Mitochondrial damage: An important mechanism of ambient PM2.5 exposure-induced acute heart injury in rats

Accepted Manuscript Title: Mitochondrial damage: an important mechanism of ambient PM2.5 exposure-induced acute heart injury in rats Author: Ruijin Li Xiaojing Kou Hong Geng Jingfang Xie Jingjing Tian Zongwei Cai Chuan Dong PII: DOI: Reference:

S0304-3894(15)00087-4 http://dx.doi.org/doi:10.1016/j.jhazmat.2015.02.006 HAZMAT 16577

To appear in:

Journal of Hazardous Materials

Received date: Revised date: Accepted date:

5-9-2014 31-1-2015 2-2-2015

Please cite this article as: Ruijin Li, Xiaojing Kou, Hong Geng, Jingfang Xie, Jingjing Tian, Zongwei Cai, Chuan Dong, Mitochondrial damage: an important mechanism of ambient PM2.5 exposure-induced acute heart injury in rats, Journal of Hazardous Materials http://dx.doi.org/10.1016/j.jhazmat.2015.02.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Title page Title: Mitochondrial damage: an important mechanism of ambient PM2.5 exposure-induced acute heart injury in rats

Author names and affiliations: Ruijin Lia, Xiaojing Koua, Hong Genga, Jingfang Xiea, Jingjing Tiana, Zongwei Caib*, and Chuan Donga* a

Institute of Environmental Science, College of Environmental & Resource Sciences, Shanxi

University, Taiyuan, China b

State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong

Kong Baptist University, Hong Kong SAR, China Corresponding author and contact information: Chuan Dong Institute of Environmental Science, Shanxi University, No. 92 Wucheng Road, Taiyuan 030006, Shanxi Province, PR China Tel/fax: +086-351-7011011 Email: [email protected] Zongwei Cai Department of Chemistry Hong Kong Baptist University, Kowloon Tong, Kowloon, Hong Kong SAR, China Tel: +0852-34117070; Fax: +0852-34117348 E-mail: [email protected] 1

Graphical abstract Highlights 

PM2.5 induces heart mitochondrial morphological damage of rats.



Mitochondrial fission/fusion gene expression is important regulation mechanism.



Proinflammatoy cytokine level changes are accompanied with mitochondrial damage.



Alterations in oxidative stress and calcium homeostasis are focused on.

ABSTRACT: Epidemiological studies suggested that ambient fine particulate matter (PM2.5) exposure was associated with cardiovascular disease. However, the underlying mechanism, especially the mitochondrial damage mechanism, of PM2.5-induced heart acute injury is still unclear. In this study, the alterations of mitochondrial morphology and mitochondrial fission/fusion gene expression, oxidative stress, calcium homeostasis and inflammation in hearts of rats exposed to PM2.5 with different dosages (0.375, 1.5, 6.0 and 24.0 mg/kg body weight) were investigated. The results indicated that the PM2.5 exposure induced pathological changes and ultra-structural damage in hearts such as mitochondrial swell and cristae disorder. Furthermore, PM2.5 exposure significantly increased specific mitochondrial fission/fusion gene (Fis1, Mfn1, Mfn2, Drp1 and Opa1) expression in rat hearts. These changes were accompanied by decreases of activities of superoxide dismutase (SOD), inducible nitric oxide synthase (iNOS), Na+K+-ATPase and Ca2+-ATPase and increases of levels of malondialdehyde (MDA) and nitric oxide (NO) as well as levels of pro-inflammatory mediators including TNF-α, IL-6 and IL-1β in rat hearts. The results implicated that mitochondrial damage, oxidative stress, cellular homeostasis imbalance and inflammation are potentially important mechanisms for the PM2.5-induced heart injury, and may have relations with cardiovascular disease. 1

Abbreviations: Dynamin-related protein 1 (Drp1); Fine particulate matter (PM2.5); Fission-mediator protein 1 (Fis1); Hydroxyl radical (.OH); Lipid peroxidation (LPO); Inducible nitric oxide synthase (iNOS), Malondialdehyde (MDA); Mitofusin (Mfn); Superoxide dismutase (SOD); Nitric oxide (NO); Optic atrophy protein 1 (OPA1), Polycyclic aromatic hydrocarbon (PAH); Phosphate buffer solution (PBS); Quartz fiber filters (QFFs); Reactive oxygen species (ROS); Reactive nitrogen species (RNS); Superoxide radical (O2.-); Transmission electron microscope (TEM)

Keywords: PM2.5, Rat heart mitochondrial damage; Fusion/fission; Inflammation; Oxidative stress

2

1. Introduction

Ambient fine particulate matter (PM2.5) with an aerodynamic diameter less than 2.5 μm, a well-known air pollutant, has been attracting more and more attention. People are widely exposed to PM2.5 mostly originated from coal combustion, vehicle exhaust, construction and agricultural pollution [1]. Recently, epidemiological studies have demonstrated that short- and long-term exposures to PM2.5 are associated with cardiovascular diseases [2-4], while laboratory investigations have showed that PM2.5 may induce mammal cardiovascular dysregulation and heart failure [5-6]. The mitochondrion is a sensitive target of both oxidative stress and environmental toxicants stimulus like PM2.5 [7-8]. Disorder in the balance of mitochondrial fission and fusion may result in the abnormal changes of mitochondrial structure and function, which are associated with respiratory diseases [9]. PM2.5 may induce mitochondrial damage in exposed individuals [10], and in turn mitochondrial dysfunction partially mediate PM-induced cardiovascular injury effects [11]. Because the disruption in fission-fusion process is the important regulatory mechanism of mitochondrial dysfunction, elucidation of the fusion and fission gene expression pattern after PM2.5 exposure is helpful in understanding the mechanisms of PM2.5-induced adverse health effects. Additionally, increasing evidences indicate that the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS), oxidative stress, calcium homeostasis imbalance and inflammatory responses are involved in PM-related cardiovascular disease [12-13]. However, there has been only limited data on the detailed mechanisms of PM2.5-induced heart acute injury associated with mitochondrial fusion/fission balance, oxidative stress and inflammation so far. As a northern city of China with energy production and chemical industries, Taiyuan is 1

currently facing serious air pollution problems including extremely high PM2.5 concentrations in the atmosphere [14, 15]. In this study, we sought to investigate the damage effects of PM2.5 in Taiyuan’s winter on rat heart mitochondria and explore the related mechanisms of PM2.5-induced alterations in the expression of mitochondrial fission/fusion genes, oxidative stress and inflammation as well as cellular ionic homeostasis. The experiments performed include: (1) examining the pathological damage in the exposed hearts by hematoxylin-eosin (HE) staining and ultrastructural changes in the exposed hearts and mitochondria using transmission electron microscope (TEM); (2) measuring the mRNA and protein expressions of specific fission/fusion markers [Optic atrophy protein 1 (OPA1), Mitofusin (Mfn) 1, Mfn2, dynamin-related protein 1 (Drp1) and fission-mediator protein 1 (Fis1)] in heart mitochondria using real-time RT-PCR and western blot; and (3) detecting the oxidative stress levels such as superoxide dismutase (SOD), inducible nitric oxide synthase (iNOS), nitric oxide (NO) and malondialdehyde (MDA), enzyme activities of Na+K+-ATPase and Ca2+-ATPase, and levels of the pro-inflammatory mediators including tumor necrosis factor-α (TNF-α), interleukin (IL)-6 and IL-1β in the hearts of rats exposed to PM2.5.

2. Materials and methods

2.1. PM2.5 sample collection and preparation

The sampling site was located on the roof of a five-story building (about 25 m above ground) on the Shanxi University campus (30°15'N, 112°33'E) in Taiyuan, China, during January, 2013. PM2.5 mass concentrations were measured using a DustTrak ™ II aerosol monitor (TSI Inc., USA), 2

and daily PM2.5 samples were collected on quartz fiber filters (QFFs) for 24 h/day using a PM 2.5 high-volume air sampler (Thermo Anderson, USA), with a pump flow rate of 1.13 m3/min. The filters used were prebaked at 450 °C for 6 h and equilibrated in desiccators. The QFFs after sampling were packed in clean aluminum foil and stored at -20 °C until use. The concentrations of polycyclic aromatic hydrocarbons (PAHs) in PM2.5 during sampling period were measured by gas chromatograph–mass spectrometer (GC–MS), and the concentrations of nitrate (NO3−) and sulfate (SO42−) were analyzed by ion chromatography. Five sheets of the QFFs loaded with PM2.5 during the sampling time and one blank QFF were cut and submerged in Milli-Q water with sonication. The extraction was filtered through six layers of sterile gauze, and then the collecting solution was obtained and freeze-dried in vacuum. Prior to use, the dried samples were mixed, weighed, and then diluted in sterilized 0.9 % physiological saline with swirling for 10 min.

2.2. Animal experiment

Healthy adult, clean-grade male SD rats, weighing 180–200 g, were purchased from the Animal Center of Hebei Medical University. Animals were housed in metallic cages under standard conditions (24 ± 2 °C and 50± 5% humidity) with a 12-h light-dark cycle. Rats were divided randomly into five equal groups of five animals each: (1) control group, (2) 0.375 mg/kg body weight (b.w.) PM2.5 group, (3) 1.5 mg/kg b.w. PM2.5 group, (4) 6.0 mg/kg b.w. PM2.5 group and (5) 24.0 mg/kg b.w. PM2.5 group. As has been reported, the respiratory volume of an adult rat is 200 mL/min, and the respiratory volume for 2 days reaches 0.576 m3. According to the China National Ambient Quality Standard 3

(NAAQS, 2012) for PM2.5 (0.075 mg/m3), the amount of PM2.5 inhalation over 2 days is 0.0432 mg and the concentration of PM2.5 exposure for each rat every 2 days is estimated to be 0.216 mg/kg b.w.. PM2.5 mean mass concentration was 0.161 ± 0.060 mg/m3 on non-haze weather in Taiyuan [14], and the higher concentrations corresponded to the haze weather reached 0.692 ± 0.272 mg/m3 [15]. Xie et al. (2014) revealed that PM2.5 concentration was significantly associated with ischemic heart disease morbidity and mortality in Beijing, where the mean daily PM2.5 concentration was 0.0962 mg/m3 with a maximal value of 0.4939 mg/m3 [16]. Taken together, the average concentrations of PM2.5 exposure for each rat every 2 days may be estimated to range from 0.464 to 1.993 mg/kg b.w.. Besides this, the main PM2.5 doses were based on a literature reported by Qiao et al (2011) [17]. To further investigate the acute toxicological effects of the higher dose PM2.5 on the heart, 24.0 mg/kg b.w. PM2.5 was used as the exposure concentration with the reference to the above literature [17]. The control group was instilled with physiological saline at the same volume as that used for the treatment group, and the other special control group (vehicle group) was treated with the same volume of a suspension from extracts from a blank filter. The other four treatment groups were instilled with a PM2.5 suspension at different concentrations, and the final exposure concentrations reached 0.375, 1.5, 6.0 and 24.0 mg/kg b.w., respectively. The instillation was performed using a nonsurgical intratracheal instillation method adapted [18]. The volume of instillation of physiological saline or PM2.5 suspension was 0.5 mL. Instillation was performed five times every 2 days. When not being treated, the rats had free access to food and water. The care and use of the animals reported in this study was approved by the Institutional Animal Care and Use Committee of Shanxi University.

4

2.3. Histological and ultrastructural evaluation

Rats were killed by anesthesia (sodium pentobarbital, 80 mg/kg, i.p.) 24 h after the last treatment. Heart tissues were excised into small pieces. Then some were immediately fixed in 4 % paraformaldehyde in phosphate-buffered saline (PBS pH 7.4) for the HE staining. Light microscopic findings were graded semi-quantitatively from – (no histopathological change) to +++ (severe histopathological change) with reference to the literature [19]. This histopathological grading was performed according to the degrees of the myocardial myofibril disorder, myocardial gap expansion, inflammatory cell infiltration, myocardial interstitial edema and hyperemia in the specimens. At the same time, another piece of heart tissue was fixed in 2.5 % glutaraldehyde in PBS and postfixed in 1 % of buffered osmium tetroxide. TEM analysis of heart tissue was performed according to the method described in our previous study [20]. Under a 20000 × magnification by TEM, the degree of mitochondrial damage in the different groups was estimated according to the mitochondrial damage classification method described by Flameng et al. (1980) [21]. In brief, under the same magnification, about 20 mitochondria from each of 5 randomly selected fields (100 mitochondria per rat) were analyzed. The mitochondrial damage types were assessed using a scale from 0 to 4 with 0 indicating a normal structure, 1, normal with slight swelling, 2, mitochondrial swelling, 3, serious swelling and cristae disorder, and 4, mitochondrial membrane breach and vacuolization. On the basis of the above scale, the degree of mitochondrial damage in the different group of rats was scored and the total scores of 100 mitochondria per rat were summed. Finally, this value was divided by 100, and the ratio accounted for the degree of mitochondrial damage. The higher the ratio is, the more severe the injury is. 5

2.4. Real time quantitative RT-PCR

After the last treatment, rats were sacrificed, and then some heart tissue was quickly frozen in liquid nitrogen and then stored at -80 °C. When performing RT-PCR analysis, the frozen heart tissue samples were thawed, and mRNA was extracted using the Transzol reagent (Transgen, Beijing, China). Then first-strand cDNA was synthesized using an AMV RT First Strand cDNA Synthesis Kit (Transgen, Beijing, China) according to the manufacturer’s protocols. The cDNA product was stored at -80 °C until use. Expression levels of fusion and fission related genes were assessed by real-time PCR in an iCycler iQ real time PCR detection system (Bio-Rad, Hercules, CA, USA) with the SYBR Premix Ex Taq

TM

(perfect real time) kit (TaKaRa, Dalian, China). PCR amplification was performed in a

20 μL reaction solution containing 7 μL of ddH2O, 10 μL of SYBR® Premix Ex TaqTM, 1 μL each of the forward and reverse primers and 1 μL of cDNA using the iCycler iQ real time PCR detection system. Thermal cycling was carried out as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 94 °C for 20 s, 55 °C (for OPA1, Drp1, Fis1, TNF-α, iNOS and actin) or 60 °C (for IL-6, IL-1β, Mfn1 and Mfn2) for 20 s and 72 °C for 20 s. Melting curve analysis was also performed using 81 cycles of 15 seconds increasing from 55 °C to 95 °C. The relative quantification of the expression of target gene was measured using mRNA signal for the housekeeping gene actin as an internal control. The copy number of target gene/actin mRNA ratio was measured in all samples. The GenBank accession numbers and the primer sequences of the tested genes and actin together with the PCR product amplified fragments are listed in Table 1.

6

2.5. Western Blotting

Mitochondrial proteins for OPA1, Mfn1, Mfn2, Drp1 and Fis1 and heart total protein for actin from fresh heart tissues after the last exposure to PM2.5 were extracted with a protein extraction kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Protein concentrations were determined by a BCA protein assay kit (Beyotime, Shanghai, China). Samples were mixed with loading buffer and boiled for 5 min. Western blot analysis was performed as described previously [22]. The rabbit polyclonal antibodies specific for rat Mfn1 and Mfn2 (Santa Cruz, CA, USA) and goat polyclonal antibodies specific for rat OPA1, Drp1, Fis1, and actin (Santa Cruz, CA, USA) were incubated at a concentration of 1:50 (for OPA1 and Fis1), 1:100 (for Drp1, Mfn1 and Mfn2), or 1:1000 (for β-actin) in 1×PBS, 0.1 % Tween and 5 % BSA overnight at 4 °C. The infrared-labeled anti-rabbit and anti-goat secondary antibodies (LI-COR Biosciences, USA) at a concentration of 1:5000 were added to nitrocellulose filter membranes and incubated for 1.5 h at room temperature. The membranes were scanned and the band densities were quantified using the Odyssey Infrared Imaging System (Li-COR Biosciences, USA).

2.6. Measurement of SOD, iNOS, NO, MDA, Na+K+-ATPase and Ca2+-ATPase levels in rat hearts

The heart tissue was weighed and homogenized in ice-cold 0.9 % physiological saline. After the homogenized solutions were centrifuged for 10 min at 3000 rpm, the heart supernatants were collected. The enzymatic activities of SOD, iNOS, Na+K+-ATPase and Ca2+-ATPase as well as the contents of MDA and NO in heart supernatants were detected using the corresponding kits from 7

Nanjing Jiancheng Bioengineering Institute, China according to the manufacturer’s protocols.

2.7. Cytokine measurement

The levels of TNF-α, IL-6 and IL-1β in rat heart supernatants were measured using rat TNF-α, IL-6 and IL-1β ELISA kit (R&D systems, USA) according to the manufacturer’s instructions.

2.8. Statistical analysis

Results were expressed as means ± standard deviation. Analysis of variance (ANOVA) was applied for between-group statistical comparison using the SPSS19.0 package of programs for Windows. Post hoc tests were conducted to determine the difference between groups, followed by Fisher’s least significant difference (LSD) test. A level of P <0.05 was accepted as statistically significant.

3. Results

3.1. Analysis of PM2.5 chemical characteristics

The PM2.5 chemical characteristics during the same sampling used in this study were reported in our previous studies [14, 23]. The daily average mass concentration of PM2.5 was 0.161 ± 0.060 mg/m3, the levels of chrysene (CHR), benzo[b]fluoranthene (BbF), benzo[k]fluoranthene (BkF), benzo[a]pyrene (BaP), benzo[a]anthracene (BaA), and benzo[g,h,i]perylene (BghiP) among 16 PAHs 8

in PM2.5 were obviously higher than those of the Chinese national standard for PAHs (10 ng/m3). The data from ion chromatography indicated that the daily mean levels of SO42− and NO3− ions in the PM2.5 samples reached 5.87 and 1.71 μg/m3, respectively.

3.2. Effects of PM2.5 on heart histology and ultrastructural damage

Representative H&E staining images were shown in Fig. 1A–E and histopathological changes were evaluated in Table 2. No histopathological abnormalities were observed in control and 0.375 mg/kg b.w. PM2.5 group animals (Fig. 1A and B). After different concentrations of PM2.5 exposure, the myocardial myofibril disorder, myocardial gap expansion, inflammatory cell infiltration (mainly concluding lymphocytes) in myocardium, myocardial interstitial edema, and hyperemia were observed in hearts of rats compared with those in control group. Such effects were remarkable with the increasing of PM2.5 exposure concentrations (Fig. 1C–E, Table 2), in which the higher the PM2.5 concentrations were, and the more severe the heart pathological injuries were. Comparisons of the ultrastructural changes of mitochondria in rat myocardial cells in different groups are depicted in Fig. 2 and Table 2. Fig. 2A illustrated ultra-structural features of control group showing normal architecture of myocardium. A similar pattern could be found in PM2.5-treated group with concentration of 0.375 mg/kg b.w. particles (Fig. 2B). Table 2 and Fig. 2 results indicated that PM2.5 caused an increase of mitochondrial damage scores in a concentration-dependent manner (R2 = 0.89). Such damage effects were significant in the presence of PM2.5 at 1.5, 6.0 and 24.0 mg/kg b.w. doses relative to the control (P < 0.01). For example, myocardial myofibril disorder, mitochondrial swelling, cristae decrease or mitochondrial vacuolation and some mitochondrial membrane breach markedly appeared in the presence of PM2.5. 9

Mitochondrial membrane breach and cristae disorder were more prominent in rats exposed to 24.0 mg/kg b.w. PM2.5 compared to that at the dose of 1.5 or 6.0 mg/kg b.w..

3.3. Effects of PM2.5 on rat heart mitochondrial fusion/fission gene expression

On the basis of our data in Fig. 3, the OPA1 mRNA and protein levels in hearts of rats exposed to PM2.5 at the concentrations of 1.5, 6.0, and 24.0 mg/kg b.w. were significantly increased compared with the control (P < 0.05 or P < 0.01), whereas OPA1 gene expression was not significantly changed in the presence of PM2.5 at dose of 0.375 mg/kg b.w.. The Mfn1 mRNA levels in the all the PM2.5 concentrations and protein levels in the presence of PM2.5 at the doses of 1.5, 6.0, and 24.0 mg/kg b.w. were significantly enhanced in rats compared to the control (P < 0.05 or P < 0.01). No significant changes of the Mfn2 expressions were observed in the rats exposed to PM2.5. Moreover, the fission related genes Drp1 and Fis1 mRNA and protein levels showed an obvious increase in response to the higher dose exposure to PM2.5 (from 1.5 to 24 mg/kg b.w.; P < 0.05 or P < 0.01). No significant transcriptional and translational differences in two mitochondrial fission genes were found in the rats in the presence of the lowest dose of PM2.5 (0.375 mg/kg b.w.).

3.4. Effects of PM2.5 on expression of inflammatory markers in hearts of rats

Fig. 4 displays the gene expression of three proinflammatory cytokines (TNF-α, IL-1β and IL-6). The IL-1β mRNA and protein levels showed an obvious increase in response to the higher dose exposure to PM2.5 (from 1.5 to 24.0 mg/kg b.w) compared to the control (P < 0.05 or P < 0.01). Also, TNF-α and IL-6 mRNA expression were increased with treatment concentration of 10

PM2.5, and statistical difference was observed at higher concentrations (6.0 mg/kg b.w., 1.45-fold of control for TNF-α, 1.41-fold of control for IL-6; 24.0 mg/kg b.w., 1.54-fold of control for TNF-α, 1.52-fold of control for IL-6) (Fig. 4A). The changing trends of TNF-α and IL-6 protein expression were similar to that of mRNA expression (Fig. 4B). No significant changes of the TNF-α, IL-1β and IL-6 were observed in the rats exposed to PM2.5 at the concentration of 0.375 mg/kg b.w. compared to that in the control.

3.5. Effects of PM2.5 on markers of oxidative stress and calcium homeostasis in rat hearts

The sample suspension from the special control group, which was treated with extracts from the blank filter, did not induce pathological alterations or affect the levels of SOD, iNOS, MDA, NO, Na+K+-ATPase and Ca2+-ATPase of hearts, and no statistical difference was observed between normal control and special control group (data not shown). As shown in Figs. 4–6, PM2.5 at the doses of 1.5, 6.0 and 24.0 mg/kg b.w. significantly inhibited SOD activities, while obviously raising the MDA contents in hearts compared with the control group (P < 0.05 or P < 0.01). Moreover, higher dose of PM2.5 (6.0 and 24.0 mg/kg b.w.) decreased the Na+K+-ATPase and Ca2+-ATPase activities, and elevated NO levels and iNOS mRNA and protein levels relative to the control (P < 0.05 or P < 0.01).

4. Discussion

Epidemiologic studies have revealed that PM2.5 pollution is correlated with cardiovascular diseases including ischemia, stroke, arrhythmia and heart failure exacerbation [2-4]. An increase of 11

mass concentration of 10 μg/m3 in ambient PM2.5 may elevate 4.5 % of the risk for ischemic cardiac events [24]. Furthermore, emerging data suggest that changes in mitochondrial dynamics such as structural and functional aberrations in mitochondria have been implicated in cardiovascular diseases, including cardiomyocyte hypertrophy, ischemia-reperfusion injury and heart failure [25, 26]. However, the mechanism of PM2.5 on altering mitochondrial shape and expression of mitochondrial fusion and fission proteins remains unclear. Mitochondria are morphologically dynamic organelles that continuously divide and fuse to form small individual units or interconnected networks within the cell. They can reach a kind of equilibrium between mitochondrial fusion and fission, which are important for mitochondrial growth, redistribution and maintenance of a healthy mitochondrial network. In mammalian cells, mitochondrial fusion is mediated by two mitofusins (Mfn1 and Mfn2) in outer membrane and OPA1 in inner membrane [27]. The past research showed that over-expression of Mfn1/2 and OPA1 promoted fusion in mitochondrial membranes and mitochondrial network [28], whereas Fis1 participated in mitochondrial fission by recruiting the cytoplasmic Drp1 into the mitochondrial outer-membrane. Drp1 could punctuate spots on the mitochondrial surface to mediate mitochondrial fission for meeting energy needs [29]. From ultrastructural experimental data (See Fig. 2 and Table 2), we observed some abnormal morphological alterations in mitochondria such as swelling, cristae disorder, vacuolation and number increase in the presence of higher PM2.5 doses. Mitochondrial damage degrees were positively correlated with PM2.5 dosages. These ultra-structural damage results implied that PM2.5 exposure induced strong structural mitochondrial changes, subsequently having influences upon the function of gas exchange and lead to mitochondrial damage. As is reported in the literatures, the mitochondrial number increase may be to enhance cardiac mitochondrial energy production [30], 12

whereas swelling, cristae disorder and mitochondrial vacuolation account for the pathological changes of heart mitochondria [20]. Besides, Marchini et al. (2013) reported that an acute PM exposure could produce significant mitochondrial dysfunction accompanied by the decreased cardiac oxygen consumption, succinate dehydrogenase activity and mitochondrial membrane potential as well as impaired oxidative phosphorylation [31]. It suggests that the PM2.5 exposure-caused mitochondrial damage may be linked to the mitochondrial dysfunction. The detailed mechanisms need further investigations. Although it is difficult to reconcile the pro-fusion gene high-expression with the pro-fission gene over-expression in mitochondria in this study (See Fig. 3), it may be speculated that, under PM2.5 exposure conditions (from 1.5 to 24 mg/kg b.w.), higher-expression of OPA1 and Mfn1 in heart mitochondria is helpful for mitochondrial elongation, whereas overexpression of Drp1 and Fis1 can enhance mitochondrial fission to meet energy requirements. From the TEM results (Fig. 2), the mitochondrial fusion or swelling is significant relative to fission, which supports the results of fusion/fission gene expression above. The mitochondrial dilation with the cristae disorder and disappearance may result in the mitochondrial membrane rupture and dysfunction [32]. Interestingly, an in-depth study has shown that OPA1 cannot promote mitochondrial fusion in the absence of Mfn1, and that Mfn1 is unable to promote mitochondrial elongation if OPA1 is ablated [33]. In the absence of Mfn2, the inner-outer membrane fusion machinery composed of OPA1 and Mfn1 is still intact and can provide a low degree of fusion [33]. Consequently, although Mfn1 and Mfn2 are associated with the outer mitochondrial fusion, their functions are not all the same. In the current study, the tendency of PM2.5-caused change in OPA1 mRNA and protein expression to be up-regulated was consistent with Mfn1 expression, implicating that OPA1 and Mfn1 can mutually promote in mitochondrion morphological alteration induced by PM2.5. 13

Considering that Mfn2 expression was not significant compared with that in the control, Mfn2 seemed to be ineffective in the regulation of mitochondrial fusion. The abnormal alterations in mitochondrial morphology and in pattern of fusion-fission gene expression may provide an explanation for the possible mechanisms of PM2.5-induced heart damage. In the present study we demonstrated that the changes of tissue morphology, oxidative stress, calcium homeostasis and inflammation occurred in the hearts after PM2.5 exposure in the Taiyuan heating season. PM2.5 may produce ROS such as superoxide radical (O2.-) and hydroxyl radical (.OH) in vitro, and aqueous suspension of ambient PM2.5 may generate .OH [34, 35]. Under stress conditions, activities of anti-oxidative enzymes such as SOD may be inhibited, whereas excessive ROS are easy to attack the cell membrane and form MDA, which is a typical product of lipid peroxidation (LPO). Also, excessive NO regulated by iNOS may form a peroxynitrite anion, which is more toxic than O2.- and .OH or other free radicals [36], causing LPO and cytotoxicity [37]. The SOD activity decrease and MDA, iNOS and NO level increase in this study were consistent with the above reports. These results suggest that PM2.5 may produce ROS and RNS triggering heart LPO, and that PM2.5-induced oxidative stress may be considered as an important mechanism of PM2.5-mediated heart injury. From the HE experimental results in Fig. 1, we observed that inflammatory cell infiltration (mainly concluding lymphocytes) in myocardium and hyperemia in hearts of rats exposed to higher PM2.5 doses. To investigate whether the heart injury induced by PM2.5 was in relation with the increased inflammatory activity, we measured expression of the pro-inflammatory cytokines, such as TNF-α, IL-6 and IL-1β, which are known to be elevated in the serum of heart disease patients [38]. Wang et al. (2013) reported that PM2.5 deposition and myocardial inflammation were 14

observed in high-dose PM2.5 rats (3.2 mg PM2.5/rat) in cardiac histopathology results, along with significant increases of TNF-α and IL-6 levels in rat serum [39]. Kvietys and Granger (2012) reviewed the reactive oxygen and nitrogen species contributed significantly to the diverse vascular responses in inflammation [40]. Our results of the increased NO and MDA levels, decreased SOD activity and elevating inflammatory cytokines in the rat hearts exposed to PM2.5 supported this viewpoint. It hints that ROS/RNS may be a consequence of the inflammatory response in heart injury, and PM2.5 exposure induced-inflammatory response is related to heart injury [41]. We also focused our attention on the ionic homeostasis changes in the rat hearts exposed to PM2.5. Na+K+-ATPase (or the sodium pump) and Ca2+-ATPase (or the calcium pump) are a special class of membrane-bound proteins. They play a major role in maintaining the transmembrane gradients of the ions or a low intracellular Ca2+ concentration. Na+K+-ATPase is a sodium pump which not only maintains the inside cells at a low concentration of sodium (Na+) and a high concentration of potassium (K+), but also regulates the intracellular Ca2+ levels. Ca2+-ATPase permits rapid and localized increases in cytosolic calcium upon modulation of calcium channel function. As the results of Fig. 5, PM2.5 (6.0 and 24.0 mg/kg) significantly inhibited mitochondrial Na+K+-ATPase and Ca2+-ATPase activities compared with the control group, implying that PM2.5 causes dysfunction of sodium pump and calcium pump. On the other hand, the function of the Na+K+-ATPase can be impaired in the presence of ROS, while the functional impairment of the Ca pump may be related to oxidative damage, which may occur in pathological conditions of calcium iron overload and imbalance of calcium homeostasis [42]. Cell membrane LPO contributes to a decrease in the activities of Na+K+-ATPase and Ca2+-ATPase [43]. On the basis of our data, the enzyme activity decreases of SOD, Na+K+-ATPase and Ca2+-ATPase accompanied by an increase of MDA levels showed that PM2.5-caused reduction of Na+K+-ATPase and Ca2+-ATPase activity 15

may account for oxidative stress. Importantly, it is observed that oxidative stress, calcium homeostasis imbalance and inflammation have close relationships with dysfunctional mitochondria in a wide range of heart diseases [12, 13, 44]. First, the mitochondrion is a major source of ROS production. It has demonstrated that PM2.5 may induce ROS primarily from site III of the mitochondrial electron transport chain [45]. Excessive ROS-induced LPO may result in mitochondrial permeabilization, membrane potential decreasing and mitochondrial swelling [46]. Moreover, mitochondrial superoxide reacts with RNS such as NO to form peroxynitrite, further endangering mitochondrial structure and function [47]. Accordingly, mitochondrion is the sensitive target of both PM2.5 and oxidative stress [7, 8]. Next, Rodriguez-Enriquez et al. (2004) reported that ROS, Ca2+ overloading, decreased mitochondrial membrane potential and mitochondrial permeability transition opening are the crucial causes of mitochondrial swell and outer membrane rupture [48]. Finally, Urrutia et al. (2014) demonstrated a strong correlation between mitochondrial dysfunction and the severity of inflammation, as reflected by higher levels of the pro-inflammatory cytokines TNF-α and IL-6 [49]. In the present study, we propose that PM2.5 suppresses the SOD, iNOS, Na+K+-ATPase and Ca2+-ATPase activity, augments the MDA and NO content and affects fusion/fission gene expression in hearts, leading to mitochondrial and heart injury.

A recent research shows that PM2.5 can be inhaled and deposited in lung tissue, and then the ultra fine particles and chemical compositions in PM enter the bloodstream, causing harm to the heart [50]. PM2.5 inhalation-produced pulmonary inflammatory factors are able to transfer into the systemic circulation from the lung, leading to the direct toxic effects to the heart [51]. It has been reported that Taiyuan winter PM2.5 is characterized by the presences of nitrate, sulfite, organic carbon fraction, PAHs, and elements such as Hg, As, Pb, and Zn and others [14, 15, 23]. As for 16

PAHs and the transition metals such as Zn, they have been demonstrated to be associated with cardiac injury and heart disease [52, 53]. Additionally, sulfate and nitrate in PM may indirectly affect health through interactions with certain metal species and with production of secondary organic matter [54]. Hence, it was hypothesized that adverse health effects observed after exposure to winter PM2.5 is partly caused by specific PM2.5 and PM components, i.e. PAHs, sulfate, nitrate and Zn. The toxicological mechanisms of the components of PM2.5 on heart mitochondrial injury need to be further investigated.

5. Conclusion

The results in this study show that PM2.5 may cause pathological injury and mitochondrial damage in rat heart. It is proposed that the fusion and fission gene high-expression might play an important role in PM2.5-induced mitochondrial damage, which has relations with oxidative stress, calcium homeostasis imbalance and inflammatory response. Since mitochondrial damage is thought as one of the possible causes of heart injury, the study of PM2.5-aggravated cardiovascular disease should focus more on mitochondria. In the future, we will explore other related mechanisms of PM2.5-caused mitochondrial dysfunctions, such as cytochrome c release, mitochondrial DNA change, apoptosis and mitochondrial genomic variation, etc. Moreover, more experiments are required to investigate toxicological effects of PM2.5 components, including metals, salts, PAHs and carbonaceous material, on mitochondria in the context of pathogenesis of the ambient PM2.5-induced heart injury.

Acknowledgments 17

This research was supported by the National Natural Science Foundation of China (Nos. 21177078, 21175086 and 21175025), the Research Project Supported by Shanxi Scholarship Council of China (2013-16), the Nature Science Foundation of Shanxi Province in China (2014011036-2) and the 100 Talents Program of Shanxi Province.

References [1] J.J. Cao, Z.X. Shen, J.C. Chow, J.G. Watson, S.C. Lee, X.X. Tie, K.F. Ho, G. H. Wang, Y.M. Han, Winter and summer PM2.5 chemical compositions in fourteen Chinese cities, J. Air Waste Manag. Assoc. 62(2012)1214−1226. [2] N. Martinelli, O. Olivieri, D. Girelli, Air particulate matter and cardiovascular disease: a narrative review, Eur. J. Intern. Med. 24(2013)295−302. [3] M. Lippmann, Toxicological and epidemiological studies of cardiovascular effects of ambient air fine particulate matter (PM2.5) and its chemical components: coherence and public health implications, Crit. Rev. Toxicol. 44(2014)299−347. [4] R. Brook, S. Rajagopalan, A. Pope, J.R. Brook, A. Bhatnagar, A.V. Diez-Roux, F. Holguin, Y. Hong, R.V. Luepker, M.A. Mittleman, A. Peters, D. Siscovick, S.C. Smith, L. Whitsel, J. Kaufman, Particulate matter air pollution and cardiovascular disease: an update to the scientific statement from the American Heart Association, Circulation 12(2012)2331−2378. [5] J.G. Wagner, A.S. Kamal, M. Morishita, J.T. Dvonch, J.R. Harkema, A.C. Rohr,PM2.5-induced cardiovascular

dysregulation

in

rats

is

associated

with

elemental

carbon

and

temperature-resolved carbon subfractions, Part. Fibre Toxicol. 11(2014)25. [6] C.S. Weldy, Y. Liu, Y.C. Chang, I.O. Medvedev, J.R. Fox, T.V. Larson, W.M. Chien, M.T. 18

Chin, In utero and early life exposure to diesel exhaust air pollution increases adult susceptibility to heart failure in mice, Part. Fibre Toxicol. 10(2013)59. [7] N. Li, C. Sioutas, A. Cho, D. Schmitz, C. Misra, J. Sempf, M. Wang, T. Oberley, J. Froines, A. Nel, Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage, Environ. Health Perspect. 111(2003)455−460. [8] J.N. Meyer, M.C. Leung, J.P. Rooney, A. Sendoel, M.O. Hengartner, G.E. Kisby, A.S. Bess, Mitochondria as a target of environmental toxicants, Toxicol. Sci. 134(2013)1−17. [9] A.R. Hall, N. Burke, R.K. Dongworth, D.J. Hausenloy, Mitochondrial fusion and fission proteins: novel therapeutic targets for combating cardiovascular disease, Br. J. Pharmacol. 171(2014)1890−1906. [10] L. Hou, Z.Z. Zhu, X. Zhang, F. Nordio, M. Bonzini, J. Schwartz, M. Hoxha, L. Dioni, B. Marinelli, V. Pegoraro, P. Apostoli, P.A. Bertazzi, A. Baccarelli, Airborne particulate matter and mitochondrial damage: a cross-sectional study, Environ. Health 9(2010)48. [11] T. Xia, M. Kovochich, A.E. Nel, Impairment of mitochondrial function by particulate matter (PM) and their toxic components: implications for PM-induced cardiovascular and lung disease, Front Biosci. 12(2007)1238−1246. [12] T.J. Grahame, R.B. Schlesinger, Oxidative stress-induced telomeric erosion as a mechanism underlying airborne particulate matter-related cardiovascular disease, Part. Fibre Toxicol. 9(2012)21. [13] M.S. Lee, K.D. Eum, S.C. Fang, E.G. Rodrigues, G.A. Modest, D.C. Christiani, Oxidative stress and systemic inflammation as modifiers of cardiac autonomic responses to particulate air pollution, Int. J. Cardiol. 2014, doi: 10.1016/j.ijcard.2014.07.012. [14] R. Li, X. Kou, H. Geng, C. Dong, Z. Cai, Pollution characteristics of ambient PM2.5-bound 19

PAHs and NPAHs during winter time in Taiyuan, Chinese Chem. Lett. 25(2014)663−666. [15] L. Cao, H. Geng, C. Yao, L. Zhao, P. Duan, Y. Xuan, H. Li, Investigation of chemical compositions of atmospheric fine particles during a wintertime haze episode in Taiyuan City, China Environmental Science 34(2014)259−265. [16] W. Xie, G. Li, D. Zhao, X. Xie, Z. Wei, W. Wang, M. Wang, G. Li, W. Liu, J. Sun, Z. Jia, Q. Zhang, J. Liu, Relationship between fine particulate air pollution and ischaemic heart disease morbidity and mortality, Heart. 2014. doi: 10.1136/heartjnl-2014-306165. [17] G. Qiao, Z. Zhang, J. Dong, Y. Qiu, L. Guo, Y. Bai, J. Song, G. Chen, The effect of subacute PM2.5 exposure related to traffic on cytokine levels in BALF and serum of rats, J. Toxicol. 25(2011)275−277. [18] R. Bai, L. Zhang, Y. Liu, L. Meng, L. Wang, Y. Wu, W. Li, C. Ge, L. Le Guyader, C. Chen, Pulmonary responses to printer toner particles in mice after intratracheal instillation, Toxicol. Lett. 199(2010)288−300. [19] J. Ren, L.X. Wang, X.C. Ji, J.Y Zhou, M.Y. Zhang, Ultrastructural observation on pulmonary fibrosis in E9 rats treated with compound Carapax trionycis formula, Asian Pac. J. Trop. Med. 6 (2013)153–155. [20] Z. Meng, Y. Liu, Cell morphological ultrastructural changes in various organs from mice exposed by inhalation to sulfur dioxide, Inhal. Toxicol. 19(2007)543−551. [21] W. Flameng, M. Borgers, W. Daenen, G. Stalpaert, Ultrastructural and cytochemical correlates of myocardial protection by cardiac hypothermia in man, J. Thorac. Cardiovasc. Surg. 79(1980)413–424. [22] R. Li, Z. Meng, J. Xie, Effects of sulfur dioxide derivatives on four asthma-related gene expressions in human bronchial epithelial cells, Toxicol. Lett. 175(2007)71−81. 20

[23] R. Li, H. Geng, Z. Cai, Z. Song, L. Xu, J. Chen, M. Chen, Pollution Characteristics of PM2.5 PAHs, NPAHs, SO42-and NO3- in Wintertime in Taiyuan City, Research & Application of Building Materials 177(2014)13−15. [24] C.A. 3rd Pope, J.B. Muhlestein, H.T. May, D.G. Renlund, JL. Anderson, B.D. Horne, Ischemic heart disease events triggered by short-term exposure to fine particulate air pollution, Circulation 11(2006)2443−2448. [25] S.B. Ong, A.R. Hall, D.J. Hausenloy, Mitochondrial dynamics in cardiovascular health and disease, Antioxid. Redox. Signal. 19(2013)400−414. [26] S.B. Ong, D.J. Hausenloy, Mitochondrial morphology and cardiovascular disease, Cardiovasc. Res. 88(2010)16−29. [27] R.J. Youle, A.M. van der Bliek, Mitochondrial fission, fusion, and stress, Science 337(2012)1062−1065. [28] L. Griparic, N.N. van der Wel, I.J. Orozco, PJ. Peters, A.M. van der Bliek, Loss of the intermembrane space protein Mgm1/OPA1 induces swelling and localized constrictions along the lengths of mitochondria, J. Biol. Chem. 279(2004)18792–18798. [29] E. Smirnova, D.L. Shurland, S.N. Ryazantsev, A.M. van der Bliek, A human dynamin-related protein controls the distribution of mitochondria, J. Cell Biol. 143(1998)351–358. [30] J.J. Lehman, P.M. Barger, A. Kovacs, J.E. Saffitz, D.M. Medeiros, D.P. Kelly, Peroxisome proliferator-activated receptor gamma coactivator-1 promotes cardiac mitochondrial biogenesis, J. Clin. Invest. 106(2000)847–856. [31] T. Marchini, N. Magnani, V. D'Annunzio, D. Tasat, R.J. Gelpi, S. Alvarez, P. Evelson, Impaired cardiac mitochondrial function and contractile reserve following an acute exposure to environmental particulate matter, Biochim Biophys Acta. 1830 (2013)2545-2552. 21

[32] D. C. Chan, Fusion and fission: interlinked processes critical for mitochondrial health, Annu. Rev. Genet. 46(2012)265–287. [33] S. Cipolat, O. Martins de Brito, B. Dal Zilio, L. Scorrano, OPA1 requires mitofusin 1 to promote mitochondrial fusion, Proc. Natl. Acad. Sci. U. S. A. 101(2006)15927–15932. [34] M. Sagai, H. Saito, T. Ichinose, M. Kodama, Y. Mori, Biological effects of diesel exhaust particles. I. In vitro production of superoxide and in vivo toxicity in mouse, Free Radic. Biol. Med. 14(1993)37–47. [35] W.M. Gehling, L. Khachatryan, B. Dellinger, Hydroxyl Radical Generation from Environmentally Persistent Free Radicals (EPFRs) in PM2.5, Environ. Sci. Technol. 48(2014)4266–4272. [36] I.T. Mak, J. Zhang, W.B. Weglicki, Protective effects of dihydropyridine Ca-blockers against endothelial cell oxidative injury due to combined nitric oxide and superoxide, Pharmacol. Res. 45(2002)27–33. [37] S. Snyder, H.D.S. Bredt, Biological roles of nitric oxide, Sci. Am. 266(1999)68–7l. [38] X.Z. Lu, X. Yu, Study on the changes of serum TNF-α, IL-1β, IL-6 and IL-8 levels in patients with coronary cardiac heart diseases, Journal of Radioimmunology 16(2003)175–176. [39] G. Wang, L. Zhen, P. Lü, R. Jiang, W. Song, Effects of ozone and fine particulate matter (PM2.5) on rat cardiac autonomic nervous system and systemic inflammation, Wei Sheng Yan Jiu 42(2013)554–560. [40] P.R. Kvietys, D.N. Granger, Role of reactive oxygen and nitrogen species in the vascular responses to inflammation, Free Radic. Biol. Med. 52(2012) 556-592. [41] T. Oka, S. Hikoso, O. Yamaguchi, M. Taneike, T. Takeda, T. Tamai, J. Oyabu, T. Murakawa, H. Nakayama, K. Nishida, S. Akira, A. Yamamoto, I. Komuro, K. Otsu, Mitochondrial DNA that 22

escapes from autophagy causes inflammation and heart failure, Nature 485(2012)251-255. [42] V.H. Moreau, R.F. Castilho, S.T. Ferreira, P.C. Carvalho-Alves, Oxidative damage to sarcoplasmic reticulum Ca2+-ATPase at submicromolar iron concentrations: evidence for metal-catalyzed oxidation, Free Radical Biol. Med. 25(1998)554–560. [43] E.A. Golod, M.I. Savina, Ca-dependent ATPase activity and lipidperoxidation in the microsome fraction of renal medulla after thermal lschemia with and without a-Tocopherol protection, Bull. Exp. Biol. Med. 9(1997)876–879. [44] Y. Ikeda, S. Sciarretta, N. Nagarajan, S. Rubattu, M. Volpe, G. Frati, J. Sadoshima, New insights into the role of mitochondrial dynamics and autophagy during oxidative stress and aging in the heart, Oxid. Med. Cell Longev. 2014(2014)210934. [45] S. Soberanes, D. Urich, C.M. Baker, Z. Burgess, S.E. Chiarella, E.L. Bell, A.J. Ghio, A. De Vizcaya-Ruiz, J. Liu, K.M. Ridge, D.W. Kamp, N.S. Chandel, P.T. Schumacker, G.M. Mutlu, G.R. Budinger, Mitochondrial complex III-generated oxidants activate ASK1 and JNK to induce alveolar epithelial cell death following exposure to particulate matter air pollution, J. Biol. Chem. 284(2009)2176–2186. [46] R.F. Castilho, A.R. Meinicke, A.M. Almeida, M. Hermes-Lima, A.E. Vercesi, Oxidative damage of mitochondria induced by Fe(II) citrate is potentiated by Ca2+ and includes lipid peroxidation

and

alterations

in

membrane

proteins,

Arch.

Biochem.

Biophys.

308(1994)158–163. [47] M.A. Packer, C.M. Porteous, M.P. Murphy, Superoxide production by mitochondria in the presence of nitric oxide from peroxynitrite. Biochem, Mol. Biol. Int. 40(1996)527–534. [48] S. Rodriguez-Enriquez, L. He, J.J. Lemasters, Role of mitochondrial permeability transition pores in mitochondrial autophagy, Int. J. Biochem. Cell Biol. 36(2004)2463–2472. 23

[49] P.J. Urrutia, N.P. Mena, M.T. Núñez, The interplay between iron accumulation, mitochondrial dysfunction, and inflammation during the execution step of neurodegenerative disorders, Front Pharmacol. 5(2014)38. [50] N.L. Mills, K. Donaldson, P.W. Hadoke, N.A. Boon, W. MacNee, F.R. Cassee, T. Sandström, A. Blomberg, D.E. Newby, Adverse cardiovascular effects of air pollution, Nat. Clin. Pract. Cardiovasc. Med. 6(2009)36−44. [51] W.Y. Wang, Q. Wang, Impact and mechanism of ambient particulate matter on cardiovascular diseases, J. Environ. Health 26(2009)834−837. [52] C.S. Baxter, J.D. Hoffman, M.J. Knipp, T. Reponen, E.N. Haynes, Exposure of firefighters to particulates and polycyclic aromatic hydrocarbons, J. Occup. Environ. Hyg. 11(2014)D85−91.

[53] U.P. Kodavanti, M.C. Schladweiler, P.S. Gilmour, J.G. Wallenborn, B.S. Mandavilli, A.D. Ledbetter, D.C. Christiani, M.S. Runge, E.D. Karoly, D.L. Costa, S. Peddada, R. Jaskot, J.H. Richards, R. Thomas, N.R. Madamanchi, A. Nyska, The role of particulate matter-associated zinc in cardiac injury in rats, Environ. Health Perspect. 116 (2008) 13−20. [54] R. Reiss, E.L Anderson, C.E. Cross, G. Hidy, D. Hoel, R. McClellan, S. Moolgavkar, Evidence of health impacts of sulfate-and nitrate-containing particles in ambient air, Inhal. Toxicol. 19(2007)419–449.

Fig. 1. The morphological characteristics in the hearts of rats from control (A), 0.375 mg/kg b.w. (B), 1.5 mg/kg b.w. (C), 6.0 mg/kg b.w. (D) and 24.0 mg/kg b.w. (E), 400 × magnification. The control group was instilled with same amount of physiological saline. Right panels are high magnification images corresponding to the left panels. The red arrows indicate sites of hyperemia, 24

the blue arrow indicates site of inflammatory cell infiltration, respectively.

25

26

Fig. 2. Ultrastructural damage effects of PM2.5 exposure on myocardial cells and mitochondria of rats from control (A), 0.375 mg/kg b.w. (B), 1.5 mg/kg b.w. (C), 6.0 mg/kg b.w. (D) and 24.0 mg/kg b.w.(E, F) group, 20000 × magnification. The red arrows indicate sites of mitochondrial swelling, the blue arrow indicates site of mitochondrial fission, and the yellow arrows indicate sites of mitochondrial crista disorder or vacuolization, respectively. N: Nucleus; Mt: Mitochondrion; Mf: Myocardial fibers.

27

28

Fig. 3. (A) Expression of mRNA of OPA1, Mfn1, Mfn2, Drp1 and Fis1 in rat hearts treated with different PM2.5 concentrations; (B and C) Expression of protein of OPA1, Mfn1, Mfn2, Drp1 and Fis1 in heart mitochondria of rats treated with different PM2.5 concentrations. The control group was instilled with same amount of physiological saline. Mean expression in each treated group is shown as increase/decrease compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are mean ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by*P < 0.05 and **P < 29

0.01.

Fig. 4. (A) Expression of mRNA of TNF-α, IL-1β, IL-6 and iNOS in rat hearts treated with different PM2.5 concentrations; (B) TNF-α, IL-1β, IL-6 levels in rat hearts treated with different 30

PM2.5 concentrations. Mean expression of mRNA in each treated group is shown as increase/decrease compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are mean ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by*P < 0.05 and **P < 0.01.

Fig. 5. Activities of SOD, iNOS, Na+K+-ATPase and Ca2+-ATPase in rat hearts treated with different PM2.5 concentrations. The control group was instilled with same amount of physiological saline, and the other special control group (vehicle group) was treated with same amount of suspension from extracts of“blank” filter. The values are mean ± SD from five individual samples. 31

Using one-way ANOVA, comparing with control group, significant difference is indicated by*P < 0.05 and **P < 0.01.

Fig. 6. MDA and NO contents in rat hearts treated with different PM2.5 concentrations. The control group was instilled with same amount of physiological saline, and the other special control group (vehicle group) was treated with same amount of suspension from extracts of “blank” filter. The values are mean ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by*P < 0.05 and **P < 0.01.

Table 1 Primer sequences and the PCR product amplified fragments used in real-time RT-PCR. 32

Gene s OPA

Accession No. NM_13358

1

5

Prod

107 bp

ucts Mfn1

NM_13897

143 bp

ucts Mfn2

NM_13089

136 bp

ucts Drp1

NM_05365

120 bp

ucts Fis1

NM_21374

162 bp

ucts TNFα Prod

5’- CATGAGCAGGATTTTGACACC -3’

Forward primer

5’-CCTTGTACATCGATTCCTGGGTT C-3’

Reverse

5’-CCTGGGCTGCATTATCTGGTG-3’

Forward

5’- GATGTCACCACGGAGCTGGA -3’

primer Reverse

5’- AGAGACGCTCACTCACTTTG -3’

Forward

5’-CGTAGTGGGAACTCAGAGCA-3’

primer Reverse

5’-TGGACCAGCTGCAGAATAAG-3’

Forward

5’-AAATGATGCTACGCAGGCTT-3’

primer Reverse

5’- CCTGGACCATGACCAAGTTT-3’

primer NM_01267 5 148 bp

ucts IL-6

Reverse

primer

6 Prod

-3’

primer

5 Prod

primer

5’-CAGCTGGCAGAAGATCTCAAG

primer

4 Prod

Forward

primer

6 Prod

Sequence

Forward primer Reverse primer

NM_01258

5’-ACAGAAAGCATGATCCGAGA-3’

5’-TCAGTAGAGAGAAGAGCGTGG-3 ’

Forward

33

5’-TCCTACCCCAACTTCCAATGCTC-

9 Prod

79 bp

ucts IL-1β

NM_03151

Prod

172 bp

ucts

Reverse

NM_01261

Prod

123 bp

ucts

5’-TTGGATGGTCTTGGTCCTTAGCC3’

Forward primer

5’-GCCTCAAGGGGAAGAATCTATAC C-3’

Reverse primer

1

actin

3’

primer

2

iNOS

primer

5’-GGGAACTGTGCAGACTCAAACT3’

Forward primer

5’-CAGAAGCAGAATGTGACCATCAT -3’

Reverse

5’-CGGAGGGACCAGCCAAATC-3’

primer NM_03114 4

Prod ucts

211 bp

Forward

5’-CCTCTATGCCAACACAGTGC-3’

primer Reverse

5’-ATACTCCTGCTTGCTGATCC-3’

primer

Table 2 Comparison of myocardial cell histopathological changes and mitochondrion ultrastructural changes in PM2.5 exposure groups and the control group a

Abbreviations: -, histopathological changes; +, mild histopathological changes; ++, moderate

histopathological changes; +++, severe histopathological changes for HE results. For mitochondrial damage results of TEM, the values are mean ± SD from three individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.

34

Group a

Control

0.375 mg/kg PM2.5

1.5 mg/kg PM2.5

6.0 mg/kg PM2.5

24.0 mg/kg PM2.5

－

－

＋

＋＋

＋＋＋

0.32±0.03*

0.46±0.04**

0.65±0.04**

Histopathological damage (HE) Scoring by Flameng method

0.22±0.03

0.24±0.03

(TEM)

Linear regression Y(damage score)=0.0167X(dosage)+0.2703; analysis

35

R2=0.89