Mitochondrial fission protein MoFis1 mediates conidiation and is required for full virulence of the rice blast fungus Magnaporthe oryzae

Microbiological Research 178 (2015) 51–58

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Mitochondrial fission protein MoFis1 mediates conidiation and is required for full virulence of the rice blast fungus Magnaporthe oryzae Irshad Ali Khan a,d , Guoao Ning a , Xiaohong Liu a , Xiaoxiao Feng a , Fucheng Lin a,c , Jianping Lu b,∗ a

State Key Laboratory for Rice Biology, Biotechnology Institute, Zhejiang University, Hangzhou 310058, Zhejiang Province, China College of Life Sciences, Zhejiang University, Hangzhou 310058, Zhejiang Province, China c China Tobacco Gene Research Center, Zhengzhou Tobacco Research Institute of CNTC, Zhengzhou 450001, Henan Province, China d University of Swabi, Khyber Pakhtunkhwa, Pakistan b

a r t i c l e

i n f o

Article history: Received 23 January 2015 Received in revised form 6 June 2015 Accepted 7 June 2015 Available online 2 July 2015 Keywords: Fis1 Mitochondrion Conidiation Pathogenicity Magnaporthe oryzae

a b s t r a c t The mitochondrial fission protein Fis1 regulates yeast mitochondrial fission and is required for ethanolinduced mitochondrial fragmentation and apoptosis. To examine the function of Fis1 in a plant pathogenic fungus, we cloned the MoFIS1 gene, a homolog of Saccharomyces cerevisiae FIS1, from Magnaporthe oryzae and characterized its function by targeted gene deletion and mutant phenotypic analysis. MoFIS1 deletion mutants were unaltered in conidial germination, appressorium formation, and mating tests, but were severely defective in colony growth, conidiation, virulence on rice and barley, growth under nitrogen and glucose deficiency, and growth under osmotic stress. Blast lesions on rice leaves caused by the Mofis1 strain were significantly reduced, were non-proliferating, and were less coalesced as compared to the highly coalesced and proliferating lesions resulting from infection with the wild-type strain. The defects in growth, conidiation, and virulence of the mutant were restored in a complementation strain of Mofis1. A MoFis1-GFP fusion protein co-localized with Mitotracker red in mitochondria. These results show that MoFIS1 encodes a mitochondrial protein that regulates fungal growth, conidiation, and virulence in M. oryzae. © 2015 Elsevier GmbH. All rights reserved.

1. Introduction Rice blast disease caused by the fungus Magnaporthe oryzae that is the most serious disease of cultivated rice. This disease is a threat to global food security and has been reported in at least 85 countries; it can cause 70–80% losses to rice yields during epidemics (Howard and Valent 1996; Ou 1980). M. oryzae also is used as a model organism to study plant–fungi interactions (Dean et al. 2005; Ebbole 2007; Talbot 2003; Valent 1990). The life cycle of M. oryzae begins when a three-celled conidium lands on the surface of a plant leaf and germinates (Ebbole 2007). The germ tube develops into a single-celled appressorium that later penetrates the host’s cuticle layer via a penetration peg, using the turgor pressure derived from glycerol (Howard et al. 1991; Howard and Valent 1996). The fungus then develops infectious hyphae within host tissues that colonize the host tissues 3–5 days post penetration, causing necrotic lesions in plant tissues

∗ Corresponding author. Tel.: +86 571 88982291. E-mail address: [email protected] (J. Lu). http://dx.doi.org/10.1016/j.micres.2015.06.002 0944-5013/© 2015 Elsevier GmbH. All rights reserved.

(Heath et al. 1990; Talbot 2003). Although many genes related to both development and pathogenicity have been characterized, the function of the mitochondria of M. oryzae in the plant–fungi interactions of rice blast disease remain poorly understood. The mitochondria play a paramount role in the life span and stress responses of eukaryotic microorganisms (Osiewacz 2002). Mitochondria are semiautonomous organelles; their function depends on both nuclear and mitochondrial genes (Osiewacz 2002). Roles for mitochondria in viability and stress resistance have been reported in mitochondrial mutants in yeast and Candida spp. (Brun et al. 2004, 2005; Dagley et al. 2011; Jimenez and Benitez 1988). Mitochondria-regulated virulence has been reported in plant fungal pathogens such as Heterobasidion annosum (Olson and Stenlid 2001). Loss of mitochondrial function in Candida glabrata resulted in defective virulence (Brun et al. 2005). The mitochondrial-related proteins GOA1 and SOD2 in Candida albicans are required for virulence (Bambach et al. 2009; Becker et al. 2010; Noble et al. 2010). A role for mitochondria in hypervirulence was reported for Cryptococcus gattii and it was proposed that this positive role of mitochondria function in virulence is due to the change in mitochondrial morphology toward more tubular-structured

52

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

organelles (Byrnes et al. 2010; Ma et al. 2009). Shingu-Vazquez and Traven (2011) reported in their 2011 review that the reduced virulence associated with dysfunctional mitochondria is probably due to reduced fitness, metabolic changes, and sensitivity to oxidative stress caused by defective respiration. The mitochondrial fission machinery in yeast is regulated by three proteins: Dnm1, Mdv1, and Fis1 (Jensen et al. 2000; Shaw and Nunnari 2002). Fis1 is known to play an important role in programmed cell death in yeast (Madeo et al. 1999). Becker et al. reported in 2010 that not all mitochondrial mutants have the same effect on virulence; some of the mitochondrial mutants they identified were essential for virulence while others only attenuated virulence (Becker et al. 2010). Although the functions of Fis1 proteins have been reported in yeast and in human, little is known about the function of Fis1 in filamentous fungal pathogens. In this study, we conducted functional analysis of MoFis1 in M. oryzae and found that MoFIS1 is essential for growth, conidiation, and full pathogenicity of the rice blast fungus. 2. Materials and methods 2.1. Growth conditions and fungal strains M. oryzae wild-type strain Guy11 and the mutant strains were cultured on CM medium (Talbot et al. 1993) at 25 ◦ C for 9–12 days with a 14 h light and 10 h dark photoperiod using fluorescent lights. For growth analysis, the strains were grown on minimal medium (MM, 6 g NaNO3 , 0.52 g KCl, 0.52 g MgSO4 , 1.52 g KH2 PO4 , 10 g glucose, 0.5% biotin, and 1 L water, pH 6.5), MM-N (MM medium without the nitrogen source), and MM-C medium (MM medium without the carbon source) at 25 ◦ C for 9–12 days under continuous light conditions. The defined complex medium (DCM, yeast nitrogen base without amino acids 1.7 g, NH4 NO3 2 g, l-asparagine 1 g, glucose 10 g, and 1 L water; Na2 HPO4 was used to adjust the pH to 6.0) supplemented with 100 ␮g/mL chlorimuron-ethyl as an antibiotic was used for initial screening of chlorimuron-ethyl -resistant mutants during Agrobacterium tumefaciens mediated transformation (ATMT), as described previously (Liu et al. 2008). Sexual crossing of the Guy11 and Mofis1 (Mat1-2) strain with the opposite mating type strain 2539 (Mat1-1) was conducted by inoculating on an OMA (Oat Meal Agar: 30 g oat in 1 L water) medium plate. 2.2. Targeted gene disruption For constructing the MoFIS1 gene replacement construct, the 5 and 3 flanking sequences of the MoFIS1 gene were amplified by PCR from the wild-type genomic DNA and inserted into the XhoI/EcoRV and EcoRI/BamH1 sites of the pBS-SUR vector (Li et al. 2012). The primers used were FIS1-up-p1 (ATctcgagGTGCGGAACTTTTGCGTGTCG) and FIS1-up-p2 (ATgatatcAAGGCTGAGATTTGGCGTGTAT) for the 5 -flanking fragment, and FIS1-low-p1 (ATgaattcGATTTAGGTTTGGCGGTTTTGTGA) and FIS1-low-p2 (ATggatccCAGTTGATATCGGCGGCTTCTTAC) for the 3 flanking fragment. The knockout cassette was linearized and inserted into the Xho1/BamH1 sites of the pCAMBIA1300 binary vector. The resulting pCAMBIA1300-FIS1 vector was then transformed into the germinating conidia of the wild-type strain using the ATMT method. Chlorimuron-ethyl resistant transformants were initially confirmed by PCR using primers (GCTGGGGGTCATGCTCCTCTC and GCTCGCTGCGTACACCCAACTT) that were internal to MoFIS1 and then reconfirmed by Southern blot analysis. To perform Southern blotting, genomic DNA of the mutants and Guy11 was digested with EcoRV, separated on 0.7% agarose gel, and transferred to a positively charged nylon membrane. The 846-bp fragment of the 5 flanking sequence of the MoFIS1 gene was labeled as a probe. The targeted

gene deletion event was confirmed by the detection of a 2.2-kb fragment in the transformants compared to a 4.5-kb fragment in the wild-type. Knock-out mutants purified by mono-conidial isolation were used for phenotypic analysis. For the genetic complementation assays, a 2.7-kb fragment containing the full length CDS of MoFIS1, a 1.5-kb upstream promoter region, and a 0.5-kb downstream terminator region was amplified with a pair of primers (TAAGTAGAATAAGATGAGCGTTTGGG and ATCCCGCCAAGAGGCTCAGACAT) and cloned into the pKD8 vector (Li et al. 2012) to generate pKD8-MoFIS1. The pKD8-MoFIS1 was transformed into Mofis1 conidia through via ATMT transformation using a selective reporter gene (NEO). The transformants were screened on CM medium containing G418 (800 ␮g/mL). The resulting antibiotic-resistant transformants were finally confirmed by RT-PCR analysis of the gene complementation event. 2.3. Generation of the MoFis1-GFP fusion strain The MoFIS1-GFP fusion vector was constructed by cloning the MoFIS1 CDS into the pKD8-GFP vector (Li et al. 2012) using a pair of primers (ATGGGGACTAATCTTCCCTGTG and ATCCCGCCAAGAGGCTCAGACAT). The pMoFIS1-GFP vector was transformed into mutant Mofis1 conidia via ATMT transformation. Transformants obtained were screened on selective medium containing G418 (800 ␮g/mL). The hyphae of transformants expressing GFP fluorescence were stained with 1 mmol/L Mitotracker red (Invitrogen, USA) for 40 min and observed under a fluorescence microscope. 2.4. Assays for fungal development To analyze the growth characteristics of vegetative mycelium colonies, a 5 mm mycelium block of 8–12-day-old Guy11 and mutant fungi was inoculated on the center of solid CM medium plates followed by incubation at 25 ◦ C under continuous fluorescent light. Diameters (cm) of the mycelium colonies were recorded and photographed at 9 days post-inoculation (dpi). The assay was repeated three times with three replicate plates for each experimental condition. Fungal conidiation assays were carried out by harvesting the whole conidia of a 9-day-old CM-grown Guy11 and mutant cultures with 5 mL of sterile distilled water by gently rubbing the surface of the plate with a sterile Q-tip. A 10 ␮L conidial suspension was dropped on a clean microscope glass coverslip and spore concentration was determined using a hemacytometer under a microscope. To observe conidiophore development, a thinner piece of mycelia mat of each strain was placed on a clean glass slide and grown over 2% water agar medium at 25 ◦ C for 24 h under continuous light and photographed. To measure conidial germination and appressorium formation, a 20 ␮L drop of conidial suspension (105 conidia/mL) was dropped on the surface of a sterile plastic coverslip and incubated in a moistened box at 28 ◦ C for 2, 4, or 6 h, as in a previously described study (Liu et al. 2007). More than 200 conidia were observed in each sample; and the conidia that produced germ tubes, and the germ tubes that formed appressoria, were counted; and then the percentage of the germinated conidia and the percentage of the formed appressoria were calculated. Each assay was independently repeated three times with three replicates. 2.5. Stress condition growth assays To evaluate the effect of nitrogen and glucose deficiency on the growth of the deletion mutants, a 5 mm mycelium block of Guy11 and mutant fungi was inoculated on the center of plates of solid CM medium, MM medium, MM-C medium, and MM-N medium, followed by incubation at 25 ◦ C under constant fluorescent light.

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

The diameters of the mycelium colonies were recorded and photographed at 8 dpi. Cell wall composition in M. oryzae plays an important role in full virulence; defects of cell walls can affect appressorium formation and result in defective pathogenicity (Dou et al. 2011; Xu 2000; Xu et al. 1998). Cell wall integrity tests were conducted by growing a 5 mm mycelium plug of Guy11 and mutant fungi on CM medium plates containing 200 ␮g/mL of Congo red (Sangon Co., Shanghai, China) followed by incubation at 25 ◦ C under continuous light. The diameters of fungal colonies were measured and photographed at 7 dpi. To evaluate the vegetative growth of the Guy11 and mutant strains under chemical stress conditions, 5 mm mycelium blocks of each strain were grown on solid MM medium supplemented with ZnSO4 (10 mM), CuSO4 (1 mM), or CdCl2 (0.5 mM) followed by incubation at 25 ◦ C for 10 days in darkness, as conditions using a method described previously (Tucker et al. 2004). Diameters of representative fungal colonies were measured and photographed. To evaluate the hyperosmotic stress response of the Guy11 and mutant strains against NaCl, 5 mm mycelial blocks each strain were grown on solid CM medium containing NaCl (1 M) followed by incubation at 25 ◦ C for 7 days with continuous light, as described previously (Zhang et al. 2011). Diameters of fungal colonies were measured and photographed. These experiments were repeated three times independently with three replicates per strain. The growth inhibition ratios under stress treatments were calculated by comparing the colony growth of the strains on the stress media with the growth of strains on MM or CM media: the growth inhibition rate = (colony diameter on MM or CM medium − colony diameter under stress condition)/colony diameter on MM or CM medium. 2.6. Infection assays on rice and barley Two week-old rice (Oryza sativa cv CO-39) seedlings (3–4 leaf stage) were spray inoculated with 1 × 105 conidia/mL conidial suspensions (10 mL) of Guy11, mutant, and rescued M. oryzae strains that contained 0.2% gelatin solution, as described previously (Lu et al. 2007). Disease lesions were photographed at 7 dpi and disease density and intensity was recorded from 5 cm leaf segments of 10

53

randomly selected heavily infected leaves for each fungal strain using a previously reported disease rating scale (Lu et al. 2007). 8-Day-old barley (Hordeum vulgare) seedlings were spot inoculated with three drops (20 ␮L each) of 1 × 105 conidia/mL conidial suspensions (10 mL) of Guy11, mutant, and rescued M. oryzae strains that contained 0.2% gelatin solution and incubated in a growth chamber at 25 ◦ C for 4 days. Control plants were spot inoculated with 0.2% gelatin solution. Disease lesions were photographed at 4 dpi. 7-Day-old barley seedlings were inoculated with 5 mm mycelium blocks of Guy11 and mutant fungi and incubated in a growth chamber at 25 ◦ C for 4 days and then photographed. 2.7. Mating with 2539 strain The role of MoFIS1 in sexual reproduction was determined by crossing the mutants and Guy11 with the opposite mating type strain 2539 for perithecia formation, as previously described (Liu et al. 2007). Mycelium blocks (5 mm) of Guy11, the mutants, and the 2539 strain were placed on an OMA medium plate at about 5 cm apart from one another and incubated at 25 ◦ C under continuous light for about a week until their colonies merged, and then transferred to another incubator at 22 ◦ C under constant fluorescent light and photographed at 28 dpi. 3. Results 3.1. Identification and isolation of MoFIS1 Blastp searches against the M. oryzae genome database MG8 (www.broad.mit.edu) using the Saccharomyces cerevisiae Fis1 protein sequence identified an M. oryzae ortholog (MGG 06075.7), designated as MoFis1; this ortholog is 154 amino acids in length and contains a Fis1 domain (cd12212: E-value = 1.59e−78). The MoFis1 protein shared 47, 40, 45, 74, and 38% sequence identity with the Fis1 proteins of S. cerevisiae, Homo sapiens, C. glabrata, Aspergillus niger, and Drosophila melanogaster, respectively. The MoFis1 homologs in eight species of fungi (A. niger, Aspergillus oryzae, C. glabrata, C. globosum, M. oryzae, Neurospora tetrasperma, Puccinia graminis, S. cerevisiae) were aligned using the CLC Main workbench program (www.clcbio.com) (Fig. 1). The results of the

Fig. 1. The alignment of MoFis1 and its homologous proteins in eight fungi. These Fis1 proteins are XP 001399360.1 (A. niger), XP 001821771.1 (A. oryzae), XP 449893.1 (C. glabrata), XP 001224063.1 (C. globosum), MoFis1 (M. oryzae), XP 009850063.1 (N. tetrasperma), XP 003331294.1 (P. graminis), and NP 012199.3 (S. cerevisiae).

54

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

The Mofis1 mutants were then purified by mono-conidial isolation and further phenotypically characterized. We also complemented Mofis1 with the native MoFIS1 genomic DNA sequence from the wild-type strain. The gene deletion event in Mofis1 and the complemented gene in rescued strain were confirmed by RT-PCR (Fig. 2C). 3.3. MoFIS1 is required for radial growth of mycelia and for conidiation

Fig. 2. Gene deletion and complementation of MoFIS1 in M. oryzae. (A) The MoFIS1 locus and gene deletion vector. B = BamHI, E = EcoI, EV = EcoRV, X = XbaI. (B) Southern blot assay of Mofis1. Genomic DNA of the wild-type and mutant strains were digested with EcoRV and probed with an 846-bp fragment marked in Fig. 2A. The mutants had a 2.2-kb band that differed from the 4.5-kb band of the wild-type strain. (C) RT-PCR confirmation of MoFIS1 in the rescued strain. C-5 and C-37 are two Mofis1 strains.

alignment are displayed in Fig. 1 and a show that the proteins in fungi are highly conserved and share 38 fully conserved amino acid residues.

3.2. Deletion of MoFIS1 To evaluate the function of the MoFIS1 gene in the development and pathogenicity of the rice blast fungus, we deleted it from M. oryzae. A 5.0-kb gene deletion vector (pBS-up-Sur-low) containing a sulfonylurea resistant gene (SUR) as a marker gene was generated as described in Section “Materials and methods” (Fig. 2A). The deletion vector was then transformed into germinating conidia of the wild-type Guy11 strain via the ATMT method. Chlorimuron-resistant transformants grown on DCM medium were initially screened by PCR, resulting in the identification of two MoFIS1-deletion mutants. These two MoFIS1-deletion mutants (C-5 and C-37) were then confirmed by Southern blot analysis (Fig. 2B).

For mycelial growth and conidiation analysis, wild-type, mutant, and rescued strains were grown on CM medium at 25 ◦ C for 9 d and the diameter of mycelial growth and conidial production were then recorded. The MoFIS1-deletion mutants grew significantly slower (P < 0.05) than did the wild-type and the rescued strain (Table 1 and Fig. 3A). The measured culture colony growth values of the mutants were 4.81 ± 0.13 cm for strain C-5 and 4.94 ± 0.09 cm for strain C-37, respectively, and 6.61 ± 0.18 cm for the wild-type and 6.01 ± 0.09 cm for the rescued strain (Table 1). We next analyzed the conidiation of the wild-type, mutant, and rescued strains after growth on CM medium for 9 d by counting the number of conidia using a hemacytometer. Conidia production by the mutants was significantly lower than that of the wild-type (P < 0.05) (Table 1). The mutants produced 0.70 ± 0.15 × 103 conidia/mm2 (strain C-5) and 0.66 ± 0.1 × 103 conidia/mm2 (strain C-37), compared to 1.40 ± 0.26 × 103 and 1.67 ± 0.14 × 103 conidia/mm2 in the wildtype and rescued strain, respectively. The conidiophore development of the strains was also assayed as described in Section “Materials and methods”. The mutants developed fewer conidiophores than the wild-type and rescued strain, and the mutant conidiophores had fewer conidia than did those of the wild-type and rescued strains (Fig. 3B). These results show that MoFIS1 is in involved in mycelial growth and conidiation of M. oryaze. 3.4. MoFIS1 does not affect conidial germination or appressorium formation We analyzed conidial germination and appressorial formation in the wild-type, mutant, and rescued strains by incubating a drop (20 ␮L each) of conidial suspension (1 × 105 conidia/mL) on sterile plastic coverslips at 28 ◦ C for 2, 4, and 24 h. The germination rates of conidia in the mutants Mofis1 C-5 and C-37 were comparable to

Fig. 3. Mycelial growth and conidiophore development of the Mofis1 strains (C-5 and C-37) and the rescued strain. (A) Mycelial growth of M. oryzae strains on CM medium at 25 ◦ C for 9 d. (B) Conidiophore development of Mofis1 strains.

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

55

Table 1 Developmental characteristics of M. oryzae strains. Strain

Growth (mm)a

Guy11 C-5 C-37 Rescued

66.1 48.1 49.4 60.1

Conidiation (n × 103 /mm2 )b

Conidial germination (%) 2 hpi

± ± ± ±

1.8Ae 1.3C 0.9C 0.9B

1.40 0.70 0.66 1.67

± ± ± ±

0.26A 0.15B 0.14B 0.14A

Appressorium formation (%)c

93.7 87.5 87.5 94.5

94.2 91.0 90.2 95.8

± ± ± ±

1.2AB 7.8B 2.9B 1.5A

98.8 98.3 98.0 98.5

± ± ± ±

1.5A 2.3A 2.0A 1.0A

Growth inhibition ratio under stress (%)d MM-N

Guy11 C-5 C-37 Rescued

4 hpi ± ± ± ±

−40.4 −25.1 −25.2 −43.9

3.2A 6.0A 4.5A 1.5A

MM-C ± ± ± ±

10.5A 22.5B 16.2B 5.3A

26.0 43.3 39.6 25.0

± ± ± ±

CM-NaCl 3.8B 12.4A 7.8A 2.2B

16.0 10.3 10.9 15.5

± ± ± ±

4.0A 1.7B 1.5B 3.0A

Growth inhibition ratio under stress (%)d CM-CR Guy11 C-5 C-37 Rescued

5.0 5.9 6.5 2.2

± ± ± ±

3.3A 2.4A 2.8A 4.1A

MM-CuSO4

MM-ZnSO4

MM-CdCl2

22.7 ± 4.9A – 24.6 ± 7.7A 19.9 ± 4.9A

71.5 ± 5.3A – 71.2 ± 3.7A 66.4 ± 1.7A

61.1 ± 2.3A – 57.8 ± 3.5A 58.9 ± 1.8A

a

Mycelial growth. Conidiation were measured for the strains growing on CM medium at 25 ◦ C for 9 days. c Appressorium formation rates were measured at 24 hpi. d The growth inhibition ratio was calculated by comparing the colony growth of the strains under stress (on MM-N, MM-C, CM-NaCl, CM-CR, MM-CuSO4 , MM-ZnSO4 , and MM-CdCl2 media) with that strains grown on MM or CM medium. e Same capital letters indicate non-significant differences estimated by Duncan’s test (P < 0.05) for all tests. C-5 and C-37 are Mofis1 strains. b

those of the wild-type and rescued strains at 4 h post-inoculation (hpi); there were no statistically significant differences between the mutants and the wild-type (P < 0.05). The appressorium formation rates of the mutant at 24 hpi were similar to those of the wildtype and rescued strains (P < 0.05) (Table 1). These results suggest that the MoFIS1 gene is not required for conidial germination or appressorial formation in M. oryzae.

3.5. MoFIS1 does not affect M. oryzae sensitivity to several stresses and does not affect cell wall integrity To evaluate the effects of nitrogen and glucose deficiency on the M. oryzae growth, all of the strains on this study were grown on MM, MM-N, and MM-C media at 25 ◦ C for 8 days and the diameters of mycelial growth were recorded. The Mofis1 mutants grew slowly on MM-N and MM-C media (Fig. 4A), and the growth inhibition ratio of the mutants displayed obvious differences compared to those of the wild-type and rescued strains (Table 1), showing that this gene is somehow related with glucose and nitrogen utilization. To investigate the potential of a hypersensitive function of the MoFis1 protein, the wild-type and mutant strains were grown on hyperosmotic medium amended with NaCl (0.5 M) at 28 ◦ C for 7 days in darkness. The mycelial growth of the mutants was affected on hyperosmotic stress (Fig. 4B), and the growth inhibition ratio of the mutants showed obvious differences compared to the wildtype and rescued strain (Table 1). We also tested the response of mutants to Zn2+ , Cu2+ or Cd2+ stresses. The wild-type and the Mofis1 mutant were grown on solid MM medium supplemented with ZnSO4 (10 mM), CuSO4 (1 mM), or CdCl2 (0.5 mM), followed by incubation at 25 ◦ C for 10 days in darkness. The mutants grew slowly on these stress media (Fig. 4C), but the growth inhibition ratio of the mutants did not show obvious differences compared to the wild-type or rescued strain (Table 1). These results indicate that the MoFis1 protein is involved in osmotic stress responses but that it does not does not play a required role resistance to ZnSO4 , CuSO4 , or CdCl2 stress.

Defects in cell wall composition in M. oryzae are known to affect appressorium formation and successful infection of rice plants (Jeon et al. 2008; Skamnioti et al. 2007; Xu 2000; Xu et al. 1998). Congo Red (CR), which binds to the cell wall component beta-1,4glucan (Wood and Fulcher 1983), is commonly used to evaluate cell wall integrity. To investigate the function of MoFIS1 in cell wall integrity, the strains of this study were grown on CM medium amended with CR (200 ␮g/mL) for 7 days. We found that the mutants grew slower on CM-CR medium than did the wild-type or the rescued strain. (Fig. 4C and Table 1), but the growth inhibition ratio of the mutants did not show obvious differences compared to the wild-type or rescued strain (Table 1). 3.6. MoFIS1 is not required for sexual reproduction In order to determine the possible role of the MoFIS1 gene in sexual reproduction, the wild-type and mutant (C-5 and C-37) strains were crossed with the opposite mating type 2539 isolate of M. oryzae to allow perithecia production. After 4 weeks of incubation at 22 ◦ C, we observed numerous perithecia at the junctions between mated individuals, indicating that the MoFIS1 gene is not essential for sexual reproduction in M. oryzae. 3.7. MoFIS1 is required for full virulence of M. oryzae To evaluate the role of the MoFIS1 gene in pathogenicity, leaves of 14-day-old blast-susceptible rice plants were spray-inoculated with 10 mL of a 1 × 105 conidia/mL conidial suspension and lesions on leaves were photographed 7 dpi (Fig. 5A). The mutant strains did not lose their ability to cause rice blast disease on rice leaves, but inoculation with the mutants showed less severe virulence with smaller, reduced, non-spreading, non-coalesced, and nonproliferating lesions as compared to those caused by the wild-type and the rescued strain (Fig. 5A). The mutant treatment led to an disease density (7.0 ± 2.5 and 5.0 ± 1.6 lesions/5 cm for strain C-5 and C-37, respectively) compared to 24.1 ± 8.6 lesions/5 cm and 22.6 ± 8.4 lesions/5 cm in the wild-type and rescued strains,

56

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

Fig. 4. Mycelial growth of M. oryzae strains under stress conditions. (A) Growth on MM, MM-N, and MM-C media at 25 ◦ C for 8 days. (B) Growth on MM media containing (10 mM ZnSO4 , 1 mM CuSO4 or 0.5 mM CdCl2 ) at 25 ◦ C for 10 days. (C) Growth on CM media containing (0.5 M NaCl or 200 ␮g/mL Congo red) at 25 ◦ C for 7 days. CR, Congo red. C-5 and C-37, Mofis1 strains; rescued, the MoFIS1-rescued strain of Mofis1.

respectively. Lesions on barley treated with the mutant strains were also significantly reduced compared to those on leaves treated with the wild-type and the rescued strain (Fig. 5B and C). These results show that the MoFIS1 gene is required for full virulence of M. oryzae. 3.8. Subcellular localization of the MoFis1 protein We generated a MoFIS1-GFP fusion construct using the pKD8GFP vector and transformed this construct into the Mofis1 mutant. A total of 11 transformants were isolated. All of these produced normal conidia, germ tubes, and appressoria and 10 of these transformants had detectable GFP signals in vegetative hyphae and conidia. The hyphae of the transformants were stained with

1 mmol/L of Mitotracker red, a red-fluorescent mitochondrial dye, to check if MoFis1-GFP was co-localized with mitochondria. The results showed that mitochondria marked by red fluorescence were co-localized with green MoFis1-GFP fusion proteins in hypha cells grown in liquid CM media, suggesting that MoFis1 is a mitochondrial protein (Fig. 6). 4. Discussion M. oryzae has been used as a model organism for the study of fungal-caused plant diseases in recent decades. The rice blast fungus produces spores that form dome-shaped appressoria. Many genes have been reported to affect the production of conidia and

Fig. 5. Pathogenicity assays of M. oryzae strains (wild-type strain Guy11, Mofis1 strains C-5 and C-37, and MoFIS1-rescued strain). (A) Rice seedlings were sprayed with a conidial suspension of M. oryzae strains and cultured for 7 days. (B) A conidial suspension (20 ␮L, 1 × 105 conidia/mL) was placed drop-wise on intact barley leaf explants for 4 days. (C) Mycelial agar plugs of the mutants were placed on intact barley leaf explants for 4 days.

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

57

for the full pathogencity of M. oryzae in the development of rice blast disease in rice and barley. These findings can help us more fully understand the functions of mitochondria in the development and pathogenicity of filamentous fungus. Acknowledgments We thank Dr. John Hugh Snyder at the China Tobacco Gene Research Center, CNTC, for critical reading of this manuscript. This research was supported by the National Basic Research Program of China (Grant No: 2012CB114002) and the Natural Science Foundation of China (Grant Nos. 31370171, 31371891). This work was also supported by the Fundamental Research Funds for the Central Universities, Pakistan. References

Fig. 6. Subcellular localization of MoFis1-GFP fusion protein in M. oryzae hyphae. Hyphae expressing MoFis1-GFP fusion protein were stained with Mitotracker red. Bar = 10 ␮m.

appressoria and disruption of these genes leads to failure of the development of rice blast disease (Jeon et al. 2007; Kershaw and Talbot 2009; Kim et al. 2009; Lu et al. 2014; Nishimura et al. 2009; Saitoh et al. 2012). In this study, we analyzed the genedeletion mutants for their function in infection-related events such as mycelium growth on CM medium, conidiation, conidial germination, appressorium formation, sexual reproduction, pathogenicity on blast susceptible rice and barley, osmotic stress response, glucose and nitrogen deficiencies, and cell wall integrity test. We found that the mutants were significantly impaired in pathogenicity, produced reduced numbers of conidia, and grew slowly on CM medium compared to the wild-type strain. Mitochondria are important organelles for fungal development and pathogenicity in the rice blast fungus M. oryzae. Deletion of MoTCTP, a homolog of translationally controlled tumor protein which is located in the mitochondrial outer membrane, leads to the defects in mycelial growth, conidial production, conidial germination, resistance to H2 O2 , and pathogenicity in M. oryzae (Zhang et al. 2013). Mitochondrial and peroxisomal ␤-oxidation is essential for the development of infection-competent appressoria (Patkar et al. 2012). In the chestnut blight fungus Cryphonectria parasitica, the impairment of mitochondrion also results in hypovirulence in Prodh and P5Cdhi and reduced conidiation in Prodh (Yao et al. 2013). In this study, Mofis1, a mitochondrial outer membraneanchored protein gene deletion mutant, displayed defects in fungal growth, conidiation and virulence. In budding yeast, Fis1 cooperates with adaptor proteins Mdv1 and Caf4 to recruit the cytoplasmic dynamin-related GTPase Dnm1 to sites of membrane scission from the cytoplasm during mitochondrial fission (Cerveny and Jensen 2003; Cerveny et al. 2001; Jakobs et al. 2003; Mozdy et al. 2000; Tieu and Nunnari 2000; Tieu et al. 2002). The damage of mitochondrial fission in Mofis1 maybe leads to defects in carbon metabolism, which is required for fungal development and virulence (Fernandez et al. 2012; Zeng et al. 2014). Therefore, MoFis1 functions in the fungal development and virulence through keeping normal mitochondrial fission in M. oryzae. In conclusion, this work suggests that MoFIS1 plays important roles in fungal growth and conidiation and that this gene is required

Bambach A, Fernandes MP, Ghosh A, Kruppa M, Alex D, Li D, et al. Goa1p of Candida albicans localizes to the mitochondria during stress and is required for mitochondrial function and virulence. Eukaryot Cell 2009;8:1706–20. Becker JM, Kauffman SJ, Hauser M, Huang L, Lin M, Sillaots S, et al. Pathway analysis of Candida albicans survival and virulence determinants in a murine infection model. Proc Natl Acad Sci U S A 2010;107:22044–9. Brun S, Berges T, Poupard P, Vauzelle-Moreau C, Renier G, Chabasse D, et al. Mechanisms of azole resistance in petite mutants of Candida glabrata. Antimicrob Agents Chemother 2004;48:1788–96. Brun S, Dalle F, Saulnier P, Renier G, Bonnin A, Chabasse D, et al. Biological consequences of petite mutations in Candida glabrata. J Antimicrob Chemother 2005;56:307–14. Byrnes EJ 3rd, Li W, Lewit Y, Ma H, Voelz K, Ren P, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the northwest United States. PLoS Pathog 2010;6:e1000850. Cerveny KL, Jensen RE. The WD-repeats of Net2p interact with Dnm1p and Fis1p to regulate division of mitochondria. Mol Biol Cell 2003;14:4126–39. Cerveny KL, McCaffery JM, Jensen RE. Division of mitochondria requires a novel DMN1-interacting protein, Net2p. Mol Biol Cell 2001;12:309–21. Dagley MJ, Gentle IE, Beilharz TH, Pettolino FA, Djordjevic JT, Lo TL, et al. Cell wall integrity is linked to mitochondria and phospholipid homeostasis in Candida albicans through the activity of the post-transcriptional regulator Ccr4-Pop2. Mol Microbiol 2011;79:968–89. Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK, Orbach MJ, et al. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 2005;434:980–6. Dou X, Wang Q, Qi Z, Song W, Wang W, Guo M, et al. MoVam7, a conserved SNARE involved in vacuole assembly, is required for growth, endocytosis, ROS accumulation, and pathogenesis of Magnaporthe oryzae. PLoS ONE 2011;6:e16439. Ebbole DJ. Magnaporthe as a model for understanding host-pathogen interactions. Ann Rev Phytopathol 2007;45:437–56. Fernandez J, Wright JD, Hartline D, Quispe CF, Madayiputhiya N, Wilson RA. Principles of carbon catabolite repression in the rice blast fungus: Tps1, Nmr1-3, and a MATE-family pump regulate glucose metabolism during infection. PLoS Genet 2012;8:e1002673. Heath MC, Valent B, Howard RJ, Chumley FG. Interactions of 2 strains of Magnaporthe grisea with rice, gossegrass, and weeping lovegrass. Can J Bot 1990;68:1627–37. Howard RJ, Ferrari MA, Roach DH, Money NP. Penetration of hard substrates by a fungus employing enormous turgor pressures. Proc Natl Acad Sci U S A 1991;88:11281–4. Howard RJ, Valent B. Breaking and entering: host penetration by the fungal rice blast pathogen Magnaporthe grisea. Annu Rev Microbiol 1996;50:491–512. Jakobs S, Martini N, Schauss AC, Egner A, Westermann B, Hell SW. Spatial and temporal dynamics of budding yeast mitochondria lacking the division component Fis1p. J Cell Sci 2003;116:2005–14. Jensen RE, Hobbs AE, Cerveny KL, Sesaki H. Yeast mitochondrial dynamics: fusion, division, segregation, and shape. Microsc Res Tech 2000;51:573–83. Jeon J, Goh J, Yoo S, Chi MH, Choi J, Rho HS, et al. A putative MAP kinase kinase kinase, MCK1, is required for cell wall integrity and pathogenicity of the rice blast fungus, Magnaporthe oryzae. Mol Plant Microbe Interact 2008;21:525–34. Jeon J, Park SY, Chi MH, Choi J, Park J, Rho HS, et al. Genome-wide functional analysis of pathogenicity genes in the rice blast fungus. Nat Genet 2007;39:561–5. Jimenez J, Benitez T. Yeast cell viability under conditions of high temperature and ethanol concentrations depends on the mitochondrial genome. Curr Genet 1988;13:461–9. Kershaw MJ, Talbot NJ. Genome-wide functional analysis reveals that infectionassociated fungal autophagy is necessary for rice blast disease. Proc Natl Acad Sci U S A 2009;106:15967–72. Kim S, Park SY, Kim KS, Rho HS, Chi MH, Choi J, et al. Homeobox transcription factors are required for conidiation and appressorium development in the rice blast fungus Magnaporthe oryzae. PLoS Genet 2009;5:e1000757. Li HJ, Lu JP, Liu XH, Zhang LL, Lin FC. Vectors building and usage for gene knockout, protein expression and fluorescent fusion protein in the rice blast fungus. J Agric Biotechnol 2012;20:94–104.

58

I.A. Khan et al. / Microbiological Research 178 (2015) 51–58

Liu XH, Liu TB, Lin FC. Monitoring autophagy in Magnaporthe oryzae. Methods Enzymol 2008;451:271–94. Liu XH, Lu JP, Zhang L, Dong B, Min H, Lin FC. Involvement of a Magnaporthe grisea serine/threonine kinase gene, MgATG1, in appressorium turgor and pathogenesis. Eukaryot Cell 2007;6:997–1005. Lu J, Cao H, Zhang L, Huang P, Lin F. Systematic analysis of Zn2 Cys6 transcription factors required for development and pathogenicity by high-throughput gene knockout in the rice blast fungus. PLoS Pathog 2014;10:e1004432. Lu JP, Feng XX, Liu XH, Lu Q, Wang HK, Lin FC. Mnh6, a nonhistone protein, is required for fungal development and pathogenicity of Magnaporthe grisea. Fungal Genet Biol 2007;44:819–29. Ma H, Hagen F, Stekel DJ, Johnston SA, Sionov E, Falk R, et al. The fatal fungal outbreak on Vancouver Island is characterized by enhanced intracellular parasitism driven by mitochondrial regulation. Proc Natl Acad Sci U S A 2009;106:12980–5. Madeo F, Frohlich E, Ligr M, Grey M, Sigrist SJ, Wolf DH, et al. Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol 1999;145:757–67. Mozdy AD, McCaffery JM, Shaw JM. Dnm1p GTPase-mediated mitochondrial fission is a multi-step process requiring the novel integral membrane component Fis1p. J Cell Biol 2000;151:367–80. Nishimura M, Fukada J, Moriwaki A, Fujikawa T, Ohashi M, Hibi T, et al. Mstu1, an APSES transcription factor, is required for appressorium-mediated infection in Magnaporthe grisea. Biosci Biotechnol Biochem 2009;73:1779–86. Noble SM, French S, Kohn LA, Chen V, Johnson AD. Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity. Nat Genet 2010;42:590–8. Olson A, Stenlid J. Plant pathogens – mitochondrial control of fungal hybrid virulence. Nature 2001;411:438. Osiewacz HD. Genes, mitochondria and aging in filamentous fungi. Ageing Res Rev 2002;1:425–42. Ou SH. Pathogen variability and host resistance in rice blast disease. Annu Rev Phytopathol 1980;18:167–87. Patkar RN, Ramos-Pamplona M, Gupta AP, Fan Y, Naqvi NI. Mitochondrial beta-oxidation regulates organellar integrity and is necessary for conidial germination and invasive growth in Magnaporthe oryzae. Mol Microbiol 2012;86:1345–63. Saitoh H, Fujisawa S, Mitsuoka C, Ito A, Hirabuchi A, Ikeda K, et al. Large-scale gene disruption in Magnaporthe oryzae identifies MC69, a secreted protein required for infection by monocot and dicot fungal pathogens. PLoS Pathog 2012;8:e1002711. Shaw JM, Nunnari J. Mitochondrial dynamics and division in budding yeast. Trends Cell Biol 2002;12:178–84.

Shingu-Vazquez M, Traven A. Mitochondria and fungal pathogenesis: drug tolerance, virulence, and potential for antifungal therapy. Eukaryot Cell 2011;10:1376–83. Skamnioti P, Henderson C, Zhang Z, Robinson Z, Gurr SJ. A novel role for catalase B in the maintenance of fungal cell-wall integrity during host invasion in the rice blast fungus Magnaporthe grisea. Mol Plant Microbe Interact 2007;20:568–80. Talbot NJ. On the trail of a cereal killer: exploring the biology of Magnaporthe grisea. Annu Rev Microbiol 2003;57:177–202. Talbot NJ, Ebbole DJ, Hamer JE. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell 1993;5:1575–90. Tieu Q, Nunnari J. Mdv1p is a WD repeat protein that interacts with the dynamin-related GTPase, Dnm1p, to trigger mitochondrial division. J Cell Biol 2000;151:353–66. Tieu Q, Okreglak V, Naylor K, Nunnari J. The WD repeat protein, Mdv1p, functions as a molecular adaptor by interacting with Dnm1p and Fis1p during mitochondrial fission. J Cell Biol 2002;158:445–52. Tucker SL, Thornton CR, Tasker K, Jacob C, Giles G, Egan M, et al. A fungal metallothionein is required for pathogenicity of Magnaporthe grisea. Plant Cell 2004;16:1575–88. Valent B. Rice blast as a model system for plant pathology. Phytopathology 1990;80:33–6. Wood PJ, Fulcher RG. Dye interactions – a basis for specific detection and histochemistry of polysaccharides. J Histochem Cytochem 1983;31:823–6. Xu JR. Map kinases in fungal pathogens. Fungal Genet Biol 2000;31:137–52. Xu JR, Staiger CJ, Hamer JE. Inactivation of the mitogen-activated protein kinase Mps1 from the rice blast fungus prevents penetration of host cells but allows activation of plant defense responses. Proc Natl Acad Sci U S A 1998;95: 12713–8. Yao Z, Zou C, Zhou H, Wang J, Lu L, Li Y, et al. Delta(1)-pyrroline5-carboxylate/glutamate biogenesis is required for fungal virulence and sporulation. PLoS ONE 2013;8:e73483. Zeng XQ, Chen GQ, Liu XH, Dong B, Shi HB, Lu JP, et al. Crosstalk between SNF1 pathway and the peroxisome-mediated lipid metabolism in Magnaporthe oryzae. PLoS ONE 2014;9:e103124. Zhang H, Liu K, Zhang X, Tang W, Wang J, Guo M, et al. Two phosphodiesterase genes, PDEL and PDEH, regulate development and pathogenicity by modulating intracellular cyclic AMP levels in Magnaporthe oryzae. PLoS ONE 2011;6:e17241. Zhang LL, Cao HJ, Li XD, Lin FC, Feng XX, Lu JP. MoTCTP, a homolog of translationally controlled tumor protein, is required for fungal growth and conidiation in Magnaporthe oryzae. Chinese J Cell Biol 2013;35:1141–54.