in tumor size and classified according to the RECIST criteria [16] as follows: complete response (CR), partial response (PR) as greater than 30% tumor shrinkage, stable disease (SD) as a decrease of less than 30% or an increase of less than 20%, and progressive disease (PD) as an increase of at least 20% or the appearance of new lesions. For further analysis, patients with CR or PR were regarded as clinical responders, while patients with SD or PD were regarded as non-responders. We collected 10 nonresponder breast cancer tissues as the chemoresistant group and 29 responders as the chemo-sensitive control. Fresh tumor samples were immediately frozen in liquid nitrogen and preserved at 80 8C. The women provided written informed consent to participate in the study. 2.3. Methyl thiazolyl tetrazolium (MTT) assay MCF-7/Adr and MCF-7 cells were seeded in 96-well plates at a density of 1 104 cells per well and incubated overnight. After incubation with different doses of doxorubicin (0, 1, 10, 100, 1000 nM) for 24 h, 48 h and 96 h at 37 8C, 20 mL of 3-(4, 5dimethylthiazol-2-yl)-2, 5-diphenyltetrazoliumbromide (MTT, Sigma Aldrich) solution (5 mg/mL in phosphate buffered saline) was added to each well, and the incubation was continued for an additional 4 h at 37 8C. Then, the medium was rapidly removed, and the MTT crystals were solubilized in 150 mL DMSO. The resulting absorbance was read in a plate reader at 490 nm. The absorbance readings were subtracted from the value of the blank wells; the reduction in cell growth was calculated as a percentage of the control absorbance in the absence of any drug. The data represent the mean SD of at least three independent experiments. 2.4. Terminal deoxyribonucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) staining TUNEL is an established technique for detecting apoptotic chondrocytes by labeling the fragmented DNA with deoxyribonucleotide triphosphate (dNTP). TUNEL was performed on randomly selected sections from each strain using a TACS1 2 TdT-DAB in situ detection kit (R&D Systems, Abingdon, UK). For the negative control, sections were incubated with the labeling buffer alone, and for the positive control, sections (Tissue Control Slide, R&D Systems, Abingdon, UK) were treated according to the manufacturer. 2.5. Intracellular doxorubicin accumulation assay The doxorubicin accumulation assay was performed to detect the sensitivity of cells to doxorubicin. MCF-7/Adr and MCF-7 cells were harvested and washed twice with ice-cold PBS. The intracellular mean fluorescence intensity associated with doxorubicin was determined using a microplate reader. Cells were then lysed in RIPA cell lysis buffer and collected for the detection of the OD at 570 nm. Intracellular doxorubicin accumulation was defined as the mean OD of the samples.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
3
2.6. Real-time RT-PCR quantification of miRNAs The total RNA of tumor tissue samples was isolated using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. The purified total RNA (1 mg) was then reverse transcribed using the PrimeScript RT reagent kit (Takara, Japan), and qPCR was performed on an ABI 7900 PCR System (Applied Biosystems, USA) using Power SYBR Green PCR Master Mix (2X, Applied Biosystems). The primers for amplification are listed in Table 1. Each reaction was performed in triplicate, and U6 snRNA was used as a normalization control [17,18]. The relative expression levels were determined using the comparative threshold cycle DD 2 Ct analysis method. Changes in miRNA expression were calculated as the fold change relative to the control. 2.7. miRNA target prediction and functional annotations The potential targets of miRNAs were predicted using the Target-Scan, PicTar, and microRNA.org programs with the default parameters. In our study, we subjected 6 up-regulated miRNAs and 7 down-regulated miRNAs in the MCF-7/Adr cell line to target prediction. Intersecting elements identified in each miRNA target prediction program were manually selected as miRNA targets. To investigate the possible biological processes regulated by the miRNAs, the MAS3 program (http://www.bioinfo.capitalbio.com/ mas3/) was used to determine the putative functions of the potential miRNA target genes by annotation using the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses.
Fig. 1. The resistance index of MCF-7 and MCF-7/Adr cells to doxorubicin. Cells were treated with different concentrations of doxorubicin (0, 1, 10, 100, 500, and 1000 mM) for 24 h, 48 h and 96 h before MTT treatment. The resulting changes in absorbance were read at 490 nm in a plate reader and expressed as a percentage of the control absorbance in the absence of any drug. The results showed that the IC50 of MCF-7/Adr cells has been elevated.
concentration (IC50) of MCF-7 cells was 9.007 mM doxorubicin. However, the IC50 of MCF-7/Adr cells was 800.853 mM doxorubicin. Compared to the IC50 of MCF-7 cells, the IC50 of MCF-7/Adr cells was elevated 88.91-fold (Fig. 1), which indicated that MCF-7/ Adr cells are resistant to doxorubicin. This result was further supported by a TUNEL assay demonstrating that the number of apoptotic cells was lower in MCF-7/Adr cells compared to MCF-7 cells (Fig. 2). 3.2. Intracellular doxorubicin accumulation in MCF-7/Adr cells
2.8. Statistical analysis All statistical analyses were evaluated by a two-tailed Student’s t-test. The data are presented as the mean standard deviation. A P value less than 0.05 was considered statistically significant. SPSS version 20 (SPSS Inc., Chicago, IL, USA) was used for the calculations. 3. Results
To confirm the sensitivity of the cells to doxorubicin, we characterized the intracellular accumulation of doxorubicin in MCF-7 and MCF-7/Adr cells by fluorescence microscopy. The data demonstrated that intracellular doxorubicin was decreased in MCF-7/Adr cells compared to MCF-7 cells (Fig. 3), indicating that MCF-7/Adr cells pumped more doxorubicin out of the cells and that the cells were resistant to doxorubicin compared to the parental MCF-7 cell line.
3.1. Cell viability and apoptosis of MCF-7 and MCF-7/Adr cells after doxorubicin treatment
3.3. miRNA expression patterns in MCF-7 and MCF-7/Adr cells
To determine whether MCF-7/Adr cells are resistant to the chemotherapeutic agent doxorubicin, cell viability was measured using the MTT assay. MCF-7 and MCF-7/Adr cells were treated with different concentrations of doxorubicin (0, 1, 10, 100, 500, 1000 mM). The results showed that the semi-effective inhibitory
Chen et al. performed an miRNA microarray to detect differentially expressed miRNAs between the parental MCF-7 cell line and the doxorubicin-resistant MCF-7/Adr cell line [8]. These authors demonstrated that 16 miRNAs were down-regulated and 165 miRNAs were up-regulated in MCF-7/Adr cells compared to
Table 1 Primers for amplification. microRNA miR-200a miR-141 miR-200c miR-31 miR-429 miR-491-3p miR-196b let-7e miR-576-3p miR-125b-1 miR-370 miR-145 miR-765 miR-760 U6
Forward primer 0
Reverse primer 0
5 - AGCCGC ATCTTACCGGAC AGT-3 50 - AGCCGC ATCTTACCGOAC AGT-30 50 -AGCCGCGTCTTACCC AGCAGT-30 50 - AGCCG AGGC A AG ATGCTGGC -30 50 - AGCCGTAATACTGTCTGGTA A-30 50 -AGCCGCrrATGCAAGAlTCCC-30 50 -AGCCGTAGGTAGTTTCCTGTT-30 50 - AGCCGTGAGGTAGGAGGTTGT-30 S0 -AGCCGAAGATGTGGAAAA/VTT-S0 50 - AGCCGACGGGT TAGGCCTCTTG- 30 50 AGCCGGCCTGCTGGGGTGGAA-30 50 AGCC GGTCCAGTTTTCCC AGGA-30 50 - AGCCGTGGAGGAGAAGGAAG-30 50 -AGCCGCGGCTCTGGOTCTG-30 50 -CTCGCTTCGGCAGCACA-30
50 -GTGCAGGGTCCG AGGT-30 50 - GTGCAGGGTCCGAGGT-30 50 - GTGCAGGGTCCG AGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 - GTGCAGGGTCCGAGGT-30 50 - GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGC AGGGTCCG AGGT-30 50 -GTGCAGGGTCCG AGGT-30 50 -GTGC AGGGTCCG AGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -A.ACGCTTC AC G A ATTTGCGT- 30
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 4
J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Fig. 2. We measured apoptosis in MCF-7 and MCF-7/Adr cells by the TUNEL assay. Cells were treated with different concentrations of doxorubicin (250 or 500 nM), and we found that the number of apoptotic MCF-7/Adr cells reduced compared to MCF-7 cells (A). The frequency of TUNEL-positive cells in the MCF-7/Adr cell line was lower than that in the MCF-7 cell line (B).
MCF-7 cells. However, this study provided few linkages between the miRNAs and the resistance of breast cancer to doxorubicin. To clarify the expression pattern of these miRNAs in clinical tumors, we first selected 14 significantly dysregulated miRNAs (over 5-fold change) from Chen’s results and detected their expression levels in our resistant MCF-7/Adr cells by qRT-PCR. As illustrated in Fig. 4, compared to the parental MCF-7 cell line, 6 miRNAs (miR-200a, miR-141, miR-200c, miR-31, miR-429, and miR-196b) were up-regulated, and 7 miRNAs (let-7e, miR-576-3p, miR-125b-1,
miR-370, miR-145, miR-765, and miR-760) were down-regulated in MCF-7/Adr cells. Except for miR-491-3p, the RT-PCR data were consistent with the microarray profiles. 3.4. Target gene predictions and Gene Ontology and pathway mapping analysis The above miRNAs were subjected to further target gene prediction and functional analyses. The identification of target
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
5
Fig. 3. Intracellular doxorubicin accumulations in MCF-7 and MCF-7/Adr cells. We assessed the intracellular accumulation of doxorubicin in cells by measuring the OD values at 570 nm. The results demonstrated that intracellular doxorubicin was increased in MCF-7/Adr cells compared to MCF-7 cells by fluorescence microscopy.
genes has been accelerated by the development of several computational algorithms. These databases can be accessed to compile potential targets for all miRNA genes. In our study, we found 490 potential targets of the miRNAs (Supplemental material, S1). S1 presents the categorization of miRNA target genes according to the bioinformatics analysis provided by microRNA.org, Targetscan, and PicTar. Next, we performed GO and KEGG analyses to identify the biological pathways of these target genes. The GO analysis indicated that these gene products are primarily found in the cytoplasm, nucleus, and membranes (Fig. 5A). The genes were enriched in the biological processes of regulation of transcription, signal transduction, and development (Fig. 5B). The molecular functions of these genes included protein binding, zinc
ion binding, DNA binding, and transcription factor activity (Fig. 5C). A total of 119 pathways were identified, and 20 categories are shown, including the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, Wnt signaling pathway, focal adhesion, calcium signaling pathway, and ubiquitin-mediated proteolysis (Fig. 6). 3.5. miRNA expression in tumor tissues To further explore the association between the miRNA expression pattern and chemoresistance in patients with breast cancer, the expression levels of the 13 identified miRNAs were evaluated by qRT-PCR in 39 clinical samples, including 29 chemosensitive samples and 10 chemoresistant samples. Fig. 7 shows that the miR-141, miR-31, and miR-200c miRNAs were upregulated in the chemoresistant group compared to the chemosensitive group. Additionally, the let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760 miRNAs were downregulated in the chemoresistant group. Notably, these data indicated that this dysregulated miRNA expression pattern might be associated with the poor prognosis of patients with breast cancer to respond to neoadjuvant chemotherapy. 4. Discussion
Fig. 4. We quantified the miRNA expression patterns in MCF-7 and MCF-7/Adr cells by real-time RT-PCR. Compared to control MCF-7 cells, 6 miRNAs (miR-200a, miR141, miR-200c, miR-31, miR-429, and miR-196b) were up-regulated, and 7 miRNAs (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760) were down-regulated in MCF-7/Adr cells.
Recently, drug resistance has become an important problem in the successful treatment of patients with breast cancer. The molecular mechanisms of breast cancer cell resistance to chemotherapeutic agents have been linked to miRNA dysregulation. In this study, the doxorubicin-resistant cell line MCF-7/Adr was obtained upon long-term selection of the MCF-7 human breast cancer cell line, which is widely used as an in vitro model of breast cancer drug resistance. MTT and TUNEL assays confirmed that the resistance index of MCF-7/Adr cells to doxorubicin was increased compared to the parental line. In addition, the intracellular
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 6
J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Fig. 5. GO analysis of the predicted targets of fourteen miRNAs. The results showed that the genes were enriched in the biological processes of regulation of transcription, signal transduction, and development (A); these gene products were primarily located in the cytoplasm, nucleus, and membranes (B). The molecular functions of these genes included protein binding, zinc ion binding, DNA binding, and transcription factor activity (C).
doxorubicin accumulation data showed that the accumulation of doxorubicin in MCF-7/Adr cells was less than that in MCF-7 cells, which indicated that MCF-7/Adr cells could prevent the cytotoxicity of doxorubicin by pumping more doxorubicin out of the cells. These data are consistent with the MTT and TUNEL results and imply that the selected MCF-7/Adr cell line is resistant to doxorubicin.
Chen et al. performed an miRNA microarray to detect the differentially expressed miRNAs between the parental MCF-7 cell line and the doxorubicin-resistant MCF-7/Adr cell line. In their study, the authors demonstrated that 16 miRNAs were downregulated and 165 miRNAs were up-regulated in MCF-7/Adr cells compared to MCF-7 cells [8]. However, this study provided few
Fig. 6. A KEGG analysis of the predicted targets of fourteen miRNAs. Twenty categories are represented in the figure and include the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, Wnt signaling pathway, focal adhesion, calcium signaling pathway, and ubiquitin-mediated proteolysis.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Fig. 7. miRNA expression in tumor tissues. The miRNA expression pattern was evaluated by real-time RT-PCR in tumors from thirty-nine patients with breast cancer, including 10 chemoresistant and 29 chemo-sensitive samples. Compared to the chemo-sensitive tumors, 3 miRNAs (miR-141, miR-31, and miR-200c) and 7 miRNAs (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR760) were dysregulated in the chemoresistant samples.
linkages between miRNAs and the resistance of breast cancer to doxorubicin. To clarify the expression patterns of these miRNAs in clinical tumors, we first selected 14 significantly dysregulated miRNAs (over 5-fold change) from Chen’s results and detected their expression levels in our resistant MCF-7/Adr cells by qRTPCR. We assembled a set of 14 important miRNAs and examined whether the expression profile in our MCF-7/Adr and MCF-7 cells correlated with the results of the previous study. Except for miR491-3p, the expression levels of the set of 14 miRNAs were approximately in agreement with the results of Chen et al. Our data indicate the importance of miRNA dysregulation in the acquisition of cancer cell resistance to chemotherapeutic drugs, which was further supported by the pronounced alteration in the expression of miRNAs in the MCF-7/Adr resistant cells compared with the parental MCF-7 cells. After validating the 14 selected miRNAs, we predicted the candidate miRNA targets using several different strategies. A GO term analysis showed that the targeted genes of the differentially expressed miRNAs were mainly located in the nucleus, cytosol and membrane components; the genes were enriched in the biological processes of regulation of transcription, signal transduction, and development. The molecular functions of these genes included protein binding, zinc ion binding, DNA binding, and transcription factor activity. The pathway analysis results indicated that these genes were tightly related to the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, Wnt signaling pathway, focal adhesion, calcium signaling pathway, and ubiquitin-mediated proteolysis. MAPK, Wnt, and calcium signaling have been demonstrated to be linked to breast cancer chemoresistance, and this result indicated that these miRNAs might be involved in the breast cancer chemoresistance process. A previous study found that increased drug efflux due to the high expression of P-gp is the primary mechanism involved in doxorubicin chemoresistance [19], and we found that the expression of miRNAs that target P-gp mRNA was down-regulated in resistant cells and tissues. Interestingly, the intracellular doxorubicin accumulation results were consistent with the hypothesis that dysregulated miRNAs might enhance breast cancer cell chemoresistance via P-gp, and further studies should be performed to explore the underlying mechanism.
7
miRNA expression analyses is an effective tool for predicting the therapeutic response to chemotherapy treatment, especially in association with well-established gene expression array-based profiling technology [20]. To evaluate the clinical value of these 13 miRNAs, we analyzed their expression levels in 39 tumor samples and found that miR-141, miR-31, and miR-200c were significantly up-regulated in chemoresistant tissues; in addition, the expression of let-7e, miR-125b-1, miR-370, miR-765, and miR760 was down-regulated in chemoresistant tissues. Among these miRNAs, miR-200c and miR-125b-1 have been identified to be closely linked to breast cancer chemoresistance, while no reports have demonstrated the mechanisms of how the other miRNAs regulate breast cancer sensitivity to chemotherapy. miR-141, which is found in the miR-200 cluster, is up-regulated in nasopharyngeal and ovarian carcinomas in comparison with normal tissues and correlates with poor prognosis [21]. Another study found aberrant miR-141 DNA methylation in invasive breast cancer cells [22]. These studies confirm that miR-141 might be correlated with poor prognosis in breast cancer patients. In 2013, Van et al. further reported that miR-141 could modulate cisplatin sensitivity in ovarian cancer cells by regulating KEAP1 [23]. In our study, we found that miR-141 was over-expressed in chemoresistant breast cancer tissues. We hypothesize that miR-141 might be involved in the breast cancer chemoresistance process and correlate with the poor prognosis of patients with breast cancer. miR-31 has been defined as tumor suppressor during tumorigenesis and cancer development. Bhatnagar et al. demonstrated that inhibited expression of miR-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells [24]. Another study demonstrated that the down-regulation of miR-31 induced taxane resistance in ovarian cancer cells by increasing the receptor tyrosine kinase MET [25]. Several recent studies have confirmed that the aberrant expression of miR-31, including both over-expression and down-regulation, could lead to chemotherapy resistance [26]. In our study, we found that miR-31 is over-expressed in chemoresistant breast cancer tissues, and more studies are required to uncover the relationship between miR-31 over-expression and breast cancer chemoresistance. Let-7e is an important member of the let-7 family. let-7 was the second microRNA to be identified and is widely viewed as a tumor suppressor miRNA [27]. For some cancers, most or all let-7 family members are inhibited, and the loss of let-7 family members is associated with a poor prognosis [28]. Although the study by Mitra et al. (2011) confirmed that the JARID1B protein can stimulate the breast cancer cell cycle through the inhibition of let-7e expression [29], little information about let-7e and cancer chemotherapy resistance is known. Our study demonstrated that let-7e may not only affect cancer development but may also regulate breast cancer sensitivity to chemotherapy. miR-760 is a recently identified miRNA that is thought to play a role in cancer progression. Although there are few reports that have explored the function of miR-760 in cancer, plasma miR-760 has recently been shown to be a biomarker for the early detection of colorectal cancer [30]. In addition, Kim et al. (2013) found that miR-760 could induce colorectal cancer cell senescence through targeting the a subunit of protein kinase CKII in cooperation with miR-186, miR-216b, and miR-337-3p [31]. In this study, we found the down-regulation of miR-760 in chemoresistant breast cancer tissues, and we discovered that P-gp is one of the targets of miR760. We hypothesize that miR-760 could be a new biomarker for the detection of breast cancer; future research may provide information regarding the possibility that miR-760 mediates breast cancer chemoresistance via the regulation of P-gp expression. In this study, we explored several new miRNAs that might be biomarkers for the prognosis of breast cancer chemoresistance.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
8
Additional efforts are needed to identify how these miRNAs regulate breast cancer sensitivity to chemotherapies. In conclusion, our study provides a comprehensive understanding of prognostic biomarkers during clinical treatment, and we hypothesize that the miRNA signatures of drug-resistant carcinoma tissues could be used to develop new strategies for targeted therapies in patients with chemoresistant breast cancer. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgments This study was financially supported by the National Natural Science Foundation of China (81302306 and 81302304).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biopha.2014.09.011. References [1] DeSantis C, Ma J, Bryan L, Jemal A. Breast cancer statistics, 2013. CA Cancer J Clin 2014;64:52–62. [2] Chuthapisith S, Eremin J, El-Sheemey M, Eremin O. Breast cancer chemoresistance: emerging importance of cancer stem cells. Surg Oncol 2010;19:27–32. [3] Szakacs G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM. Targeting multidrug resistance in cancer. Nat Rev Drug Discov 2006;5:219–34. [4] Chen JQ, Contreras RG, Wang R, Fernandez SV, Shoshani L, Russo IH, et al. Sodium/potassium atpase (na+, k+-atpase) and ouabain/related cardiac glycosides: a new paradigm for development of anti- breast cancer drugs? Breast Cancer Res Treat 2006;96:1–15. [5] Fojo T. Multiple paths to a drug resistance phenotype: mutations, translocations, deletions and amplification of coding genes or promoter regions, epigenetic changes and micrornas. Drug Resist Updat 2007;10:59–67. [6] Ng EK, Wong CL, Ma ES, Kwong A. Micrornas as new players for diagnosis, prognosis, and therapeutic targets in breast cancer. J Oncol 2009;2009: 305420. [7] Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microrna genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004;101:2999–3004. [8] Chen GQ, Zhao ZW, Zhou HY, Liu YJ, Yang HJ. Systematic analysis of microrna involved in resistance of the mcf-7 human breast cancer cell to doxorubicin. Med Oncol 2010;27:406–15. [9] Krol J, Loedige I, Filipowicz W. The widespread regulation of microrna biogenesis, function and decay. Nat Rev Genet 2010;11:597–610. [10] Liang Z, Wu H, Xia J, Li Y, Zhang Y, Huang K, et al. Involvement of mir-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol 2010;79:817–24.
[11] Koch M, Krieger ML, Stolting D, Brenner N, Beier M, Jaehde U, et al. Overcoming chemotherapy resistance of ovarian cancer cells by liposomal cisplatin: molecular mechanisms unveiled by gene expression profiling. Biochem Pharmacol 2013;85:1077–90. [12] Kastl L, Brown I, Schofield AC. Mirna-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat 2012;131:445–54. [13] Pogribny IP, Filkowski JN, Tryndyak VP, Golubov A, Shpyleva SI, Kovalchuk O. Alterations of micrornas and their targets are associated with acquired resistance of mcf-7 breast cancer cells to cisplatin. Int J Cancer 2010;127:1785–94. [14] Chen J, Tian W, Cai H, He H, Deng Y. Down-regulation of microrna-200c is associated with drug resistance in human breast cancer. Med Oncol 2012;29:2527–34. [15] Ying W, Wang S, Shi J, Sun Y. Er-/er+ breast cancer cell lines exhibited different resistance to paclitaxel through pulse selection. Med Oncol 2012;29:495–502. [16] Galea MH, Blamey RW, Elston CE, Ellis IO. The nottingham prognostic index in primary breast cancer. Breast Cancer Res Treat 1992;22:207–19. [17] Jiang X, Xue M, Fu Z, Ji C, Guo X, Zhu L, et al. Insight into the Effects of Adipose Tissue Inflammation Factors on miR-378 Expression and the Underlying Mechanism. Cell Physiol Biochem 2014;33(6):1778–88. [18] Qian B, Katsaros D, Lu L, Preti M, Durando A, Arisio R, et al. High miR-21 expression in breast cancer associated with poor disease-free survival in early stage disease and high TGF-beta1. Breast Cancer Res Treat 2009;117(1): 131–40. [19] Bao L, Haque A, Jackson K, Hazari S, Moroz K, Jetly R, et al. Increased expression of p-glycoprotein is associated with doxorubicin chemoresistance in the metastatic 4t1 breast cancer model. Am J Pathol 2011;178:838–52. [20] Potti A, Dressman HK, Bild A, Riedel RF, Chan G, Sayer R, et al. Retraction: genomic signatures to guide the use of chemotherapeutics. Nat Med 2011;17:135. [21] Hu M, Xia M, Chen X, Lin Z, Xu Y, Ma Y, et al. Microrna-141 regulates smad interacting protein 1 (sip1) and inhibits migration and invasion of colorectal cancer cells. Dig Dis Sci 2010;55:2365–72. [22] Neves R, Scheel C, Weinhold S, Honisch E, Iwaniuk KM, Trompeter HI, et al. Role of DNA methylation in mir-200c/141 cluster silencing in invasive breast cancer cells. BMC Res Notes 2010;3:219. [23] van Jaarsveld MT, Helleman J, Boersma AW, van Kuijk PF, van Ijcken WF, Despierre E, et al. Mir-141 regulates keap1 and modulates cisplatin sensitivity in ovarian cancer cells. Oncogene 2013;32:4284–93. [24] Bhatnagar N, Li X, Padi SK, Zhang Q, Tang MS, Guo B. Downregulation of mir205 and mir-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells. Cell Death Dis 2010;1:e105. [25] Mitamura T, Watari H, Wang L, Kanno H, Hassan MK, Miyazaki M, et al. Downregulation of mirna-31 induces taxane resistance in ovarian cancer cells through increase of receptor tyrosine kinase met. Oncogenesis 2013;2:e40. [26] Laurila EM, Kallioniemi A. The diverse role of mir-31 in regulating cancer associated phenotypes. Genes Chromosomes Cancer 2013;52:1103–13. [27] Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, et al. The 21-nucleotide let-7 rna regulates developmental timing in caenorhabditis elegans. Nature 2000;403:901–6. [28] Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME. The role of let-7 in cell differentiation and cancer. Endocr Relat Cancer 2010;17:F19–36. [29] Mitra D, Das PM, Huynh FC, Jones FE. Jumonji/arid1 b (jarid1b) protein promotes breast tumor cell cycle progression through epigenetic repression of microrna let-7e. J Biol Chem 2011;286:40531–5. [30] Wang Q, Huang Z, Ni S, Xiao X, Xu Q, Wang L, et al. Plasma mir-601 and mir760 are novel biomarkers for the early detection of colorectal cancer. PLoS ONE 2012;7:e44398. [31] Kim SY, Lee YH, Bae YS. Mir-186, mir-216b, mir-337-3p, and mir-760 cooperatively induce cellular senescence by targeting alpha subunit of protein kinase ckii in human colorectal cancer cells. Biochem Biophys Res Commun 2012;429:173–9.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
BIOPHA-3454; No. of Pages 8 Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Available online at
ScienceDirect www.sciencedirect.com
Original article
miRNA expression patterns in chemoresistant breast cancer tissues Jianxin Lv b,1, Kai Xia c,1, Pengfei Xu a, Erhu Sun a, Jingjing Ma a, Sheng Gao a, Qian Zhou a, Min Zhang a, Fengliang Wang a, Fei Chen a, Ping Zhou a, Ziyi Fu a,*, Hui Xie a,* a
Nanjing Maternity and Child Health Medical Institute, Affiliated Nanjing Maternal and Child Health Hospital, Nanjing Medical University, 210004 Nanjing, China b Yangzhou Maternal and Child Health Hospital, Affiliated with Yangzhou Medical University, 225002 Yangzhou, China c The Affiliated Jiangyin Hospital of Southeast University Medical College, 214400 Jiangyin, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 August 2014 Accepted 21 September 2014
Background/aims: Breast cancer chemoresistance is a major obstacle to the successful treatment of patients. miRNAs perform critical roles in biological processes, including tumorigenesis and chemoresistance. However, little clinical data are available regarding the relationship between miRNA expression patterns and breast cancer chemoresistance. Methods: We created a doxorubicin-resistant MCF-7 (MCF-/Adr) cell line using a pulse-selection method; then verified the resistance of the MCF-7/Adr cell line to doxorubicin by using the methyl thiazolyl tetrazolium (MTT) assay, terminal deoxyribonucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) staining, and Intracellular doxorubicin accumulation assay. Then, we performed qRTPCR to detect the expression patterns of 14 selected miRNAs (which are related to breast cancer resistance) in both cell lines. Subsequently, we performed a bioinformatics analysis, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses, to determine the putative functions of 13 differentially expressed miRNA-targeted genes. Finally, we tested the expression levels of these 13 miRNAs in 10 chemotherapy non-responder breast cancer tissues and 29 responder tissues. All statistical analyses were performed by a two-tailed Student’s t-test, and a P value less than 0.05 was considered statistically significant. Results: The results of the MTT assay showed that the MCF-7/Adr cell line was significantly more resistant to doxorubicin compared to the MCF-7 cells The results of the TUNEL assay indicated that doxorubicin induced an increase in the number apoptotic cells in the MCF-7 group. Additionally, the accumulation of doxorubicin was higher in MCF-7 cells compared to MCF-7/Adr cells, which was consistent with the MTT and TUNEL results. The qRT-PCR results demonstrated that compared to the parental MCF-7 cell line, miR-200a, miR141, miR-200c, miR-31, miR-429, and miR-196b were over-expressed, and let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760 were significantly down-regulated in MCF-7/Adr cells. The GO analysis results revealed that the predicted target genes of these 14 miRNAs primarily regulated protein binding, zinc ion binding, DNA binding, and transcription factor activity. The KEGG data demonstrated that these target genes are mainly involved in the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, and other signaling pathways. Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). Conclusion: In this study, we identified 10 dysregulated miRNAs in both breast cancer cells and chemoresistant tissues, which might be biomarkers for the prognosis of breast cancer chemoresistance. Our study contributes to a comprehensive understanding of prognostic biomarkers during clinical treatment, and we hypothesize that the miRNA signatures of drug-resistant carcinoma tissues could be useful for developing new strategies for targeted therapies in patients with chemoresistant breast cancer. ß 2014 Published by Elsevier Masson SAS.
Keywords: miRNA Breast cancer Chemoresistance
* Corresponding authors. Nanjing Maternal and Child Health Medical Institute, Affiliated Nanjing Maternal and Child Health Hospital, Nanjing Medical University, 123 Mochou road, 210004 Nanjing, China. Tel.: +86 25 52226159; fax: +86 25 84460507. E-mail address: [email protected] (Z. Fu). 1 Jianxin Lv and Kai Xia contributed equally to this work. http://dx.doi.org/10.1016/j.biopha.2014.09.011 0753-3322/ß 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 2
J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
1. Introduction Breast cancer is the most common malignancy in women, with 234,580 estimated new cases and 40,030 estimated deaths in the United States in 2013 [1]. Although early detection methods and treatment options have greatly improved due to a better understanding of the underlying molecular mechanisms, approximately 50% of patients with breast cancer will either fail to respond to initial chemotherapy or will rapidly acquire resistance to chemotherapeutic agents [2,3]. Drug resistance remains a major clinical obstacle to the successful treatment of patients with breast cancer, and a better understanding of the drug resistance mechanisms is needed to improve the current chemotherapy regimens [4]. The molecular mechanisms of breast cancer cell resistance to chemotherapeutic agents are very complex and involve multiple processes, including gene mutation, gene amplification, epigenetic changes, and microRNA expression [5]. MicroRNAs (miRNAs) are 19–25 nucleotide-long regulatory non-coding RNA molecules that regulate the expression of a wide variety of genes by sequence-specific base pairing to the 3’untranslated region (3’-UTR) of the target mRNAs, resulting in the degradation of target mRNAs or the inhibition of translation [6]. Greater than 50% of miRNA genes are located in cancerassociated genomic regions or in fragile sites, indicating that miRNAs may play important roles in tumorigenesis [7]. miRNAs are phylogenetically conserved and have a variety of functions in biological processes, including the regulation of cellular proliferation, differentiation and cell death [7–9]. miRNAs are also closely associated with drug resistance, and previous studies have shown that miRNAs can modulate the sensitivity of breast cancer cells to chemotherapeutic drugs and therefore contribute to the acquisition of chemoresistance [10–14]. Although miRNAs are becoming increasingly recognized as regulatory molecules in breast cancer cell lines, limited data have been reported regarding the relationship between miRNA expression signatures and breast cancer chemoresistance. A recent study suggested that 181 human miRNAs were differentially expressed between a chemoresistant cell line MCF-7/ Adr and the parental cell line MCF-7. Compared to MCF-7 cells, 16 miRNAs were down-regulated, and 165 miRNAs were upregulated in MCF-7/Adr cells [8]. However, this study included little information about the relationship between miRNA expression and breast cancer chemoresistance. Therefore, in our study, we aimed to identify differentially expressed miRNAs in chemoresistant breast cancer tissues. Our study contributes to a comprehensive understanding of prognostic biomarkers during clinical treatment, and we hypothesize that the miRNA signatures of drug-resistant carcinoma tissues could be used to develop new strategies for targeted therapies in patients with chemoresistant breast cancer.
2. Material and methods 2.1. Cell culture Human breast cancer MCF-7 cells were obtained from ATCC. Cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% (v/v) fetal bovine serum (Gibco), 100 U/mL streptomycin (Gibco), and 100 U/mL penicillin (Gibco) at 37 8C in a humidified atmosphere containing 5% carbon dioxide. MCF-7 cells were pulseselected with doxorubicin (10 pulses once a week for 4 h with 1 mM ADR) for six months to generate MCF-7/Adr cells [15]. The pulse concentrations were chosen based on changes in cell morphology and the clinical doxorubicin plasma concentration. MCF-7/Adr cells were cultured in the continuous presence of
doxorubicin (1 mg/mL) to maintain the drug resistance phenotype and in drug-free medium for more than 2 weeks before subsequent experiments. 2.2. Patients and samples Patients were identified through electronic records obtained from Nanjing Maternity and Child Health Hospital, and tissue samples were collected between 2008 and 2009. Clinical and ultrasound measurements were recorded before treatment, every two cycles during neoadjuvant chemotherapy (NAC), and at the end of NAC before surgery. The clinical response was evaluated by the decrease in tumor size and classified according to the RECIST criteria [16] as follows: complete response (CR), partial response (PR) as greater than 30% tumor shrinkage, stable disease (SD) as a decrease of less than 30% or an increase of less than 20%, and progressive disease (PD) as an increase of at least 20% or the appearance of new lesions. For further analysis, patients with CR or PR were regarded as clinical responders, while patients with SD or PD were regarded as non-responders. We collected 10 nonresponder breast cancer tissues as the chemoresistant group and 29 responders as the chemo-sensitive control. Fresh tumor samples were immediately frozen in liquid nitrogen and preserved at 80 8C. The women provided written informed consent to participate in the study. 2.3. Methyl thiazolyl tetrazolium (MTT) assay MCF-7/Adr and MCF-7 cells were seeded in 96-well plates at a density of 1 104 cells per well and incubated overnight. After incubation with different doses of doxorubicin (0, 1, 10, 100, 1000 nM) for 24 h, 48 h and 96 h at 37 8C, 20 mL of 3-(4, 5dimethylthiazol-2-yl)-2, 5-diphenyltetrazoliumbromide (MTT, Sigma Aldrich) solution (5 mg/mL in phosphate buffered saline) was added to each well, and the incubation was continued for an additional 4 h at 37 8C. Then, the medium was rapidly removed, and the MTT crystals were solubilized in 150 mL DMSO. The resulting absorbance was read in a plate reader at 490 nm. The absorbance readings were subtracted from the value of the blank wells; the reduction in cell growth was calculated as a percentage of the control absorbance in the absence of any drug. The data represent the mean SD of at least three independent experiments. 2.4. Terminal deoxyribonucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) staining TUNEL is an established technique for detecting apoptotic chondrocytes by labeling the fragmented DNA with deoxyribonucleotide triphosphate (dNTP). TUNEL was performed on randomly selected sections from each strain using a TACS1 2 TdT-DAB in situ detection kit (R&D Systems, Abingdon, UK). For the negative control, sections were incubated with the labeling buffer alone, and for the positive control, sections (Tissue Control Slide, R&D Systems, Abingdon, UK) were treated according to the manufacturer. 2.5. Intracellular doxorubicin accumulation assay The doxorubicin accumulation assay was performed to detect the sensitivity of cells to doxorubicin. MCF-7/Adr and MCF-7 cells were harvested and washed twice with ice-cold PBS. The intracellular mean fluorescence intensity associated with doxorubicin was determined using a microplate reader. Cells were then lysed in RIPA cell lysis buffer and collected for the detection of the OD at 570 nm. Intracellular doxorubicin accumulation was defined as the mean OD of the samples.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
3
2.6. Real-time RT-PCR quantification of miRNAs The total RNA of tumor tissue samples was isolated using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. The purified total RNA (1 mg) was then reverse transcribed using the PrimeScript RT reagent kit (Takara, Japan), and qPCR was performed on an ABI 7900 PCR System (Applied Biosystems, USA) using Power SYBR Green PCR Master Mix (2X, Applied Biosystems). The primers for amplification are listed in Table 1. Each reaction was performed in triplicate, and U6 snRNA was used as a normalization control [17,18]. The relative expression levels were determined using the comparative threshold cycle DD 2 Ct analysis method. Changes in miRNA expression were calculated as the fold change relative to the control. 2.7. miRNA target prediction and functional annotations The potential targets of miRNAs were predicted using the Target-Scan, PicTar, and microRNA.org programs with the default parameters. In our study, we subjected 6 up-regulated miRNAs and 7 down-regulated miRNAs in the MCF-7/Adr cell line to target prediction. Intersecting elements identified in each miRNA target prediction program were manually selected as miRNA targets. To investigate the possible biological processes regulated by the miRNAs, the MAS3 program (http://www.bioinfo.capitalbio.com/ mas3/) was used to determine the putative functions of the potential miRNA target genes by annotation using the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses.
Fig. 1. The resistance index of MCF-7 and MCF-7/Adr cells to doxorubicin. Cells were treated with different concentrations of doxorubicin (0, 1, 10, 100, 500, and 1000 mM) for 24 h, 48 h and 96 h before MTT treatment. The resulting changes in absorbance were read at 490 nm in a plate reader and expressed as a percentage of the control absorbance in the absence of any drug. The results showed that the IC50 of MCF-7/Adr cells has been elevated.
concentration (IC50) of MCF-7 cells was 9.007 mM doxorubicin. However, the IC50 of MCF-7/Adr cells was 800.853 mM doxorubicin. Compared to the IC50 of MCF-7 cells, the IC50 of MCF-7/Adr cells was elevated 88.91-fold (Fig. 1), which indicated that MCF-7/ Adr cells are resistant to doxorubicin. This result was further supported by a TUNEL assay demonstrating that the number of apoptotic cells was lower in MCF-7/Adr cells compared to MCF-7 cells (Fig. 2). 3.2. Intracellular doxorubicin accumulation in MCF-7/Adr cells
2.8. Statistical analysis All statistical analyses were evaluated by a two-tailed Student’s t-test. The data are presented as the mean standard deviation. A P value less than 0.05 was considered statistically significant. SPSS version 20 (SPSS Inc., Chicago, IL, USA) was used for the calculations. 3. Results
To confirm the sensitivity of the cells to doxorubicin, we characterized the intracellular accumulation of doxorubicin in MCF-7 and MCF-7/Adr cells by fluorescence microscopy. The data demonstrated that intracellular doxorubicin was decreased in MCF-7/Adr cells compared to MCF-7 cells (Fig. 3), indicating that MCF-7/Adr cells pumped more doxorubicin out of the cells and that the cells were resistant to doxorubicin compared to the parental MCF-7 cell line.
3.1. Cell viability and apoptosis of MCF-7 and MCF-7/Adr cells after doxorubicin treatment
3.3. miRNA expression patterns in MCF-7 and MCF-7/Adr cells
To determine whether MCF-7/Adr cells are resistant to the chemotherapeutic agent doxorubicin, cell viability was measured using the MTT assay. MCF-7 and MCF-7/Adr cells were treated with different concentrations of doxorubicin (0, 1, 10, 100, 500, 1000 mM). The results showed that the semi-effective inhibitory
Chen et al. performed an miRNA microarray to detect differentially expressed miRNAs between the parental MCF-7 cell line and the doxorubicin-resistant MCF-7/Adr cell line [8]. These authors demonstrated that 16 miRNAs were down-regulated and 165 miRNAs were up-regulated in MCF-7/Adr cells compared to
Table 1 Primers for amplification. microRNA miR-200a miR-141 miR-200c miR-31 miR-429 miR-491-3p miR-196b let-7e miR-576-3p miR-125b-1 miR-370 miR-145 miR-765 miR-760 U6
Forward primer 0
Reverse primer 0
5 - AGCCGC ATCTTACCGGAC AGT-3 50 - AGCCGC ATCTTACCGOAC AGT-30 50 -AGCCGCGTCTTACCC AGCAGT-30 50 - AGCCG AGGC A AG ATGCTGGC -30 50 - AGCCGTAATACTGTCTGGTA A-30 50 -AGCCGCrrATGCAAGAlTCCC-30 50 -AGCCGTAGGTAGTTTCCTGTT-30 50 - AGCCGTGAGGTAGGAGGTTGT-30 S0 -AGCCGAAGATGTGGAAAA/VTT-S0 50 - AGCCGACGGGT TAGGCCTCTTG- 30 50 AGCCGGCCTGCTGGGGTGGAA-30 50 AGCC GGTCCAGTTTTCCC AGGA-30 50 - AGCCGTGGAGGAGAAGGAAG-30 50 -AGCCGCGGCTCTGGOTCTG-30 50 -CTCGCTTCGGCAGCACA-30
50 -GTGCAGGGTCCG AGGT-30 50 - GTGCAGGGTCCGAGGT-30 50 - GTGCAGGGTCCG AGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 - GTGCAGGGTCCGAGGT-30 50 - GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGC AGGGTCCG AGGT-30 50 -GTGCAGGGTCCG AGGT-30 50 -GTGC AGGGTCCG AGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -GTGCAGGGTCCGAGGT-30 50 -A.ACGCTTC AC G A ATTTGCGT- 30
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 4
J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Fig. 2. We measured apoptosis in MCF-7 and MCF-7/Adr cells by the TUNEL assay. Cells were treated with different concentrations of doxorubicin (250 or 500 nM), and we found that the number of apoptotic MCF-7/Adr cells reduced compared to MCF-7 cells (A). The frequency of TUNEL-positive cells in the MCF-7/Adr cell line was lower than that in the MCF-7 cell line (B).
MCF-7 cells. However, this study provided few linkages between the miRNAs and the resistance of breast cancer to doxorubicin. To clarify the expression pattern of these miRNAs in clinical tumors, we first selected 14 significantly dysregulated miRNAs (over 5-fold change) from Chen’s results and detected their expression levels in our resistant MCF-7/Adr cells by qRT-PCR. As illustrated in Fig. 4, compared to the parental MCF-7 cell line, 6 miRNAs (miR-200a, miR-141, miR-200c, miR-31, miR-429, and miR-196b) were up-regulated, and 7 miRNAs (let-7e, miR-576-3p, miR-125b-1,
miR-370, miR-145, miR-765, and miR-760) were down-regulated in MCF-7/Adr cells. Except for miR-491-3p, the RT-PCR data were consistent with the microarray profiles. 3.4. Target gene predictions and Gene Ontology and pathway mapping analysis The above miRNAs were subjected to further target gene prediction and functional analyses. The identification of target
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
5
Fig. 3. Intracellular doxorubicin accumulations in MCF-7 and MCF-7/Adr cells. We assessed the intracellular accumulation of doxorubicin in cells by measuring the OD values at 570 nm. The results demonstrated that intracellular doxorubicin was increased in MCF-7/Adr cells compared to MCF-7 cells by fluorescence microscopy.
genes has been accelerated by the development of several computational algorithms. These databases can be accessed to compile potential targets for all miRNA genes. In our study, we found 490 potential targets of the miRNAs (Supplemental material, S1). S1 presents the categorization of miRNA target genes according to the bioinformatics analysis provided by microRNA.org, Targetscan, and PicTar. Next, we performed GO and KEGG analyses to identify the biological pathways of these target genes. The GO analysis indicated that these gene products are primarily found in the cytoplasm, nucleus, and membranes (Fig. 5A). The genes were enriched in the biological processes of regulation of transcription, signal transduction, and development (Fig. 5B). The molecular functions of these genes included protein binding, zinc
ion binding, DNA binding, and transcription factor activity (Fig. 5C). A total of 119 pathways were identified, and 20 categories are shown, including the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, Wnt signaling pathway, focal adhesion, calcium signaling pathway, and ubiquitin-mediated proteolysis (Fig. 6). 3.5. miRNA expression in tumor tissues To further explore the association between the miRNA expression pattern and chemoresistance in patients with breast cancer, the expression levels of the 13 identified miRNAs were evaluated by qRT-PCR in 39 clinical samples, including 29 chemosensitive samples and 10 chemoresistant samples. Fig. 7 shows that the miR-141, miR-31, and miR-200c miRNAs were upregulated in the chemoresistant group compared to the chemosensitive group. Additionally, the let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760 miRNAs were downregulated in the chemoresistant group. Notably, these data indicated that this dysregulated miRNA expression pattern might be associated with the poor prognosis of patients with breast cancer to respond to neoadjuvant chemotherapy. 4. Discussion
Fig. 4. We quantified the miRNA expression patterns in MCF-7 and MCF-7/Adr cells by real-time RT-PCR. Compared to control MCF-7 cells, 6 miRNAs (miR-200a, miR141, miR-200c, miR-31, miR-429, and miR-196b) were up-regulated, and 7 miRNAs (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760) were down-regulated in MCF-7/Adr cells.
Recently, drug resistance has become an important problem in the successful treatment of patients with breast cancer. The molecular mechanisms of breast cancer cell resistance to chemotherapeutic agents have been linked to miRNA dysregulation. In this study, the doxorubicin-resistant cell line MCF-7/Adr was obtained upon long-term selection of the MCF-7 human breast cancer cell line, which is widely used as an in vitro model of breast cancer drug resistance. MTT and TUNEL assays confirmed that the resistance index of MCF-7/Adr cells to doxorubicin was increased compared to the parental line. In addition, the intracellular
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 6
J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Fig. 5. GO analysis of the predicted targets of fourteen miRNAs. The results showed that the genes were enriched in the biological processes of regulation of transcription, signal transduction, and development (A); these gene products were primarily located in the cytoplasm, nucleus, and membranes (B). The molecular functions of these genes included protein binding, zinc ion binding, DNA binding, and transcription factor activity (C).
doxorubicin accumulation data showed that the accumulation of doxorubicin in MCF-7/Adr cells was less than that in MCF-7 cells, which indicated that MCF-7/Adr cells could prevent the cytotoxicity of doxorubicin by pumping more doxorubicin out of the cells. These data are consistent with the MTT and TUNEL results and imply that the selected MCF-7/Adr cell line is resistant to doxorubicin.
Chen et al. performed an miRNA microarray to detect the differentially expressed miRNAs between the parental MCF-7 cell line and the doxorubicin-resistant MCF-7/Adr cell line. In their study, the authors demonstrated that 16 miRNAs were downregulated and 165 miRNAs were up-regulated in MCF-7/Adr cells compared to MCF-7 cells [8]. However, this study provided few
Fig. 6. A KEGG analysis of the predicted targets of fourteen miRNAs. Twenty categories are represented in the figure and include the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, Wnt signaling pathway, focal adhesion, calcium signaling pathway, and ubiquitin-mediated proteolysis.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
Fig. 7. miRNA expression in tumor tissues. The miRNA expression pattern was evaluated by real-time RT-PCR in tumors from thirty-nine patients with breast cancer, including 10 chemoresistant and 29 chemo-sensitive samples. Compared to the chemo-sensitive tumors, 3 miRNAs (miR-141, miR-31, and miR-200c) and 7 miRNAs (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR760) were dysregulated in the chemoresistant samples.
linkages between miRNAs and the resistance of breast cancer to doxorubicin. To clarify the expression patterns of these miRNAs in clinical tumors, we first selected 14 significantly dysregulated miRNAs (over 5-fold change) from Chen’s results and detected their expression levels in our resistant MCF-7/Adr cells by qRTPCR. We assembled a set of 14 important miRNAs and examined whether the expression profile in our MCF-7/Adr and MCF-7 cells correlated with the results of the previous study. Except for miR491-3p, the expression levels of the set of 14 miRNAs were approximately in agreement with the results of Chen et al. Our data indicate the importance of miRNA dysregulation in the acquisition of cancer cell resistance to chemotherapeutic drugs, which was further supported by the pronounced alteration in the expression of miRNAs in the MCF-7/Adr resistant cells compared with the parental MCF-7 cells. After validating the 14 selected miRNAs, we predicted the candidate miRNA targets using several different strategies. A GO term analysis showed that the targeted genes of the differentially expressed miRNAs were mainly located in the nucleus, cytosol and membrane components; the genes were enriched in the biological processes of regulation of transcription, signal transduction, and development. The molecular functions of these genes included protein binding, zinc ion binding, DNA binding, and transcription factor activity. The pathway analysis results indicated that these genes were tightly related to the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, Wnt signaling pathway, focal adhesion, calcium signaling pathway, and ubiquitin-mediated proteolysis. MAPK, Wnt, and calcium signaling have been demonstrated to be linked to breast cancer chemoresistance, and this result indicated that these miRNAs might be involved in the breast cancer chemoresistance process. A previous study found that increased drug efflux due to the high expression of P-gp is the primary mechanism involved in doxorubicin chemoresistance [19], and we found that the expression of miRNAs that target P-gp mRNA was down-regulated in resistant cells and tissues. Interestingly, the intracellular doxorubicin accumulation results were consistent with the hypothesis that dysregulated miRNAs might enhance breast cancer cell chemoresistance via P-gp, and further studies should be performed to explore the underlying mechanism.
7
miRNA expression analyses is an effective tool for predicting the therapeutic response to chemotherapy treatment, especially in association with well-established gene expression array-based profiling technology [20]. To evaluate the clinical value of these 13 miRNAs, we analyzed their expression levels in 39 tumor samples and found that miR-141, miR-31, and miR-200c were significantly up-regulated in chemoresistant tissues; in addition, the expression of let-7e, miR-125b-1, miR-370, miR-765, and miR760 was down-regulated in chemoresistant tissues. Among these miRNAs, miR-200c and miR-125b-1 have been identified to be closely linked to breast cancer chemoresistance, while no reports have demonstrated the mechanisms of how the other miRNAs regulate breast cancer sensitivity to chemotherapy. miR-141, which is found in the miR-200 cluster, is up-regulated in nasopharyngeal and ovarian carcinomas in comparison with normal tissues and correlates with poor prognosis [21]. Another study found aberrant miR-141 DNA methylation in invasive breast cancer cells [22]. These studies confirm that miR-141 might be correlated with poor prognosis in breast cancer patients. In 2013, Van et al. further reported that miR-141 could modulate cisplatin sensitivity in ovarian cancer cells by regulating KEAP1 [23]. In our study, we found that miR-141 was over-expressed in chemoresistant breast cancer tissues. We hypothesize that miR-141 might be involved in the breast cancer chemoresistance process and correlate with the poor prognosis of patients with breast cancer. miR-31 has been defined as tumor suppressor during tumorigenesis and cancer development. Bhatnagar et al. demonstrated that inhibited expression of miR-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells [24]. Another study demonstrated that the down-regulation of miR-31 induced taxane resistance in ovarian cancer cells by increasing the receptor tyrosine kinase MET [25]. Several recent studies have confirmed that the aberrant expression of miR-31, including both over-expression and down-regulation, could lead to chemotherapy resistance [26]. In our study, we found that miR-31 is over-expressed in chemoresistant breast cancer tissues, and more studies are required to uncover the relationship between miR-31 over-expression and breast cancer chemoresistance. Let-7e is an important member of the let-7 family. let-7 was the second microRNA to be identified and is widely viewed as a tumor suppressor miRNA [27]. For some cancers, most or all let-7 family members are inhibited, and the loss of let-7 family members is associated with a poor prognosis [28]. Although the study by Mitra et al. (2011) confirmed that the JARID1B protein can stimulate the breast cancer cell cycle through the inhibition of let-7e expression [29], little information about let-7e and cancer chemotherapy resistance is known. Our study demonstrated that let-7e may not only affect cancer development but may also regulate breast cancer sensitivity to chemotherapy. miR-760 is a recently identified miRNA that is thought to play a role in cancer progression. Although there are few reports that have explored the function of miR-760 in cancer, plasma miR-760 has recently been shown to be a biomarker for the early detection of colorectal cancer [30]. In addition, Kim et al. (2013) found that miR-760 could induce colorectal cancer cell senescence through targeting the a subunit of protein kinase CKII in cooperation with miR-186, miR-216b, and miR-337-3p [31]. In this study, we found the down-regulation of miR-760 in chemoresistant breast cancer tissues, and we discovered that P-gp is one of the targets of miR760. We hypothesize that miR-760 could be a new biomarker for the detection of breast cancer; future research may provide information regarding the possibility that miR-760 mediates breast cancer chemoresistance via the regulation of P-gp expression. In this study, we explored several new miRNAs that might be biomarkers for the prognosis of breast cancer chemoresistance.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011
G Model
BIOPHA-3454; No. of Pages 8 J. Lv et al. / Biomedicine & Pharmacotherapy xxx (2014) xxx–xxx
8
Additional efforts are needed to identify how these miRNAs regulate breast cancer sensitivity to chemotherapies. In conclusion, our study provides a comprehensive understanding of prognostic biomarkers during clinical treatment, and we hypothesize that the miRNA signatures of drug-resistant carcinoma tissues could be used to develop new strategies for targeted therapies in patients with chemoresistant breast cancer. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgments This study was financially supported by the National Natural Science Foundation of China (81302306 and 81302304).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biopha.2014.09.011. References [1] DeSantis C, Ma J, Bryan L, Jemal A. Breast cancer statistics, 2013. CA Cancer J Clin 2014;64:52–62. [2] Chuthapisith S, Eremin J, El-Sheemey M, Eremin O. Breast cancer chemoresistance: emerging importance of cancer stem cells. Surg Oncol 2010;19:27–32. [3] Szakacs G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM. Targeting multidrug resistance in cancer. Nat Rev Drug Discov 2006;5:219–34. [4] Chen JQ, Contreras RG, Wang R, Fernandez SV, Shoshani L, Russo IH, et al. Sodium/potassium atpase (na+, k+-atpase) and ouabain/related cardiac glycosides: a new paradigm for development of anti- breast cancer drugs? Breast Cancer Res Treat 2006;96:1–15. [5] Fojo T. Multiple paths to a drug resistance phenotype: mutations, translocations, deletions and amplification of coding genes or promoter regions, epigenetic changes and micrornas. Drug Resist Updat 2007;10:59–67. [6] Ng EK, Wong CL, Ma ES, Kwong A. Micrornas as new players for diagnosis, prognosis, and therapeutic targets in breast cancer. J Oncol 2009;2009: 305420. [7] Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microrna genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004;101:2999–3004. [8] Chen GQ, Zhao ZW, Zhou HY, Liu YJ, Yang HJ. Systematic analysis of microrna involved in resistance of the mcf-7 human breast cancer cell to doxorubicin. Med Oncol 2010;27:406–15. [9] Krol J, Loedige I, Filipowicz W. The widespread regulation of microrna biogenesis, function and decay. Nat Rev Genet 2010;11:597–610. [10] Liang Z, Wu H, Xia J, Li Y, Zhang Y, Huang K, et al. Involvement of mir-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol 2010;79:817–24.
[11] Koch M, Krieger ML, Stolting D, Brenner N, Beier M, Jaehde U, et al. Overcoming chemotherapy resistance of ovarian cancer cells by liposomal cisplatin: molecular mechanisms unveiled by gene expression profiling. Biochem Pharmacol 2013;85:1077–90. [12] Kastl L, Brown I, Schofield AC. Mirna-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat 2012;131:445–54. [13] Pogribny IP, Filkowski JN, Tryndyak VP, Golubov A, Shpyleva SI, Kovalchuk O. Alterations of micrornas and their targets are associated with acquired resistance of mcf-7 breast cancer cells to cisplatin. Int J Cancer 2010;127:1785–94. [14] Chen J, Tian W, Cai H, He H, Deng Y. Down-regulation of microrna-200c is associated with drug resistance in human breast cancer. Med Oncol 2012;29:2527–34. [15] Ying W, Wang S, Shi J, Sun Y. Er-/er+ breast cancer cell lines exhibited different resistance to paclitaxel through pulse selection. Med Oncol 2012;29:495–502. [16] Galea MH, Blamey RW, Elston CE, Ellis IO. The nottingham prognostic index in primary breast cancer. Breast Cancer Res Treat 1992;22:207–19. [17] Jiang X, Xue M, Fu Z, Ji C, Guo X, Zhu L, et al. Insight into the Effects of Adipose Tissue Inflammation Factors on miR-378 Expression and the Underlying Mechanism. Cell Physiol Biochem 2014;33(6):1778–88. [18] Qian B, Katsaros D, Lu L, Preti M, Durando A, Arisio R, et al. High miR-21 expression in breast cancer associated with poor disease-free survival in early stage disease and high TGF-beta1. Breast Cancer Res Treat 2009;117(1): 131–40. [19] Bao L, Haque A, Jackson K, Hazari S, Moroz K, Jetly R, et al. Increased expression of p-glycoprotein is associated with doxorubicin chemoresistance in the metastatic 4t1 breast cancer model. Am J Pathol 2011;178:838–52. [20] Potti A, Dressman HK, Bild A, Riedel RF, Chan G, Sayer R, et al. Retraction: genomic signatures to guide the use of chemotherapeutics. Nat Med 2011;17:135. [21] Hu M, Xia M, Chen X, Lin Z, Xu Y, Ma Y, et al. Microrna-141 regulates smad interacting protein 1 (sip1) and inhibits migration and invasion of colorectal cancer cells. Dig Dis Sci 2010;55:2365–72. [22] Neves R, Scheel C, Weinhold S, Honisch E, Iwaniuk KM, Trompeter HI, et al. Role of DNA methylation in mir-200c/141 cluster silencing in invasive breast cancer cells. BMC Res Notes 2010;3:219. [23] van Jaarsveld MT, Helleman J, Boersma AW, van Kuijk PF, van Ijcken WF, Despierre E, et al. Mir-141 regulates keap1 and modulates cisplatin sensitivity in ovarian cancer cells. Oncogene 2013;32:4284–93. [24] Bhatnagar N, Li X, Padi SK, Zhang Q, Tang MS, Guo B. Downregulation of mir205 and mir-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells. Cell Death Dis 2010;1:e105. [25] Mitamura T, Watari H, Wang L, Kanno H, Hassan MK, Miyazaki M, et al. Downregulation of mirna-31 induces taxane resistance in ovarian cancer cells through increase of receptor tyrosine kinase met. Oncogenesis 2013;2:e40. [26] Laurila EM, Kallioniemi A. The diverse role of mir-31 in regulating cancer associated phenotypes. Genes Chromosomes Cancer 2013;52:1103–13. [27] Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, et al. The 21-nucleotide let-7 rna regulates developmental timing in caenorhabditis elegans. Nature 2000;403:901–6. [28] Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME. The role of let-7 in cell differentiation and cancer. Endocr Relat Cancer 2010;17:F19–36. [29] Mitra D, Das PM, Huynh FC, Jones FE. Jumonji/arid1 b (jarid1b) protein promotes breast tumor cell cycle progression through epigenetic repression of microrna let-7e. J Biol Chem 2011;286:40531–5. [30] Wang Q, Huang Z, Ni S, Xiao X, Xu Q, Wang L, et al. Plasma mir-601 and mir760 are novel biomarkers for the early detection of colorectal cancer. PLoS ONE 2012;7:e44398. [31] Kim SY, Lee YH, Bae YS. Mir-186, mir-216b, mir-337-3p, and mir-760 cooperatively induce cellular senescence by targeting alpha subunit of protein kinase ckii in human colorectal cancer cells. Biochem Biophys Res Commun 2012;429:173–9.
Please cite this article in press as: Lv J, et al. miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother (2014), http://dx.doi.org/10.1016/j.biopha.2014.09.011