miRNA551b-3p Activates an Oncostatin Signaling Module for the Progression of Triple-Negative Breast Cancer

Article

miRNA551b-3p Activates an Oncostatin Signaling Module for the Progression of Triple-Negative Breast Cancer Graphical Abstract

Authors Deepak Parashar, Anjali Geethadevi, Miriam Ragle Aure, ..., Gordon B. Mills, Sunila Pradeep, Pradeep Chaluvally-Raghavan

Correspondence [email protected]

In Brief Parashar et al. demonstrate that the mature microRNA-551b-3p translocates to the nucleus for transcriptional activation of STAT3 gene. As a consequence, miR551b activates an autocrine signaling loop through the upregulation of oncostatin family genes, including oncostatin, and its receptors for the growth and metastasis of triplenegative breast cancer.

Highlights d

miR551b-3p translocates to the nucleus and activates STAT3 transcription

d

Importin-8 (IPO8) is required for the nuclear translocation of miR551b-3p

d

miR551b-3p activates the expression of OSM family genes for autocrine signaling loop

d

Inhibition of miR551b-3p disrupts OSM-mediated signaling addiction

Parashar et al., 2019, Cell Reports 29, 4389–4406 December 24, 2019 ª 2019 The Author(s). https://doi.org/10.1016/j.celrep.2019.11.085

Cell Reports

Article miRNA551b-3p Activates an Oncostatin Signaling Module for the Progression of Triple-Negative Breast Cancer Deepak Parashar,1,12 Anjali Geethadevi,1,12 Miriam Ragle Aure,2 Jyotsna Mishra,3 Jasmine George,1 Changliang Chen,1 Manoj K. Mishra,4 Andliena Tahiri,5 Wei Zhao,6 Bindu Nair,1 Yiling Lu,6 Lingegowda S. Mangala,7 Cristian Rodriguez-Aguayo,8 Gabriel Lopez-Berestein,8 Amadou K.S. Camara,3 Mingyu Liang,4 Janet S. Rader,1,9 Ramani Ramchandran,1,9,10 Ming You,9,11 Anil K. Sood,7 Vessela N. Kristensen,2,5 Gordon B. Mills,6 Sunila Pradeep,1,4,9 and Pradeep Chaluvally-Raghavan1,4,9,13,* 1Department

of Obstetrics and Gynecology, Medical College of Wisconsin, Milwaukee, WI 53226, USA of Cancer Genetics, Institute for Cancer Research, Oslo University Hospital, The Norwegian Radium Hospital, Oslo, Norway 3Department of Anesthesiology, Medical College of Wisconsin, Milwaukee, WI 53226, USA 4Department of Physiology, Medical College of Wisconsin, Milwaukee, WI 53226, USA 5Division of Medicine, Department of Clinical Molecular Biology (EpiGen), Akershus University Hospital, Lørenskog, Norway 6Department of Systems Biology, The University of Texas MD Anderson Cancer Center, Houston, TX 77054, USA 7Department of Gynecology and Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX 77054, USA 8Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77054, USA 9Medical College of Wisconsin Cancer Center, Medical College of Wisconsin, Milwaukee, WI 53226, USA 10Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI 53226, USA 11Department of Pharmacology & Toxicology, Medical College of Wisconsin, Milwaukee, WI 53226, USA 12These authors contributed equally 13Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2019.11.085 2Department

SUMMARY

Genomic amplification of 3q26.2 locus leads to the increased expression of microRNA 551b-3p (miR551b-3p) in triple-negative breast cancer (TNBC). Our results demonstrate that miR551b-3p translocates to the nucleus with the aid of importin-8 (IPO8) and activates STAT3 transcription. As a consequence, miR551b upregulates the expression of oncostatin M receptor (OSMR) and interleukin-31 receptor-a (IL-31RA) as well as their ligands OSM and IL-31 through STAT3 transcription. We defined this set of genes induced by miR551b-3p as the ‘‘oncostatin signaling module,’’ which provides oncogenic addictions in cancer cells. Notably, OSM is highly expressed in TNBC, and the elevated expression of OSM associates with poor outcome in estrogen-receptor-negative breast cancer patients. Conversely, targeting miR551b with anti-miR551b3p reduced the expression of the OSM signaling module and reduced tumor growth, as well as migration and invasion of breast cancer cells. INTRODUCTION MicroRNAs (miRNAs), a class of small (~22 nt long), non-coding RNAs, have been implicated in multiple important physiological and pathological processes (Calin, 2009). miR551b is part of the 3q26.2 chromosomal locus, which is frequently amplified in

breast cancer (Weber-Mangal et al., 2003) as well as in multiple other cancer lineages, including cervical, head and neck, and prostate cancers (Nanjundan et al., 2007). We found that miR551b directly activates transcription via RNA activation (RNAa) to increase transcription of the signal transducer and activator of transcription factor 3 (STAT3) oncogene (Chaluvally-Raghavan et al., 2016). In concordance with our studies, others also have reported that small RNAs like miRNAs could interact with the promoter sequence and activate transcription of genes (Huang et al., 2012; Matsui et al., 2013; Place et al., 2008). STAT3 is a well-known oncogenic transcription factor that is upregulated in many cancers, including breast and ovarian cancers (Chaluvally-Raghavan et al., 2016), but it is unclear how RNAa upregulates the expression of oncogenes, such as STAT3, in tumor cells. It is known that cytokines or growth factors promote the phosphorylation of STAT3 within the cytoplasm, leading to STAT3 dimerization, nuclear translocation, and binding to oncogene promoters. STAT3 is known for its role on the transcription of growth factors, cytokines, and their receptors and causes autocrine signaling (Rosen et al., 2006). We have shown that miR551b-3p interacts with promoter sequences of STAT3 to facilitate the recruitment of RNA polymerase II and TWIST1 transcription factor, increasing STAT3 transcription (Chaluvally-Raghavan et al., 2016). Although our previous study identified miR551b as a key mediator of STAT3 transcription through RNAa (Chaluvally-Raghavan et al., 2016), it did not elucidate the functional consequences of the miR551b-STAT3 signaling cascade. In the current study, we demonstrate that miR551b-STAT3 signaling axis upregulates a set of genes for the oncostatin-M

Cell Reports 29, 4389–4406, December 24, 2019 ª 2019 The Author(s). 4389 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

A

B

C

D

E

F

G

H

(legend on next page)

4390 Cell Reports 29, 4389–4406, December 24, 2019

(OSM) family of chemokines, including OSM and interleukin-31 (IL-31), and their receptors OSM receptor (OSMR) and IL-31 receptor-a (IL-31RA). We named this set of genes as ‘‘oncostatin gene module.’’ Studies have shown that the defined set of genes in specific modules could act as a self-sustained signaling loop, which can feed signaling cues consistently for prolonged periods and regulates the gene expression for decisive cellular outputs (Amit et al., 2007a). OSMR, a member of the type I cytokine receptor family (Bilsborough et al., 2010), is the primary receptor for OSM. OSMR hetero-dimerizes with IL-6 signal transducer (IL-6ST) (also known as gp130) upon binding with OSM (Godoy-Tundidor et al., 2005). OSMR also hetero-dimerizes with IL-31RA upon binding with IL-31 (Yu et al., 2014). Studies have reported that elevated levels of OSM expression results in a feedforward loop involving the de novo production of both OSM and OSMR to facilitate aggressive properties of cancer cells (Kucia-Tran et al., 2018). However, the role of miR551bmediated upregulation of oncostatin gene module in basal-like breast cancers has not been well understood. In this study, we uncover the mechanism how mature miRNA-551b-3p translocated to the nucleus and upregulates OSM gene module for breast cancer progression. RESULTS miR551b Increases Cell Proliferation, Migration, and Invasion in Breast Cancer Cells To explore the oncogenic role of miRNA-551b-3p (miR551b-3p) in breast cancer, first, we determined the expression of miR551b-3p in different breast cancer cell lines represents different subtypes of breast cancer and found that basal-like triple-negative breast cancer cells (TNBCs), such as MDA-MB231, MDA-MB-436, SUM-149, and HCC-1806RR, express high levels of miR551b-3p compared to estrogen receptor (ER)-positive luminal cell lines, like T47D, and MCF-7 and HER2-expressing cell line BT-474 cells (Figure S1A). To determine the role of miR551b-3p in basal-like breast cancer cells, we used MCF10A and MDA-MB-231 cell lines. MCF10A cell line is a spontaneously immortalized breast epithelial cell line derived from the benign breast tissue of a woman. Both MCF10A and MDA-MB-231 cell lines do not express ER, PR, and HER2 and express wild-type BRCA1, thus exhibiting the characteristics of

basal-like TNBC samples in the clinic (Chavez et al., 2010; Paine et al., 1992; Soule et al., 1990). Our results show that miR551b3p increased the proliferation (Figure 1A) and clonogenic potential of both MCF10A and MDA-MB-231 cells (Figures 1B and S1B) as well as promoted the migration and invasion of both MCF10A and MDA-MB-231 cells (Figure 1C). Furthermore, miR551b increased the wound healing ability of MCF10A and MDA-MB-231 cells (Figure 1D) and increased the levels of vimentin and N-cadherin and reduced the levels of E-cadherin (Figures 1E and 1F; see Figure S1C for miRNA expression). Next, we used a model that reflects in vivo conditions better; we transfected miR551b into MCF10A and MDA-MB-231 cells and cultured the cells on non-adherent condition and in Matrigel to form spheroids. Importantly, miR551b-3p increased the number and size of spheroids and the invasion of MDA-MB-231 tumor spheroids (Figures 1G and S1D). We and others have previously showed that cells in tumor spheroids exhibit characteristics of cancer stem cells (CSCs) and express EMT (epithelial to mesenchymal transition) markers (Chaluvally-Raghavan et al., 2014, 2016; Mani et al., 2008; Pradeep et al., 2012a). Complementing these findings, we found that miR551b-3p upregulates expression of CD44 and c-Kit and downregulates expression of CD24 and E-cadherin (Figure 1H). To determine whether miR551b induces the TNBC-characteristics-like mesenchymal properties and cancer stemness in luminal breast cancer cells, we overexpressed miR551b-3p in a luminal cell line MCF-7 and found that the gain of miR551b-3p in MCF-7 cells increased the levels of vimentin and N-cadherin and reduced the levels of E-cadherin (Figure S1E). We also found that miR551b-3p upregulated the expression of CD44 and downregulated CD24, which demonstrates the acquisition of the characteristics of cancer stemness in MCF-7 cells (Figure S1F). We also found that miR-551b-3p promoted the migration, invasion, and sphereforming and colony-forming ability of MCF-7 cells (Figures S1G and S1H). Inhibition of miR551b Decreases the Tumorigenic Features of Breast Cancer Cells Consistent with the finding that miR551b-3p confers oncogenic properties, knockdown of miR551b-3p reduced proliferation and colony-forming activity of MDA-MB-231 cells (Figures 2A–2C; see Figure S2A for miR551b-3p expression). Furthermore,

Figure 1. miR551b-3p Promotes Oncogenic Features in Breast Cancer Cells (A) Cell lines were transfected with control miRNA or miR551b-3p, and the viability was assessed at the indicated time points, using 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT). *p < 0.05 versus control (con.) miRNA. (B) Cell lines above were transfected as above then assessed for their colony-forming ability 14 days after transfection by staining with crystal violet and photographed. (C) Representative images (scale bars represent 500 mm) of transfected (with con. miRNA or miR551b-3p) MCF10A or MDA-MB-231 cells that migrated or invaded through trans-well inserts with or without Matrigel and the quantification of absorbance crystal violet eluted. (D) Representative images of three microscopic fields in a wound-healing assay of MCF10A and MDA-MB-231 cells captured at 24 h after transfection with con. miRNA and different concentrations of miR551b-3p. Red line indicates the empty space between healing cells. Scale bars represent 500 mm. (E) Cell lines were transfected with con. miRNA (7 nM) and miR551b-3p at the indicated concentrations and immunoblotted 48 h after transfection. (F) Total RNA was isolated from samples (as indicated in E), and qPCR was performed. mRNA expression was normalized to b-actin. Bars represent SE of triplicate determinations. (G) Cells were transfected with con. miRNA (7 nM) or miR551b-3p at the indicated concentrations and representative images of MCF10A and MDA-MB-231 spheroids formed on a low-attachment plate were captured. Scale bars represent 500 mm. (H) Total RNA was isolated from samples (as indicated in F), and qPCR was performed. Error bars represent SEs of triplicates. Student’s t test was used for statistical analysis.

Cell Reports 29, 4389–4406, December 24, 2019 4391

(legend on next page)

4392 Cell Reports 29, 4389–4406, December 24, 2019

anti-miR551b-3p promotes apoptosis in MDA-MB-231 cells (Figure 2D). In parallel to anti-proliferative and pro-apoptotic effects of anti-miR551b-3p, we found that anti-miR551b-3p reduced migration and invasion of MDA-MB-231 and HCC1806RR cells (Figures 2E, 2F, and S2B). Anti-miR551b-3p also reduced the number and size of MDA-MB-231 spheroids in both non-adherent and adherent conditions and HCC-1806RR spheroids in non-adherent conditions (Figures 2G, S2C, and S2D). We also noticed that anti-miR551b reduced the expression of vimentin and N-cadherin and increased the expression of E-cadherin in both MDA-MB-231 and HCC-1806RR cell lines, which expresses high levels of miR551b-3p (Figures 2H, 2I, and S2E), decreased stem cell characteristics as displayed by decreased levels of CD44 and c-Kit, and increased levels of CD24 in both MDA-MB-231 and HCC-1806RR cell lines (Figures 2J and S2F). miR551b-3p Upregulates STAT3 Transcription Factor and the OSM Gene Module To explore the mechanisms by which miR551b-3p mediates its effects in TNBC, we assessed the changes in protein expression resulting from miR551b-3p expression in MDA-MB-231 cells, using reverse-phase protein array (RPPA) as described before (Hennessy et al., 2010). We found that miR551b-3p upregulated both total and phospho-STAT3 (Y705) proteins, supporting that STAT3 is the key target of miR551b-3p in breast cancer cells (Figure 3A). Furthermore, miR551b-3p increased phosphatidylinositol 3-kinase (PI3K) and AKT signaling while downregulating RAS/mitogen-activated protein kinase (MAPK) signaling and decreasing levels of phosphorylated S6 protein (Figures 3A and S3A). These findings support the contention that increased PI3K and AKT signaling together with decreased levels of RAS/ MAPK signaling by miR551b-3p constitute an important oncogenic mechanism in tumor cells. miR551b-3p is located at the 3q26.2 locus, the miR551b copy gain is present in ~27% breast cancer patients, and miR551b is amplified in ~3.5% breast cancer patients in The Cancer Genome Atlas (TCGA) breast cancer dataset (Table S1; The Cancer Genome Atlas Network, 2012). Our analysis using TCGA

breast cancer data further showed that breast cancer samples exhibit miR551b amplification express high levels of STAT3 mRNA (Figure S3B), and miR551b-3p expression is correlated with STAT3 and phospho-STAT3 (Y705) levels in breast cancer samples, particularly in the basal-like subtype (Figures 3B, 3C, and S3C; Nielsen et al., 2006). In conjunction with our previous findings in ovarian cancer (Chaluvally-Raghavan et al., 2016), our data demonstrate that miR551b-3p appears to regulate total and phospho-STAT3 in breast cancer cells, where miR551b-3p could be a major contributor to the functional effects of STAT3. Next, we determined whether there is an association between miR551b-3p and STAT3 in the set of breast cancer cell lines, in which we have determined the expression of miR551b (see Figure S1A), and found that those cell lines expressing high levels of miR551b-3p also express high levels of STAT3 and phosphorylated form of STAT3 (S727 and Y705; Figure S3D). Our correlation coefficient analysis between the expression of miR551b3p and the levels of STAT3, pSTAT3 (Y705), or pSTAT3 (S727) again confirm a positive correlation between miR551b-3p versus STAT3 proteins (Pearson correlation coefficient [r] > 0.7; Figures S3D and S3E). To identify the key transcriptional targets upregulated by STAT3 in breast cancer, we employed three breast cancer datasets, including TCGA breast cancer dataset (The Cancer Genome Atlas Network, 2012), METABRIC dataset, and the MicMa micro-metastasis cohort of breast cancer (Enerly et al., 2011; Naume et al., 2007; Wiedswang et al., 2003) for mRNAs correlated with STAT3 mRNA. Strikingly, our analysis, using a Spearman’s correlation coefficient above 0.4, identified OSMR is the only mRNA significantly associated with STAT3 RNA in both datasets (sheets 1–3 in Table S2; Figure S3F). Next, we identified proteins that interact with STAT3 and OSMR, using the STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) database catalogs direct and indirect protein interactions, and identified six proteins, including OSM, IL-31, IL-6 signal transducer, IL-31RA, Janus kinase-1 (JAK1), and JAK2, as primary interactors with OSMR, with an interaction score of 0.90 or above (Figure 3D; Table S3). Taken together, our data suggest that miR551b-3p could act through a gene module consisting of

Figure 2. Inhibition of miR551b-3p Reduces Oncogenic Properties of Breast Cancer Cells (A) MDA-MB-231 cells were transfected with con. anti-miRNA or anti-miR551b-3p at different concentrations, cell viability was assessed at the indicated time point using MTT. Error bars represent SE of quadruplicates, and p values were determined by Student’s t test. *p < 0.05 compared to the control group. (B) The colony-forming ability of MDA-MB-231 cells transfected with con. anti-miRNA or anti-miR551b-3p was assessed after 14 days, and the cells were photographed. (C) Quantitative analysis of the colony-forming assay in (B). (D) MDA-MB-231 cells were transfected with con. anti-miRNA (7 nM) or anti-miR551b (7 nM) for 48 h, and the numbers of apoptotic cells (Q1) and viable cells (Q3) were assessed with a calcein AM/ethidium bromide (EtBr) assay kit, using flow cytometry. Data shown are representative of three independent experiments in triplicate. (E) MDA-MB-231 cells were transfected with con. anti-miRNA or anti-miR551b-3p and plated on trans-well inserts. Migrated cells were photographed (upper panel). Scale bars represent 500 mm. Bar graph represents the quantification of the cells migrated or invaded. (F) MDA-MB-231 cells were transfected with con. anti-miRNA or anti-miR551b-3p and plated on trans-well inserts. Invaded cells were photographed (upper panel). Scale bars represent 500 mm. Bar graph represents the quantification of the cells were invaded. (G) The cells were transfected with control anti-miRNA or anti-miR551b-3p at the indicated concentrations, and the spheroids formed on low-attachment plates were photographed and quantitated on day 7. Scale bar represents 500 mm. (H) Total RNA extracted from cells was transfected with control anti-miRNA or anti-miR551b-3p (7 nM) 48 h after transfection, and qPCR was performed to determine indicated genes. (I) Cell lysates were prepared 48 h after transfection of con. anti-miRNA or anti-miR551b-3p (7 nM), and immunoblotting was performed. (J) Total RNA isolated from (I) and qPCR was performed to determine the expression of the genes indicated. All mRNAs were normalized to b-actin in qPCR assays. Bars represent SE of triplicate determinations. Statistical analysis was done by Student’s t test.

Cell Reports 29, 4389–4406, December 24, 2019 4393

miR551b-3p expression (log 2 Scale)

B Column Z-Score

C

-2 Basal-like

r=0.35

miR551b-3p

miR551b-3p expression (log 2 Scale)

A

-4 -6 -8

-2

Basal-like r=0.47

-4 -6 -8

-10

-10 -0.5

0.0

0.5

-1.0 -0.5 0.0 0.5 1.0 1.5

1.0

STAT3 pY705 (log 2 Scale)

STAT3 (log2 Scale)

Con. miR GPBB MEK1 pS217/pS221 FAK pY397 S6 pS235 pS236 COX2 S6 pS240 pS244 RAPTOR GAPDH SOD2 NDRG1 pT346 LDHA AKT pT308 TFRC PTEN HIF-1α STAT3 CD171 AKT pS473 STAT3 pY705

D

p<0.01

9 6 3 0

OSMR IL6ST IL31RA

H

MDA-MB-231

5 0

OSM

10 8 6 p=0.003

OSMR IL6ST IL31RA

Con. miR 3nM 5nM 7nM

p=0.0004 p<0.0001

15 10 5 0

OSM

IL31

120

Con. antimiR 3nM 5nM 7nM p-STAT3 (S727)

p-STAT3 (S727)

p-STAT3 (Y705)

p-STAT3 (Y705)

IL31RA

IL31RA

IL6ST

IL6-ST

OSMRß

OSMRß

ß-Actin

ß-Actin

40 0

160

p=0.004

120 80 40 0

Con.miR miR551b

MCF10A 450

Con.miR miR551b

MDA-MB-231

p=0.003

300 150 0

K

p=0.005

80

J

STAT3

MDA-MB-231

MCF10A

I

MDA-MB-231

STAT3

25 20

IL31

anti-miR551b

miR551b

p=0.004

2 0

anti-miR551b

OSM (pg/mL)

12

p<0.001

IL31 (pg/mL)

p<0.001

35 p<0.0001 30 25 20 p<0.001 15 10

12

Rel. mRNA expression (Fold change)

miR551b-3p

Con. antimiR

OSM (pg/mL)

15

Con. miR

F Rel. mRNA expression (Fold change)

18 p<0.0005

Rel. mRNA expression (Fold change)

Rel. mRNA expression (Fold change)

G

MDA-MB-231

MDA-MB-231

IL31 (pg/mL)

E

600

p=0.05

400 200

Con.miR miR551b

0

Con.miR miR551b

MDA-MB-231 Con. OSM

Con. IL31 p-JAK1 (Y1034/1035) JAK1 p-JAK2 (Y1008) JAK2 p-STAT3 (S727) p-STAT3 (Y705) STAT3

(legend on next page)

4394 Cell Reports 29, 4389–4406, December 24, 2019

OSM, OSMR, IL-31, IL-31RA, IL-6ST, JAK1, and JAK2. Importantly miR551b-3p upregulated the expression of OSM, OSMR, IL-31, IL-31RA, and IL-6ST, which we define as the OSM gene module, and that anti-miR551b-3p reduces expression of these components at both mRNA and protein levels (Figures 3E–3H and S3G). OSM and IL-31 are secreted cytokines, and these secreted cytokines can activate cellular signaling in autocrine manner. Thus, we quantified the secreted levels of OSM and IL-31 by ELISA and found that miR551b-3p increased the levels of both OSM and IL31 in supernatants of MCF10A and MDA-MB-231 cells (Figures 3I and 3J). Conversely, anti-miR551b-3p reduced the levels of OSM and IL-31 in MDA-MB-231 cells (Figure S3H). OSM or IL31 also induced the phosphorylation of JAK1 (Y-1034/1035), JAK2 (Y-1008), and STAT3 (S-727 and Y-705) in breast cancer cells (Figure 3K). We further determined the effects of OSM and IL-31 on phosphorylation of STAT3 in comparison with IL-6, which is a known stimulator of STAT3 phosphorylation, and found that OSM induced the phosphorylation of STAT3 at Y705 and S727 residues markedly higher than IL-6 and IL-31 and persistent for prolonged period (Figures S3I and S3J). Mature miR551b-3p Translocates to the Nucleus for Transcriptional Activation of STAT3 We have shown that miR551b-3p interacts with STAT3 promoter in the nucleus and activates STAT3 transcription previously (Chaluvally-Raghavan et al., 2016; Ramchandran and Chaluvally-Raghavan, 2017). To determine whether mature miR551b-3p is present in the nucleus and is required for transcriptional activation, we have performed qPCR to quantitate the expression of miR551b-3p in the nuclear and cytoplasmic fractions in breast cancer cell lines. Our qPCR and northern blot assays show that mature form of miR551b-3p translocated to the nucleus in substantial level in TNBC cell lines, such as MDAMB-231 and HCC-1806RR, which express high levels of miR551b (Figures 4A and S4A). Our in situ hybridization also shows increased levels of mature miR551b-3p in the nucleus of MDAMB-231 and HCC-1806RR cells compared to MCF7 and MCF10A cells, which express low levels of miR551b and exhibit less miR551b-3p in the nucleus (Figures 4A, S4B, and S4C). Importantly, the overexpression of miR551b3p in MDA-

MB231 leads to the increased expression of miR551b-3p in both cytoplasmic and nuclear fractions compared to the cells transfected with control miRNA (Figure S4D). In conjunction with previous studies from us and others (Huang et al., 2010; Janowski et al., 2007; Place et al., 2008; Ramchandran and Chaluvally-Raghavan, 2017), the mutation in the STAT3 promoter sequences (mutant nos. 2 and 3), which is complementary to the 50 sequences of miR551b-3p and the deletion of non-complementary loop in the STAT3 promoter (mutant no. 4), abolished miR551b-3p-induced promoter activity (Figures 4B and 4C). We also noticed that mutations in STAT3 promoter complementary toward 30 sequences of miR551b-3p (mutant no. 1) reduced the miR551b-3p-induced promoter activity about 30%, whereas other mutations as described above reduced the promoter activity more than 75% compared to the luciferase activity induced by miR551b-3p in the cells were transfected with wild-type STAT3 promoter. Collectively, our results suggest that the sequence 50 -GCGACCCAUACUUGGU-30 in miR551b-3p is critical for the interaction of miR551b-3p with STAT3 promoter for STAT3 transcription. To visualize the translocation of miR551b to the nucleus, we have used the 50 Cy3-labeled wild-type miR551b-3p (50 -GCGACCCAUACUUGGUUUCAG-30 ) or mutated miR551b3p, in which UUGGUUU sequence in miR551b-3p mutated to CCAUCGG and transfected into MDA-MB-231 cells. Strikingly, we found that the mutations in UUGGUUU sequence abolished the nuclear translocation of miR551b-3p (Figures 4D and 4E; Videos S1 and S2). Taken together, our results show that UUG GUUU sequence in miR551b-3p is important for its nuclear translocation, and the 50 -GCGACCCAUACUUGGU-30 sequence in miR551b-3p is important for STAT3 transcriptional activation. To further validate the nuclear translocation of miR551b-3p in miR551b genetic knockout model, we deleted miR-551b in TNBC subtype Hs578T breast cancer cells using CRISPR/ Cas9 vectors, and the deletion of miR551b is confirmed using gel electrophoresis of the DNA fragment encompassing miR551b amplified using target specific primers and Sanger sequencing (Figures S4E–S4G). We then performed the RNA in situ hybridization of miR551b-3p and northern blot analysis using the miRNA isolated from cytoplasmic and nuclear fractions. As expected, the wild-type (WT) cells exhibited the expression

Figure 3. miR551b-3p Regulates Oncostatin Gene Module Expression in Breast Cancer Cells (A) MDA-MB-231 cells were transfected with con. miRNA or miR551b-3p in three independent experiments, and effects on protein levels were determined by RPPA 48 h later. Proteins with >20% change in expression are represented in the heatmap. (B) Pearson correlation analysis was performed based on the expression of miR551b-3p versus STAT3 protein levels in basal-like subtype of breast cancer patient samples in the Danish Breast Cancer Cohort Group (DBCG) cohort; n = 89. (C) Pearson correlation analysis was performed based on the expression of miR551b-3p versus pSTAT3 protein levels in basal-like subtype of breast cancer patient samples in the Danish Breast Cancer Cohort Group (DBCG) cohort; n = 89. (D) OSMR-signaling network predicted by STRING database. (E and F) MDA-MB-231 cells were (E) transfected with con. miRNA (7 nM) or miR551b-3p (7 nM) or (F) transfected with con. anti-miRNA (7 nM) or with antimiR551b (7 nM), and qPCR was performed to test the expression of the indicated genes using RNA collected 48 h after transfection. (G) MDA-MB-231 cells were transfected with control miR or miR551b-3p; then immunoblot was performed using the cell lysates prepared 48 h after transfection. (H) MDA-MB-231 cells were transfected with control anti-miR or anti-miR551b-3p; then immunoblot was performed using the cell lysates prepared 48 h after transfection. (I) Secreted levels of OSM in the culture supernatant of MCF10A and MDA-MB-231 cells were collected after con. miRNA or miR-551b-3p transfection and quantitated by ELISA. Bars represent mean ± SE of quadruplicate determinations of three different experiments. (J) Secreted levels of IL-31 in the culture supernatant of MCF10A and MDA-MB-231 cells were collected after con. miRNA or miR-551b-3p transfection and quantitated by ELISA. Bars represent mean ± SE of quadruplicate determinations of three different experiments. (K) MDA-MB-231 cells were treated with OSM or IL-31 (20 ng/mL) and then lysates were prepared and immunoblot was performed 48 h after transfection.

Cell Reports 29, 4389–4406, December 24, 2019 4395

C Con. miR m miR551b

12

MD

DAPI

8

3'CCCTGGGT TT AA C CC AAGAC 5' -503 #3 #2 #1 -530 TC G A A GG #4 STAT3 Promoter

6 4 2 0

miR551b-3p

miR551b-3p 5'GCGACCCAUACUUGGUUUCAG 3'

STAT3 promoter

GGTT

Colocalization Profile

E Intensity

200 100 0 0 300

Intensity

Mut miR551b

miR551b/DAPI

miR551b-3p DAPI

300

WT miR551b

TAATT

Mut #2: CCAA

Mut #3: deletion of loop CAGGAGT TTTGT Mut #4: TGGGTC

WT Mut1 Mut2 Mut3 Mut4

Merge

Mut #1: CAGAA

Mander’s Coefficient

R 31 F-7 47D T B-2 806R MC 1 A-M

A 10

D

50

100

100 0

50

100

150 200

Distance (pixels)

Nuclear

IPO8

p<0.0001

Ago-1 p<0.005

RNA Pol II

p<0.001

Twist 1 GAPDH

b 1b 1b iR 1b miR 551 55 . m iR55 iR55 n. miR t-miR Con m m Co t mu mu

DAPI

miR551b-3p

Merge

Lamin A/C

J

Colocalization Profile miR551b-3p DAPI

Intensity

si-Con

300 200 100 0

0

Intensity

300

si-IPO-8

0.8

14 12 10

0.2 0.0

Wild type

Mutant

p<0.0005 25 20 15 10 5 0

Wild type

Mutant

miR551b-3p

8 6 4

2 0 si-Con. si-IPO8 si-IPO9

miR551b/DAPI

p<0.0005

0.6 0.4 0.2 0.0

0.6 0.4

p=0.0001 p=0.0005 p=0.0002

9 on O-8 Osi-C si-IP si-IP

50 100 150 200 250

200

1.0

0.8

Con. miR

H Rel. miR551b-3p expression (Fold change)

Cytoplasmic

Mander’s Coefficient

Fold Enrichment

p<0.0005 60 0 50 0 40 30 0 20 0 10 0

G

pu Ig t G IP O 8 In pu Ig t G IP O 8

Nuclear

IPO8 Cytoplasmic

In

IgG

p<0.005

1.0

150

200

0

F

I

C

Cells with ≥10 (foci%)

p<0.005

Nuclear Fraction

p<0.01

14 p<0.0005 p<0.05 10

F

MC

Cytoplasmic Fraction

-++ - -

++ - - Cells with 10 (foci%)

5 4 3 2 1 0

B

p<0.001

Rel. luciferase activity (x103 RLU)

Rel. mi551b expression (Fold w.r.t MCF10A)

A

25

--++

p=0.0001

20 15 10 5 0

on O-8 O-9 si-C si-IP si-IP

K

100 0

0

50 100 150 200 250

Intensity

si-IPO-9

300 200 100 0

0

50

100

Distance (pixels)

150

(legend on next page)

4396 Cell Reports 29, 4389–4406, December 24, 2019

of miR551b both in the cytoplasm and nucleus, although miR551b-deleted cells did not have any expression of miR551b in the cytoplasm and nucleus (Figures S4H and S4I). To further support our results on the nuclear translocation of mature miR551b-3p in the WT and miR551b-knockout (KO) Hs578T cells, we performed RNA in situ hybridization in a cancer cell line exhibiting homozygous deletion of miR551b, which did not show any presence of mature miR551b-3p in the cytoplasm or in nucleus (Figures S4J and S4K). IPO8 Is Required for the Nuclear Translocation of miR551b-3p It is shown recently that importin-8 (IPO8), which is a member of the karyopherin b (a.k.a. protein import receptor importin b) family, is important for the translocation of mature miRNAs to nucleus (Wei et al., 2014). To determine the role of IPO8 on the nuclear transport of miR551b-3p, we performed RNA immunoprecipitation (RIP) assay by purifying miRNA followed by IP of IPO8 from the cytoplasmic and nuclear extracts of the MDA-MB-231 cells that were transfected with control (con.) miRNA, miR551b-3p, or mutant miR551b. We found that miR551b-3p, but not the con. miRNA or mutated miR551b-3p, is enriched in the nuclear fraction when we purified IPO8-bound miRNAs from the nuclear extract (Figure 4F). Next, we performed IP of IPO8 in cytoplasmic and nuclear extract to determine whether IPO8 would interact with the proteins that are required for transcription and found that IPO8 interacts with RNA polymerase II and TWIST1 transcription factor in nuclear extract (Figure 4G). Next, we determined the IPO8 levels in a set of breast cancer cell lines and found that TNBC cells express high levels of IPO8 (Figures S5A and S5B), which also express high levels of STAT3 and miR551b-3p (Figures S1A and S3D). To further confirm the role of IPO8 on nuclear import of miR551b, we overexpressed miR551b-3p or control miRNA in the cells that were pre-transfected with control siRNA, siRNA of IPO8, or siRNA of IPO9 and then isolated miR551b-3p from the nuclear extract and performed qPCR to determine the

enrichment of miR551b-3p in the nucleus. We used IPO9 as a control to confirm whether there is specificity between the interaction of miR551b-3p with IPO8. This assay demonstrated that the loss of IPO8 expression, but not the loss of IPO9, reduced the enrichment of miR551b in the nuclear fractions of cells, which were transfected with miR551b (Figures 4H, S5C, and S5D). In conjunction with our qPCR assays in Figure 4H, our immunofluorescence assay also shows that the loss of IPO8, but not the loss of IPO9, disrupted the translocation of miR551b-3p to the nucleus (Figures 4I and 4J). Next, we determined the interaction between miR551b-3p and IPO8 by assessing the co-localization of Cy-3-labeled miR551b-3p with IPO8 in immunofluorescence assay and found that miR551b-3p co-localized with IPO8 in the cytoplasm (orange) and in the nucleus (cyan; Figure S5E). Previous studies have shown that mature miRNA interact with AGO1 protein in the cytoplasm during the maturation of miRNA (Eulalio et al., 2008; Li et al., 2017). To determine whether AGO1 acts as an adaptor protein to connect IPO8, we have performed immunofluorescence and found that AGO1 interacts with IPO8, as evidenced by the co-localization in both cytoplasm (orange) and nucleus (cyan; Figure S5F). Next, we performed the rescue experiment, where we introduced the miR551b-3p expression in the miR551b-KO Hs578T cells, which were pre-transfected with IPO8 small interfering RNAs (siRNAs) or control siRNAs to prove the exogenous miR551b requires IPO8-mediated nuclear translocation to upregulate STAT3 expression. In this assay, we found that the gain of expression of miR551b rescued the proliferation and spheroidforming ability of miR551b-KO-Hs578T cells, which was disrupted by the loss of miR551b (Figures S6G and S6H). Importantly, the knockdown of IPO8, but not IPO-9, abrogated the nuclear translocation of miR551b and miR551b-induced STAT3 induction and subsequent increase in proliferation and spheroid-forming ability of miR551b-KO-Hs578T cells, which was disrupted by the loss of miR551b (Figures S5G–S5K). Taken together, our results demonstrate that the interaction of IPO8 to miR551b-3pAGO complex translocates to the nucleus, and the sequence

Figure 4. miR551b Is Translocated to the Nucleus and Is Mediated by Importin-8 (A) Total RNA was isolated from cytoplasmic and nuclear fractions of cell lines indicated, and miR551b-3p expression was analyzed by qPCR. miRNA was normalized to U6. (B) The WT STAT3 promoter, including 962 bp upstream of the transcription start site (TSS), was cloned in the pLight luciferase reporter construct and co-transfected with control miRNA and miR551b-3p. Similarly, mutant STAT3 promoter constructs (nos. 1–4) as indicated in (C) were co-transfected with con. miRNA or miR551b-3p into MDA-MB-231 cells and then luciferase activity was assessed. (C) Sequence complementarity between miR551b-3p with STAT3 promoter and the sites and sequences of mutations prepared. (D) MDA-MB-231 cells were transfected with Cy3-labeled (red) miR551b or mutant miR551b and then fixed after 48 h, and confocal microscopy was performed and representative images presented. Scale bars represent 20 mm. (E) Nuclear translocation signal of miR551b-3p is quantitated by Image-J Coloc-2 pixel intensity spatial correlation analysis suite and Mander’s co-localization coefficient and the percentage of foci presented. (F) RNA immunoprecipitation (RIP) assay was performed following transfection with con. miRNA, miR551b-3p, or mutant miR551b for 48 h in MDA-MB-231 cells. Lysates of transfected cells were pulled down using antibodies specific to IPO8 or control immunoglobulin G (IgG) in cytoplasmic and nuclear fractions to detect miR551b in lysates bound to IPO8. Control IgG antibody was used as negative controls for RIP, whereas U6 was used as a control for qRT-PCR and fold enrichment was calculated with regard to control IgG. Data were presented as mean ± SE (n = 3). (G) Lysates of MDA-MB-231 cells were used to perform immunoprecipitation of IPO8 as in (F) and immunoblotted for the indicated proteins. (H) Total RNA was isolated from MDA-MB-231 cells transfected with siControl, siIPO8, and siIPO9 as followed by transfection with con. miRNA and miR551b. miR551b expression was analyzed by qPCR 48 h after transfection. miRNA expression was normalized to U6. (I) MDA-MB-231 cells were transfected with cy3-labeled miR551b (red), that were pre-transfected with control siRNAs, siIPO8, or siIPO9 and then fixed and imaged. Scale bars represent 20 mm. (J) Nuclear translocation signal of miR551b-3p is quantitated as described in (E). (K) Proposed model illustrating the transport of miR551b-3p into nucleus aided by IPO8-AGO1 complex.

Cell Reports 29, 4389–4406, December 24, 2019 4397

A

Con. miR

STAT3 siRNA-1

STAT3 siRNA-2

miR551b-3p

STAT3 siRNA-1 + miR551b-3p

STAT3 siRNA-2 + miR551b-3p

Con. miR miR551b-3p STAT3 siRNA 1 STAT3 siRNA 2

p<0.005

6

p<0.05

p<0.05

p<0.0001

Rel. mRNA expression (Fold change)

B

+ -

+ -

+ -

+ + -

+

+ +

p-STAT3 (S727)

p=0.0001

p=0.03

4

p-STAT3 (Y705)

p<0.05

p<0.001

p<0.05

STAT3

2

IL31RA IL31RA

OSMR

C

IL6-ST

p<0.01 p<0.001

p<0.05

2

miR551b-3p

IgG STAT3 ChIP- miR OSM

p p<0.001

30 20 0 10 0

p<0.001

60 40 20 0

IL31RA 20 15 10 5 0

5 25 20 15 10 5 0

20 0 10

iR

p

3 b-

n Co

1 55

iR

m

Fold Enrichment

30

.m

40 20 0

n Co

3p

1b

5 R5

i

m

4 0

40 30 20 10 0

p<0.0001

50 40 30 20 10 0

p<0.005

IL-8

p<0.005

iR

.m

8

IL6ST

p<0.05

75 5 60 0 45 5 30 0 15 5 0

12

IL31

p<0.0001 p<0.0001

IL-8

p<0.005

0

80 60

OSM

p<0.005 p<0.005

IL31RA

p<0.05

IL6ST 40

p<0.005 p<0.001

IL31 Fold Enrichment

p<0.05

OSMR

Fold Enrichment

40

Fold Enrichment

Fold Enrichment

OSMR

IgG STAT3 ChIP-miR

E

Fold Enrichment

D

Fold Enrichment

IL31

Fold Enrichment

OSM

ß-Actin

STAT3 siRNA-1 STAT3 siRNA-1 + miR551b-3p STAT3 siRNA-2 STAT3 siRNA-2 + miR551b-3p

1

0

Fold Enrichment

OSMRß

Con. miR

p<0.01

100 80 60 40 20 0 0

ed

t ea

r nt

U

p<0.05

p<0.0001

Fold Enrichment

Rel. mRNA expression (Fold change)

3

Fold Enrichment

STAT3

IL6ST

O

SM

1

3 IL

Fold Enrichment

0

p<0.05

90 60 30 0

ed

at

re

t Un

O

SM

31

IL

(legend on next page)

4398 Cell Reports 29, 4389–4406, December 24, 2019

complementarity between miR551b-3p and STAT3 promoter allows the binding of miR551b-3p on STAT3 promoter. Importantly, this interaction of miR551b-3p with STAT3 promoter improves the occupancy of TWIST1 transcription factor and RNA polymerase II (RNA Pol II) to the transcription initiation site for STAT3 transcription (Figure 4K). STAT3 Is Required for miR551b-3p-Induced Expression of the OSM Gene Module STAT3 regulates the expression of various interleukins and cytokines (Rosen et al., 2006; Yu et al., 2014). To further interrogate whether STAT3 is critical for the expression of the OSM gene module, we transfected miR551b-3p into breast cancer cells that had been transfected separately with two different STAT3 siRNAs. We then quantified the expression of the OSM and IL-31 chemokines and their receptors by qPCR and western blotting (Figures 5A–5C). Importantly, our results showed that loss of STAT3 expression abolished miR551b-induced OSMR, IL-6ST, and IL-31RA at both the transcript (Figure 5A) and protein level (Figure 5B). Because OSM and IL-31 can potentially interact with OSMR after dimerizing with IL-6ST or IL-31R, we used qPCR to determine the effect of the miR551b-STAT3 axis on OSM and IL-31 mRNA expression using total RNA isolated from the breast cancer cells that were pre-transfected with STAT3 siRNAs prior to miR551b-3p transfection. Our results showed that loss of STAT3 abolished miR551b-induced increase in the expression of OSM and IL31 in both MDA-MB-231 and MCF10A cell lines (Figures 5C and S6A). To investigate whether miR551b induces STAT3-mediated transcription of OSM family genes, we performed chromatin IP (ChIP), targeting STAT3 protein. This approach showed that miR551b-3p treatment enriched STAT3 on promoters of the OSM gene module, including the promoters of OSMR, OSM, IL-31RA, IL-31, and IL-6ST (Figures 5D and S6B). To confirm that OSM and IL-31 use a feedforward mechanism to activate the signaling pathway initiated by STAT3 protein, we stimulated MDA-MB-231 cells with OSM and IL-31 and performed ChIP, targeting STAT3. The results demonstrated that OSM and IL-31 stimulation enriched STAT3 transcription factor in the promoters of OSM, OSMR, IL-6ST, IL-31, and IL-31R compared to untreated controls (Figures 5E and S6C). This result supports the notion that chemokines, such as OSM or IL-31, produced by STAT3 could activate STAT3 for prolonged periods, contributing to transcription of OSM, OSMR, IL-6ST, IL-31, and IL-31R. Thus, miR551b-3p-mediated activation of STAT3 promotes transcription of OSM gene module and,

more importantly, for autocrine regulation of OSM family gene expression. miR551b-3p Effectors Promote Oncogenic Effects in Immortalized Breast Epithelial and TNBC Cell Lines As our data implied that OSM and IL-31 are effectors of miR551b-3p in cancer, we next determined their effects on MDA-MB-231 breast cancer cells. OSM or IL-31 stimulation significantly increased cell proliferation (Figure 6A), and the combination of OSM or IL-31 enhanced proliferation modestly compared with either OSM or IL-31 alone (Figure 6A). OSM and IL-31 also promoted colony formation by breast cancer cells (Figure 6B), and their combination was more effective than either ligand alone (Figure 6B). OSM or IL-31 promoted wound healing and migration and invasion of tumor cells, with the combination being more effective than either mediator alone (Figures 6C and 6D). To further determine whether OSM and IL-31 promote autocrine signaling and STAT3 activation, we stimulated MDA-MB231 cells with each ligand. Importantly, OSM and IL-31 induced phosphorylation of STAT3 (Y705). We also noticed that OSM or IL-31 treatment increased protein levels of unphosphorylated STAT3, IL-31RA, and OSMR (Figure 6E). Consistent with our finding that OSM and IL-31 promote a migratory phenotype of breast cancer cells, we found that OSM or IL-31 treatment promoted mesenchymal characteristics of breast cancer cells, as evidenced by increased mRNA expression of vimentin and reduced expression of the epithelial marker E-cadherin (Figure 6F). Our qPCR also showed that OSM or IL-31 treatment upregulated the expression of CD44 and reduced the levels of CD24, which are characteristics of tumor-initiating breast cancer cells (Figure 6F). Together, our results support the notion that the signaling of OSM and IL-31 through OSMR and IL-31RA is important for STAT3 expression and activation, which could contribute to proliferation, clonogenic capacity, EMT, and tumor-initiating capacity. The Oncostatin Gene Module Associates with Breast Cancer Progression To determine whether the OSM gene module is important for the pathobiology of breast cancer, we determined the expression of OSMR, OSM, IL-31, IL-6ST, and STAT3 in normal breast tissues collected from reduction mammoplasty and in breast tumor tissues in a published breast cancer dataset (Quigley et al., 2017). Strikingly, our analysis show that STAT3, IL-31, and IL-6ST transcripts are highly and significantly expressed in breast tumor tissues compared with normal tissues (Figures 6G–6I), and the increase in OSM in tumor samples approached significance

Figure 5. miR551b-3p Requires STAT3 for the Regulation of the OSM-Gene Module (A) MDA-MB-231 cells were transfected with con. miRNA or miR551b-3p 24 h after transfection of two different STAT3 siRNAs. RNA was isolated 48 h after transfection, and qPCR was performed to quantitate the expression of indicated mRNAs. mRNA expression was normalized to b-actin. Bars represent SE of triplicates. p value was determined by Student’s t test. (B) Immunoblot was performed using the lysates prepared from (A). (C) qPCR was performed to quantitate the mRNA expression of OSM and IL-31 from cells co-transfected with that siSTAT3 and miR551b as indicated in (A). Error bars represent means ± SE from three different experiments performed in quadruplicates. (D and E) ChIP-qPCR analysis of the enrichment of STAT3 at the indicated promoter genes in MDA-MB-231 cells were transfected with con. miRNA and miR551b-3p in (D) or treated with OSM (20 ng/mL) and IL-31 (20 ng/mL) in (E). The qPCR data are presented as fold enrichment compared to IgG control. Bars represent mean ± SE. Statistical analysis was done by Student’s t test.

Cell Reports 29, 4389–4406, December 24, 2019 4399

A

B

D

C

F

E

G

H

I

J

K

L

M

N

(legend on next page)

4400 Cell Reports 29, 4389–4406, December 24, 2019

(Figure 6J). We also determined the expression of OSM and IL31 transcripts in a published mRNA dataset of ductal carcinoma in situ (DCIS) and invasive breast carcinoma (IBC) (Aure et al., 2017; Lesurf et al., 2016). As expected, OSM and IL-31 were more highly expressed in IBC samples than in DCIS (Figures 6K and 6L). Furthermore, our analysis of TCGA dataset using the UALCAN portal showed that OSM is highly expressed in the TNBC subtype compared to other molecular subtypes of breast cancer (Chandrashekar et al., 2017; Figure 6M), and OSM is highly expressed in primary breast tumor tissues compared to the normal tissue (Figure S6D). Importantly, our outcome analysis based on the expression of OSM, using the Kaplan Meier (KM) plotter survival analysis portal (Gyo¨rffy et al., 2010), demonstrated that high levels of OSM in the ERnegative patient cohort is associated with poor outcomes (Figure 6N). In contrast, OSMR expression did not vary markedly among the molecular subtypes of breast cancer (data not shown), whereas IL-31RA is highly expressed in the primary breast tumor tissues compared to the normal breast tissues and IL-31RA is highly expressed in TNBC subtype compared to other molecular subtypes (Figures S6E and S6F). Silencing miR551b-3p Inhibits Tumor Growth in an Orthotopic Breast Cancer Model We next used an orthotopic mouse model of breast cancer to explore the therapeutic potential of targeting miR551b-3p to inhibit breast cancer growth. After encapsulating antimiR551b-3p or control anti-miRNA into neutral nanoliposomes 1,2-dioleoyl-sn-glycero-3-phosphotidylcholine(DOPC), we injected them intraperitoneally into athymic female nude mice bearing MDMB231 breast cancer cells orthotopically (Figure 7A). Importantly, this treatment reduced tumor growth, total tumor weight, and tumor volume (Figures 7B–7D). As expected, antimiR551b-3p also reduced the expression of miR551b-3p (Figure 7E) and key effectors, including STAT3, OSMR, and IL-6ST (Figures 7F and 7G). In conjunction, the treatment with antimiR551b-3p reduced the expression of cellular proliferation marker Ki67 and upregulated the levels of apoptotic marker cleaved caspase-3 in vivo (Figure 7H). We also noticed that

anti-miR551b-3p decreased the levels of vimentin and N-cadherin and increased the levels of E-cadherin in tumor tissues and reduced secreted levels of OSM and IL-31 (Figures 7G and 7I). It is noteworthy that the delivery of anti-miR551b-3p encapsulated in neutral nanoliposome did not make any unfavorable toxic effects in mice, as indicated by significant changes in the levels of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT), loss in body weight, or toxicity-induced damages in kidney, liver, lung, heart, brain, and spleen (Figures S7A–S7D). To further determine the effects of anti-miR551b-3p that we observed due to the specific inhibition of miR551b, but not through other non-specific targets, we prepared MDA-MB-231 cells stably knockdown of miR551b using small hairpin loop-expressing anti-miRNA sequences or scrambled sequences, and selected clone no. 3 (in which miR551b expression is reduced more than 90% compared to the control for further studies; Figures S8A and S8B) and also reduced the sphere-forming capacity of MDA-MB-231 cells ~90% consistently in the serial dilutions (Figure S8C) along with loss of characteristics of cancer stem cell markers evidenced by the loss of expression of CD44 and c-KIT and gain in the levels of CD24 (Figure S8D). Next, we determined whether the effects of anti-miR551b-3p that we observed through the loss of miR551b-3p, using the MDA-MB-231-control-short hairpin RNA (shRNA) cells or MDA-MB-231-shmiR551b-3p cells in 3D culture model and in vivo model. In our 3D culture assay, we found that the stable knockdown of miR551b-3p in MDA-MB-231 cells reduced the size and number of 3D colonies in Matrigel significantly. We also found that the transfections of anti-miR551b-3p reduced the cell viability, spheroid size, and number of 3D colonies of MDA-MB-231-shcontrol-miR cells. In contrast, transfections of anti-miR551b-3p in MDA-MB-231-sh-miR551b cells did not have any effect on the cell viability, spheroid size, and number of 3D colonies and miR551b-3p expression in miR551b-3p stable knockdown cells (Figures S8E–S8G). Next, we employed the orthotopic breast cancer model, in which we injected the MDA-MB-231 control cells or MDA-MB231-sh-miR551b (miR551b stable knockdown) cells in the

Figure 6. miR551b Effectors Associate with the Progression of Breast Cancer (A) MDA-MB-231 cells were stimulated with OSM (20 ng/mL), IL-31 (20 ng/mL), or both at 10 ng/mL of each, and the cell viability was assessed at indicated time points using MTT assay. Error bars represent SE of quadruplicates. *p < 0.05. (B) Colony-forming ability of MDA-MB-231 cells treated with OSM or IL-31 or their combination as in (A) was assessed on 14th day after treatment. Colonies were stained using crystal violet and photographed. Bar graph shows the optical density (OD) of crystal violet eluted from the colonies measured at 560 nm. (C) MDA-MB-231 cells were treated as in (A), and the wound healing capacity was monitored at indicated time points. Red line indicates the empty space between healing cells. Scale bars represent 500 mm. (D) MDA-MB-231 cells were treated as in (A), and the invaded or migrated cells through Matrigel-coated or non-coated trans-well inserts were monitored and photographed. Scale bars represent 500 mm. Bar graph shows the OD of the crystal violet eluted measured at 560 nm. (E) MDA-MB-231 cells were treated with OSM and IL-31. Lysates were prepared at indicated time points, and immunoblot was performed using indicated antibodies. (F) Total RNA was isolated 48 h after the treatment of chemokines as in (E), and qPCR was performed to quantitate the expression of indicated genes. mRNA expression was normalized to b-actin. Bars represent mean ± SE. Statistical analysis was done by Student’s t test. (G–J) Indicated gene transcripts were quantitated in the primary tumors versus normal breast tissues collected from mammoplasty reduction surgery. p values were determined by Wilcoxon test. (K and L) Indicated gene transcripts were quantitated in the ductal carcinoma in situ (DCIS), and invasive breast cancers (IBCs). p values were determined by Student’s t test. Due to low sample numbers in the normal group, we excluded normal group from our analysis. (M) OSM expression in different molecular subtypes of breast cancer in the TCGA dataset plotted using UALCAN portal (Chandrashekar et al., 2017). (N) Kaplan-Meier analysis of ER-negative breast cancer patients whose samples were stratified as high versus low based on median expression of OSM (226621_at) using KM survival analysis plotter (Gyo¨rffy et al., 2010).

Cell Reports 29, 4389–4406, December 24, 2019 4401

B

7 days

1

2

3

4 5 Weeks

6

7

Animals sacrificed when moribund/terminal Female Athymic Con. antimiR anti-miR551b nude mice (n=7/group)

*p<0.05

0.2

*

0.1 0

*

*

*

*

14 18 21 25 28 32 35 39 42 46 Days

H

1.2 0.8 0.4

p-STAT3 (S727) p-STAT3 (Y705)

p<0.05

0

iR 1b tim 55 an -miR i t an

anti-miR551b

OSMR

IL6ST

p=0.007

p=0.01

0.4 STAT3

IL31RA

Cleaved Caspase3 Con. antimiR anti-miR551b

anti-miR551b

OSMRß

0.1

0.8

0

Ki-67

p<0.005

STAT3 IL31RA

0.2

1.2

0

H&E

0.3

Con. antimiR 1.6

Positive Cells (%)

anti-miR551b

Con. antimiR

F

p<0.01

1.6

0.4

C

Con. antimiR anti-miR551b

p<0.01

0.5

. on

Con. antimiR

Tumor volume (cm3)

G

E

Con. antimiR anti-miR551b

0.3

Rel. miR551b expression (Fold change)

D

Tumor weight (mg)

Anti-miRs DOPC (twice in a week)

C

Rel. mRNA expression (Fold change)

MDA-MB-231 cells

anti-miR551b Con. antimiR

A

p<0.001

100

p=0.002

75 50 25 0

Cl. Caspase3

Ki-67

IL6-ST Vimentin

Autocrine signaling

J

E-Cadherin

rward eed -Fo OSM F naling Sig

N-Cadherin

IL 31

IL3

OSM

I

200 40 20 0

n.

Co

b

R mi

a

nti

iR

ti-m

an

600

OSM Rß IL31 RA

E Cadherin N Cadherin Vimentin

200

R

mi

n.

Co

b

miR551b

51

R5 mi

3’

ti-

an

3’ 3’ 3’

IL3

1

IL3

1

CYTOPLASM OSMRß, IL31RA, IL6ST OSM, IL31

P

ti an

OSM

Secretory Factors

P

0

M

OSM

T3 STA T3 STA

400

1 55

OS

1

P STAT3

p<0.0001

800

1

1

IL6ST Rß OSM

1000

p<0.0001

400

IL31 (pg/mL)

OSM (pg/mL)

600

IL3

IL3

OSM

ß-Actin

OSM

Feed Signa -Forward ling

5’ 3’

EMT

NUCLEUS CD44 CD24 C-Kit Cancer Stemness

miR551b-3p

(legend on next page)

4402 Cell Reports 29, 4389–4406, December 24, 2019

mammary fat pad of nude mice. After a week, mice were injected with control anti-miRNA or anti-miR-551b-3p encapsulated in nanoliposome twice in a week for 7 weeks (intraperitoneally [i.p.]) in the mice bearing control MDA-MB-231 tumors or MDA-MB-231sh-miR551b-3p tumors. In conjunction with our results in 3D culture model, we found that the loss of miR551b3p using shRNA vector reduced the tumor growth more than 70% and reduced the tumor volume on 5th week onward until the termination of the study ~80% as compared to the group of mice bearing MDA-MB-231-control-shRNA cells. Importantly, we noticed that the delivery of anti-miR551b-3p in the group of mice bearing MDA-MB-231-control-shRNA reduced the tumor growth ~60% and reduced tumor volume on 5th week onward until the termination of the study ~70%, which is comparable to the genetic loss of miR551b-3p using shRNA vectors. In contrast, we did not find any effect on tumor growth or tumor volume by the delivery of anti-miR551b-3p encapsulated nanoliposomes in the mice bearing MDA-MB-231-sh-miR551b tumors (Figures S9A–S9D). Although the treatment with anti-miR551b3p reduced the expression of cellular proliferation marker Ki67 and upregulated the levels of cleaved caspase-3 in the mice bearing MDA-MB-231 sh-control tumors, anti-miR551b-3p did not make any significant change in the levels of Ki67 and cleaved caspase-3 in the group of mice bearing MDA-MB-231shmiR551b-3p tumors (Figure S9E). Taken together, our results demonstrate that the anti-tumor effect of anti-miR551b is not mediated through any other targets other than specific inhibition of miR551b. DISCUSSION Studies have shown that different cancer cells rely on unique growth and survival requirements that are acquired through distinct subsets of genomic alterations. Although the roles of protein-coding genes in cellular signaling and autocrine loops are well established, the roles of non-coding RNAs and miRNAs as fine-tuners of cellular signaling are less well understood. Our data demonstrate that miR551b-3p located in 3q26.2 locus provides growth and proliferative advantages to cancer cells. In contrast to the proliferative phenotypes, malignant tumors express high levels of mesenchymal genes, which increase the

ability of tumor cells to invade and metastasize. In addition to the proliferative effects, miR551b-3p, its effector OSM gene module, and STAT3 transcription factor induce several molecular switches that could contribute to the migration and invasion of breast cancer cells. We found that mature miR551b-3p translocates from the cytoplasm to nucleus with the aid of IPO8 to interact with STAT3 promoter. This interaction of miR-551b-3p with STAT3 promoter is important for the recruitment of RNA Pol II and TWIST1 transcription factor to the transcription initiation site (Figure 4K). Our data suggest that the tumor cells express both high levels of IPO8 and miR-551b-3p expresses high levels of STAT3; thus, RNA activation mechanism is an important tool in tumor cells for persistent activation of STAT3 signaling. STAT3 is considered to be a master transcription factor with roles in many physiological processes, such as inflammatory signaling, aerobic glycolysis, and immune suppression (Masciocchi et al., 2011). Constitutive activation of STAT3 has been reported in various cancers (Rosen et al., 2006); thus, STAT3 could be exploited as a target for cancer therapy in the patients whose tumors express high levels of miR551b-3p. However, the upregulated levels of STAT3-like master transcription factors often leads drug resistance to therapeutic regimens, which adversely affects patient’s outcome (Carmo et al., 2011). Recent developments in the small molecule inhibitors yielded new generation STAT3 inhibitors, like PG-S3001, which is derived from the SH-4-54 class of STAT3 inhibitors, as well as inhibitors like SF-1-066, BP-1-102, and BP-5-087, which demonstrated superior pharmacokinetic properties for cancer therapy and treatment without severe toxicity and offtarget effects (Arpin et al., 2016; Ball et al., 2016). However, the therapeutic efficacies of these compounds are yet to be characterized for breast cancer treatment. We found that STAT3 activates the oncogenic signaling through OSM gene module, which consists of the ligands OSM and IL-31 as well as their receptors OSMR and IL-31RA, which enhances the robustness of STAT3 signaling in TNBC cells (Figure 7J). We have previously shown that the growth factors epidermal growth factor (EGF) and neuregulin-1 (NRG-1) promote the transition of DCIS-like structures to invasive structures in 3D culture of MCF10A cells (Pradeep et al., 2012a, 2012b). Overexpression of growth factor family genes or their mutations

Figure 7. Therapeutic Targeting of miR551b-3p Reduces Breast Cancer Cell Growth In Vivo (A) Schema of the experimental design and treatment schedule for in vivo study. MDA-MB-231 cells (2 3 106 cells/animal) were injected into the mammary fat pad of female athymic nude mice (age: 4–6 weeks; n = 7/group). Mice were treated with con. anti-miRNA or anti-miR551b-3p incorporated in DOPC nanoliposomes twice weekly until any of the mice became moribund. (B) Tumors were isolated at the end of the experiments from (A) and representative tumor tissues were photographed. (C) Tumor weight from (A) were quantitated. pValue was determined by Student’s t test (D) Tumor volume calculated twice in a week up to the end of the experiments (6.5 weeks). Bars represent SE of seven mice per group. *p < 0.05 determined by Student’s t test compared between respective time point. (E) Total RNA was extracted from tumor samples (n = 3) from each group, and qPCR was performed to quantitate the expression of miR551b-3p . miR551b-3p expression was normalized to U6 RNA. (F) Total RNA was extracted from tumor samples (n = 3) from each group, and qPCR was performed to quantitate the expression of the genes indicated. The mRNAs expression was normalized to b-actin. (G) Representative tumor tissues from four different mice were isolated, lysed, and immunoblotted. (H) Representative H&E and immunohistochemistry analysis using tumor tissues from (A) were performed. Scale bars represent 150 mm. Bar graph represents the percentage of Ki67 and cleaved caspase-3 in the indicated groups. Error bar indicates the SE from mean value calculated from five random fields. (I) Serum samples collected from the blood from each group at the end of experiment, and ELISA was performed to determine the levels of OSM and IL-31. Bars represent SE, and p values were determined by Student’s t test. (J) Model depicts how miR551b-3p-STAT3 axis activates the feedforward signaling through IL-31 or OSM for tumor growth, cancer stemness, and EMT.

Cell Reports 29, 4389–4406, December 24, 2019 4403

are important mechanisms for aberrant activation of growth factor signaling that enhance the robustness of oncogenic signaling (Amit et al., 2007b). Experimental and clinical data indicate that DCIS can progress to invasive disease; however, the mechanism of DCIS progression to invasive cancer is not well understood. Our in vitro and clinical data support the notion that miR551b3p-mediated upregulation of OSM and IL-31 not only promotes the proliferation of tumor cells, but also facilitates their transition to cells with mesenchymal characterestics for invasion and metastasis. Although it is possible to classify cancers based on their gene expression patterns into different subsets, a major challenge lies in identifying druggable pathways or gene modules in those subtypes. In this regard, we propose that targeting OSM gene module will be an effective approach to treat a subset of patients, whose tumors express miR551b-3p, STAT3, or both. The OSM signaling module that we identified as the downstream effect of miR551b-3p is composed of ligands (OSM and IL-31) and their receptors (OSMR and IL-31RA), and the STAT3 transcription factors are regulated through an autocrine mechanism (Figure 7J). Emerging evidences suggest that OSM is a pivotal component in the tumor microenvironment (TME) to promote EMT and epithelial-mesenchymal plasticity (E-M plasticity) and the acquisition of CSC properties (Smigiel et al., 2018). This study has shown that the generation of cells with mesenchymal and cancer stem cell properties was unique to OSM as implicated by robust activation of two key oncogenic effector proteins STAT3 and ZEB1, which was not observed following IL-6 exposure in cancer cells. Compatible with the above findings, our results demonstrate that OSM induces the activation of STAT3 transcription factor for prolonged period, which again suggests that OSM and its receptors are critical for persistent oncogenic signaling for EMT, EM plasticity, and the acquisition of CSC properties. Signaling modules are often conceptualized as linear events; however, the key regulators in each module are interconnected with other modules to form complex functional networks, which are critical for oncogenic events, including cell growth, proliferation, migration, and metastasis (Chang et al., 2009; Kholodenko et al., 2010). A critical challenge remaining in cancer biology is to identify the key regulator in signaling modules, which are critical for tumor growth and metastasis. We are employing RNAi approaches to target and inhibit the components of miR551b-3p or OSM gene module to inhibit the progression of breast cancer. Many nanoliposome encapsulated RNAi strategies have entered in the clinic trials for a number of cancers (Tatiparti et al., 2017), suggesting that targeting miR551b-3p with anti-miRNAs warrants further exploration as a novel therapy to inhibit STAT3 and OSM signaling module in breast cancer. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Mice

4404 Cell Reports 29, 4389–4406, December 24, 2019

d

d

d

B Cell Lines METHOD DETAILS B miRNA Transfections B siRNA Transfection B Generation of miR551b-3p Knockdown using shRNA B Generation of miR551b-3p Knockout Cells using CRISPR/Cas9 Vectors B Cell Proliferation and Cell Viability Assay B Colony Formation Assay B Wound Healing Assay B Migration and Invasion Assay B 3-Dimensional (3-D) Culture of Tumor Cells and Limiting Dilution Assay B Flow Cytometry B Reverse-Phase Protein Arrays (RPPA) B Western Blot and Immunoprecipitation B Northern Blotting B ELISA B RNA Extraction B mRNA qRT-PCR B miRNA qRT-PCR B Luciferase Reporter Assay B Immunostaining B RNA Fluorescence In Situ Hybridization (RNA-FISH) B RNA Immunoprecipitation Assay B Chromatin Immunoprecipitation Assay B Liposomal Preparation B Immunohistochemistry Analysis QUANTIFICATION AND STATISTICAL ANALYSIS B Statistical Analysis of In Vitro and In Vivo Studies B Western Blot Analysis B Image Analysis B Clinical Data Analysis DATA AND CODE AVAILABILITY B Data Availability Statement

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. celrep.2019.11.085. ACKNOWLEDGMENTS P.C.-R. is supported by 1R01CA229907, United States; the Ovarian Cancer Research Fund Alliance (OCRFA), United States; the DoD Breast Cancer Research Program (W81XWH-18-1-0024), United States; the Women’s Health Research Program (WHRP) at MCW, the American Cancer Society’s Institutional Research Grant (ACS-16-183-31), United States; and research funds from MCW’s Cancer Center. S.P. is supported by OCRFA, United States; and WHRP funds at MCW. R.R. is supported by 1R01HL112639, 1R01HL120585, and 1R01HL123338, United States. M.Y. is supported by N01CN2015000037, United States; and R01CA134682, United States. G.B.M. is supported by the NCI (2P50CA083639-11, 5P50CA058183-17, and R01CA123219-01), United States, the Stand Up to Cancer/AACR fund (SU2C-AACR-DT0209), United States; the Adelson Medical Research Foundation, United States; and a Komen Promise Grant (KG081694), United States. A.K.S. is supported by the NCI (P50 CA217685, P50 CA098258, R35 CA209904, and UH3 TR000943), United States; the American Cancer Society Research Professor Award, United States; and the Frank McGraw Memorial Chair in Cancer Research, United States. M.R.A. is supported by grant number 2014021, Norway; and A.T. by grant

number 2016065 from the South Eastern Norway Health Authority, Norway. The authors acknowledge Dr. Suresh Kumar for his assistance on confocal microscopy. AUTHOR CONTRIBUTIONS P.C.-R. conceived the study, generated hypotheses, and designed the experiments. D.P. and A.G. performed most of the experiments, including cell cultures, animal experiments, qPCR, 3D morphogenesis, and statistical analyses, and they prepared figures and the manuscript. J.G., B.N., and C.C. prepared stable cells. Y.L. performed RPPA analysis, which G.B.M. supervised. M.R.A. and A.T. performed the bioinformatics analysis, which V.N.K. supervised. M.K.M. and M.L. assisted on the preparation of gene knockout cells. S.P. and P.C.-R. designed the animal experiments. J.M. assisted on confocal microscopy imaging. C.R.-A., L.S.M., G.L.-B., and A.K.S. encapsulated the anti-miRNAs in nanoliposomes for animal studies. M.Y., J.S.R., R.R., and G.B.M. provided scientific feedback and edited the manuscript. P.C.-R. provided scientific direction, established collaborations, prepared the manuscript with D.P. and A.G., and allocated funding for the work. DECLARATION OF INTERESTS The authors declare no competing interests. Received: July 1, 2018 Revised: June 16, 2019 Accepted: November 20, 2019 Published: December 24, 2019 REFERENCES

Calin, G.A. (2009). MicroRNAs and cancer: what we know and what we still have to learn. Genome Med. 1, 78. The Cancer Genome Atlas Network (2012). Comprehensive molecular portraits of human breast tumours. Nature 490, 61–70. Carmo, C.R., Lyons-Lewis, J., Seckl, M.J., and Costa-Pereira, A.P. (2011). A novel requirement for Janus kinases as mediators of drug resistance induced by fibroblast growth factor-2 in human cancer cells. PLoS ONE 6, e19861. Chaluvally-Raghavan, P., Zhang, F., Pradeep, S., Hamilton, M.P., Zhao, X., Rupaimoole, R., Moss, T., Lu, Y., Yu, S., Pecot, C.V., et al. (2014). Copy number gain of hsa-miR-569 at 3q26.2 leads to loss of TP53INP1 and aggressiveness of epithelial cancers. Cancer Cell 26, 863–879. Chaluvally-Raghavan, P., Jeong, K.J., Pradeep, S., Silva, A.M., Yu, S., Liu, W., Moss, T., Rodriguez-Aguayo, C., Zhang, D., Ram, P., et al. (2016). Direct upregulation of STAT3 by microRNA-551b-3p deregulates growth and metastasis of ovarian cancer. Cell Rep. 15, 1493–1504. Chandrashekar, D.S., Bashel, B., Balasubramanya, S.A.H., Creighton, C.J., Ponce-Rodriguez, I., Chakravarthi, B.V.S.K., and Varambally, S. (2017). UALCAN: a portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia 19, 649–658. Chang, J.T., Carvalho, C., Mori, S., Bild, A.H., Gatza, M.L., Wang, Q., Lucas, J.E., Potti, A., Febbo, P.G., West, M., and Nevins, J.R. (2009). A genomic strategy to elucidate modules of oncogenic pathway signaling networks. Mol. Cell 34, 104–114. Chavez, K.J., Garimella, S.V., and Lipkowitz, S. (2010). Triple negative breast cancer cell lines: one tool in the search for better treatment of triple negative breast cancer. Breast Dis. 32, 35–48. Curtis, C., Shah, S.P., Chin, S.F., Turashvili, G., Rueda, O.M., Dunning, M.J., Lynch, A.G., Samarajiwa, S., Yuan, Y., Gra¨f, S., et al. (2012). The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346–352.

Agarwal, S., Parashar, D., Gupta, N., Jagadish, N., Thakar, A., Suri, V., Kumar, R., Gupta, A., Ansari, A.S., Lohiya, N.K., and Suri, A. (2014). Sperm associated antigen 9 (SPAG9) expression and humoral response in benign and malignant salivary gland tumors. OncoImmunology 3, e974382.

Enerly, E., Steinfeld, I., Kleivi, K., Leivonen, S.K., Aure, M.R., Russnes, H.G., Rønneberg, J.A., Johnsen, H., Navon, R., Rødland, E., et al. (2011). miRNAmRNA integrated analysis reveals roles for miRNAs in primary breast tumors. PLoS ONE 6, e16915.

Amit, I., Citri, A., Shay, T., Lu, Y., Katz, M., Zhang, F., Tarcic, G., Siwak, D., Lahad, J., Jacob-Hirsch, J., et al. (2007a). A module of negative feedback regulators defines growth factor signaling. Nat. Genet. 39, 503–512.

Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). GW182 interaction with Argonaute is essential for miRNA-mediated translational repression and mRNA decay. Nat. Struct. Mol. Biol. 15, 346–353.

Amit, I., Wides, R., and Yarden, Y. (2007b). Evolvable signaling networks of receptor tyrosine kinases: relevance of robustness to malignancy and to cancer therapy. Mol. Syst. Biol. 3, 151.

George, J., Nihal, M., Singh, C.K., Zhong, W., Liu, X., and Ahmad, N. (2016). Pro-proliferative function of mitochondrial sirtuin deacetylase SIRT3 in human melanoma. J. Invest. Dermatol. 136, 809–818.

Anjali, G., Kaur, S., Lakra, R., Taneja, J., Kalsey, G.S., Nagendra, A., Shrivastav, T.G., Devi, M.G., Malhotra, N., Kriplani, A., and Singh, R. (2015). FSH stimulates IRS-2 expression in human granulosa cells through cAMP/SP1, an inoperative FSH action in PCOS patients. Cell. Signal. 27, 2452–2466.

Godoy-Tundidor, S., Cavarretta, I.T., Fuchs, D., Fiechtl, M., Steiner, H., Friedbichler, K., Bartsch, G., Hobisch, A., and Culig, Z. (2005). Interleukin-6 and oncostatin M stimulation of proliferation of prostate cancer 22Rv1 cells through the signaling pathways of p38 mitogen-activated protein kinase and phosphatidylinositol 3-kinase. Prostate 64, 209–216.

Arpin, C.C., Mac, S., Jiang, Y., Cheng, H., Grimard, M., Page, B.D., Kamocka, M.M., Haftchenary, S., Su, H., Ball, D.P., et al. (2016). Applying small molecule signal transducer and activator of transcription-3 (STAT3) protein inhibitors as pancreatic cancer therapeutics. Mol. Cancer Ther. 15, 794–805. Aure, M.R., Leivonen, S.K., Fleischer, T., Zhu, Q., Overgaard, J., Alsner, J., Tramm, T., Louhimo, R., Alnæs, G.I., Pera¨la¨, M., et al. (2013). Individual and combined effects of DNA methylation and copy number alterations on miRNA expression in breast tumors. Genome Biol. 14, R126. Aure, M.R., Vitelli, V., Jernstro¨m, S., Kumar, S., Krohn, M., Due, E.U., Haukaas, €ders, T., et al.; OSBREAC (2017). IntegraT.H., Leivonen, S.K., Vollan, H.K., Lu tive clustering reveals a novel split in the luminal A subtype of breast cancer with impact on outcome. Breast Cancer Res. 19, 44. Ball, D.P., Lewis, A.M., Williams, D., Resetca, D., Wilson, D.J., and Gunning, P.T. (2016). Signal transducer and activator of transcription 3 (STAT3) inhibitor, S3I-201, acts as a potent and non-selective alkylating agent. Oncotarget 7, 20669–20679. Bilsborough, J., Mudri, S., Chadwick, E., Harder, B., and Dillon, S.R. (2010). IL31 receptor (IL-31RA) knockout mice exhibit elevated responsiveness to oncostatin M. J. Immunol. 185, 6023–6030.

Gyo¨rffy, B., Lanczky, A., Eklund, A.C., Denkert, C., Budczies, J., Li, Q., and Szallasi, Z. (2010). An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients. Breast Cancer Res. Treat. 123, 725–731. Hennessy, B.T., Lu, Y., Gonzalez-Angulo, A.M., Carey, M.S., Myhre, S., Ju, Z., Davies, M.A., Liu, W., Coombes, K., Meric-Bernstam, F., et al. (2010). A technical assessment of the utility of reverse phase protein arrays for the study of the functional proteome in non-microdissected human breast cancers. Clin. Proteomics 6, 129–151. Huang, V., Qin, Y., Wang, J., Wang, X., Place, R.F., Lin, G., Lue, T.F., and Li, L.C. (2010). RNAa is conserved in mammalian cells. PLoS ONE 5, e8848. Huang, V., Place, R.F., Portnoy, V., Wang, J., Qi, Z., Jia, Z., Yu, A., Shuman, M., Yu, J., and Li, L.C. (2012). Upregulation of cyclin B1 by miRNA and its implications in cancer. Nucleic Acids Res. 40, 1695–1707. Jagadish, N., Parashar, D., Gupta, N., Agarwal, S., Purohit, S., Kumar, V., Sharma, A., Fatima, R., Topno, A.P., Shaha, C., and Suri, A. (2015). A-kinase anchor protein 4 (AKAP4) a promising therapeutic target of colorectal cancer. J. Exp. Clin. Cancer Res. 34, 142.

Cell Reports 29, 4389–4406, December 24, 2019 4405

Janowski, B.A., Younger, S.T., Hardy, D.B., Ram, R., Huffman, K.E., and Corey, D.R. (2007). Activating gene expression in mammalian cells with promoter-targeted duplex RNAs. Nat. Chem. Biol. 3, 166–173.

Parker, J.S., Mullins, M., Cheang, M.C., Leung, S., Voduc, D., Vickery, T., Davies, S., Fauron, C., He, X., Hu, Z., et al. (2009). Supervised risk predictor of breast cancer based on intrinsic subtypes. J. Clin. Oncol. 27, 1160–1167.

Kholodenko, B.N., Hancock, J.F., and Kolch, W. (2010). Signalling ballet in space and time. Nat. Rev. Mol. Cell Biol. 11, 414–426.

Place, R.F., Li, L.C., Pookot, D., Noonan, E.J., and Dahiya, R. (2008). MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc. Natl. Acad. Sci. USA 105, 1608–1613.

Kucia-Tran, J.A., Tulkki, V., Scarpini, C.G., Smith, S., Wallberg, M., PaezRibes, M., Araujo, A.M., Botthoff, J., Feeney, M., Hughes, K., et al. (2018). Anti-oncostatin M antibody inhibits the pro-malignant effects of oncostatin M receptor overexpression in squamous cell carcinoma. J. Pathol. 244, 283–295. Landen, C.N., Kinch, M.S., and Sood, A.K. (2005). EphA2 as a target for ovarian cancer therapy. Expert Opin. Ther. Targets 9, 1179–1187. Lesurf, R., Aure, M.R., Mørk, H.H., Vitelli, V., Lundgren, S., Børresen-Dale, A.L., Kristensen, V., Wa¨rnberg, F., Hallett, M., and Sørlie, T.; Oslo Breast Cancer Research Consortium (OSBREAC) (2016). Molecular features of subtype-specific progression from ductal carcinoma in situ to invasive breast cancer. Cell Rep. 16, 1166–1179. Li, Y.E., Xiao, M., Shi, B., Yang, Y.T., Wang, D., Wang, F., Marcia, M., and Lu, Z.J. (2017). Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites. Genome Biol. 18, 169. Mani, S.A., Guo, W., Liao, M.J., Eaton, E.N., Ayyanan, A., Zhou, A.Y., Brooks, M., Reinhard, F., Zhang, C.C., Shipitsin, M., et al. (2008). The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133, 704–715. Masciocchi, D., Gelain, A., Villa, S., Meneghetti, F., and Barlocco, D. (2011). Signal transducer and activator of transcription 3 (STAT3): a promising target for anticancer therapy. Future Med. Chem. 3, 567–597. Matsui, M., Chu, Y., Zhang, H., Gagnon, K.T., Shaikh, S., Kuchimanchi, S., Manoharan, M., Corey, D.R., and Janowski, B.A. (2013). Promoter RNA links transcriptional regulation of inflammatory pathway genes. Nucleic Acids Res. 41, 10086–10109. McCarroll, J.A., Phillips, P.A., Kumar, R.K., Park, S., Pirola, R.C., Wilson, J.S., and Apte, M.V. (2004). Pancreatic stellate cell migration: role of the phosphatidylinositol 3-kinase(PI3-kinase) pathway. Biochem. Pharmacol. 67, 1215– 1225. Myhre, S., Lingjærde, O.C., Hennessy, B.T., Aure, M.R., Carey, M.S., Alsner, J., Tramm, T., Overgaard, J., Mills, G.B., Børresen-Dale, A.L., and Sørlie, T. (2013). Influence of DNA copy number and mRNA levels on the expression of breast cancer related proteins. Mol. Oncol. 7, 704–718. Nanjundan, M., Nakayama, Y., Cheng, K.W., Lahad, J., Liu, J., Lu, K., Kuo, W.L., Smith-McCune, K., Fishman, D., Gray, J.W., and Mills, G.B. (2007). Amplification of MDS1/EVI1 and EVI1, located in the 3q26.2 amplicon, is associated with favorable patient prognosis in ovarian cancer. Cancer Res. 67, 3074–3084. Naume, B., Zhao, X., Synnestvedt, M., Borgen, E., Russnes, H.G., Lingjaerde, O.C., Strømberg, M., Wiedswang, G., Kvalheim, G., Ka˚resen, R., et al. (2007). Presence of bone marrow micrometastasis is associated with different recurrence risk within molecular subtypes of breast cancer. Mol. Oncol. 1, 160–171. Nielsen, H.M., Overgaard, M., Grau, C., Jensen, A.R., and Overgaard, J.; Danish Breast Cancer Cooperative Group (2006). Study of failure pattern among high-risk breast cancer patients with or without postmastectomy radiotherapy in addition to adjuvant systemic therapy: long-term results from the Danish Breast Cancer Cooperative Group DBCG 82 b and c randomized studies. J. Clin. Oncol. 24, 2268–2275.

Pradeep, C.R., Ko¨stler, W.J., Lauriola, M., Granit, R.Z., Zhang, F., JacobHirsch, J., Rechavi, G., Nair, H.B., Hennessy, B.T., Gonzalez-Angulo, A.M., et al. (2012a). Modeling ductal carcinoma in situ: a HER2-Notch3 collaboration enables luminal filling. Oncogene 31, 907–917. Pradeep, C.R., Zeisel, A., Ko¨stler, W.J., Lauriola, M., Jacob-Hirsch, J., HaibeKains, B., Amariglio, N., Ben-Chetrit, N., Emde, A., Solomonov, I., et al. (2012b). Modeling invasive breast cancer: growth factors propel progression of HER2-positive premalignant lesions. Oncogene 31, 3569–3583. Pradeep, S., Kim, S.W., Wu, S.Y., Nishimura, M., Chaluvally-Raghavan, P., Miyake, T., Pecot, C.V., Kim, S.J., Choi, H.J., Bischoff, F.Z., et al. (2014). Hematogenous metastasis of ovarian cancer: rethinking mode of spread. Cancer Cell 26, 77–91. Pullar, C.E., Chen, J., and Isseroff, R.R. (2003). PP2A activation by beta2adrenergic receptor agonists: novel regulatory mechanism of keratinocyte migration. J. Biol. Chem. 278, 22555–22562. €ders, T., Riis, M.H., Balmain, A., Børresen-Dale, Quigley, D.A., Tahiri, A., Lu A.L., Bukholm, I., and Kristensen, V. (2017). Age, estrogen, and immune response in breast adenocarcinoma and adjacent normal tissue. OncoImmunology 6, e1356142. Ramchandran, R., and Chaluvally-Raghavan, P. (2017). miRNA-mediated RNA activation in mammalian cells. Adv. Exp. Med. Biol. 983, 81–89. Rosen, D.G., Mercado-Uribe, I., Yang, G., Bast, R.C., Jr., Amin, H.M., Lai, R., and Liu, J. (2006). The role of constitutively active signal transducer and activator of transcription 3 in ovarian tumorigenesis and prognosis. Cancer 107, 2730–2740. Smigiel, J., Parvani, J.G., Tamagno, I., Polak, K., and Jackson, M.W. (2018). Breaking the oncostatin M feed-forward loop to suppress metastasis and therapy failure. J. Pathol. 245, 6–8. Soule, H.D., Maloney, T.M., Wolman, S.R., Peterson, W.D., Jr., Brenz, R., McGrath, C.M., Russo, J., Pauley, R.J., Jones, R.F., and Brooks, S.C. (1990). Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res. 50, 6075–6086. Tatiparti, K., Sau, S., Kashaw, S.K., and Iyer, A.K. (2017). siRNA delivery strategies: a comprehensive review of recent developments. Nanomaterials (Basel) 7, E77. Wang, D., Sun, X., Wei, Y., Liang, H., Yuan, M., Jin, F., Chen, X., Liu, Y., Zhang, C.Y., Li, L., and Zen, K. (2018). Nuclear miR-122 directly regulates the biogenesis of cell survival oncomiR miR-21 at the posttranscriptional level. Nucleic Acids Res. 46, 2012–2029. Weber-Mangal, S., Sinn, H.P., Popp, S., Klaes, R., Emig, R., Bentz, M., Mansmann, U., Bastert, G., Bartram, C.R., and Jauch, A. (2003). Breast cancer in young women (< or = 35 years): genomic aberrations detected by comparative genomic hybridization. Int. J. Cancer 107, 583–592. Wei, Y., Li, L., Wang, D., Zhang, C.Y., and Zen, K. (2014). Importin 8 regulates the transport of mature microRNAs into the cell nucleus. J. Biol. Chem. 289, 10270–10275.

Overgaard, M., Jensen, M.B., Overgaard, J., Hansen, P.S., Rose, C., Andersson, M., Kamby, C., Kjaer, M., Gadeberg, C.C., Rasmussen, B.B., et al. (1999). Postoperative radiotherapy in high-risk postmenopausal breast-cancer patients given adjuvant tamoxifen: Danish Breast Cancer Cooperative Group DBCG 82c randomised trial. Lancet 353, 1641–1648.

Wiedswang, G., Borgen, E., Ka˚resen, R., Kvalheim, G., Nesland, J.M., Qvist, H., Schlichting, E., Sauer, T., Janbu, J., Harbitz, T., and Naume, B. (2003). Detection of isolated tumor cells in bone marrow is an independent prognostic factor in breast cancer. J. Clin. Oncol. 21, 3469–3478.

Paine, T.M., Soule, H.D., Pauley, R.J., and Dawson, P.J. (1992). Characterization of epithelial phenotypes in mortal and immortal human breast cells. Int. J. Cancer 50, 463–473.

Yu, H., Lee, H., Herrmann, A., Buettner, R., and Jove, R. (2014). Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat. Rev. Cancer 14, 736–746.

4406 Cell Reports 29, 4389–4406, December 24, 2019

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

anti-E-Cadherin

Cell Signaling Technology

Cat# 14472; RRID: AB_2728770

anti-N-Cadherin

Cell Signaling Technology

Cat# 14215; RRID: AB_2798427

anti-Vimentin

Abcam

Cat# ab76601; RRID: AB_1566863

anti-b-Actin

Santa Cruz Biotechnology

Cat# sc-58679; RRID: AB_772478

anti-pSTAT3 (S727)

Cell Signaling Technology

Cat# 9134; RRID: AB_331589

anti-pSTAT3 (Y705)

Cell Signaling Technology

Cat# 9145; RRID: AB_2491009

anti-STAT3

Cell Signaling Technology

Cat# 9139; RRID: AB_331757

anti-IL31RA

Thermo Fisher Scientific

Cat# PA5-47391; RRID: AB_2606511

anti-IL6ST (anti-gp130)

Santa Cruz Biotechnology

Cat# sc-376280; RRID: AB_10986409

anti-OSMRß

Santa Cruz Biotechnology

Cat# sc-271695; RRID: AB_10708846

Antibodies

anti-pJAK1 (Y1034/1035)

Cell Signaling Technology

Cat# 74129; RRID: AB_2799851

anti-JAK1

Cell Signaling Technology

Cat# 3344; RRID: AB_2265054

anti-pJAK2 (Y1008)

Cell Signaling Technology

Cat# 8082; RRID: AB_10949104

anti-JAK2

Cell Signaling Technology

Cat# 74987; RRID: AB_2799862

anti-IPO8

Santa Cruz Biotechnology

Cat# sc-398854

anti-Ago1

Sigma Aldrich

Cat# 07-599; RRID: AB_310742

anti-RNA Pol II

Santa Cruz Biotechnology

Cat# sc-47701; RRID: AB_677353

anti-Twist1

Santa Cruz Biotechnology

Cat# sc-81417; RRID: AB_1130910

anti-GAPDH

Cell Signaling Technology

Cat# 5174; RRID: AB_10622025

anti-Lamin A/C

Santa Cruz Biotechnology

Cat# sc-376248; RRID: AB_10991536

anti-IPO9

Thermo Fisher Scientific

Cat# PA5-25477; RRID: AB_2542977

anti-pERK

Cell Signaling Technology

Cat# 5726; RRID: AB_2797617

anti-ERK2

Cell Signaling Technology

Cat# 9108; RRID: AB_2141156

anti-pAkt (T308)

Cell Signaling Technology

Cat #13038; RRID: AB_2629447

anti-Akt

Cell Signaling Technology

Cat# 2920; RRID: AB_1147620

Purified Mouse IgG1, k Isotype Ctrl Antibody

Biolegend

Cat# 401401, RRID: AB_2801452

Ki-67

Cell Signaling Technology

Cat# 9027, RRID:AB_2636984

Cleaved caspase3

Cell Signaling Technology

Cat# 9661, RRID: AB_2341188

Anti-rabbit IgG, HRP-linked Antibody

Cell Signaling Technology

Cat# 7074, RRID: AB_2099233

Anti-mouse IgG, HRP-linked Antibody

Cell Signaling Technology

Cat# 7076, RRID: AB_330924

DMEM

Thermo Fisher Scientific

Cat# 10569010

DMEM/F12 1:1

Thermo Fisher Scientific

Cat# 10565018

FBS

Atlanta Biologicals

Cat# H17112

Chemicals, Peptides, and Recombinant Proteins

Antibiotic (Penicillin/Streptomycin)

Thermo Fisher Scientific

Cat# 15140122

DMSO

Sigma Aldrich

Cat# D8418

Lipofectamine 2000

Invitrogen-Thermo Fisher Scientific

Cat# 11668027

Dharmafect Transfection Reagent

Dharmacon

Cat# T-2001-01

RNAiMax Transfection Reagent

Thermo Fisher Scientific

Cat# 13778030

Insulin

Sigma Aldrich

Cat# I3536

Hydrocortisone

Sigma Aldrich

Cat# H0888

Horse serum

Thermo Fisher Scientific

Cat# 26050088

Cholera toxin

Sigma Aldrich

Cat# C8052 (Continued on next page)

Cell Reports 29, 4389–4406.e1–e10, December 24, 2019 e1

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Recombinant Human EGF Protein

R & D Systems

Cat# 236-EG

Recombinant Human OSM Protein

R & D Systems

Cat# 295-OM

Recombinant Human IL31 Protein

R & D Systems

Cat# 2824-IL

Recombinant Human IL-6 Protein

R & D Systems

Cat# 206-IL

Trypan Blue

Sigma Aldrich

Cat# T8154

MTT

Sigma Aldrich

Cat# M5655

Glutaraldehyde

Sigma Aldrich

Cat# G7651

Crystal Violet

Sigma Aldrich

Cat# C6158

Acetic acid

Sigma Aldrich

Cat# A6283

Mitomycin C

Sigma Aldrich

Cat# M4287

Matrigel

Corning

Cat# 354230, 356234

Trypsin

Thermo Fisher Scientific

Cat# 15400054

PBS

Sigma Aldrich

Cat# P5493

RIPA buffer

Thermo Fisher Scientific

Cat# 89900

Protein A/G Magnetic Beads

Thermo Fisher Scientific

Cat# 88802

Qiazol

QIAGEN

Cat# 79306

Paraformaldehyde

Sigma Aldrich

Cat# 158127

Triton X-100

Sigma Aldrich

Cat# T8787

ProLong Gold Antifade Mountant with DAPI

Invitrogen

Cat# P36931

Glycine

Sigma Aldrich

Cat# G8898

PIPES

Sigma Aldrich

Cat# P6757

KCl

Sigma Aldrich

Cat# P9333

NP40

Thermo Scientific

Cat# 85124

Sodium butyrate

Sigma Aldrich

Cat# B5887

Protease inhibitor cocktail

Sigma Aldrich

Cat# P8340

Dynabeads Protein A

Invitrogen

Cat# 10001D

Proteinase K

Invitrogen

Cat# 25530049

RNase A

Invitrogen

Cat# AM2271

1,2-dioleoyl-sn-glycero-3- phosphatidylcholine (DOPC)

Sigma Aldrich

Cat# P6354

HBSS

Thermo Fisher Scientific

Cat# 14060040

10% Formalin fixative

VWR

Cat# 16004-121

TURBO DNase

Invitrogen

Cat# AM2238

Formamide

Sigma Aldrich

Cat# F9037-100ML

SSC Buffer

Sigma Aldrich

Cat# 93017

Yeast tRNA

Roche-Sigma Aldrich

Cat# TRNABAK-RO

Denhardt solution

Sigma Aldrich

Cat# D9905

Dextran sulfate

Sigma Aldrich

Cat# D8906

EDTA

Invitrogen

Cat# AM9260G

Tween 20

Bio-Rad

Cat# 1706531

BSA

Sigma Aldrich

Cat# A7906

Anti-Digoxigenin-Fluorescein, Fab fragments

Roche-Sigma

Cat# 11207741910

Ampicillin

Sigma Aldrich

Cat# A5354

LB Agar

Sigma Aldrich

Cat# L2897

LB Broth (Lennox)

Sigma Aldrich

Cat# L3022

Hematoxylin Solution, Harris Modified

Sigma Aldrich

Cat# HHS32-1L

IHC Antigen Retrieval solution

IHC World

Cat# IW-1100

Puromycin

Thermo

Cat# A1113803 (Continued on next page)

e2 Cell Reports 29, 4389–4406.e1–e10, December 24, 2019

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Calcein AM/EtBr based Live/Dead cell viability Kit

Molecular Probes, Thermo Fisher Scientific Inc.

Cat# L3224

Pierce BCA Protein Assay kit

Thermo Fisher Scientific

Cat# 23227

Subcellular Protein Fractionation Kit for Cultured Cells

Thermo Fisher Scientific

Cat# 78840

Human OSM DuoSet ELISA

R & D Systems

Cat# DY295

Human IL-31 DuoSet ELISA

R & D Systems

Cat# DY2824

RNeasy kit

QIAGEN

Cat# 74104

miRNeasy kit

QIAGEN

Cat# 217004

miScript Reverse transcription II kit

QIAGEN

Cat# 218161

miScript SyBr Green PCR Kit

QIAGEN

Cat# 218073

iScript cDNA synthesis kit

Bio-Rad

Cat# 1708891

iTaq Universal SYBR Green PCR Kit

Bio-Rad

Cat# 1725121

Dual-Luciferase Reporter Assay kit

Promega

Cat# E1910

Magna RIPTM RNA-Binding Protein Immunoprecipitation Kit

Millipore Sigma

Cat# 17-700

ChIP assay kit

Millipore Sigma

Critical Commercial Assays

QIAquick PCR purification kit

Cat# 17-295 Cat# 28104

ABC-AP Kit

Vector Labs

Cat# AK-5000

Vector Red Alkaline Phosphatase Substrate Kit I

Vector Labs

Cat# SK-5100

Highly sensitive miRNA Northern Blot Assay Kit

Signosis Inc

Cat# NB-1001

This paper

https://doi.org/10.17632/vh8p3fdkfs.3

MCF-10A

ATCC

Cat# CRL-10317; RRID: CVCL_0598

MDA-MB-231

ATCC

Cat# HTB-26, RRID: CVCL_0062

HCC-1806RR

ATCC

Cat# CRL-2335; RRID: CVCL_1258

SUM-149

BioIVT

Cat# SUM149PT; RRID: CVCL_3422

MCF-7

Millipore

Cat# SCC100; RRID: CVCL_1D47

T47D

ATCC

Cat# 85102201; RRID: CVCL_0553

HEK293T

ATCC

Cat# CR-3216

MDA-MB-436

ATCC

Cat# HTB-130, RRID: CVCL_0623

BT474

ATCC

Cat# CRL-7913, RRID: CVCL_0179

ZR-75-1

ATCC

Cat# CRL-1500, RRID: CVCL_0588

Hs578-WT

ATCC

Cat# HTB-126, RRID: CVCL_0332

Taconic

Cat# NCRNU-F; sp/sp

MiRIDIAN human microRNA mimic Negative control

Dharmacon

Cat# CN-001000-01-05

MiRIDIAN human hsa-miR551b-3p mimic

Dharmacon

Cat# C-300887-01-05

MiRIDIAN human hsa-miR551b-3p inhibitor

Dharmacon

Cat# IH-300887-03-0005

Human hsa-miR551b-3p Nu-mutant

Sigma Aldrich

Cat# 3022076770-000030

Deposited Data Mendeley Data Experimental Models: Cell Lines

Experimental Models: Organisms/Strains Athymic nude mice: CrTac: NCr-Foxn1nu Oligonucleotides

Human microRNA mimic Negative control Cy3

Sigma Aldrich

Cat# 3022446129-000130

Human hsa-miR551b-3p mimic Cy3

Sigma Aldrich

Cat# 3022076770-000010

Human hsa-miR551b-3p Nu-mutant Cy3

Sigma Aldrich

Cat# 3022076770-000020

Human microRNA mimic Negative control DIG probe

Sigma Aldrich

Cat# 3022112254-000010

Human hsa-miR551b-3p mimic DIG Probe

Sigma Aldrich

Cat# 3022112254-000020

mirVana miRNA Inhibitor, Negative Control

Ambion

Cat# 4464076 (Continued on next page)

Cell Reports 29, 4389–4406.e1–e10, December 24, 2019 e3

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

mirVana miRNA inhibitor

Ambion

Cat# 4464084

siIPO9

Sigma Aldrich

Cat# SASI_Hs01_00233065

Human hsa-miR551b-3p mutant 1 Promoter

Switchgear

Cat# Rag-1 s706087-m1

Human hsa-miR551b-3p mutant 2 Promoter

Switchgear

Cat# Rag-1 s706087-m2

Human hsa-miR551b-3p mutant 3 Promoter

Switchgear

Cat# Rag-1 s706087-m3

Human hsa-miR551b-3p mutant 4 Promoter

Switchgear

Cat# Rag-1 s706087-m4

STAT3 WT Promoter

Active Motif

Cat# S706087

Empty Vector

Active Motif

Cat# S790005

Primers for qPCR, see Table S4

IDT

N/A

Primers for CHIP-qPCR, see Table S4

IDT

N/A

miR551b sgRNA

Synthego

N/A

Non-Target sgRNA

Synthego

N/A

pEZX vector control

GeneCopoeia

Cat# CmiR-AN0001-AM01

pEZX vector expressing miR-551b-3p inhibitor

GeneCopoeia

Cat# HmiR-AN0651-AM01

GraphPad Prism 7

GraphPad Software

https://www.graphpad.com/scientificsoftware/prism/

FlowJo Software

FlowJo

https://www.flowjo.com/

cBioPortal

cBioPortal

http://www.cbioportal.org/

TCGA Firebrowse version: 20160128

TCGA Firebrowse

http://firebrowse.org,

GEO database, with accession number GSE70951, GSE59246

The Gene Expression Omnibus database

https://www.ncbi.nlm.nih.gov/geo

Lasergene 15.2 core suite

DNAstar

https://www.dnastar.com/software/ lasergene/

qPCR software

BioRad CFX Maestro

#12004110

ImageJ: J Coloc 2 image analysis plug-in

ImageJ

https://imagej.net/Coloc_2

ICE V2 CRISPR analysis software tool

Synthego

https://www.synthego.com/products/ bioinformatics/crispr-analysis

UALCAN

UALCAN

http://ualcan.path.uab.edu/

Recombinant DNA

Software and Algorithms

LEAD CONTACT AND MATERIALS AVAILABILITY This study did not generate new unique reagents. Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Pradeep Chaluvally-Raghavan ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Mice Female athymic nude mice (CrTac: NCr-Foxn1nu, Taconic Laboratories, RRID: IMSR_TAC:ncrnu), approximately 4 to 6 weeks old were maintained under specific pathogen-free conditions in accordance with guidelines and therapeutic interventions approved by the Institutional Animal Care and Use Committee (IACUC) at the Medical College of Wisconsin. MDA-MB-231 cells (2 3 106 cells/mouse) were trypsinized, washed, and resuspended in Hanks’ balanced salt solution (GIBCO, Carlsbad, CA) and 50ml was injected into each mice orthotopically. For injecting stable knockdown of miR51b-3p, MDA-MB-231-shControl miRNA and MDA-MB231-shmiR551b-3p cells- (2 3 106 cells/mouse) were trypsinized, washed, and resuspended in Hanks’ balanced salt solution (GIBCO, Carlsbad, CA) and injected into mice orthotopically in mammary fat pad. For both studies, as a therapeutic approach, MDA-MB-231 tumor cells or MDA-MB-231 shmiRNA tumor bearing mice were randomly divided in two groups (n = 7/group) after seven days of tumor cell injection and treated with (150 mg/kg body weight) control anti-mirRNA or anti-miR551b-3p (encapsulated in neutral DOPC nanoliposomes) in 100ml PBS intraperitoneally twice in a week as indicated. Treatment continued for 7 weeks, at which point, all mice were sacrificed, necropsied, and tumors harvested. Treatment continued for 7 weeks, at which point, all mice were sacrificed, necropsied, and tumors harvested. Tumor volume was measured every week using caliper throughout the

e4 Cell Reports 29, 4389–4406.e1–e10, December 24, 2019

experiment and tumor volume was calculated using the formula (Width2 3 Length)/2. Tumor tissue was prepared as snap frozen for lysate preparation for RNA and protein isolation or fixed in 10% formalin for immunohistochemistry. Blood collected and 100 ml of serum prepared for cytokine ELISA. Cell Lines The human breast cancer cell lines MDA-MB-231, HCC-1806, MDA-MB-436, T47D, ZR-75-1, BT474 and MCF10A were obtained from the American Type Culture Collection (ATCC), MCF-7 was obtained from The European Collection of Authenticated Cell Cultures (ECACC-Sigma Aldrich), OVCAR8 was obtained from National Cancer Institute (NCI) and SUM-149 was obtained from BioVT (Westbury, NY). Hs578-WT and Hs578-miR551b-3p-KO cells were provided by Synthego Corporation, CA. All cells were cultured in DMEM with 10% fetal bovine serum (Atlanta Biologicals, GA, USA). MCF10A cells were cultured in DMEM/F12 1: 1 media (GIBCO, Thermo Fisher Scientific Inc., Waltham, MA, USA) with 5% horse serum (GIBCO, Thermo Fisher Scientific Inc., Waltham, MA, USA), EGF (20 ng/mL), Hydrocortisone (0.5mg/mL), Cholera Toxin (100ng/mL) and Insulin (10 mg/mL). All cell media was supplemented with 100 IU/ml penicillin-streptomycin and maintained at 37 C in a humidified incubator with 5% CO2 as described previously (Pradeep et al., 2012b). Cells were routinely tested and deemed free of PlasmotestTM Mycoplasma Detection Kit (InvivoGen, San Diego, CA). Authenticity of the cell lines used were confirmed by STR characterization at IDEXX Bioanalytics Services (Columbia, MO). METHOD DETAILS miRNA Transfections Control miRNA, miR551b-3p mimics, control antimiR and anti-miR551b-3p were obtained from Dharmacon (Lafayette, CO). Mature sequences of the miRNAs used in this study are as follows: miR551b-3p: 50 -GCGACCCAUACUUGGUUUCAG-30 ; control miR: 50 -UCACAACCUCCUAGAAAGAGUAGA-30 ; and mutated miR551b-3p: 50 -GCGUGGGAUACAACCUUUCAG-30 . Briefly, 1x 106 cells (100 cm dish) or 1 3 105 cells (35 mm3 well plate) were seeded for miRNA transfections and transfected and transfected using Dharmafect transfection reagent (Dharmacon, Lafayette, CO) following the manufacturer’s instructions at a final concentration of 3-7 nM for 48 h. Control miRNA or control anti-miRNA was transfected at a concentration of 7 nM. Each transfection experiment was independently repeated at least in triplicates. siRNA Transfection 1x 104 cells (100cm dish) were transfected with scrambled (7 nM) or non-overlapping siRNA sequences (Thermo Fisher Scientific Inc., Waltham, MA) (7 nM) listed as below using the RNAiMax transfection reagent (Thermo Fisher Scientific Inc., Waltham, MA), according to manufacturer’s protocols.

Gene Symbol

Sequence#1

Sequence#2

STAT3

50 GAGAUUGACCAGCAGUAUA30

50 CAACAUGUCAUUUGCUGAA30

IPO8

50 GUGUCAUGCAGCUAAACUU30

50 CAAUUGCUGCCUUGUACUA30

IPO9

50 CAAACCUGCUCUAGAGUUU30

50 CAUCAGUCAUCUUGAAACA30

Generation of miR551b-3p Knockdown using shRNA To establish the stable knockdown of miR-551b-3p in MDA-MB-231 cells, we transfected the cells with pEZX vector control or pEZX vector expressing miR-551b-3p inhibitor (GeneCopoeia, Rockville, MD) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Cells were selected 48h after transfection to ensure that the cells were stably incorporated with control scrambled sequences or miR551b-3p inhibitor using puromycin (8 mg/ml) containing culture media for one week. Total RNA was isolated, and qPCR was performed to determine miR551b expression. Generation of miR551b-3p Knockout Cells using CRISPR/Cas9 Vectors CRISPR/Cas9-Edited miR551b-knockout Hs578T breast cancer cells were prepared by Synthego Inc (Menlo Park, CA, USA). The following sgRNA sequences UCUAACAGAGGUCUGAAGUC, AAGUCCUGCAUAAACAUAAA and 2NLS Cas9 nuclease were used for the generation of miR551b-KO cells. HS578T were electroporated with the sgRNA complex, composed of 6 mg of Cas9 and 3.2 mg sgRNA, using the P3 Cell 4D-Nucleofector X Kit in Amaxa 4-D device (Lonza, Alpharetta, GA, USA). 2x105 cells per condition were electroporated in separated strip wells using program EO-100 and DZ-100. Cell viability was determined 24h after transfection. Deletion of miR551b in Hs578T cells was validated by Synthego via Sanger sequencing of the PCR amplified edited fragment using the primers F: CCCCTGAGTTATATTTGCTGGTTCTTAC R: CCCATTGGAACAGAAATGCAATATAATC and gel electrophoresis after extracting the genomic DNA. Sequencing data were analyzed using ICE V2 CRISPR analysis software tool (Synthego, Menlo Park, CA).

Cell Reports 29, 4389–4406.e1–e10, December 24, 2019 e5

Cell Proliferation and Cell Viability Assay To measure cell proliferation, MDA-MB-231 and MCF10A cells were plated at a density of 1 3 104 cells in 96 well plates and were treated with OSM (20 ng/mL), IL31 (20 ng/mL) or combination of OSM and IL31 (each 10 ng/mL) (R and D systems, Minneapolis, MN). Cell were trypsinized, stained with Trypan Blue (Sigma Aldrich, MO, USA) and counted after 0 h, 24 h, 48 h, and 72 h using TC10 automated cell counter (Bio-Rad, CA, USA). To measure cell viability, MDA-MB-231 and MCF10A cells were plated at a density of 1 3 104 cells in 96 well plates after transfection of control miRNA or miRNA mimics and/or miRNA inhibitor. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Sigma Aldrich, MO, USA) were added and incubated at 37 C for 3 h. This was followed by dissolving formazan crystals with acidic isopropanol. Absorbance was measured in microplate reader (Tecan, Mannedorf, Switzerland) at 560nm. Colony Formation Assay MDA-MB-231 and MCF10A cells at densities of 400-1200 cells per well were seeded in 6-well plate following transfection with Control miRNA/miR551b-3p or treatment with OSM or IL31 and incubated at 37 C, 5% CO2 for 14-21 days to allow colony formation. Cells were rinsed with PBS, fixed in 5% glutaraldehyde for 10min and then stained with 1% crystal violet (Sigma Aldrich, MO, USA) for 20 min. Plates were washed with water and dried before scanning. Crystal Violet was solubilized with 10% acetic acid and quantified by reading absorbance at 560 nm. Wound Healing Assay For wound healing assay, the cells were grown to confluence and wounded using 200 uL pipette tip in a 35mm3 culture dish. The wound closure was visualized by time-lapse imaging using a phase contrast microscope (Nikon, Fukok, Japan) coupled to a CCD camera. Phase-contrast images of three to five selected fields were acquired for at least 24 h. Images were analyzed using ImageJ software. Migration and Invasion Assay The effect of miR551b on cellular motility was analyzed by carrying out cell migration and invasion assay as described earlier (Jagadish et al., 2015). In brief, for migration assay, miR551b transfected MDA-MB-231 and MCF10A cells (1 3 105 cells) were seeded on the upper chamber of the Boyden chambers trans-well inserts (BD Biosciences, Bedford, MA, USA). Growth medium containing 10% FBS was the chemoattractant in lower chamber. For invasion assay 2 3 105 cells were seeded in triplicate (n = 3) to the Matrigel (BD Biosciences, Bedford, MA, USA) coated inserts, or to the uncoated inserts as control. Cells were also treated with OSM and IL31 after seeding for migration and invasion assays for indicated times. Migration and invasion assays were performed in the presence of cell cycle inhibitors mitomycin C (5 mg/ml), in the trans-well chambers as described before (McCarroll et al., 2004; Pullar et al., 2003). Cells were incubated at 37 C for 12 h for migration assays and for 16h for invasion assays. Cells that did not migrate through the pores were removed using a cotton swab and inserts were washed and stained with 0.5% crystal violet in 20% methanol for imaging. Alternatively, stained membranes were dissolved in 10% acetic acid, and quantified in microplate reader at 560 nm. 3-Dimensional (3-D) Culture of Tumor Cells and Limiting Dilution Assay Tumor cells were cultured as 3-D spheroids as described previously (Pradeep et al., 2012a, 2012b). For anchorage dependent culture, 3 3 104 cells were suspended in growth factor reduced Matrigel purchased from BD Biosciences (Bedford, MA, USA) supplemented with growth enriched media-DMEM/F12 1: 1 media (GIBCO) with 5% horse serum (GIBCO), EGF (20 ng/mL), and supplemented with 100 IU/ml penicillin-streptomycin and maintained at 37 C in a humidified incubator with 5% CO2 (1:1 Matrigel/medium in a total volume of 250 mL). Cells were then cultured in complete medium up to two weeks based on the requirement and replenished with 1:1 Matrigel/Media every two days. For in vitro limiting dilution assay, spheroid cultures from MDA-MB-231 cells stably knockdown with shmiR551b and shcontrol miRNA were suspended as mentioned previously at 1, 10, 100, 1000, 10,000 cells per well. For anchorage independent culture, MDA-MB231 cells at a density of 3 3 104 cells were suspended in 24 well low adherent plate in DMEM containing complete media following transfection with control miRNA and miR551b-3p as mentioned previously. Flow Cytometry Apoptosis was detected using a Calcein AM/EtBr based Live/Dead cell viability Kit (Molecular Probes, Thermo Fisher Scientific Inc., Waltham, MA, USA). MDAMB-231 cells were plated at optimal densities and transfected with Control anti-miR and anti-miR551b. After transfection, supernatants from each treatment group were collected and trypsinized to single cell suspension. Trypsinized cells were washed with PBS, pelleted, re-suspended in Ca2+ and Mg2+ free PBS, and counted. The 5 3 10 6 cells were resuspended in PBS and incubated with 50 mM Calcein AM and 2mM EtBr for 20 min according to manufacturer’s instructions. Finally, cells were strained to single cells into 5 mL polystyrene round-bottom FACS tubes (BD Falcon), placed on ice, and processed on a BD LSR II Flow Cytometer (BD Biosciences, San Jose, CA) no longer than 1 h post-staining. The data were analyzed using FlowJo software (FlowJo LLC, Ashland, Oregon).

e6 Cell Reports 29, 4389–4406.e1–e10, December 24, 2019

Reverse-Phase Protein Arrays (RPPA) RPPA analysis was performed as described previously (Chaluvally-Raghavan et al., 2016; Hennessy et al., 2010) and detailed at the MD Anderson Cancer Center RPPA core facility as below: https://www.mdanderson.org/research/research-resources/core-facilities/functional-proteomics-rppa-core.html. Briefly, cells were washed in ice-cold PBS, and lysed in 30 mL of RPPA lysis buffer [1% Triton X-100, 50 nmol/L HEPES (pH 7.4), 150 nmol/L NaCl, 1.5 nmol/L MgCl2, 1 mmol/L EGTA, 100 nmol/L NaF, 10 nmol/L NaPPi, 10% glycerol, 1 nmol/L PMSF, 1 nmol/L Na3VO4, and protease inhibitor cocktail] for 30 minutes with frequent vortexing on ice, followed by centrifuging for 15 min at 14,000 rpm, and the supernatant were collected. Protein concentration was determined by Pierce BCA Protein Assay kit (Thermo Fisher Scientific, Waltham, MA) with a BSA standard curve according to manufacturer’s protocol. 30 mL lysates were transferred into a 96-well PCR plate. To each sample well, 10 mL of SDS/2-ME sample buffer (35% glycerol, 8% SDS, 0.25 mol/L Tris-HCl, pH 6.8; with 10% b-mercaptoethanol) was added and incubated for 5 minutes at 95 C and then centrifuged for 1 minute at 2,000 rpm. Samples were diluted serially and transferred into 384-well plates and heated at 95 C for 10 min. Approximately, 1 nL of protein lysate lysate was then printed onto nitrocellulose-coated glass slides (FAST Slides, Schleicher & Schuell BioScience, Inc., Keene, NH) with an automated robotic GeneTac arrayer (Genomic Solutions, Inc., Ann Arbor, MI) per array by pin touch. Each spot on the array slide represents a certain dilution of the lysate of a particular sample. Following slide printing, the array slides were blocked for endogenous peroxidase prior to the addition of the primary antibody, then treated with biotinylated secondary antibody (anti-mouse or antirabbit) was used as a starting point for signal amplification. Tyramide-bound horseradish peroxidase cleaves 3,30 -diaminobenzidine tetrachloride, giving a stable brown precipitate with excellent signal-to-noise ratio. Signal intensity was captured by scanning the slides with ImageQuant (Molecular Dynamics, Sunnyvale, CA) and quantified using the MicroVigene automated RPPA module unit (VigeneTech, Inc., North Billerica, MA). The intensity of each spot was calculated, and an intensity concentration curve was calculated with a slope and intercept using MicroVigene software. Western Blot and Immunoprecipitation Cultured cells were washed with ice-cold PBS and lysed in RIPA buffer containing protease inhibitors and phosphatase inhibitors (Santa Cruz Biotechnology, Dallas, TX). Lysates were vortexed five times at 5 s interval and incubated on ice for 30 min, then centrifuged at 12,000 rpm for 10 min. Protein concentration was determined by Pierce BCA Protein Assay kit (Thermo Fisher Scientific, Waltham, MA) with a BSA standard curve according to manufacturer’s protocol. About 25 mg of protein was separated with precast SDS-PAGE gradient gels (4%–12%, Bio-Rad, Hercules, CA) and transferred onto a PVDF membrane (Bio-Rad, Hercules, CA). Membranes were probed with the primary antibodies overnight at 4 C, then washed and probed with anti-mouse or anti-rabbit IgG secondary antibodies (Cell Signaling Technology) for 1 h at room temperature. Chemiluminescence was detected using X-ray films. For immunoprecipitation, nuclear and cytoplasmic protein extracts were prepared using Cell Fractionation kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions. The lysates were pre-cleared with protein A/G magnetic beads (Thermo Fischer Scientific) for 1 h at 4 C with rotation, followed by incubating with IPO8 and Control IgG antibodies (Santa Cruz Biotechnology, Dallas, TX) coupled with protein A/G magnetic beads overnight at 4 C. The samples were then washed with lysis buffer and treated with 20 ug/mL RNase A (Thermo Scientific) for 15 min at room temperature with rotation. Subsequently, the protein-antibody conjugated beads were washed, and proteins were eluted in 2x SDS sample buffer (BioRad) at 95 C for 10 min. Cytoplasmic and nuclear cell lysates (Input) and immunoprecipitated proteins were separated by SDS-PAGE, transferred, and blotted as described earlier and analyzed with specific primary antibodies as indicated. Northern Blotting Total RNA from cytoplasmic and nuclear fractions were isolated using RNA subcellular isolation kit (Active Motif) according to manufacturer’s instructions. TURBO DNase (Ambion) was used to digest if any DNA fragment exists in the RNA fractions. For endogenous expression, 1x 106 cells from various breast cancer cell lines were seeded for 24h and harvested. For shRNA and CRISPR-Cas9 KO, shControl miRNA and shmIr551b-3p, Hs578T-WT and Hs578T-miR551b-KO cells (1x 106 cells) respectively were seeded for 24 h and harvested. For co-transfection, 1x 106 MDA-MB-231 cells were seeded for 24 h and transfected with siIPO8 or siIPO9 for 24h followed by transfection with control miRNA or miR551b-3p mimic and harvested in cell lysis buffer after a total incubation of 48 h. RNA was isolated and nuclear and cytoplasmic RNA fractions were subjected to Northern Blotting using Highly sensitive miRNA Northern Blot Assay Kit (Signosis Inc., CA) according to manufacturer’s protocol. miR551b-3p, U6 (nuclear marker) and tRNA-lysine (cytoplasmic marker) probes were designed by Signosis Inc. For miRNA detection, Northern blotting analysis was carried out using 5 mg of RNAs separated on 15% pre-run urea-polyacrylamide gel in TBE buffer and RNA were transferred onto nylon membrane. The membranes were hybridized with biotin-labeled RNA probes (containing complementary sequence of the miRNA and a tag sequence) overnight at 42 C with gentle rotation. To amplify the signal and detect the tag sequence membranes were incubated with an amplifier enriched with biotin molecules for 2 h. Subsequently, the membranes were washed extensively, blocked with blocking solution and further incubated with Streptavidin-HRP Conjugate. The membranes were subsequently incubated with chemiluminescence detection solution and exposed to X-ray film.

Cell Reports 29, 4389–4406.e1–e10, December 24, 2019 e7

ELISA To determine the amounts of IL31 and OSM secreted by the cells and in the mouse serum, ELISA tests were performed. Cells were plated at 1 3 106 per 10-cm dish. At confluency following 48 h post miRNA transfections, or treatment with OSM or IL31, culture supernatants were harvested, centrifuged and centrifuged at 10,000 rpm for 10 min, and ELISA of OSM and IL31 was performed using Human OSM DuoSet ELISA and Human IL-31 DuoSet ELISA (R and D Systems, MN, USA) respectively according to the manufacturer’s instructions. Human-specific IL-31 and OSM recombinant protein (R and D Systems, MN, USA) were used as standards to determine the amounts of these cytokines present in the culture supernatants and serum. All assays were performed in triplicate and repeated three times independently. RNA Extraction Cultured Cells Total RNA and miRNA from cultured cells were extracted using RNeasy Plus kit and miRNeasy kit (QIAGEN, Valencia, CA) according to manufacturer’s guidelines. Briefly, cells were washed with PBS and lysed by addition of RLT buffer provided in RNAeasy kit or Qiazol reagent, mixed thoroughly by pipetting several times and incubated at room temperature for 10 min. For miRNA, chloroform was added and mixed thoroughly, then centrifuged for 15 min at 12,000 rpm, 4 C. The aqueous layer was removed, mixed with an equal volume 70% ethanol, and transferred to an miRNeasy spin column for RNA purification. Xenografts Animal xenograft tumor tissues were harvested and snap frozen. 10 mg of tissue was homogenized using a handheld electric tissue homogenizer followed by Polytron in Qiazol reagent. Once homogenized, miRNA or mRNA was isolated using the Qiazol/Chloroform/ Spin column purification protocol as described earlier. mRNA qRT-PCR Primer Design qRT-PCR primers (Table S4) were designed by the primer design program Primer3Plus. Reverse Transcription 1 mg RNA was transcribed to cDNA using iScript cDNA synthesis kit (BioRad, Hercules, CA) in a total volume of 20 ml. qRT-PCR iTaq Universal SYBR Green PCR Kit (BioRad, Hercules, CA) was used for all assays and qPCR was performed in CFX Connect Real Time PCR system (Bio Rad, Hercules, CA). mRNA expression was normalized to b-Actin (ACTB) mRNA. The total reaction volume was 10 mL, including 10 mL 2X iTaq Universal SYBR Green mix, 10 mM left primer and 10 mM right primer, and 1 mL cDNA template. Each assay was performed in triplicate. Non template control (NTC) was added each time in all the assays. The PCR program started with 1 min. at 95 C, followed by 40 cycles (95 C, 30 s.; 57 C, 30 s) and extension of 72 C for 2 min. The last steps of PCR are performed to acquire the dissociation curve and to validate the specificity of PCR amplicons. miRNA qRT-PCR Reverse Transcription 1 mg total RNA was transcribed to cDNA using miScript HiSpec Buffer in miScript Reverse transcription II kit (QIAGEN, Valencia, CA) in a total volume of 20 mL following the manufacturer’s protocol. qRT-PCR mature miRNA qRT-PCR reactions were performed as described previously (Chaluvally-Raghavan et al., 2014, 2016) using miScript SyBr Green PCR Kit (QIAGEN, Valencia, CA) with primers for hsa-miR551b-3p (#000593) and small nuclear RNA U6 was used as endogenous control (#001973) (QIAGEN) and negative controls without template were added in each plate. All qPCR was run in CFX Connect Real Time PCR system (Bio Rad, Hercules, CA) with the following cycling condition: 95 C, 15 min; 40 cycles of denaturation at 94 C 15 s, annealing at 55 C for 30 s and extension at 70 C for 30 s with a ramp rate of 1 C/sec. This was followed by a default dissociation curve to validate the specificity of PCR amplicons. Luciferase Reporter Assay For luciferase assay, 2x104 MDA-MB-231 cells were plated in 96-well plates 24 h prior to transfection. For each well, 100 ng of wildtype (WT) STAT3 promoter or mutant STAT3 promoter cloned in Renila Luciferase reporter vector pLight (Active Motif, Carlsbad, CA) was co-transfected along with 7 nM control miRNA or miR551b using Lipofectamine 2000. Renilla luciferase activity was measured using Dual-Glo luciferase Assay system (Promega) as mentioned previously (Chaluvally-Raghavan et al., 2016) according to manufacturer’s protocol in triplicate at 48 h post transfection and normalized to firefly luciferase activity. MiR551b-3p reporter activity was normalized to empty vector control. Immunostaining Immunostaining was performed as described previously (Chaluvally-Raghavan et al., 2014; Pradeep et al., 2014). Briefly, MDA-MB231 1x104 cells were grown on 35mm glass bottom dish (ibidi Fitchburg, WI, USA) transfected with Cy3 labeled miRNA for 48h then fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in blocking solution (0.5% BSA in PBS) followed by

e8 Cell Reports 29, 4389–4406.e1–e10, December 24, 2019

blocking for 1 h with 0.5% BSA in PBS, and then stained overnight at 4 C with a primary antibody (1:150 dilution). After washing with PBS, cells were incubated with Alexa Fluor anti-mouse 488 and Alexa Fluor 568 Goat Anti-Rabbit IgG (1:1000, Life Technologies, Carlsbad, CA) for 1 hour at room temperature. Glass slides were mounted using ProLong Gold Antifade Reagent (Life Technologies, Carlsbad, CA) containing DAPI. Each transfection was replicated independently three times. Images were acquired with a 40X objective using a Nikon confocal microscope. Z stacked sections (10 to 22 slices) of the cells were captured with a motorized Z-focus controlled camera. ImageJ software was used to reconstruct the images using the Z project plug-in. RNA Fluorescence In Situ Hybridization (RNA-FISH) RNA-FISH was used to identify the nuclear and cytoplasmic localization of miR551b-3p in breast cancer cells. Oligonucleotide miR551b-3p probes labeled with digoxigenin (DIG) at their 50 ends were obtained from Sigma Aldrich. The sequences of miR551b-3p probe and the scrambled control probe were 50 -[DIG]CTGAAACCAAGTATGGGTCGC-30 and 50 -[DIG]AGTGTTGGAG GATCTTTCTCATCT-30 , respectively. 5 3 104 cells were plated in the glass center of 35 mm glass-bottom dishes (Cellvis, CA). Cells were fixed with 4% paraformaldehyde for 10 min and washed three times for 5 min with PBST at RT and processed for FISH as described previously with some modifications (Agarwal et al., 2014; Wang et al., 2018). Briefly, following fixation, acetylation solution (5 mL DEPC-treated water, 80 mL triethanolamine, 10.5 mL HCl (37%), 15 mL acetic anhydride) was added for 10 min and incubated for 7 min with TURBO DNase (Ambion) to digest any contaminating DNA at 37 C followed by quenching with 0.2% Glycine in PBS. The culture dishes were pre-incubated in prewarmed hybridization solution (50% formamide, 2 3 SSC buffer, 100 mg/ml yeast RNA, 1x Denhardt Solution, 10% Dextran Sulfate, 10mM EDTA, 0.01% Tween) for 2 h at 55 C. For each culture dish, the DIG probe was diluted with hybridization buffer and denatured by heating them up to 80 C for 5 min followed by quickly placing on ice. The probes were added onto the culture dish and hybridized at 65 C overnight followed by extensive washes with 0.1 3 SSC buffer (Sigma Aldrich). Slides were incubated in RNase A for 1 h at 37 C to remove unbound RNA and incubated in blocking solution (1% BSA in PBST) for 1 h, and then in anti-digoxigenin-FITC Fab fragments (Roche) for 1 h. After three washes, culture dishes were mounted in DAPI containing mounting media and observed in Nikon confocal microscope using a 60x objective lens. Z stacked sections (10 to 22 slices) of the cells were captured with a motorized Z-focus controlled camera. RNA Immunoprecipitation Assay RNA immunoprecipitation assay (RIP) was performed using Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore Sigma, Burlington, MA) according to manufacturer’s instructions. Following nuclear and cytoplasmic protein extraction using Cell fractionation kit as mentioned earlier, lysates were incubated with respective antibodies coupled to Dynabeads Protein A/G for overnight at 4 C. Following extensive washes, the immobilized immunoprecipitated complexes were incubated with proteinase K 55 C for 30 min to digest the protein. Co-precipitated RNA and the Input (crude lysate) were eluted and purified with Trizol Reagent and analyzed by qPCR. The fraction of co-precipitated RNA is presented as fold enrichment. Chromatin Immunoprecipitation Assay MDA-MB-231 cells were either treated with OSM (20 ng/mL) and IL31 (20 ng/mL) or transfected with control miR and miR551b-3p for 48h. ChIP was performed as previously described (Anjali et al., 2015) using ChIP assay kit (Millipore Sigma, Burlington, MA). In brief, formaldehyde fixed and 125 mM glycine neutralized cells were lysed with 5 mM PIPES pH 8, 85 mM KCl, 0.5% NP-40 with 20 mM sodium butyrate and protease/phosphatases inhibitors (2 mM PMSF, 20 mM NaF, 1X Aprotinin, 0.1 mg/mL Leupeptin, 2 mM Na3VO4) followed by sonication using a Bioruptor sonicator (Diagenode, Denville, NJ) to obtain chromatin fragments of 100–500 base pairs. Fragmented chromatin (200 mg) was incubated overnight with 5 mg STAT3 antibody (Cell Signaling Technology) or anti-IgG (Santa Cruz) as negative control. Immune-complexes were coupled to Protein A beads and crosslinks were reversed (65 C for 12–16 h), and precipitated DNA was treated with Proteinase K and RNase A and then purified using QIAquick PCR purification kit (QIAGEN, Valencia, CA). Input and purified STAT3-ChIP-DNA was used in qPCR and 5% of the eluted DNA input was used in the Thermal PCR reaction Primers were designed for the putative STAT3-binding regions on promoters of OSMR, OSM, IL31, IL31RA, and IL6ST using DNA-star Lasergene 15.2 core suite (DNAstar, Madison, WI). IL8 promoter sequences with putative STAT3-binding was used a positive control. All the primers were designed using Primer-BLAST (NCBI, Bethesda, MD) and the primer sequences were included in Table S4. Immunoprecipitated DNA was analyzed by real-time qPCR (Bio-Rad, Des Plaines, IL) as described earlier (Anjali et al., 2015). Fold changes were calculated using the DDCt method, normalized to % input and presented as fold enrichment over control rabbit IgG. Liposomal Preparation Control anti-miRNA and Anti-miR551b-3p were incorporated into neutral 1,2-dioleoyl-sn-glycero-3- phosphatidylcholine (DOPC) nanoliposomes (Sigma Aldrich) for in vivo delivery as described previously (Chaluvally-Raghavan et al., 2014; Landen et al., 2005). Briefly, DOPC and anti-miRNAs specific for in vivo delivery (Cat#AM17000 Ambion, Thermo Fisher Scientific) were mixed in the presence of excess tertiary butanol at a ratio of 1:10 (w/w) miR/DOPC. Tween 20 was added to the mixture in a ratio of 1:19 Tween 20: miR/DOPC to enhance the incorporation of siRNA into liposomes, then vortexed, frozen in an acetone/dry ice bath and lyophilized overnight. Before in vivo administration, the lyophilized preparation was hydrated with PBS at room temperature at a concentration of 150 mg/kg body weight per injection. Cell Reports 29, 4389–4406.e1–e10, December 24, 2019 e9

Immunohistochemistry Analysis Serial tissue sections (4 mm) were sliced from paraffin embedded formalin-fixed tissue and immunohistochemical staining performed as described earlier (George et al., 2016). Briefly, tissue sections were deparaffinized, hydrated, and stained using Ki67 and cleaved caspase3 primary antibodies. The slides were dewaxed in xylene and rehydrated through graded ethanol to distilled water. For staining Vectastain ABC-AP Kit (Vector Labs, Burlingame, CA) and Vector Red Alkaline Phosphatase Substrate Kit I (Vector Labs, Burlingame, CA) were used according to manufacture protocol. Both primary antibodies were used at 1:100 dilution. The slides were counterstained with hematoxylin (Thermo Fisher Scientific Inc., Rockford, IL), dehydrated and mounted with paramount. Ki67 and cleaved caspase3 positive cells were quantified in three fields from the tumor tissues isolated from three mice from each group. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical Analysis of In Vitro and In Vivo Studies In most cases, data obtained from three or four biological replicates were analyzed, unless indicated otherwise in the Figure legends. Statistical significance defined as a p value < 0.05 or < 0.01 was determined by two-tailed and equal-variance Student’s t test. Data are presented as the mean ± standard deviation or standard errors as indicated in the figure legends. In case of cumulative distribution function analysis, statistical significance was determined by the two-tailed Mann-Whitney U test, which is mentioned in the respective figure legends. For the analysis of correlation co-efficient, Pearson’s correlation coefficients (r) were calculated. P value < 0.05 was considered significant. GraphPad Prism 7 was used to perform statistical analysis and p value determinations. Western Blot Analysis For densitometric western blot analysis, the intensity of each immunoreactive band was normalized to the optical density of the corresponding b-Actin bands. Image Analysis Using DAPI as nucleus marker, the nuclear localization of miR551b-3p was determined by line scan analysis with ImageJ to indicate the degree of overlap between signals. A line (yellow color) across the cell was drawn in the merged figure and the intensity pixel profiles of the two signals were plotted with a RGB profile plot program using ImageJ software. The extension of co-localization between the miR551b-3p and DAPI was quantitated using J Coloc 2 image analysis plug-in. For each group, 10-15 cells were analyzed and average co-localization coefficients of miR-551b-3p to DAPI was calculated and plotted as Mander’s split co-localization coefficient in a histogram panel. Clinical Data Analysis TCGA data and METABRIC datasets were first analyzed using cBioPortal (http://www.cbioportal.org/). The segmented data for all the samples were downloaded from the TCGA Firehose (http://firebrowse.org, version: 20160128), followed by standard GISTIC2 (Genomic Identification of Significant Targets in Cancer, version 2) analysis using Firehose-suggested parameters. The METABRIC dataset was deposited in the European Genome-Phenome Archive under accession number EGAS00000000083 (Curtis et al., 2012). Correlation between miRNA expression and STAT3 or p-STAT3 levels were tested in the primary breast tumors in the Danish Breast Cancer Cooperative Group (DBCG) cohort (Aure et al., 2013; Myhre et al., 2013; Overgaard et al., 1999). Breast tumors were classified into five molecular subtypes such as luminal A, luminal B, basal-like, Her2-enriched and normal-like using the PAM50 classification method (Parker et al., 2009). To assess the expression of OSM-gene module in primary breast tumors and normal breast tissues, we used the previously published mRNA expression data (Quigley et al., 2017). Microarray data can be accessed from the GEO database, (https://www.ncbi.nlm.nih.gov/geo) with accession number GSE70951. Wilcoxon test was used to determine the differential expression of genes between tumors and normal tissues. To assess the expression of OSM and IL31 genes in the DCIS and IBC, we used the previously published mRNA expression data (Aure et al., 2017; Lesurf et al., 2016). Dataset for this study can be accessed from the Gene Expression Omnibus site using the accession number GSE59246. DATA AND CODE AVAILABILITY Data Availability Statement The authors declare that all data supporting the findings of this study are available within the paper and its supporting information files. Raw data of western blots can be found at https://doi.org/10.17632/vh8p3fdkfs.3

e10 Cell Reports 29, 4389–4406.e1–e10, December 24, 2019