Mitochondrial alternative oxidase is involved in both compatible and incompatible host-virus combinations in Nicotiana benthamiana

Accepted Manuscript Title: Mitochondrial alternative oxidase is involved in both compatible and incompatible host-virus combinations in Nicotiana benthamiana Author: Feng Zhu Xing-Guang Deng Fei Xu Wei Jian Xing-Ji Peng Tong Zhu De-Hui Xi Hong-Hui Lin PII: DOI: Reference:

S0168-9452(15)30015-7 http://dx.doi.org/doi:10.1016/j.plantsci.2015.07.009 PSL 9236

To appear in:

Plant Science

Received date: Revised date: Accepted date:

2-4-2015 8-7-2015 10-7-2015

Please cite this article as: Feng Zhu, Xing-Guang Deng, Fei Xu, Wei Jian, Xing-Ji Peng, Tong Zhu, De-Hui Xi, Hong-Hui Lin, Mitochondrial alternative oxidase is involved in both compatible and incompatible host-virus combinations in Nicotiana benthamiana, Plant Science http://dx.doi.org/10.1016/j.plantsci.2015.07.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Mitochondrial alternative oxidase is involved in both compatible and incompatible host-virus combinations in Nicotiana benthamiana Feng Zhua,b, Xing-Guang Denga, Fei Xuc, Wei Jiana, Xing-Ji Penga, Tong Zhua, De-Hui Xia , HongHui Lina,* a

Ministry of Education Key Laboratory for Bio-Resource and Eco-Environment, College of Life Science,

State Key Laboratory of Hydraulics and Mountain River Engineering, Sichuan University, Chengdu 610064,

China b

c

College of Horticulture and Plant Protection, Yangzhou University, Yangzhou, 225009, China

Applied Biotechnology Center, Wuhan Bioengineering Insititute, 430415, China

* Corresponding author. Tel.: +862885415389.

E-mail addresses: [email protected] (H.H. Lin).

Keywords: alternative oxidase (AOX); systemic resistance; Tobacco mosaic virus (TMV); Turnip crinkle

virus (TCV); virus-induced gene-silencing (VIGS).

Highlights

We studied the mechanisms of AOX in the systemic antiviral defense response.

We used VIGS to investigate the role of AOX in N-mediated resistance to TMV.

NbAOX plays an important role in the systemic resistance to virus infection.

NbAOX is required for N-mediated resistance to TMV.

ABSTRACT The alternative oxidase (AOX) functions in the resistance to biotic stress. However, the mechanisms of

AOX in the systemic antiviral defense response and N (a typical resistance gene)-mediated resistance to

Tobacco mosaic virus (TMV) are elusive. A chemical approach was undertaken to investigate the role of

NbAOX in the systemic resistance to RNA viruses. Furthermore, we used a virus-induced gene-silencing

(VIGS)-based genetics approach to investigate the function of AOX in the N-mediated resistance to TMV.

The inoculation of virus significantly increased the NbAOX transcript and protein levels and the cyanide-

resistant respiration in the upper un-inoculated leaves. Pretreatment with potassium cyanide greatly

increased the plant’s systemic resistance, whereas the application of salicylhydroxamic acid significantly

compromised the plant’s systemic resistance. Additionally, in NbAOX1a-silenced N-transgenic Nicotiana

benthamiana plants, the inoculated leaf collapsed and the movement of TMV into the systemic tissue

eventually led to the spreading of HR-PCD and the death of the whole plant. The hypersensitive response

marker gene HIN1 was significantly increased in the NbAOX1a-silenced plants. Significant amounts of

TMV-CP mRNA and protein were detected in the NbAOX1a-silenced plants but not in the control plants.

Overall, evidence is provided that AOX plays important roles in both compatible and incompatible plant-

virus combinations.

1. Introduction The mitochondrion is the main site responsible for energy production in both animals and plants. In

addition, mitochondria have other important functions, such as their active role in the programmed cell

death (PCD) pathways of animals and plants [1-5]. The plant mitochondrial electron transport chain

supporting oxidative phosphorylation branches at ubiquinone [6]. Electrons can flow from ubiquinone (UQ)

through the usual cytochrome (Cyt) pathway or through an alternative oxidase (AOX) pathway. Under

stress, electrons are frequently rerouted through the AOX pathway, which branches from the Cyt pathway

at the level of the UQ pool [7]. The alternative pathway bypasses two important proton translocation sites

(complex III and IV) and then transfers electrons from the reduced forms of UQ to O2 directly via AOX, thereby avoiding oxidative phosphorylation and ATP production [8,9]. Alternative respiration is

widespread in plants, fungi, and some prokaryotes [7], but its physiological functional characteristics are

not well understood.

AOX was initially investigated in the thermogenic flowers of Araceae [10]. The functions of AOX have

been extensively investigated. Several studies have indicated that the AOX plays an important role in fruit

ripening [11,12]. Moreover, AOX has been proved as the important defense components in the plant

response to abiotic stresses, including drought, high salt, chilling, and wounding [13-16]. In addition,

abundant evidence suggests that AOX also functions in the resistance to biotic stresses, such as pathogen

attack. For example, the AOX protein levels increased in Nicotiana attenuata leaves infected with

Manduca sexta, and the silencing of AOX in N. attenuata makes the plants more susceptible to Empoasca

[4]. In addition, the role of AOX signaling during the defense against plant viruses was also investigated

[17-19]. Overexpression of AOX in the TMV-infected tobacco leaves resulted in reducing hypersensitive

response (HR) lesions, suggesting a link between AOX and PCD [20]. However, overexpression of AOX in

tobacco cultivar Samsun NN plants allowed an increase in TMV spread and the development of severe

symptoms [21]. Therefore, the role of AOX in virus resistance has been reported, however, the mechanisms

of this antiviral action are complex and varied [9,22,23].

The reactive oxygen species (ROS) equilibrium is maintained between production and scavenging under

normal metabolic conditions [24]. For a long time, ROS was considered to be a harmful byproduct.

Extensive studies suggest that high levels of ROS cause cell death inside the cell. However, low levels of

ROS possess regulatory effect in plant stress responses. The ROS production is involved in plant responses

to different types of stresses, which suggests that ROS may act as a defense signal in the plant stress

responses [25]. Several lines of evidence have suggested that AOX may have a general function by limiting

the production of ROS [26]. This evidence indicates that the levels of ROS production affected by AOX

proteins can influence the plant defense against viruses [27]. However, Murphy et al. (2004) [21] suggested

that a high level of the AOX protein accelerates the systemic movement of TMV and the accumulation of

ROS in N. benthamiana plants. Hence, the roles of ROS and AOX in plant defense pathway may be elusive.

Plants limit the spread of pathogen that attack them by inducing defense responses. One of these is the

HR cell death, which is a form of PCD that limits the spread of the pathogen. When a plant resistance (R)

gene product recognizes specific molecules or proteins produced by pathogen avirulence genes, then the

HR is activated [28,29]. Numerous individual R genes have been identified from various plant species that

confer specific resistance to insects, bacteria, oomycetes, viruses, fungi, and nematodes [30]. The tobacco

plant resistance gene N is a classic R gene, and the N gene encodes a protein which belongs to the TIR-

NBS-LRR class [31]. The N protein specifically can recognize the helicase domain (50 kDa) of the TMV

replicase and then triggers a signal transduction cascade that leads to the induction of HR in the form of

local necrotic lesions, the restriction of virus spread, and the onset systemic acquired resistance (SAR) [32].

Salicylic acid (SA) and jasmonic acid (JA) signaling play an important role in the N gene-mediated

resistance to TMV. However, the biological role of AOX in N gene-mediated resistance to TMV is elusive.

Tobacco plants transformed with the salicylic acid hydroxylase gene could not restrict TMV to the

inoculation site in TMV-infected NN-type tobacco leaves. However, treatment with KCN restored TMV

localization [33]. These results suggested that SA play a role as potential integrator of mitochondrial

function and AOX expression [33]. In addition, the overexpression of AOX in tobacco resulted in slightly

smaller TMV-induced HR lesions [20]. However, high levels of AOX in NN-type tobacco allowed an

increase in TMV spread [21].Therefore, it is necessary to further investigate the biological role of AOX in

N gene-mediated resistance to TMV.

In this study, a chemical approach was undertaken to investigate the role of AOX in the viral resistance

of N. benthamiana plants. Furthermore, a virus induced gene silencing-based (VIGS) approach [34] was

used to investigate the function of AOX in N gene-mediated resistance to TMV. Our results indicate that

NbAOX plays an important role in the systemic resistance to virus infection and that NbAOX is required

for N gene-mediated resistance to TMV.

2. Materials and methods 2.1. Multiple alignments of AOX

We cloned the complete open reading frame (ORF) of NbAOX1a and NbAOX1b from Nicotiana

benthamiana plants using the specific primers AOX1a-ORF-F (5’-ATGATGACACGTGGAGCGA-3’),

AOX1a-ORF-R (5’-TTAGTGATACCCAATTGGTGCT-3’), AOX1b-ORF-F (5’-ATGTGGGTTAGG

CATTTTCCAG-3’), and AOX1b-ORF-R (5’-TTAGTGATACCCAATTGGTGCT-3’). The sequences of

NbAOX1a and NbAOX1b were uploaded to the National Center for Biotechnology Information (NCBI). A

multiple alignment of the amino acid sequences of NbAOX1a (GenBank accession KF367455), AtAOX1a

(GenBank accession NM_113135), NbAOX1b (GenBank accession KF367456), and AtAOX1b (GenBank

accession NM_113134) was performed with CLUSTAL 2.1.

2.2. Plant materials and growth conditions

The N-transgenic N. benthamiana and wild-type N. benthamiana plants were grown in a greenhouse at 25°C with a 16-h-light/8-h-dark cycle (100 µmol m-2 s-1). Six- to seven-week-old seedlings were used in the

experiments.

2.3. Chemical treatments and pathogen inoculations

At least six wild-type N. benthamiana seedlings were subjected to pharmacological pretreatment and

subsequent virus inoculation. In brief, 3-4 upper, fully developed wild-type N. benthamiana leaves were

treated at one site on the primary leaf with a final concentration of 1 mM KCN and a final concentration of

3.5 mM SHAM three days before inoculation with the virus, and then inoculated with TMV-GFP or TCV

on the secondary (systemic) leaves. Seedlings sprayed with distilled water three days before virus

inoculation were used as controls. The common strain of Turnip crinkle virus (TCV) was maintained in an

aqueous suspension of 0.02 M sodium phosphate buffer (PBS) at 4°C. The inocula preparation was

performed as described previously [35]. PBS buffer (pH 7.0) only inoculation was carried out as control.

Stock inocula of TCV were performed mechanically by dusting two leaves with sterile Carborundum. For

Tobacco mosaic virus (TMV) inoculation, Agrobacterium cultures at OD600 = 0.5 containing the TMVGFP construct were infiltrated into N. benthamiana leaves [36]. Empty Agrobacterium culture only

infiltration was carried out as control in TMV-GFP experiments. In the NbAOX transcript levels in response

to virus infection experiments, the inoculated leaves and systemic leaves were collected to detect the

expression of NbAOX1a and NbAOX1b. In other experiments, the systemic leaves were collected. All

experiments were repeated with similar results.

2.4. Construction of VIGS vectors and TRV-mediated VIGS assay

The pTRV vector for VIGS were carried out as described by Liu et al. (2002) [37]. Partial cDNA of the

NbAOX1a was amplified by PCR from a cDNA library of N-transgenic N. benthamiana leaf tissues using

gene-specific primers. The gene-specific primers are shown in Table S1. The RT-PCR products were cloned into the pCR®8/GW/TOPO® vector using a TOPO TA cloning kit (Invitrogen, USA) according to

the instructions of the manufacturer. Partial fragments of NbAOX1a were then inserted into the Tobacco

rattle virus (TRV) vector (pTRV-RNA2).

The VIGS assay was performed as described previously [37]. Simply, pTRV1 or pTRV2 and pTRV-

NbAOX1a were respectively introduced into Agrobacterium strain GV2260 via electroporation method

(BIO-RAD, USA). Agrobacterium cultures containing pTRV1 and pTRV2 or pTRV-NbAOX1a were mixed

at a 1:1 ratio and infiltrated into the lower leaf of 4-leaf stage plants using a 1-ml needleless syringe. In

addition, we used 12 days post-silenced plants for virus infections because the RT-PCR analysis of the

silenced plants showed a significant reduction in the RNA levels at this time point compared with non-

silenced plants.

2.5. GFP imaging

The GFP fluorescence was photographed under UV light using a Canon G11 digital camera and a B-

100AP longwave-UV lamp (Ultra-Violet Products).

2.6. Protein extraction and western blot analysis

The total proteins were extracted with extraction buffer (50 mM Tris-Cl, pH 6.8, 5% mercaptoethanol,

10% glycerol, 4% SDS, and 4 M urea) in an ice bath. The protein concentrations were determined through

the Bradford method using bovine serum albumin as the standard [38]. The western blot analysis was

performed according to the protocol described by Zhu et al. (2012) [39].

2.7. RNA extraction, RT-PCR, and quantitative real-time PCR

The total RNAs were isolated from N. benthamiana leaves by the TRIzol Reagent according to the

manufacturer’s recommendations (Invitrogen, Carlsbad, CA, USA). The purity of the RNA samples was

detected by measuring the A260/A280 absorbance ratios, which were approximately 1.9 for all of the samples. All of the RNA samples were treated with DNase I before RT-PCR. For RT-PCR, the first-strand cDNA

was prepared using the ReverTra Ace kit (Toyobo Co., Ltd., Osaka, Japan). To further assay the expression

levels of genes, quantitative real-time PCR analysis was performed on a Bio-Rad iCycler (Bio-Rad, Beijing,

China). The relative quantitation of the target gene expression level was performed using the comparative

Ct (threshold cycle) method [40,41]. Three technical replicates were performed for each experiment, which included at least three independent plants. The amplification of the Actin gene was used for an internal

control [42]. The quantitative real-time PCR and RT-PCR analysis were performed using the primers

shown in Table S2.

2.8. Respiration measurements

The respiration of leaves was detected by Clark-type electrodes (Hansatech, UK) based on the methods

described by Millenaar et al. (2002) [43] with some modifications.

Briefly, before the respiration

measurements, the plants were maintained in the dark for 20 min. The leaf was weighed and cut into small

pieces by a razor blade. The measurements were carried out in a final volume of 2 ml of phosphate buffer

(20 mM, pH 6.8) at 25ºC, and then the cuvette was tightly closed to prevent oxygen diffusion. 1 mM KCN

was added to inhibit the COX pathway and thus obtain the cyanide-resistant respiration. The total

respiration (Vt) was defined as the oxygen uptake rate without any inhibitor. The AOX pathway capacity respiration (Valt) was defined as the oxygen uptake rate in the presence of KCN.

2.9. Superoxide and H2O2 staining Superoxide and H2O2 were visually detected with nitro blue tetrazolium (NBT) reagent and 3,3diaminobenzidine (DAB), as described previously [44]. The N. benthamiana leaves were excised at the

base using a razor blade and then supplied through the cut ends with NBT (0.5 mg/mL) solutions for 2 h or

DAB (2 mg/mL) solutions for 8 h. The N. benthamiana leaves were completely decolorized in boiling

ethanol (95%) for 15 min.

2.10. H2O2 determination The endogenous concentrations of H2O2 were detected as described previously [4]. The H2O2 concentrations were determined using an Amplex red hydrogen peroxide/peroxidase assay kit (Invitrogen).

2.11. Statistical analysis

The values presented are the means ± SD of at least three replicates. The data were then subjected to

analysis of variance using the JMP IN software (Version 4, SAS Institute, http://www.sas.com/). The

significance of each treatment effect was determined by the magnitude of the F value at P = 0.05. After a

significant F value was obtained for the treatments, separation of the means was accomplished using

Fisher’s protected least-significant difference (LSD) at P = 0.05.

3. Results 3.1. Identification of AOX gene sequences in Nicotiana benthamiana

Based on their sequence homology to the Nicotiana tabacum AOX gene, two AOX genes were identified

from the N. benthamiana genome and named NbAOX1a and NbAOX1b. We cloned the full-length

NbAOX1a and NbAOX1b genes by RT-PCR. The NbAOX1a protein shares 66.57% identity with

Arabidopsis AOX1a (AtAOX1a, GenBank accession NM_113135) (Fig. S1A), and the NbAOX1b protein

shares 70.77% identity with Arabidopsis AOX1b (AtAOX1b, GenBank accession NM_113134) (Fig. S1B).

3.2. Analysis of CN-insensitive respiration and NbAOX transcript and protein levels in response to virus

infection

The AOX plays a pivotal role in the response to abiotic stress and pathogen invasion. We examined the

total respiration (Vt), CN-insensitive respiration (Valt), and NbAOX transcript levels in wild-type leaves infected with TMV-GFP (green fluorescent protein (GFP)-tagged TMV, which is an infectious recombinant

TMV) or TCV over a six-day time course (Figs. 1 and 2; Fig. S2A). As shown in Fig. 1, Vt and Valt were significantly increased in both TMV-GFP and TCV-infected leaves 3 days post inoculation (dpi) (Fig. 1A)

and 6 dpi (Fig. 1B). The expression of NbAOX1a and NbAOX1b was then investigated by quantitative real-

time PCR. The NbAOX1a and NbAOX1b mRNAs were significantly up-regulated in TMV-GFP infected

inoculated leaves and systemic leaves 3 dpi and 6 dpi compared with leaves from non-infected plants (Fig.

2A and B). These changes were also observed in the TCV-infected plants (Fig. 2C and D). To further

investigate the regulation of AOX in response to virus infection, the expression of AOX protein was

determined over a six-day time course by western blotting. The levels of AOX protein were significantly

induced in TMV-GFP and TCV-infected leaves 3 dpi and 6 dpi (Fig. S2B and C). Taken together, these

results suggest that the AOX expression is involved in the response to virus invasion.

3.3. Effect of AOX activation and suppression on viral resistance

Salicylhydroxamic acid (SHAM) is an artificial chemical inhibitor of AOX activity and has been used in

AOX studies in intact tissues [45-48]. No observable phenotypic effects on plant growth and development

were detected in N. benthamiana leaves treated with KCN or SHAM compared with the wild-type plants

(Fig. S3A). After the chemical alteration of AOX activity through KCN (a cytochrome pathway inhibitor)

or SHAM pretreatment, the wild-type N. benthamiana plants were challenged with TMV-GFP or TCV, and

the CN-resistant respiration and the transcript levels of the AOX genes were analyzed throughout the

experimental period. The indication of virus inoculation is showed in Fig.S3B. As expected, the alternative

pathway capacity was promoted by KCN and inhibited by SHAM effectively both during and after (0 dpi)

the three-day pretreatment (Fig. 3). The CN-resistant respiration was increased by approximately 46% in

the KCN-pretreated plants and reduced by approximately 55% in the SHAM-pretreated plants at 0 dpi (Fig.

3). Three days after foliar KCN or SHAM application, the plants were subjected to TMV-GFP or TCV

inoculation. The CN-resistant respiration was also significantly increased in the KCN + TMV-treated plants

and decreased in the SHAM + TMV-treated plants 3 and 6 dpi compared with the mock-treated plants (Fig.

3A). These changes were also observed in the KCN + TCV- and SHAM + TCV-treated plants at the

corresponding time points (Fig. 3B). The transcripts of NbAOX1a and NbAOX1b were also increased by

KCN and decreased by SHAM application 0 dpi (Fig. S4). The expression of NbAOX1a and NbAOX1b was

significantly up-regulated in the KCN-pretreated plants and down-regulated in the SHAM-pretreated plants

three days after TMV-GFP inoculation compared with the mock-pretreated plants (Fig. S4A and B). There

was no significant difference in the KCN-pretreated plants compared with the mock-pretreated plants six

days after TMV-GFP inoculation (Fig. S4A and B). These changes were also observed in the KCN-

pretreated and the SHAM-pretreated plants three and six days after TCV inoculation (Fig. S4C and D).

The symptoms and the levels of virus replication and expression were then detected over a 15-day time

course. We tested the control and treated N. benthamiana plants to determine their resistance against

infection using TMV-GFP [36]. The results showed that N. benthamiana plants pretreated with SHAM

displayed the most serious symptoms after virus inoculation compared with the mock- or KCN-pretreated

plants (Fig. 4A). As shown in Fig. 4A, N. benthamiana plants treated with SHAM after TMV-GFP

inoculation appeared to have the strongest GFP fluorescence in the systemic leaves 7 dpi. In addition,

netlike yellow veins, leaf crinkling, and serious stunting symptoms were observed 7 dpi in SHAM-

pretreated plants infected with TCV (Fig. 4A). However, the N. benthamiana plants treated with KCN

exhibited the weakest GFP fluorescence in the systemic leaves 7 dpi (Fig. 4A). Only slight symptoms were

observed 7 dpi in KCN-pretreated plants infected with TCV (Fig. 4A). Moreover, the levels of virus

replication and expression were highly correlated with the observed symptoms (Fig. 4B–E). KCN

pretreatment led to a significant decrease in TMV-CP and TCV-CP mRNA accumulation, whereas SHAM

treatment markedly increased the TMV-CP and TCV-CP transcript levels compared with those found in the

mock-treated plants at the corresponding time points (Fig. 4D and E). To further corroborate the qRT-PCR

results, western blotting was employed to detect the expression of the viral coat protein. The protein

immunoblots showed that the expression levels of the coat protein of TMV and TCV were significantly

decreased in KCN-treated plants compared with mock-treated plants, and only slight bands were detected 7

dpi and 15 dpi (Fig. 4B and C). In contrast, strong bands were observed in the SHAM-pretreated plants 7

dpi and 15 dpi compared with the mock-treated plants (Fig. 4B and C). Taken together, these results

suggest that the activation of AOX can enhance plant systemic resistance to virus infection, whereas the

suppression of AOX compromises plant systemic resistance.

3.4. SHAM-treated plants accumulate higher levels of ROS after virus infection

ROS is an important signaling molecule in eukaryotic cells [49]. The production of ROS is often

correlated with plant cell death and enhanced susceptibility to pathogens [50,51]. We first examined the levels of H2O2 and O2- by semiquantitative histochemical 3,3’-diaminobenzidine (DAB) and nitro blue tetrazolium (NBT) staining of SHAM- and KCN-pretreated plants after virus infection, respectively. No

ROS production occurred spontaneously in uninfected N. benthamiana plants (Fig. 5). Furthermore,

pretreatment with SHAM or KCN had very little effect on the generation of ROS (Fig. S5A). ROS

production was consistently observed to be stronger in SHAM-pretreated plants compared with mock-

treated plants after TMV-GFP infection at 7 dpi (Fig. 5A). In contrast, only a slight amount of ROS was

accumulated in KCN-pretreated plants seven days after TMV-GFP infection (Fig. 5A). Similar results were

also observed in both SHAM- and KCN-pretreated plants seven days after TCV infection (Fig. 5B). To

determine the H2O2 contents more precisely, we used a sensitive quantitative Amplex red hydrogen peroxide/peroxidase assay kit and determined the H2O2 levels in these leaves. SHAM pretreatment resulted in a strong increase in the H2O2 content of both TMV-GFP- and TCV-infected plants, whereas KCN pretreatment resulted in a significant decrease in the H2O2 content of both TMV-GFP- and TCV-infected plants (Fig. S5B and C).

3.5. NbAOX is required for the N gene-mediated resistance to TMV

We examined the function of NbAOX in the N gene-mediated resistance to TMV using a well-

established Tobacco rattle virus (TRV)-based virus-induced gene silencing (VIGS) approach [37]. This

system has been successfully used to identify and characterize the genes required for N gene-mediated

resistance to TMV [36,52]. To test the function of NbAOX in N gene-mediated defense, we targeted the 3’

region of NbAOX1a. Transgenic N-containing N. benthamiana plants were inoculated with Agrobacterium

containing the recombinant TRV-NbAOX1a, and empty TRV-vector (TRV:00) constructs. The gene-

silenced plants showed normal growth compared with the control TRV-00 infected plants (Fig. S6A). The

down-regulation of the NbAOX1a gene in the silenced plants was confirmed by RT-PCR 12 days after

infiltration (Fig. S6B). Furthermore, a multiple alignment of the gene sequences of NbAOX1a and

NbAOX1b was performed with CLUSTAL 2.1. The gene sequence of NbAOX1a shares 84.15% identity

with the NbAOX1b (Fig. S7). Therefore, the expression of NbAOX1b gene was detected in NbAOX1a-

silenced plants. The RT-PCR results shown that the expression of NbAOX1b gene was also silenced in

NbAOX1a-silenced plants (Fig.S6B). In addition, we also detected the respiratory capacity in NbAOX1a-

silenced plants. The results demonstrated that the respiratory capacity is reduced in NbAOX1a-silenced

plants (Fig.S6C).

The silenced plants were infected with TMV-GFP and monitored for the induction of hypersensitive

response (HR) cell death, which is a form of programmed cell death (PCD), resistance response, and viral

spread for at least two weeks. These plants were photographed under both normal light and UV light (Fig.

6A). In the TRV-00 control plants, TMV was restricted to the infection site, and there was no GFP

fluorescence in the upper un-inoculated leaves, which suggests that the upper un-inoculated leaves

remained healthy (Fig. 6A). However, the NbAOX1a-silenced plants exhibited a loss-of-resistance

phenotype that was characterized by a collapse of the inoculated leaf and the movement of TMV into the

systemic tissue, which eventually led to the spread of HR-PCD and the death of the whole plant (Fig. 6A).

In addition, GFP fluorescence was obvious in the upper un-inoculated leaves of the NbAOX1a-silenced

plants (Fig. 6A). To characterize the virus-induced cell death at a molecular level, the expression of the

hypersensitive response marker HARPIN-INDUCED1 (HIN1) gene was examined. HIN1 is known to be

highly expressed during incompatible plant-pathogen interactions [53]. NbHIN1 transcripts were

significantly increased 7 dpi in the NbAOX1a-silenced plants infected with TMV-GFP compared with the

control (TRV:00) plants (Fig. 6B).

To confirm that TMV spreads systemically into the upper un-inoculated leaves in the NbAOX1a-silenced

plants, we tested for the presence of TMV transcripts and proteins in the upper un-inoculated leaves. A

significant amount of TMV coat protein RNA was detected in the NbAOX1a-silenced plants but not in the

TRV-00 control plants (Fig. 6C). Furthermore, the expression of the coat protein of TMV was investigated

in the upper un-inoculated leaves by western blotting. As shown in Fig. 6D, strong bands were detected in

the NbAOX1a-silenced plants but not in the TRV-00 control plants. Overall, our results indicate that

NbAOX is required for N gene-mediated resistance to restrict TMV to the infection site.

To further corroborate the results of the above VIGS system analyses that indicated that NbAOX is

required for N gene-mediated resistance to restrict TMV, SHAM was employed to treat the transgenic N-

containing N. benthamiana plants. SHAM-pretreated plants were inoculated with TMV-GFP and monitored

for the induction of HR-PCD and resistance response. As expected, in the mock-treated plants, TMV was

restricted to the infection site, and the upper un-inoculated leaves remained healthy (no GFP fluorescence)

(Fig. 7A). In contrast, the SHAM-treated plants exhibited a loss-of-resistance phenotype (Fig. 7A).

Abundant GFP fluorescence could be observed in the upper un-inoculated leaves of the SHAM-treated

plants (Fig. 7A). In the SHAM-pretreated plants, the inoculated leaf collapsed, and the movement of TMV

into the systemic tissue eventually led to the spread of HR-PCD and the death of the whole plant (Fig. 7A).

Furthermore, the expression of the HR marker HIN1 gene was significantly increased 7 dpi in the SHAM-

treated plants infected with TMV-GFP compared with the control (Mock) plants (Fig. 7B).

To confirm that TMV spreads systemically into the upper un-inoculated leaves of the SHAM treated

plants, the levels of TMV transcript and protein were tested in the upper un-inoculated leaves by RT-PCR

and western blotting (Fig. 7C and D). A significant amount of TMV coat protein RNA was detected in the

SHAM-treated plants but not in the mock-treated plants (Fig. 7C). A strong band was detected in the

SHAM-treated plants but not in the mock-treated plants (Fig. 7D). Taken together, these results further

suggest that NbAOX is required for N gene-mediated resistance to restrict TMV.

4. Discussion Several studies have suggested that AOX may function in the resistance to biotic stresses. For example,

AOX1a participates in plant signal transduction pathway(s) and is involved in the defense response against

pathogens [54]. The expression of AOX1a was increased in both compatible and incompatible plant-

pathogen interactions [20,55]. For example, the NaAOX transcript levels increased significantly in response

to infection with piercing-sucking insects, bacterial pathogens and chewing herbivores [4]. The treatment of

plants with SHAM antagonizes the SA-induced resistance to viruses, at least in tobacco [46,48]. The

expression levels of AOX1a were enhanced in mustard plants after TuMV infection [47]. In contrast, the

overexpression of AOX in N. benthamiana plants increased susceptibility of plants to virus accumulation in

PVX-infected transgenic N. benthamiana plants [18]. They thought that AOX could regulate SA-induced

resistance to PVX. Apparently, the mechanisms of AOX in the systemic antiviral defense response are

complex and varied [9,22,23]. It is necessary to further investigate the role of AOX in the systemic defense

response against pathogens. In agreement with previous reports [46,56], SHAM (AOX inhibitor)

pretreatment resulted in a significant increase in the virus replication and expression levels in the systemic

leaves of N. benthamiana plants infected with TMV-GFP or TCV, whereas KCN (AOX elicitor)

pretreatment resulted in a significant decrease in the virus replication and expression levels. Our results

indicate that AOX plays a broad and significant role in the induction of the systemic basal defense to RNA

virus infection.

The signaling molecules such as NO, SA, and H2O2 have been shown to induce AOX in numerous species and contexts strongly, and these molecules are all showed to accumulate in response to pathogen

infection. AOX-regulated mechanisms play a role in the SA-induced resistance to virus [18]. The

relationship between AOX and NO in the virus-induced systemic defense to TMV was also investigated in

susceptible tomato plants by Fu et al. (2010) [56]. Their results suggest that TMV-induced NO is required

for the induction of AOX, which induces mitochondrial electron transport and triggers a systemic defense

response against virus infection [56]. Previous study showed that the H2O2 accumulation in mitochondria and chloroplasts is increased after CMV infection in cucumber [24]. The aox1a mutants showed increased

ROS accumulation in the Arabidopsis roots after direct inhibition of the Cyt respiratory pathway by KCN

[57]. In addition, the lack of AOX function moderately increased the H2O2 levels in Pst DC3000-infected AOX-silenced N. attenuata plants, which suggests that AOX can regulate ROS accumulation [4]. The

analyses of the AOX role in the decrease in the cellular ROS formation in plants have been mainly carried

out from isolated mitochondria and suspension-culture cells [58,59]. However, the involvement of reduced

ROS production in the AOX-associated defense response has rarely been addressed in the whole plant-

pathogen interaction system. At present, only a few studies have investigated the change of AOX content in

a whole plant-TMV interaction [20,21,60]. Therefore, in this study, we also utilized a whole plant-virus

interaction system. The relationship between plant defense response and ROS reduction mediated by AOX was mainly obtained through pharmacological and transgenic approaches [21,60]. Extensive studies suggest that both KCN and SHAM have multiple action in plants. For example, SHAM can affect the activities of peroxidases and lipoxygenases [46]. In this report, both H2O2 and O2- histochemical staining indicated that SHAM pretreatment resulted in a significant increase in the ROS levels in the systemic

leaves of N. benthamiana plants infected with TMV-GFP or TCV, whereas KCN pretreatment resulted in a

significant decrease in the ROS levels. The H2O2 levels are usually used as a marker of ROS production upon TMV infection [21]. The quantitative determination of the H2O2 levels confirmed that the levels of H2O2 were higher in the SHAM-pretreated N. benthamiana leaves and lower in the KCN-pretreated N.

benthamiana leaves compared with the leaves of the control plants after TMV-GFP or TCV inoculation.

The reduction in ROS accumulation may be an essential physiological role of AOX in the compatible

plant-virus interaction. The reason why AOX may reduce the ROS levels is that a second oxidase, which is

located downstream of the UQ pool, could maintain the upstream electron-transport components that

remained in a more oxidized state and thereby reduces the ROS production by over-reduced electron

carriers [61]. Therefore, our results might establish a crosstalk between AOX and ROS in the regulation of

the systemic antiviral defense response. In addition, other mechanisms might also work in the regulation of

the defense response. For example, the SA-mediated viral defense response in plants is involved in RNA

silencing mechanism mediated by RNA-dependent RNA polymerase 1 (RDR1) and AOX-mediated

defense pathway. Therefore, the relationship between these two defense-related pathways was studied.

Silencing SlRDR1 significantly reduced tomato resistance against TMV but had no significant effect on the

expression of SlAOX1a. In contrast, silencing SlAOX1a blocked the expression of SlRDR1 which induced

by TMV infection and decreased the defense response against TMV. Therefore, this results indicate that

RDR1 plays a role in the AOX-associated defense against TMV infection [62].

Previous studies have shown that the N gene confers strong resistance to TMV in transgenic tomato [63]

and N. benthamiana [36]. The interaction between N gene product and the helicase domain (50 kDa) of the

TMV replicase leads to the induction of HR-PCD in the form of local necrotic lesions. HR-PCD typically

results in changing in ion fluxes, the production of reactive oxygen intermediates (ROI) and NO, cell wall

strengthening, and the activation of various defense-related genes [64]. These defense responses are

thought to prevent the spread of the TMV from inoculation sites to other plant parts. Some studies have

investigated the relationship between AOX and the susceptibility to PCD induced by biotic or abiotic

stresses. For example, treatment with KCN activated AOX expression and restored TMV localization and

normal lesion in NN-type tobacco transformed with NahG gene. The results suggest that cyanide can

restore N gene–mediated resistance to TMV [33]. Overexpression of AOX in Arabidopsis protoplasts was

proved to protect against aluminum-induced PCD [65], whereas Overexpression of AOX in the TMV-

infected tobacco leaves resulted in reducing HR lesions [20]. Furthermore, overexpression of AOX in

tobacco cultivar Samsun NN plants allowed an increase in TMV spread [21]. However, the data presented

in this report show that silencing of NbAOX in N-transgenic N. benthamiana allows the spread of TMV into

the upper un-inoculated leaves. The reason for the discrepancy between our results and other groups [21]

are likely due to different experimental materials and conditions used for N gene-mediated resistance

assessment. In this study, we use N-transgenic N. benthamiana and TMV-GFP interaction system to study

the function of AOX in the N gene-mediated resistance against TMV. This system is widely applied in

studying functional genes in the N gene-mediated resistance against TMV [36,52,66]. First, the SHAM-

treated plants and the NbAOX1a-silenced plants infected with TMV exhibited a loss-of-resistance

phenotype. In these plants, the inoculated leaf collapsed, and the movement of TMV into the systemic

leaves eventually led to the spreading of HR-PCD and the death of the whole plant. GFP fluorescence was

obviously observed in the upper un-inoculated leaves of the SHAM-treated plants and the NbAOX1a-

silenced plants. Second, the expression of PCD marker gene HIN1 enhanced significantly more in AOX-

silenced tobacco leaves compared with the control after Pst DC3000 infection [4]. Our results also

indicated the transcript levels of the cell death marker HIN1 gene were significantly increased in the

SHAM-treated plants and the NbAOX1a-silenced plants. Finally, significant amounts of TMV-CP mRNA

and protein were detected in the SHAM-treated plants and the NbAOX1a-silenced plants but not in the

control plants. These results corroborate that AOX plays an important role in the N gene-mediated

resistance against TMV.

In summary, we have shown that AOX plays a broad and significant role in the induction of the systemic

basal defense to RNA virus infection. Several lines of evidence established the existence of a crosstalk

between AOX and ROS in the regulation of the systemic antiviral defense response (Fig. 8A). The AOX

was up-regulated under a compatible tobacco-virus combinations. AOX induction was in a central position

to decrease ROS accumulation, and functioned to increase the plants systemic antiviral defense response

(Fig. 8A). Furthermore, we also showed that NbAOX is required for N gene-mediated resistance to TMV

infection (Fig. 8B). The NbAOX1a-silenced plants showed a loss-of-resistance phenotype that was

characterized by the movement of TMV into the systemic tissue, which eventually led to the spread of HR-

PCD and the death of the whole plant (Fig. 8B). Taken together, our results suggest that AOX plays an

important role in both compatible and incompatible plant-virus combinations.

Acknowledgements

We thank Dr. Steve Whitham (Iowa State University, Iowa, USA) for providing pTRV vector and TMV-

GFP and Dr. Floyd Lester Erickson (Salisbury University, Salisbury, Maryland) for providing the N-

transgenic N. benthamiana seeds. This work was supported by the National Natural Science Foundation of

China (91417305, 31470342, 31400211, 31400242), the National Basic Research Program of China (973

Program) (2015CB150100), and Sichuan Natural Science Foundation (2015JY0101, 2015JY0223).

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version.

References [1] A. Jones, Does the plant mitochondrion integrate cellular stress and regulate programmed cell death?

Trends Plant Sci. 5 (2000) 225–230.

[2] D.R. Green, J.C. Reed, Mitochondria and apoptosis. Science 281 (1998) 1309–1312.

[3] E. Lam, N. Kato, N. Lawton, Programmed cell death, mitochondria and the plant hypersensitive

response. Nature 411 (2001) 848–853.

[4] L. Zhang, Y. Oh, H.Y. Li, I.T. Baldwin, I. Galis, Alternative oxidase in resistance to biotic stresses:

Nicotiana attenuata AOX contributes to resistance to a pathogen and a piercing-sucking insect but not

Manduca sexta larvae. Plant Physiol. 160 (2012) 1453–1467.

[5] W.G. van Doorn, Classes of programmed cell death in plants, compared to those in animals. J. Exp. Bot.

62 (2011) 4749–4761.

[6] G.C. Vanlerberghe, C.A. Robson, J.Y.H. Yip, Induction of mitochondrial alternative oxidase in

response to a cell signal pathway down-regulating the cytochrome pathway prevents programmed cell

death. Plant Physiol. 129 (2002) 1829–1842.

[7] A.E. McDonald, Alternative oxidase: an inter-kingdom perspective on the function and regulation of

this broadly distributed ’cyanide-resistant’ terminal oxidase. Funct. Plant Biol. 35 (2008) 535–552.

[8] A.L. Moore, and J.N. Siedow, The regulation and nature of the cyanide-resistant alternative oxidase of

plant mitochondria. BBA-Bioenergetics 1059 (1991) 121–140.

[9] G.C. Vanlerberghe, L. McIntosh, Mitochondrial electron transport regulation of nuclear gene expression:

studies with the alternative oxidase gene of tobacco. Plant Physiol. 105 (1994) 867–874.

[10] B.J.D. Meeuse, Thermogenic respiration in aroids. Annu. Rev. Plant Biol. 26 (1975) 117–126.

[11] F. Xu, S. Yuan, D.W. Zhang, X. Lv, H.H. Lin, The role of alternative oxidase in tomato fruit ripening

and its regulatory interaction with ethylene. J. Exp. Bot. 63 (2012) 5705–5716.

[12] M.J. Considine, D.O. Daley, J. Whelan, The expression of alternative oxidase and uncoupling protein

during fruit ripening in mango. Plant Physiol. 126 (2001) 1619–1629.

[13] C. Hiser, L. McIntosh, Alternative oxidase of potato is an integral membrane protein synthesized de

novo during aging of tuber slices. Plant Physiol. 93 (1990) 312–318.

[14] C.G. Bartoli, F. Gomez, G. Gergoff, J.J. Guiamét, S. Puntarulo, Up-regulation of the mitochondrial

alternative oxidase pathway enhances photosynthetic electron transport under drought conditions. J.

Exp. Bot. 56 (2005) 1269–1276.

[15] H.Q. Feng, Y.F. Wang, H.Y. Li, R.F. Wang, K. Sun, L.Y. Jia, Salt stress-induced expression of rice

AOX1a is mediated through an accumulation of hydrogen peroxide. Biologia 65 (2010) 868–873.

[16] J. Wang, N. Rajakulendran, S. Amirsadeghi, G.C. Vanlerberghe, Impact of mitochondrial alternative

oxidase expression on the response of Nicotiana tabacum to cold temperature. Physiol. Plant. 142

(2011) 339–351.

[17] D.P. Singh, C.A. Moore, A. Gilliland, J.P. Carr, Activation of multiple antiviral defence mechanisms

by salicylic acid. Mol. Plant Pathol. 5 (2004) 57–63.

[18] W.S. Lee, S.F. Fu, J. Verchot-Lubicz, J.P. Carr, Genetic modification of alternative respiration in

Nicotiana benthamiana affects basal and salicylic acid-induced resistance to potato virus X. BMC

Plant Biol. 11 (2011) 41.

[19] Y.W.K. Liao, K. Shi, L.J. Fu, S. Zhang, X. Li, D.K. Dong, Y.P. Jiang, Y.H. Zhou, X.J. Xia, W.S.

Liang, J.Q. Yu, The reduction of reactive oxygen species formation by mitochondrial alternative

respiration in tomato basal defense against TMV infection. Planta 235 (2012) 225–238.

[20] S.H. Ordog, V.J. Higgins, G.C. Vanlerberghe, Mitochondrial alternative oxidase is not a critical

component of plant viral resistance but may play a role in the hypersensitive response. Plant Physiol.

129 (2002) 1858–1865.

[21] A.M. Murphy, A. Gilliland, C.J. York, B. Hyman, J.P. Carr, High-level expression of alternative

oxidase protein sequences enhances the spread of viral vectors in resistant and susceptible plants. J.

Gen. Virol. 85 (2004) 3777–3786.

[22] C.A. Robson, G.C. Vanlerberghe, Transgenic plant cells lacking mitochondrial alternative oxidase

have increased susceptibility to mitochondria -dependent and -independent pathways of programmed

cell death. Plant Physiol. 129 (2002) 1908–1920.

[23] C.N. Mayers, K.C. Lee, C.A. Moore, S.M. Wong, J.P. Carr, Salicylic acid-induced resistance to

cucumber mosaic virus in squash and Arabidopsis thaliana: contrasting mechanisms of induction and

antiviral action. Mol. Plant-Microbe Interact. 18 (2005) 428–434.

[24] X.S. Song, Y.J. Wang, W.H. Mao, K. Shi, Y.H. Zhou, S. Nogues, J.Q. Yu, Effects of Cucumber

mosaic virus infection on electron transport and antioxidant system in chloroplasts and mitochondria

of cucumber and tomato leaves. Physiol. Plant. 135 (2009) 246–257.

[25] M.A. Torres, J.L. Dangl, Functions of the respiratory burst oxidase in biotic interactions, abiotic stress

and development. Curr. Opin. Plant Biol. 8 (2005) 397–403.

[26] N. Navrot, N. Rouhier, E. Gelhaye, J.P. Jacquot, Reactive oxygen species generation and antioxidant

systems in plant mitochondria. Physiol. Plant. 129 (2007) 185–195.

[27] L. Kiraly, Y.M. Hafez, J. Fodor, Z. Kiraly, Suppression of Tobacco mosaic virus-induced

hypersensitive-type necrotization in tobacco at high temperature is associated with downregulation of

NADPH oxidase and superoxide and stimulation of dehydroascorbate reductase. J. Gen. Virol. 89

(2008) 799–808.

[28] G.B. Martin, A.J. Bogdanove, G. Sessa, Understanding the functions of plant disease resistance

proteins. Annu. Rev. Plant Biol. 54 (2003) 23–61.

[29] J.L. Dangl, J.D.G. Jones, Plant pathogens and integrated defence responses to infection. Nature 411

(2001) 826–833.

[30] M.A. Gururani, J. Venkatesh, C.P. Upadhyaya, A. Nookaraju, S.K. Pandey, S.W. Park, Plant disease

resistance genes: Current status and future directions. Physiol. Mol. Plant Pathol. 78 (2012) 51–65.

[31] S. Whitham, S.P. Dinesh-Kumar, D. Choi, R. Hehl, C. Corr, B. Baker, The product of the tobacco

mosaic virus resistance gene N: similarity to toll and the interleukin-1 receptor. Cell 78 (1994) 1101–

1115.

[32] F.L. Erickson, S. Holzberg, A. Calderon-Urrea, V. Handley, M. Axtell, C. Corr, B. Baker, The

helicase domain of the TMV replicase proteins induces the N-mediated defense response in tobacco.

Plant J. 18 (1999) 67–75.

[33] S. Chivasa, J.P. Carr, Cyanide restores N gene-mediated resistance to tobacco mosaic virus in

transgenic tobacco expressing salicylic acid hydroxylase. Plant Cell 10 (1998)1489–1498.

[34] C.M. Rojas, M. Senthil-Kumar, K. Wang, C.M. Ryu, A. Kaundal, K.S. Mysore, Glycolate oxidase

modulates reactive oxygen species–mediated signal transduction during nonhost resistance in

Nicotiana benthamiana and Arabidopsis. Plant Cell 24 (2012) 336–352.

[35] D.H. Xi, H. Yang, Y. Jiang, M.Y. Xu, J. Shang, Z.W. Zhang, S.Y. Cheng, L.S. Sang, H.H. Lin,

Interference between Tobacco necrosis virus and Turnip crinkle virus in Nicotiana benthamiana. J.

Phytopathol. 158 (2010) 263–269.

[36] Y. Liu, M. Schiff, R. Marathe, S.P. Dinesh-Kumar, Tobacco Rar1, EDS1 and NPR1/NIM1 like genes

are required for N-mediated resistance to tobacco mosaic virus. Plant J. 30 (2002) 415–429.

[37] Y. Liu, M. Schiff, S.P. Dinesh-Kumar, Virus-induced gene silencing in tomato. Plant J. 31 (2002)

777–786.

[38] M.N. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein

utilizing the principle of protein-dye binding. Ann. Biochem. 72 (1976) 248–254.

[39] F. Zhu, M.Y. Xu, S.D. Wang, S.D. Jia, P. Zhang, H.H. Lin, D.H. Xi, Prokaryotic expression of

pathogenesis related protein 1 gene from Nicotiana benthamiana: antifungal activity and preparation

of its polyclonal antibody. Biotechnol. Lett. 34 (2012) 919–924.

[40] F. Zhu, D.H. Xi, X.G. Deng, X.J. Peng, H. Tang, Y.J. Chen, W. Jian, H. Feng, H.H. Lin, The Chilli

veinal mottle virus regulates expression of the Tobacco mosaic virus resistance gene N and jasmonic

acid/ethylene signaling is essential for systemic resistance against Chilli veinal mottle virus in tobacco.

Plant Mol. Biol. Rep. 32 (2014) 382–394.

[41] F. Zhu, P. Zhang, Y.F. Meng, F. Xu, D.W. Zhang, J. Cheng, H.H. Lin, D.H. Xi, Alpha-momorcharin, a

RIP produced by bitter melon, enhances defense response in tobacco plants against diverse plant

viruses and shows antifungal activity in vitro. Planta 237 (2013) 77–88.

[42] F. Zhu, D.H. Xi, S. Yuan, F. Xu, D.W. Zhang, H.H. Lin, Salicylic acid and jasmonic acid are essential

for systemic resistance against Tobacco mosaic virus in Nicotiana benthamiana. Mol. Plant-Microbe

Interact. 27 (2014) 567–577.

[43] F.F. Millenaar, M.A. Gonzalez-Meler, J.N. Siedow, A.M. Wagner, H. Lambers, Role of sugars and

organic acids in regulating the concentration and activity of the alternative oxidase in Poaannua roots.

J. Exp. Bot. 53 (2002) 1081–1088.

[44] Y. Cao, Z.W. Zhang, L.W. Xue, J.B. Du, J. Shang, F. Xu, S. Yuan, H.H. Lin, Lack of salicylic acid in

NahG Arabidopsis protects plants against moderate salt stress. Z. Naturforsch 64c (2009) 231–238.

[45] A. Fu, H. Liu, F. Yu, S. Kambakam, S. Luan, S. Rodermel, Alternative oxidases (AOX1a and AOX2)

can functionally substitute for plastid terminal oxidase in Arabidopsis chloroplasts. Plant Cell 24

(2012) 1579–1595.

[46] C.E. Wong, R.A.J. Carson, J.P. Carr, Chemically induced virus resistance in Arabidopsis thaliana is

independent of pathogenesis-related protein expression and the NPR1 gene. Mol. Plant-Microbe

Interact. 15 (2002) 75–81.

[47] L. Zhu, Y.M. Li, N. Ara, J.H. Yang, M.F. Zhang, Role of a newly cloned alternative oxidase gene

(BjAOX1a) in Turnip mosaic virus (TuMV) resistance in Mustard. Plant Mol. Biol. Rep. 30 (2012)

309–318.

[48] S. Chivasa, A.M. Murphy, M. Naylor, J.P. Carr, Salicylic acid interferes with tobacco mosaic virus

replication via a novel salicylhydroxamic acid-sensitive mechanism. Plant Cell 9 (1997) 547–557.

[49] D.M. Rhoads, A.L. Umbach, C.C. Subbaiah, J.N. Siedow, Mitochondrial reactive oxygen species.

Contribution to oxidative stress and inter organellar signaling. Plant Physiol. 141 (2006) 357–366.

[50] K. Overmyer, M. Brosche, J. Kangasjarvi, Reactive oxygen species and hormonal control of cell death.

Trends Plant Sci. 8 (2003) 335–342.

[51] R. Mittler, S. Vanderauwera, M. Gollery, F. Van Breusegem, Reactive oxygen gene network of plants.

Trends Plant Sci. 9 (2004) 490–498.

[52] M.S. Padmanabhan, S. Ma, T.M. Burch-Smith, K. Czymmek, P. Huijser, S.P. Dinesh-Kumar, Novel

positive regulatory role for the SPL6 transcription factor in the N TIR-NB-LRR receptor-mediated

plant innate immunity. PLoS Pathog. 9 (2013) e1003235.

[53] Y. Takahashi, T. Berberich, K. Yamashita, Y. Uehara, A. Miyazaki, T. Kusano, Identification of

tobacco HIN1 and two closely related genes as spermine-responsive genes and their differential

expression during the tobacco mosaic virus-induced hypersensitive response and during leaf and

flower-senescence. Plant Mol. Biol. 54 (2004) 613–622.

[54] B. Arnholdt-Schmitt, J.H. Costa D.F. de Melo, AOX — a functional marker for efficient cell

reprogramming under stress? Trends Plant Sci. 11 (2006) 281–287.

[55] B.H. Simons, F.F. Millenaar, L. Mulder, L.C. Van Loon, and H. Lambers, Enhanced expression and

activation of the alternative oxidase during infection of Arabidopsis with Pseudomonas syringae pv

tomato. Plant Physiol. 120 (1999) 529–538.

[56] L.J. Fu, K. Shi, M. Gu, Y.H. Zhou, D.K. Dong, W.S. Liang, F.M. Song, J.Q. Yu, Systemic induction

and role of mitochondrial alternative oxidase and nitric oxide in compatible tomato-Tobacco mosaic

virus interaction. Mol. Plant-Microbe Interact. 23 (2010) 39–48.

[57] A.L. Umbach, F. Fiorani, J.N. Siedow, Characterization of transformed Arabidopsis with altered

alternative oxidase levels and analysis of effects on reactive oxygen species in tissue. Plant Physiol.

139 (2005) 1806–1820.

[58] A.C. Purvis, Reduction of superoxide production by mitochondria oxidizing NADH in the presence of

organic acids. J. Plant Physiol. 158 (2001) 159–165.

[59] D. Pastore, D. Trono, M.N. Laus, N. Di Fonzo, S. Passarella, Alternative oxidase in durum wheat

mitochondria: activation by pyruvate, hydroxypyruvate and glyoxylate and physiological role. Plant

Cell Physiol. 42 (2001) 1373–1382.

[60] A. Gilliland, D.P. Singh, J.M. Hayward, C.A. Moore, A.M. Murphy, C.J. York, J. Slator, J.P. Carr,

Genetic modification of alternative respiration has differential effects on antimycin A-induced versus

salicylic acid-induced resistance to Tobacco mosaic virus. Plant Physiol. 132 (2003) 1518–1528.

[61] I.M. Møller, Plant mitochondria and oxidative stress: electron transport, NADPH turnover, and

metabolism of reactive oxygen species. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 (2001) 561–591.

[62] Y.W.K. Liao, Y.R. Liu, J.Y. Liang, W.P. Wang, J. Zhou, X.J. Xia, Y.H. Zhou, J.Q. Yu, K. Shi, The

relationship between the plant-encoded RNA-dependent RNA polymerase 1 and alternative oxidase in

tomato basal defense against Tobacco mosaic virus. Planta 241 (2015) 641–650.

[63] S. Whitham, S. McCormick, B. Baker, The N gene of tobacco confers resistance to tobacco mosaic

virus in transgenic tomato. Proc. Natl. Acad. Sci. USA 93 (1996) 8776–8781.

[64] J.M. McDowell, J.L. Dangl, Signal transduction in the plant immune response. Trends Biochem. Sci.

25 (2000) 79–82.

[65] Z. Li, and D. Xing, Mechanistic study of mitochondria dependent programmed cell death induced by

aluminum phytotoxicity using fluorescence techniques. J. Exp. Bot. 62 (2011) 331–343.

[66] Y. Liu, M. Schiff, S.P. Dinesh-Kumar, Involvement of MEK1 MAPKK, NTF6 MAPK, WARY/MYB

transcription factors, COI1 and CTR1 in N-mediated resistance to tobacco mosaic virus. Plant J. 38

(2004) 800–809.

Fig. 1. Effect of respiration in the upper un-inoculated leaves of N. benthamiana plants infected with RNA viruses. The total respiration (Vt) and CN-insensitive respiration (Valt) were determined in the upper un-inoculated leaves of N. benthamiana plants infected with TMVGFP or TCV at 3 (A) or 6 (B) dpi. The bars represent the means and standard deviation of the values obtained from three biological replicates. The different lowercase letters indicate significant differences (P < 0.05).

Fig. 2. Quantitative real-time PCR analysis of the transcript levels of AOX genes in the inoculated leaves and systemic leaves of N. benthamiana plants infected with RNA viruses. (A and B) Transcript levels of

NbAOX1a (A) and NbAOX1b (B) in the inoculated leaves and systemic leaves of N. benthamiana plants

infected with TMV-GFP over a six-day time course. (C and D) Transcript levels of NbAOX1a (C) and

NbAOX1b (D) in the inoculated leaves and systemic leaves of N. benthamiana plants infected with TCV

over a six-day time course. The bars represent the means and standard deviation of the values obtained

from three biological replicates at the indicated time points. The significant differences (P < 0.05) are

denoted by different lowercase letters.

Fig. 3. Change in the leaf cyanide (CN)-resistant respiration in the upper un-inoculated leaves of N. benthamiana plants. Changes in the leaf cyanide (CN)-resistant respiration in the upper un-inoculated

leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation with TMV-GFP (A) or

TCV (B) over a six-day time course. The bars represent the means and standard deviation of the values

obtained from three biological replicates at the indicated time points. The different lowercase letters

indicate significant differences (P < 0.05).

Fig. 4. Activation or suppression of AOX alters plant systemic resistance to RNA virus infection. (A) Symptoms of N. benthamiana plants pretreated with KCN or SHAM before inoculation with TMV-GFP or

TCV at 7 dpi. The symptoms in the TCV-infected seedlings are marked with red circles. (B and C)

Western-blotting analysis of the accumulation of the coat protein of TMV-GFP (B) and TCV (C) in the

upper un-inoculated leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation

with TMV-GFP or TCV over a 15-day time course. Rubisco proteins were used as loading controls and

stained with Ponceau S. All blots are run under the same experimental conditions. (D and E) Quantitative

real-time PCR analysis of the TMV-GFP (D) and TCV (E) replication levels in the upper un-inoculated

leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation with TMV-GFP or

TCV from 0 to 15 dpi. The bars represent the means and standard deviation of the values obtained from

three biological replicates at the indicated time points. The asterisk shows the significant differences with

the mock-treated leaves at the respective time points determined by one-way ANOVA (*P < 0.05, n = 3).

Fig. 5. ROS accumulation at 7 dpi in the upper un-inoculated leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation with TMV-GFP (A) or TCV (B). NBT staining revealed superoxide (O2-) production, and DAB staining revealed hydrogen peroxide (H2O2) production. The experiments were repeated three times with similar results.

Fig. 6. NbAOX function is required for the N gene-mediated resistance to TMV-GFP. (A) The symptoms in the TRV:NbAOX1a-silenced transgenic N-containing N. benthamiana plants infected with TMV-GFP at

7 dpi were investigated. (B) Quantitative real-time PCR analysis of the transcript levels of the cell death

marker gene NbHIN1 in the upper un-inoculated leaves of NbAOX1a-silenced transgenic N-containing N.

benthamiana plants infected with TMV-GFP at 7 dpi. The bars represent the means and standard deviation

of the values obtained from three biological replicates. The significant differences (P < 0.05) are denoted

by different lowercase letters. (C) RT-PCR analysis of TMV-GFP replication levels in the upper un-

inoculated leaves of the TRV:NbAOX1a-silenced transgenic N-containing N. benthamiana plants infected

with TMV-GFP at 7 dpi. Typical PCR products are also shown for Actin, which was used as an internal

standard to correct the quantity, from the same tissues. The products from PCR of cycles are 24, 28 and 32,

respectively. All gels are run under the same experimental conditions. (D) Western blotting analysis of the

accumulation of the coat protein of TMV-GFP in the upper un-inoculated leaves of the TRV:NbAOX1a-

silenced transgenic N-containing N. benthamiana plants infected with TMV-GFP at 7 dpi. Rubisco proteins

were used as loading controls and stained with Ponceau S. All blots are run under the same experimental

conditions.

Fig. 7. Suppression of NbAOX compromises the N gene-mediated resistance to TMV-GFP. (A) The symptoms in the SHAM-pretreated transgenic N-containing N. benthamiana plants infected with TMV-

GFP at 7 dpi were investigated. (B) Quantitative real-time PCR analysis of the transcript levels of the cell

death marker gene NbHIN1 in the upper un-inoculated leaves of SHAM-pretreated transgenic N-containing

N. benthamiana plants infected with TMV-GFP at 7 dpi. The bars represent the means and standard

deviation of the values obtained from three biological replicates. The different lowercase letters indicate

significant differences (P < 0.05). (C) RT-PCR analysis of the TMV-GFP replication levels in the upper

un-inoculated leaves of SHAM-pretreated transgenic N-containing N. benthamiana plants infected with

TMV-GFP at 7 dpi. The typical PCR products are also shown for Actin, which was used as an internal

standard to correct the quantity, from the same tissues. Products from PCR of cycles are 24, 28 and 32,

respectively. All gels are run under the same experimental conditions. (D) Western blotting analysis of the

accumulation of the coat protein of TMV-GFP in the upper un-inoculated leaves of SHAM-pretreated

transgenic N-containing N. benthamiana plants infected with TMV-GFP at 7 dpi. Rubisco proteins were

used as loading controls and stained with Ponceau S. All blots are run under the same experimental

conditions.

Fig. 8. A proposed model for the role of AOX in both compatible and incompatible plant-virus combinations. (A) A proposed model for the role of AOX in compatible plant-virus combination. The AOX

was up-regulated under a compatible tobacco-virus combinations. The alternative pathway capacity was

promoted by KCN and inhibited by SHAM effectively. Pretreatment with potassium cyanide greatly

increased the plant’s systemic resistance, whereas the application of salicylhydroxamic acid significantly

compromised the plant’s systemic resistance. AOX induction was in a central position to reduce ROS

production, and thus functioned to enhance the plants systemic antiviral defense response. (B) A proposed

model for the role of AOX in incompatible plant-virus combination. TMV was restricted to the infection

site in the controls plants. However, the NbAOX1a-silenced plants exhibited a loss-of-resistance phenotype

that was characterized by a collapse of the inoculated leaf and the movement of TMV into the systemic

tissue, which eventually led to the spread of HR-PCD and the death of the whole plant. NbAOX is required

for N gene-mediated resistance to restrict TMV to the infection site.

Supplementary material

Fig. S1. Comparison of NbAOX and AtAOX amino acid sequences. (A) Multiple alignments of NbAOX1a and AtAOX1a. (B) Multiple alignments of NbAOX1b and AtAOX1b. The single letter code was used for

the amino acids. The amino acid sequences were aligned using CLUSTAL 2.1.

Fig. S2. Analysis of respiration and NbAOX protein levels in response to virus infection. (A) The total respiration (Vt) and CN-insensitive respiration (Valt) were determined in the upper un-inoculated leaves of N. benthamiana plants infected with TMV-GFP or TCV at 0 days post inoculation (dpi). Mock-inoculated

plants were used as controls. The bars represent the means and standard deviation of the values obtained

from three biological replicates. (B and C) Western blotting analysis of NbAOX protein levels in the

inoculated leaves and systemic leaves of N. benthamiana plants infected with TMV-GFP (B) or TCV (C)

over a six-day time course. Both inoculated leaves and systemic leaves (second or third leaf above the

inoculated leaves) were used for detection. Approximately 3 µg of protein from each sample were loaded

onto the gels. Rubisco proteins were used as loading controls and stained with Ponceau S. The experiments

were repeated three times with similar results.

Fig. S3. (A) Phenotype of N. benthamiana plants pretreated with 3.5 mM SHAM or 1 mM KCN. Seedlings treated with distilled water (mock) were used as controls. (B) The indication of virus inoculation in N.

benthamiana leaves pretreated with 3.5 mM SHAM or 1 mM KCN.

Fig. S4. Quantitative real-time PCR analysis of the transcript levels of alternative oxidase (AOX) genes in the upper un-inoculated leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation

with RNA viruses over a six-day time course. (A and B) Quantitative real-time PCR analysis of the

transcript levels of NbAOX1a (A) and NbAOX1b (B) in the upper un-inoculated leaves of N. benthamiana

plants pretreated with KCN or SHAM before inoculation with TMV-GFP over a six-day time course. (C

and D) Quantitative real-time PCR analysis of the transcript levels of NbAOX1a (C) and NbAOX1b (D) in

the upper un-inoculated leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation

with TCV over a six-day time course. The bars represent the means and standard deviation of the values

obtained from three biological replicates at the indicated time points. The significant differences (P < 0.05)

are denoted by different lowercase letters.

Fig. S5. ROS accumulation in the upper un-inoculated leaves of N. benthamiana plants. (A) ROS accumulation in the upper un-inoculated leaves of N. benthamiana plants pretreated with KCN or SHAM.

The H2O2 levels in the upper un-inoculated leaves of N. benthamiana plants pretreated with KCN or SHAM before inoculation with TMV-GFP (B) or TCV (C) were determined at 7 dpi. The bars represent the means

and standard deviation of the values obtained from three biological replicates. The different lowercase

letters indicate significant differences (P < 0.05).

Fig. S6. (A) Phenotypes of gene-silenced plants. Agrobacterium cultures containing pTRV1 and pTRV2 or its derivatives were mixed at a 1:1 ratio and infiltrated into the lower leaf of 4-leaf stage plants using a 1-ml

needleless syringe. Photographs were taken 12 days after TRV infiltration. The experiments were repeated

three times with similar results. (B) RT-PCR analysis of the transcript levels of NbAOX1a and NbAOX1b in

VIGS-vector control (TRV:00) and NbAOX1a-silenced transgenic N-containing N. benthamiana plants.

The RT-PCR analysis was conducted using the total RNA extracted from the leaves of plants inoculated

with Agrobacterium GV2260 carrying TRV-target genes and the corresponding non-silenced leaves of

TRV:00-infected control plants. The typical PCR products are also shown for Actin, which was used as an

internal standard to correct the quantity, from the same tissues. The products from PCR of cycles are 20, 24,

28, 32, and 36, respectively. The experiments were repeated three times with similar results. (C) Changes in

the leaf cyanide (CN)-resistant respiration in the NbAOX1a-silenced transgenic N-containing N.

benthamiana plants. The bars represent the means and standard deviation of the values obtained from three

biological replicates. The different lowercase letters indicate significant differences (P < 0.05).

Fig. S7. A multiple alignment of the gene sequences of NbAOX1a and NbAOX1b was performed with CLUSTAL 2.1. The gene sequence of NbAOX1a shares 84.15% identity with the NbAOX1b.

Table S1 Primer sequences used for construction of VIGS vectors Gene

Accession

L primer

R primer

NbAOX1a

KF367455

ATGATAAGCAGCACGAT

TACCATTCCAGGCACT

Table S2 Primer sequences used for quantitative real-time PCR and RT-PCR analysis of gene expression Gene

Accession

L primer

R primer

NbAOX1a

KF367455

CTTCTTCAACGCCTATT

CAGCCCTAACAACCAA

NbAOX1b

KF367456

GAATGATAAGCAGCACG

TGACGGTCCAATAAGC

NbHIN1

AF212183

CATTAGTTCTATGGCTCGTT

ATGGCATCTGGTTTCCT

NbActin

AY179605

AACTGATGAAGATACTCACA

CAGGATACGGGGAGCTAAT

TMV-MP

AF273221

GACCTGACAAAAATGGAGAAG ATCT

GAAAGCGGACAGAAACCCGCT G

TCV-CP

NC_003821

CCAGCAGACAGAAACAGACC

GATACCATCCGCCACAAA