Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation

Article

Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation Graphical Abstract

Authors Xiaodan Liu, Jingwen Shen, Leiming Xie, ..., Xinhe Zheng, Pilong Li, Yan Song

Correspondence [email protected]

In Brief Liu et al. show that the transcription factor Prospero is retained at mitotic chromosomes of neural precursors via liquid-liquid phase separation, where it recruits and condensates HP1, driving heterochromatin domain expansion and terminal neuronal differentiation.

Highlights d

Liquid-liquid phase separation drives mitotic implantation of transcription factor Pros

d

Mitotic retention is crucial for Pros to promote terminal neuronal differentiation

d

d

Pros condensates and expands H3K9me3+ heterochromatin domains in neurons Pros recruits and concentrates HP1a into phase-separated condensates

Liu et al., 2020, Developmental Cell 52, 1–17 February 10, 2020 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.devcel.2019.11.019

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Developmental Cell

Article

Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation Xiaodan Liu,1,4 Jingwen Shen,1,4 Leiming Xie,3 Zelin Wei,1 Chouin Wong,1 Yiyao Li,1 Xinhe Zheng,1 Pilong Li,3 and Yan Song1,2,5,* 1Ministry of Education Key Laboratory of Cell Proliferation and Differentiation, School of Life Sciences, Peking University, Beijing 100871, China 2Peking-Tsinghua Center for Life Sciences, Peking University, Beijing 100871, China 3Beijing Advanced Innovation Center for Structural Biology, Tsinghua-Peking Joint Center for Life Sciences, School of Life Sciences, Tsinghua University, Beijing 100084, China 4These authors contributed equally 5Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.devcel.2019.11.019

SUMMARY

Compacted heterochromatin blocks are prevalent in differentiated cells and present a barrier to cellular reprogramming. It remains obscure how heterochromatin remodeling is orchestrated during cell differentiation. Here we find that the evolutionarily conserved homeodomain transcription factor Prospero (Pros)/ Prox1 ensures neuronal differentiation by driving heterochromatin domain condensation and expansion. Intriguingly, in mitotically dividing Drosophila neural precursors, Pros is retained at H3K9me3+ pericentromeric heterochromatin regions of chromosomes via liquid-liquid phase separation (LLPS). During mitotic exit of neural precursors, mitotically retained Pros recruits and concentrates heterochromatin protein 1 (HP1) into phase-separated condensates and drives heterochromatin compaction. This establishes a transcriptionally repressive chromatin environment that guarantees cell-cycle exit and terminal neuronal differentiation. Importantly, mammalian Prox1 employs a similar ‘‘mitotic-implantationensured heterochromatin condensation’’ strategy to reinforce neuronal differentiation. Together, our results unveiled a new paradigm whereby mitotic implantation of a transcription factor via LLPS remodels H3K9me3+ heterochromatin and drives timely and irreversible terminal differentiation. INTRODUCTION Heterochromatin domains, marked by histone H3 Lys9 trimethylation (H3K9me3) and refractory to transcription, become highly condensed and expanded during cellular differentiation (Becker et al., 2016; Wen et al., 2009). On the other hand, decompaction of H3K9me3-dependent heterochromatin regions greatly increases the efficiency of induced reprogramming from differen-

tiated cells back into pluripotent cells (Allshire and Madhani, 2018; Becker et al., 2016). The prevalent view holds that H3K9me3+ heterochromatin formation depends on the collaborative efforts between H3K9me3 ‘‘reader’’ heterochromatin protein 1 (HP1) and H3K9me3 ‘‘writer’’ histone H3K9 methyltransferase SUV39H1 (Al-Sady et al., 2013; Allshire and Madhani, 2018). HP1 utilizes its N-terminal chromodomain to bind H3K9me3 and its C-terminal chromoshadow domain to self-oligomerize and recruit SUV39H1, which in turn catalyzes H3K9 trimethylation (Allshire and Madhani, 2018; Larson et al., 2017; Strom et al., 2017). Cycles of H3K9 trimethylation and sequential recruitment of HP1 and SUV39H1 lead to heterochromatin formation and spreading (Allshire and Madhani, 2018). However, little is known about how condensation and expansion of H3K9me3-dependent heterochromatin domains are initiated and orchestrated during cell differentiation. Mitotic retention, a subset of transcription factors or histone post-translational modifications remaining on the chromosomes in mitosis, has been posited as an important strategy for maintenance of cellular identity across cellular generations (Palozola et al., 2019). During mitosis, the majority of the gene regulatory machinery is displaced by the highly condensed chromosomes (Palozola et al., 2019; Zaidi et al., 2010). Few transcription factors that manage to retain on the mitotic chromosomes have been proposed to ‘‘bookmark’’ a subset of their target genes (Palozola et al., 2019; Zaidi et al., 2010). Compared to transcription factors dislodged from their target gene loci, mitotic bookmarking factors spend much less time searching for their target gene loci, enabling faster transcriptional reactivation of the bookmarked genes upon mitotic exit (Kadauke et al., 2012; Zhao et al., 2011). Timely reactivation of these key genes could greatly help the reestablishment of the proper gene regulatory network and 3D chromatin architecture, which are critical for cell identity maintenance. However, how mitotic-retaining transcription factors could hold on to highly compacted mitotic chromosomes remains unknown. Furthermore, the physiological significance of mitotic retention has not yet been rigorously examined in multicellular organisms under physiological conditions. Liquid-liquid phase separation (LLPS), in which proteins selforganize into liquid-like condensates that recruit or exclude

Developmental Cell 52, 1–17, February 10, 2020 ª 2019 Elsevier Inc. 1

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

certain molecules (Hyman et al., 2014), has been involved in diverse biological processes (Case et al., 2019; Shin and Brangwynne, 2017; Tiwary and Zheng, 2019). Intriguingly, recent studies unveiled a fresh and exciting perspective on heterochromatin organization: LLPS of HP1 induces rapid compaction of DNA strands into puncta, driving constitutive heterochromatin domain formation (Larson et al., 2017; Strom et al., 2017; Wang et al., 2019). LLPS is triggered by multivalent protein-protein interactions via their intrinsically disordered regions (IDRs) and/or low-complexity sequences (Banani et al., 2017; Shin and Brangwynne, 2017). Under certain conditions, liquid-like phase-separated droplets can mature into less dynamic gellike structures or even solid-like aggregates (Patel et al., 2015; Shin and Brangwynne, 2017). Despite the implication of LLPS in a rapidly growing list of cellular processes, it remains challenging to establish a causal relationship between LLPS and the biological events involving LLPS (Alberti et al., 2019). Furthermore, few studies have revealed regulatory mechanisms and functional significance of LLPS in development of multi-cellular organisms under physiological conditions (Alberti et al., 2019). Prospero (Pros)/Prox1 is an evolutionarily conserved homeobox transcription factor best known for its role in promoting terminal differentiation (Bowman et al., 2008; Choksi et al., 2006; Doe et al., 1991; Oliver et al., 1993; Vaessin et al., 1991). In both fly and mammalian brain development, Pros/Prox1 exerts its function specifically in neural precursors (NPs) and neurons, which is necessary and sufficient to ensure neuronal differentiation (Elsir et al., 2012; Ming and Song, 2011). Each type I neural stem cell (NSC; so-called neuroblast) in fly larval central brain area undergoes asymmetric cell division to self-renew and give rise to a smaller NP (so-called GMC, ganglion mother cell), which divides only once to produce two post-mitotic neurons and/or glia (Figure 1A) (Holguera and Desplan, 2018; Homem et al., 2015). While loss of Pros leads to NP and neuron dedifferentiation and tumorigenesis, overexpression of Pros/Prox1 in NSC lineages results in precocious NSC differentiation and loss of stemness (Bowman et al., 2008; Choksi et al., 2006; Elsir et al., 2012; Maurange et al., 2008; Yasugi et al., 2014). Although Pros protein is expressed in type I NSCs, its differentiation-promoting activity is restrained due to its tight tethering to the basal cell cortex by the anchoring protein Miranda (Mira) (Ikeshima-Kataoka et al., 1997; Shen et al., 1997). Once Pros is asymmetrically segregated into NPs, Mira protein is quickly degraded, releasing Pros from the cell cortex to enter the nucleus, where Pros reinforces neuronal differentiation through mediating transcriptional repression of self-renewal genes and transcriptional activation of neuronal-differentiation genes (Choksi et al., 2006; Southall and Brand, 2009). Here we made an unexpected discovery that Pros/Prox1, via LLPS, is retained at the pericentromeric heterochromatin regions of chromosomes in dividing NPs, where it recruits and condensates HP1, driving heterochromatin domain expansion and terminal neuronal differentiation. RESULTS Mitotic Retention of Pros in Neural Precursors Endogenous Pros protein formed a basal crescent in fly dividing type I NSCs and was asymmetrically segregated into future NPs, 2 Developmental Cell 52, 1–17, February 10, 2020

as extensively reported before (Figure 1B) (Hirata et al., 1995; Knoblich et al., 1995; Spana and Doe, 1995). Unexpectedly, while carrying out time-lapse live imaging of dividing NSCs in intact larval brains, we noted that, upon transient overexpression, GFP-tagged Pros formed foci and localized to histone H2A-marked chromosomes throughout mitosis (Figure 1C; Video S1). Notably, transient overexpression of Pros transgenes potently promoted premature differentiation of NSCs and converted NSCs into NP-like cells (Figure S1A), producing two daughter cells permanently exiting the cell cycle and adopting neuronal fate (Figures 1C and S1A). Anti-Myc immunostaining results consistently revealed mitotic retention of Myc-tagged Pros in NP-like NSCs upon short-term overexpression (Figure S1B). These results indicated that the transiently overexpressed Pros exceeding the tethering capacity of Mira in NSCs automatically ‘‘implanted’’ into the dividing chromosomes (Figure S1A). We next assessed the expression of endogenous Pros in NPs and noted retention of endogenous Pros foci within phosphohistone H3 (pH3)-marked chromosomes in dividing NPs (arrowheads in Figure 1D). To monitor the dynamics of the endogenous Pros protein in NPs throughout the cell cycle, we generated GFP-tagged Pros knockin (KI) lines using the CRISPR-Cas9 system (Baena-Lopez et al., 2013). Such KI fly lines were healthy and fertile and behaved just like wild-type flies, indicating that GFP tagging did not interfere with the physiological activity of Pros. Importantly, while GFP-Pros-KI exhibited basal cortical distribution in dividing NSCs (Figure S1C), it formed foci and retained at the mitotic chromosomes of NPs throughout the cell cycle (arrowheads in Figure 1E; Video S1). Collectively, mitotic retention of Pros specifically in NPs, together with its tight correlation with terminal differentiation of NPs or NP-like NSCs (Figures 1F and S1A), suggested that mitotic retention is critical for Pros to drive neuronal differentiation. Distinct from the mitotic retention of transcription factors identified so far that has been posited to serve a ‘‘mitotic bookmarking’’ role to preserve cellular identity through cell divisions (Palozola et al., 2019; Zaidi et al., 2010), mitotic retention of Pros leads to changes in cell identity from precursors to terminally differentiated cells. Therefore, we hereafter refer to mitotic retention of Pros as ‘‘mitotic implantation.’’ Mitotic Implantation Is Critical for Pros to Promote Neuronal Differentiation To directly assess the functional significance of Pros mitotic retention, we sought to uncouple the potential function of Pros in mitosis from its transcription regulatory function in interphase. The strategy we took was to generate a series of truncated or mutated versions of Pros that specifically lose mitotic retention ability but not transcription activity, and meanwhile have comparable expression levels and nuclear localization abilities to those of full-length Pros (Pros-FL) (Figures S2A–S2I). We found that in all deletions harboring N7, a small motif of 59 amino acids (aa 812–870), diminished the mitotic retention of Myc-Pros in NP-like NSCs (Figures 2A–2C). Time-lapse live imaging of transiently overexpressed GFP-tagged Pros transgenes further confirmed that deletion of N7 or N3 (aa 496–870) largely or completely abolished the mitotic retention ability of Pros throughout the cell cycle (Figure 2D; Video S2). Importantly,

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 1. Mitotic Implantation of Pros in Dividing Neural Precursors (A) A schematic drawing of a fly type I neural stem cell (NSC) lineage. Nuclear Pros (cyan) signal is undetectable in NSC, moderate in NP, and high in neurons. (B) Endogenous Pros forms a basal crescent in dividing NSCs and is asymmetrically segregated into future NPs. In this and subsequent micrographs, dashed lines outline cell cortex. Arrowheads indicate the ends of Pros crescents. Phospho-Histone H3 (pH3) labels mitotic chromosomes. (C) Single frames of time-lapse movies of a dividing type I NSC expressing GFP-Pros, Histone2A-RFP (His-RFP), and CD8-BFP transgenes. Arrowheads indicate mitotically retained Pros foci. His-RFP and CD8-BFP indicate chromatin and cell cortex, respectively. Time in h:min. See also Video S1 (left). (D) Endogenous Pros forms foci (arrowheads) and retains at the chromosomes of dividing NPs. (E) Single frames of time-lapse movies of a dividing NP expressing GFP-Pros-KI (knockin) and His-RFP. Time in h:min. See also Video S1 (right). (F) Schematic drawings of Pros (cyan) distribution in dividing NSCs (left) and mitotic NPs (right), respectively. Scale bar, 5 mm (B, C, and E); 2.5 mm (D). See also Figure S1.

compared to transient overexpression of Pros-FL for 9 h that induced premature neuronal differentiation and depletion of essentially all Deadpan (Dpn)+ NSCs (100%, n = 20; Figures 2E and 2F), transient overexpression of Pros-DN7 or Pros-DN3 for

9 h failed to induce NSC loss (0%; n = 10). In contrast, deletion of N6, a small region of 62 amino acids adjacent to N7, exhibited no effects on the mitotic retention ability of Pros (Figures 2A–2C). Correspondingly, Pros-DN6 possessed full activity of Pros in Developmental Cell 52, 1–17, February 10, 2020 3

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 2. Mitotic Retention Is Essential for Pros to Ensure Neuronal Differentiation (A) A schematic summary of the mitotic retention and differentiation-promoting ability of the full-length, truncated, or mutated versions of Pros. (B and C) Various versions of Myc-Pros were transiently overexpressed in NSCs and stained for Myc and pH3. Arrowheads indicate mitotically retained Pros foci (B). Quantification of the percentage of Pros mitotic retention and non-retention of indicated genotypes is shown in (C). n = 100–108. (D) Single frames of time-lapse movies of a dividing NSC expressing GFP-Pros-DN7 or GFP-Pros-DN3 and His-RFP. Time in h:min. See also Video S2 (left). (E and F) Larval brain lobes of indicated genotypes were stained for NSC marker Dpn (Deadpan; green) and neuronal marker Elav (magenta; E). Quantification of total NSC number per brain lobe of indicated genotypes is shown in (F). **p < 0.0001 (n = 10–20). Data are represented as mean ± SEM. In this and subsequent micrographs, yellow dotted line marks the boundary between the optic lobe (left) and the central brain (right) areas. Arrowheads label central brain NSCs (green). (G and H) Luciferase reporter assay in HEK293T cells showing full transcriptional activity of Pros-DN7. Constructs expressing fusion between Gal4 and indicated protein fragments were co-transfected with a luciferase reporter construct containing Gal4 upstream activation sequences (UAS; G). EnRD and VP16 served here as transcription repressor and activator controls, respectively. Quantification of the relative luciferase (luc) activity of indicated protein fragments is shown in (H). **p < 0.001 (n = 4). (legend continued on next page)

4 Developmental Cell 52, 1–17, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

promoting neuronal differentiation (Figures 2A–2C). Thus, the N7 motif is specifically required for mitotic retention of Pros, which in turn ensures neuronal terminal differentiation. To test whether the small truncations harboring N7 might attenuate the transcription activity of Pros, we performed a luciferase reporter assay in HEK293T cells utilizing the Gal4-UAS system (Figure 2G). Full-length or truncated versions of Pros were fused with Gal4, which binds to the promoter carrying Gal4-binding site upstream activation sequence (UAS) and activates luciferase expression (Figure 2G). Pros-DN7 and Pros-DN3 exhibited transcription repression activity as potent as that of Pros-FL or a repressor domain from the Engrailed protein (EnRD), serving here as a positive control (Figure 2H). Therefore, the deletion of the N7 motif specifically impairs the mitotic retention, but not the transcription activity, of Pros. Notably, deletion of the C-terminal DNA-binding homeo-prospero domain of Pros (Pros-DHPD) completely abolished its mitotic retention (Figures 2A–2C), suggesting that the DNA-binding ability of Pros is crucial for its association with the mitotic chromosomes. Strongly supporting this idea, mutagenesis of three residues within HPD domain (Pros.3 m(HPD); K1290A, N1294A and E1297A) that are critical for sequence-specific interaction of Pros with DNA (Ryter et al., 2002) also diminished the mitotic retention of Pros (Figures 2A–2C). Taken together, both the N7 motif and the DNA-binding capacity are essential for Pros retention at mitotic chromosomes, which in turn is important for Pros to exert its differentiation-promoting function. To further assess the functional significance of Pros mitotic retention, we generated Pros-DN7 KI fly lines. Compared to Pros-FL-KI that formed foci and decorated mitotic chromosomes in dividing NPs (Figures 2I and 2J), Pros-DN7-KI with comparable expression levels (Figure S2J) failed to retain on the mitotic chromosomes (Figures 2I and 2J). We next performed mosaic analysis with a repressible cell marker (MARCM) (Lee and Luo, 1999) to assess the physiological significance of Pros mitotic retention. Pros-FL-KI NSCs behaved just like wild-type control NSCs, producing MARCM clones that each contained one Dpn+ NSC (asterisk), 3–5 Dpn
Elav
NPs, and several Elav+ post-mitotic neurons (Figures 2K–2M). In sharp contrast, N7 deletion largely impaired the tumor suppressor activity of Pros, resulting in dramatically enlarged MARCM clones that contained numerous ectopic NSCs (asterisks) and few neurons (Figures 2K–2M). Collectively, mitotic retention of Pros in dividing NPs is essential to ensure neuronal terminal differentiation and prevent NP-derived tumorigenesis. Phase Separation Drives Mitotic Implantation of Pros How does Pros manage to retain on the mitotic chromosomes while the majority of the transcription machinery is displaced? Intriguingly, prolonged overexpression of Pros-DHPD or Pros.3

m(HPD) resulted in NP-derived tumorigenesis (Figures 3A and 3B), phenocopying pros loss-of-function phenotypes (Betschinger et al., 2006). Such dominant-negative effects of ProsDHPD or Pros.3 m(HPD) transgenes strongly suggested that Pros might self-associate to form dimer or oligomer, causing these DNA-binding-defective transgenes of Pros to interfere with the tumor suppressor activity of the endogenous Pros. Consistent with this notion, Pros-DHPD or Pros.3 m(HPD) formed spherical and liquid-like droplets of various sizes in the cytosol of ectopic dividing NSCs (arrowheads in Figure 3C). Notably, Pros-DHPD and Pros.3 m(HPD) were capable of recruiting endogenous Pros, GFP-Pros transgene, or even Mira protein to the spherical clusters (Figures S3A and S3B). Such potent self-organization abilities of Pros-DHPD and Pros.3 m(HPD) hinted at an attractive possibility that LLPS (Banani et al., 2017; Shin and Brangwynne, 2017) drives Pros foci formation and mitotic retention. We therefore tested whether Pros exhibits liquid demixing properties in vitro and in vivo. First, using the Predictor of Natural Disordered Regions (PONDR) software, we found that a large portion of Pros protein toward its N terminus contained IDRs proposed to drive LLPS (Banani et al., 2017; Shin and Brangwynne, 2017) (Figure 3D). Second, we performed fluorescence recovery after photobleaching (FRAP) analysis to probe the dynamics of Pros droplets in vivo. In either dividing NSCs transiently overexpressing GFP-Pros or dividing NPs expressing GFP-Pros-KI at endogenous levels, GFP-Pros signal promptly recovered after photobleaching (Figures 3E–3H), indicating that the endogenous Pros protein decorating mitotic chromosomes was highly dynamic and freely exchanged with its cytoplasmic pool under physiological conditions. Third, treatment with 1,6-hexanediol, a compound known to specifically disrupt liquid-like condensates, but not 2,5hexanediol control, led to quick dispersal of GFP-Pros-KI foci in dividing NPs (Figures 3I and 3J). Fourth, time-lapse live imaging revealed that the GFP-Pros-DHPD major foci in NSCs were highly mobile and often fused with each other and rounded up (arrowheads in Figure S3C). Finally, we applied optoDroplet system (Shin et al., 2017), a newly developed optogenetic platform (Figure S3D), to directly assess the liquid signatures of Pros in HEK293T cells. Upon blue light illumination, Pros-mCherry-Cry2 fusion, but not Cry2 protein itself, formed spherical clusters in small sizes (Figures 3K, 3L, S3E, and S3F). Our optoDroplet assays further revealed that the N7 motif is both necessary and sufficient for the light-induced droplet formation of Pros (Figures 3K, 3L, S3E, and S3F). We also noted that even without light illumination, transient transfection of GFP-Pros led to the formation of prominent foci (Figure S3G), which exhibited liquid-like properties upon photobleaching (Figure S3H). Consistently, such droplet formation behavior of Pros was largely abolished upon deletion of the N7 motif (Figures S3G and S3I). Furthermore, the addition of 1,6hexanediol to HEK293T cells led to fast dispersal of GFP-Pros

(I and J) Mitotic retention of full-length or DN7 forms of Pros-knockin (KI) in heterozygotes (I). Quantification of the percentage of Pros mitotic retention is shown in (J). n = 60–100. (K–M) MARCM clonal analysis of WT control, pros null mutant, pros knockout (KO), Pros-FL-KI, and Pros-DN7-KI. MARCM clones are marked by CD8-GFP and stained with Dpn and Elav (K). NSCs with cellular sizes larger than 10 mm in diameter are marked by asterisks (K). Quantification of clonal area sizes and percentage of tumor phenotypes is shown in (L) and (M), respectively. n = 100–160. In this and subsequent bar charts, cat.1 (category 1; mild), cat. 2 (intermediate), and cat. 3 (severe) tumor phenotypes indicate 1; 2–10 or 11–20 NSCs (> 10 mm in diameter) per MARCM clone, respectively. Note that Pros-DN7-KI is homozygous lethal during early larval stages. Scale bar, 5 mm (B, D, and I); 10 mm (K); 50 mm (E). See also Figure S2.

Developmental Cell 52, 1–17, February 10, 2020 5

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 3. Liquid-Liquid Phase Separation Drives Mitotic Implantation of Pros (A and B) Larval brain lobes of indicated genotypes were stained for Dpn and Elav (A). Quantification of total NSC number per brain lobe of indicated genotypes is shown in (B). **p < 0.0001 (n = 10). (legend continued on next page)

6 Developmental Cell 52, 1–17, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

droplets (Figure S3J). Aromatic and hydrophobic residues have been found to play crucial roles in LLPS (Jiang et al., 2015; Nott et al., 2015; Pak et al., 2016). Mutagenesis of five aromatic and hydrophobic residues in N7 to serine residues (Pros-N2B.5 m) (Figure S3K) completely abolished the potent activity of N2B in driving LLPS (Figures 3K, 3L, S3G, and S3I), further supporting that the N7 motif is crucial for LLPS of Pros. To validate that Pros is capable of undergoing LLPS by itself, we expressed and purified Pros-N2B from E. coli to determine whether it forms phase-separated droplets in vitro. As expected, purified Pros-N2B was ready to form liquid droplets at a low protein concentration (5 mM; Figure 3M). In contrast, purified Pros-N2B.5 m, which contained the five aromatic/hydrophobic mutations, failed to undergo LLPS (Figure 3M). Collectively, Pros exhibits liquid demixing properties both in vitro and in vivo, mainly driven by its N7 motif. We further asked whether Pros-N7 promotes phase separation through self-association. Flag-tagged Pros and HA-tagged Pros were ready to interact in coimmunoprecipitation (coIP) assay using HEK293T cell extracts. Importantly, deletion of N7 but not N6 completely abolished self-association of Pros (Figures 3N and S2K–S2N). Furthermore, Pros.5m(N7), which carries the five aromatic/hydrophobic mutations in the N7 motif that impaired LLPS of N7, barely interacted with full-length Pros (Figure S2N). Therefore, LLPS of Pros is mediated by its self-association. Given that the mitotic retention of Pros is largely impaired upon removal of the N7 motif that drives LLPS of Pros (Figures 2B–2D, 2I, and 2J), LLPS is likely to be the driving force of Pros mitotic retention. Indeed, Pros.5m(N7) transgene (Figures S2D–S2F) failed to retain on the mitotic chromosomes of dividing NSCs upon transient expression (Figures 3O and 3P). In accordance, Pros.5 m(N7)-KI, expressed at comparable levels with Pros-FLKI (Figure S2J), failed to exhibit mitotic retention in NPs (Figures 3P and 3Q). Significantly, MARCM clonal analysis results demonstrated that the neuronal differentiation-promoting activities of Pros.5m(N7)-KI were drastically compromised (Figure 3R). Taken together, LLPS promoted by the N7 motif underlies the mitotic retention of Pros, which in turn ensures neuronal differentiation. Restoring Phase Separation of Pros Reinstates Its Differentiation-Promoting Activity To further validate the idea that LLPS drives Pros mitotic retention, we investigated whether restoring phase separation can

rescue the mitotic retention defects of Pros-DN7. We fused Pros-DN3 and Pros-DN7 with protein domains known to drive LLPS or dimerization, such as the C-terminal IDR of hnRNPA1 (Molliex et al., 2015) and the leucine zipper (LZ) domain (Schindler et al., 1992). Indeed, such fusions were effective to restore LLPS of Pros (Figures 4A, 4B, S3F, S3G, S3I, and S3L). Furthermore, hnRNPA1C-Pros-DN7 and LZ-Pros-DN7 fusions displayed mitotic retention upon transient expression in NSCs (Figures 4C–4F and S2A–S2D; Video S2). Therefore, LLPS drives mitotic retention of Pros in NPs. Importantly, replacing N7 with hnRNPA1C or LZ largely restored the differentiation-promoting ability of Pros (Figures 4G and 4H). More remarkably, LZ-Pros-DN7-KI (Figure S2O) exhibited prominent mitotic retention in NPs (Figures 4I and 4J) and potent tumor suppressor activity in MARCM clonal analysis (Figures 4K–4M), nearly comparable to Pros-FL-KI. Furthermore, treatment with 1,6-hexanediol led to quick dispersal of GFPLZ-Pros-DN7-KI foci in dividing NPs (Figure S3M). These observations confirmed that LLPS of Pros is crucial for its mitotic retention and neuronal differentiation-promoting activity under physiological conditions. Taken together, our results provided compelling evidence supporting that (1) deletion or mutagenesis of the N7 motif specifically affected phase separation and mitotic retention but not transcription activity of Pros, (2) LLPS of Pros is the driving force for its mitotic retention, and (3) mitotic implantation is a prerequisite for Pros to execute its full differentiationpromoting activity. Pros Condenses and Expands H3K9me3+ Heterochromatin Domains To understand how mitotically retained Pros ensures neuronal differentiation, we examined the chromosome binding sites of Pros. Metaphase chromosome spreading assay revealed that Pros associated with the pericentromeric heterochromatin regions (arrowheads in Figure S3N). Furthermore, Pros foci colocalized with the heterochromatin marker H3K9me3, but not the euchromatin marker H3K4me3, in dividing NPs (arrowheads in Figures 5A and S4A). These observations hinted at the possibility that Pros is involved in heterochromatin organization. We therefore investigated whether H3K9me3+ heterochromatin regions are specifically condensed and expanded in terminally differentiated neurons where Pros is highly expressed. Indeed, whereas NSCs (bracket in Figure 5B) and NPs (white arrowheads in

(C) Upon overexpression, Pros-DHPD or Pros.3m(HPD) formed large spherical condensates (arrowheads) in ectopic dividing NSCs. (D) Predictor of natural disordered regions (PONDR) score for Pros protein sequence. >0.5 is considered disordered. (E–H) In vivo FRAP analysis of GFP-Pros (E; n = 6) or GFP-Pros-KI (G; n = 16) droplets highlighted by the white box in dividing NSCs (E) or NPs (G). Quantification of FRAP of GFP-Pros and GFP-Pros-KI puncta over indicated time course is shown in (F) and (H), respectively. Time 0 indicates the start of recovery after photobleaching. Time in min:sec. (I and J) Representative images of mitotic retention of GFP-Pros-KI foci (green, arrowheads) in dividing NPs upon treatment with 10% 1,6-hexanediol (1,6-HD) or 2,5-hexanediol (2,5-HD; negative control) for 2 min (I). Quantification of the percentage of GFP-Pros-KI mitotic retention upon treatment is shown in (J). n = 30–40. (K and L) OptoDroplet assay of indicated protein fragments in HEK293T cells. Cells expressing the optoIDR constructs were subjected to blue light activation (also see Figure S3D). Cry2 (mCherry-Cry2 alone) and hnRNPA1C (hnRNPA1C-mCherry-Cry2) served here as negative and positive controls, respectively (K). A schematic summary of the optoDroplet formation ability of Pros derivatives is shown in (L). (M) In vitro droplet assay of purified GFP-Pros-N2B or GFP-Pros-N2B.5m at indicated concentration. (N) Coimmunoprecipitation (coIP) of FL or truncated Flag-tagged Pros and HA-tagged Pros in HEK293T cells. In this and subsequent panels, GFP served as a negative control. (O–Q) Mitotic retention of GFP-Pros transgenes in NSCs (O) or Myc-Pros-KI in heterozygotes in neural progenitors (Q). Quantification of the percentage of Pros mitotic retention is shown in (P). n = 100–150. (R) Quantification of percentage of tumor phenotypes of Pros.5 m(N7)-KI. Scale bar, 50 mm (A); 5 mm (C, E, G, I, K, M, O, and Q). See also Figures S2 and S3.

Developmental Cell 52, 1–17, February 10, 2020 7

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 4. Restoring LLPS of Pros Reinstates Its Mitotic Retention and Differentiation-Promoting Abilities (A and B) OptoDroplet assay performed in HEK293T cells (A). A schematic summary of the optoDroplet formation ability of Pros derivatives is shown in (B). (C–E) A schematic summary of mitotic retention of Pros-DN7 or its replacement transgenes is shown in (C). Mitotic retention of Pros-DN7 replacement transgenes in NSCs upon transient overexpression (D). Quantification of the percentage of Pros mitotic retention is shown in (E). n = 50–80. (F) Single frames of time-lapse movies of dividing NSCs expressing hnRNPA1C-GFP-Pros-DN7 or LZ-GFP-Pros-DN7 and His-RFP. Time in h:min. See also Video S2 (right). (G and H) Larval brain lobes of indicated genotypes were stained for Dpn and Elav (G). Quantification of total NSC number per brain lobe of indicated genotypes is shown in (H). **p < 0.0001 (n = 8–18) (legend continued on next page)

8 Developmental Cell 52, 1–17, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 5B) in interphase exhibited relatively weak H3K9me3 signal, neurons displayed 2–3 prominent chromocenters with strong and condensed H3K9me3 signal (yellow arrowheads in Figure 5B). This is consistent with recent cell-type-specific chromatin profiling results (Aughey et al., 2018; Marshall and Brand, 2017). The correlation between the expression levels of Pros and the condensation and expansion levels of heterochromatin in distinct cell types within NSC lineages prompted us to investigate whether Pros promotes H3K9me3+ heterochromatin compaction and expansion. We found that, compared with wild-type control, NSC lineage-specific overexpression of Pros resulted in neurons (encircled by dashed lines in Figure 5C) with H3K9me3+ heterochromatin domains of enlarged sizes and intensified H3K9me3 signal (Figures 5C–5E). In contrast, downregulation of Pros by RNAi (pros-IR) resulted in neurons with H3K9me3+ heterochromatin domains of markedly smaller sizes and weakened H3K9me3 signal (Figures 5C–5E). Therefore, Pros indeed promotes the condensation and expansion of H3K9me3+ heterochromatin domains in neurons. To test whether the ability of Pros to organize heterochromatin depends on its mitotic retention, various Pros transgenes were assessed. Compared to Pros-FL, mitotic-retention-deficient Pros-DN7 or Pros.5m(N7) transgene only moderately promoted heterochromatin condensation in neurons (Figures 5C and 5D). In accordance, restoring the mitotic retention ability of these Pros transgenes by hnRNPA1C or LZ fusion reinstated the potent ability of Pros to condense and expand heterochromatin domains (Figures 5C and 5D). These observations strongly suggested that only mitotically retained Pros is capable of condensing and expanding H3K9me3+ heterochromatin domains. If heterochromatin condensation is a prerequisite for neuronal fate commitment, it should precede or coincide with neuronal differentiation. Indeed, while analyzing the consequences of Pros overexpression in NSCs at distinct time points, we found that transient overexpression of Pros for 8 h led to the formation of dramatically enlarged and intensified H3K9me3+ heterochromatin domains (Figures 5F–5H). However, premature differentiation of NSCs, as indicated by the expression of neuronal marker Elav, had not yet occurred (Figures 5F–5H). Elav expression levels became detectable in NSCs at 10 h after Pros overexpression, progressively increased, and reached their peak levels at 14 h after Pros overexpression (Figures 5F–5H). Therefore, Pros-orchestrated condensation and expansion of H3K9me3+ heterochromatin regions ensure irreversible neuronal differentiation. Mitotically Retained Pros Drives HP1a Condensation What might be the molecular mechanisms by which mitotically retained Pros promotes H3K9me3+ heterochromatin condensation? Given that the fusion of HP1a/HP1a liquid-like droplets drove heterochromatin nucleation and condensation (Larson

et al., 2017; Strom et al., 2017), we tested the intriguing scenario that Pros organizes H3K9me3+ heterochromatin via HP1a. We first monitored the dynamics of HP1a in dividing NSCs utilizing an RFP-HP1a BAC line, which faithfully reports the dynamic distribution of endogenous HP1a (Strom et al., 2017). In wild-type dividing NSCs, HP1a was dispelled from chromosomes and uniformly distributed in the cytoplasm until telophase stage, when weak, discontinuous, and mobile HP1a signal started to occupy small crescent-shaped areas on the distal ends of the daughter cell nuclei (cyan arrowheads in Figure 6A; Video S3). After cytokinesis, the discontinuous and dynamic HP1a crescents slightly elongated while the daughter cell nuclei increased their sizes (Figures 6A–6C, S5A, and S5B; Video S3). In sharp contrast, in NSCs transiently overexpressing GFP-Pros, mitotically retained Pros accumulated at the distal ends of the future daughter cell nuclei immediately before continuous HP1a crescents appeared at the same locations with increasing intensity and much less mobility (Figures 6A–6C, S5A, and S5C; Video S4). The HP1a crescents continued to expand when the Pros foci quickly disassembled and distributed throughout the nucleoplasmic regions of the daughter cell nuclei (Figures 6A–6C; Video S4). Notably, GFPPros foci and HP1a transiently colocalized at the distal ends of the daughter cell nuclei before the disassembly of Pros foci (white arrowheads in Figures 6A and S5E; Video S4). Consistent with the idea that the mitotic retention ability of Pros is critical for it to promote heterochromatin condensation, transient overexpression of GFP-Pros-DN7 led to the formation of weak and discontinuous HP1a crescents (Figures 6A–6C; Video S5). More importantly, hnRNPA1C-GFP-Pros-DN7 and LZ-GFP-Pros-DN7 exhibited similar dynamic patterns as GFP-Pros-FL, resulting in the formation of continuous, intensified, and expanded HP1a crescents (arrowheads in Figures 6A–6C and S5F; Video S6). Therefore, the mitotic retention ability is essential for Pros to stimulate HP1a condensation. We next monitored the dynamic distribution of HP1a and Pros in dividing NSCs and NPs under normal physiological conditions. Immediately before and after the cytokinesis of NSCs, HP1a was localized in faint, discontinuous, and mobile crescent-shaped areas at the distal ends of the daughter cell nuclei (Figures 6D, S5A, and S5B), while GFP-Pros-KI signal was barely detectable. In contrast, continuous HP1a crescents transiently colocalized with GFP-Pros foci at the distal ends of NPs in telophase (white arrowheads in Figure 6D) and became intensified, expanded, and less mobile immediately after cytokinesis (Figures 6D, S5A, and S5D; Video S7). These observations strongly supported the notion that, under physiological conditions, mitotically retained Pros in NPs ensures neuronal differentiation through the recruitment and condensation of HP1a. Pros Promotes LLPS of HP1a and Co-phase Separates with HP1a How does Pros promote HP1a condensation? Given that LLPS of HP1a/HP1a drives heterochromatin domain formation (Larson

(I and J) Mitotic retention of Pros-FL-KI or LZ-Pros-DN7-KI in homozygotes (I). Quantification of the percentage of Pros-KI mitotic retention is shown in (J). n = 120–240. (K–M) MARCM clonal analysis showing potent tumor suppressor ability of LZ-Pros-DN7-KI (K). Quantification of clonal area sizes and percentage of tumor phenotypes is shown in (L) and (M), respectively. n = 100–160. Scale bar, 5 mm (A, D, F, and I); 10 mm (K); 50 mm (G). See also Figure S2.

Developmental Cell 52, 1–17, February 10, 2020 9

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 5. Pros Promotes Condensation and Expansion of Heterochromatin Domains (A) GFP-Pros transgene (left) and GFP-Pros-KI (right) foci colocalized with H3K9me3+ pericentromeric heterochromatin regions in dividing NP-like NSCs (left) and NPs (right), respectively. (B) Expression pattern of H3K9me3 in a wild-type type I NSC MARCM clone marked by CD8-GFP. (C and D) Expression levels and pattern of H3K9me3 in Elav+ neurons of indicated genotypes. White dashed lines and arrowheads indicate the neuronal cortex and H3K9me3+ chromocenters, respectively (C). Quantification of the relative area ratio between H3K9me3+ heterochromatin domains and neuronal nuclei of indicated genotypes is shown in (D). n = 50–344. See also STAR Methods. (E) A schematic drawing depicting the expression pattern of H3K9me3 in a type I NSC lineage. (F–H) NSCs transiently overexpressing Pros for 0, 8, 10, or 14 h were marked by CD8-GFP and stained for H3K9me3, Elav, and DAPI (F). Quantification of the relative Elav fluorescence intensity (F.I.) and H3K9me3 F.I. in NSCs at different time points is shown in (G) (**p < 0.0001; n = 50–100) and (H) (**p < 0.0001; n = 100–180), respectively. Scale bar, 5 mm (A–C and F).

10 Developmental Cell 52, 1–17, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 6. Mitotically Retained Pros Drives HP1a Condensation (A) Single frames of time-lapse movies of dividing NSCs expressing nls-GFP or various Pros transgenes and RFP-HP1a BAC line. In these and subsequent micrographs, white and cyan arrowheads label colocalization between GFP-Pros and RFP-HP1a and the RFP-HP1a crescents in daughter cells, respectively. Time in min:sec; nls: nuclear localization signal. See also Videos S3, S4, S5, and S6. (legend continued on next page)

Developmental Cell 52, 1–17, February 10, 2020 11

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

et al., 2017; Strom et al., 2017), we tested the possibility that Pros promotes LLPS of HP1a to drive heterochromatin condensation. Indeed, while in vitro-purified and fluorescently labeled HP1a alone barely underwent LLPS, addition of purified GFP-ProsN2B of low concentration (10 mM) dramatically enhanced the phase separation and droplet fusion ability of HP1a (Figure 6E). Furthermore, upon addition of purified Pros-N2B of slightly higher concentration (20 mM), HP1a condensates displayed aspherical shapes (Figure 6E). Importantly, addition of LLPSdefective GFP-Pros-N2B.5m failed to promote HP1a phase separation. Thus, Pros promotes HP1 condensation through cophase separating with HP1a. We next investigated whether Pros promotes LLPS of HP1a via physical interaction. Our coIP results showed that Pros specifically interacted with HP1a, but neither HP1b nor HP1c that localize to euchromatin regions (Brower-Toland et al., 2007; Vermaak and Malik, 2009) (Figure 6F). Domain-mapping experiments further revealed that, distinct from most characterized HP1a/HP1a-interacting proteins that associate with the C-terminal chromoshadow domain of HP1a/HP1a (Brower-Toland et al., 2007; Smothers and Henikoff, 2000), Pros utilized its N-terminal domain to specifically interact with the N-terminal portion of HP1a (Figures S5G–S5J). Together, our results indicated that mitotically retained Pros ensures neuronal terminal differentiation through condensation of HP1a and H3K9me3+ heterochromatin. HP1a Mediates Permanent Silencing of Pros Target Genes To investigate whether, upon dissociation, Pros might bring a portion of HP1a to its target gene loci to promote local heterochromatin condensation and epigenetic gene silencing, we carried out targeted DNA adenine methyltransferase identification by sequencing (DamID-seq) analysis (Marshall and Brand, 2017; Marshall et al., 2016; Southall et al., 2013; Vogel et al., 2007). Our results showed that, in NPs and neurons, Pros and HP1a preferentially and specifically bound to common Pros target genes that are important for self-renewal, such as dpn, mira, grainy head (grh), or cell-cycle progression, such as string (stg) (Choksi et al., 2006) (Figures 6G and S4B–S4D). Furthermore, in comparison to Pros-FL, Pros-DN7 exhibited significantly reduced enrichment at key target genes important for self-renewal and cell-cycle

progression (Figures 6G and S4B–S4D), suggesting that the LLPS and mitotic retention ability is important for Pros to bind to its key NSC-identity genes with high occupancy. Considering that fusion of HP1a phase-separated droplets with the H3K9me3+ heterochromatin domains leads to heterochromatin expansion (Larson et al., 2017; Strom et al., 2017), we further tested whether HP1a-bound Pros target gene loci might be incorporated into HP1a-enriched heterochromatin domains. Significantly, our DNA fluorescence in situ hybridization (DNA FISH) analysis indeed revealed localization of these HP1a-bound Pros target gene loci within or overlapping with chromocenters specifically in neurons but not interphase NSCs (25.5%–38.3% overlapping in neurons; Figures 6H and 6I). In comparison, the neuronal marker gene elav or the housekeeping gene bTub60D was barely detected in proximity to chromocenters (3.6% and 1.5% overlapping; Figures 6H and 6I). Together, we propose a model (Figure S5K) whereby, during mitotic exit of NPs, Pros dissociates from the H3K9me3+ heterochromatin regions and brings HP1a to its key target gene loci important for self-renewal and cell-cycle progression, resulting in local heterochromatin condensation. In addition, fusion of these small HP1a-bound local condensates with HP1a-enriched chromocenters might lead to further condensation and expansion of the H3K9me3+ heterochromatin domains. Therefore, HP1a-mediated local heterochromatin condensation and incorporation of Pros target gene loci into the heterochromatin domains, combined with Pros-mediated transcription repression, could permanently silence Pros target genes in a timely manner, ensuring terminal and irreversible neuronal differentiation. In line with this model, the expression levels of in vivo transcriptional reporter stg-GFP (Choksi et al., 2006; Inaba et al., 2011) were reduced to a lesser degree upon Pros-DN7 overexpression than upon Pros-FL overexpression (Figures S4E and S4F). This model is further corroborated by recent findings proposing that NSC identity genes are silenced in an HP1-dependent and Polycomb group (PcG)-independent manner in fly central brain neurons (Marshall and Brand, 2017; Abdusselamoglu et al., 2019). Mitotic Implantation of Prox1 via LLPS Drives Terminal Neuronal Differentiation To investigate whether mammalian Prox1 promotes terminal differentiation through mitotic retention and heterochromatin

(B) Quantification of relative RFP-HP1a fluorescent intensity of indicated genotypes. **p < 0.0001 (n = 7–12); NS, not significant. See also STAR Methods. A1C: hnRNPA1C. (C) Quantification of the relative discontinuity of HP1a crescents of indicated genotypes. **p < 0.0001 (n = 7–12); NS, not significant. See also STAR Methods. A1C: hnRNPA1C. (D) Single frames of time-lapse movies of dividing NSCs (top) or neural progenitors (bottom) expressing GFP-Pros-KI and RFP-HP1a BAC line. Time in min:sec. See also Video S7. (E) In vitro droplet assay showing that GFP-Pros-N2B, but not GFP-Pros-N2B.5 m, dramatically promotes LLPS of HP1a. Recombinant HP1a and GFP-Pros-N2B or GFP-Pros-N2B.5 m of indicated concentration were added to droplet formation buffers. (F) CoIP assay performed in 293T cells. (G) DamID-seq analysis of HP1a, Pros, and Pros-DN7 binding profiles over the genomic regions surrounding representative negative control gene actin (act79B), self-renewal gene dpn, and cell-cycle gene stg in NPs and neurons. Data are presented as log2(Dam-fusion/Dam). The indicated genes are black, whereas other genes in the region are gray. Horizontal bars represent peak calls. (H and I) Representative images showed interphase NSCs and neurons stained with FISH probe for indicated genes (green), FISH probe for chromocenters (heterochromatic repeat probes, red), and DAPI (blue) (H). Dashed lines and dotted lines label the cell cortex and chromocenters, respectively. Quantification of the percentage of indicated gene loci positioned within or overlapping with chromocenters of NSCs or neurons is shown in (I). Note that elav and bTub (bTub60D) served here as negative controls. n = 150–400. Scale bar, 2.5 mm (H); 5 mm (A, D, and E). See also Figure S5.

12 Developmental Cell 52, 1–17, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

condensation, we analyzed various characteristics of mouse Prox1 in fly NSC lineages. Similar to Pros, NSC lineage-specific overexpression of Prox1 led to depletion of NSCs, confirming the potency of Prox1 in promoting neuronal differentiation (Figures 7A and 7B). Interestingly, upon transient expression, Prox1 also exhibited mitotic retention in dividing NSCs (Figures 7C and 7D). Furthermore, both Prox1 and Prox1-DDBD, a DNA-binding domain deleted form of Prox1, formed phase-separated droplets in optoDroplet assays, indicating that Prox1 can also undergo LLPS (Figure 7E). In addition, coIP assays showed that Prox1 physically interacted with HP1a, the human ortholog of fly HP1a (Figure 7F). As expected, overexpression of Prox1 in NSCs also led to the condensation of HP1a crescents at distal poles of daughter cell nuclei (Figure 7G) and the formation of heterochromatin domains of enlarged sizes and intensified H3K9me3 signals in neurons (Figures 7H and 7I). Thus, mammalian Prox1 is very likely to employ the same ‘‘mitotic-implantation-ensured-heterochromatin-condensation’’ strategy via LLPS to promote terminal neuronal differentiation. DISCUSSION H3K9me3-dependent heterochromatin becomes highly condensed and expanded in terminally differentiated cells (Allshire and Madhani, 2018; Becker et al., 2016; Wen et al., 2009). It remains elusive how such heterochromatin remodeling is initiated and orchestrated during cell differentiation. Here, our unexpected observations led us to unveil that transcription factor Pros, via LLPS, is retained at the pericentromeric heterochromatin regions of chromosomes in dividing NPs, where it recruits and condensates H3K9me3 ‘‘reader’’ HP1a, leading to heterochromatin domain expansion, epigenetic silencing of Pros target gene loci, and irreversible neuronal differentiation. We propose that Pros ensures terminal neuronal differentiation through two sequential processes. First, via LLPS, Pros droplets remain associated with H3K9me3+ heterochromatin regions in dividing NPs, resulting in physical interaction between Pros and HP1a during mitotic exit (Figure 7J). Pros recruits and concentrates HP1a into phase-separated droplets (Figure 6E) and promotes their transitions into less dynamic condensates (Figures 6A–6C), reinforcing the condensation and expansion of H3K9me3+ heterochromatin regions (Figure 7J). Second, immediately after HP1a condensation, Pros dissociates from the pericentromeric heterochromatin regions and brings a portion of HP1a to its target gene loci, leading to local heterochromatin compaction (Figures 7J and S5K). Combined with HP1a-mediated incorporation of these Pros target gene loci into the heterochromatin domains and Pros-mediated transcription repression (Choksi et al., 2006), such collaborative efforts by HP1a and Pros ensure permanent silencing of these important Pros target gene loci (self-renewal and cell-cycle genes), driving cell-cycle exit and terminal neuronal differentiation (Figures 7J and S5K). The liquid demixing property is particularly suitable for Pros to exert its dynamic functions in driving terminal differentiation. First, LLPS allows Pros droplets to quickly assemble in the beginning of mitosis and dissemble

during mitotic exit; second, phase-separated Pros droplets can recruit and concentrate HP1a through co-phase separation, driving heterochromatin condensation. Furthermore, the liquid-like property may facilitate Pros to disperse throughout the daughter cell nucleoplasm to scan and bind to its target genes, permanently silencing their gene expression in a timely manner. This LLPS-based, highly dynamic cascade of events ensures irreversible neuronal differentiation. Despite the recent rapid progress in implicating LLPS in a wide range of biological processes, evidence supporting a causal relationship between LLPS and cellular events under physiological conditions has been largely lacking (McSwiggen et al., 2019). By mutagenizing five aromatic or hydrophobic amino acids or deleting a small motif that is crucial for LLPS of Pros, we generated LLPS-defective versions of Pros without compromising its transcriptional activity. Importantly, such LLPS-defective forms of Pros failed to retain on mitotic chromosomes of NPs, to reorganize heterochromatin, or to promote neuronal differentiation. More remarkably, restoring phase separation ability of Pros by fusing the LLPS-defective forms of Pros with well-characterized IDRs effectively reinstated the mitotic retention, heterochromatin condensation, and differentiation-promoting ability of Pros. Therefore, our study established a causal relationship between LLPS of a transcription factor and a cascade of important biological events, unveiling the physiological significance of LLPS in normal development of a multi-cellular organism. LLPS may represent a new and important strategy for transcription factors to achieve mitotic retention and exert their chromatin-organization function. Until now, little was known about how mitotic retaining factors manage to hold on to the highly condensed chromosomes when the majority of the gene regulatory machinery is dislodged. Furthermore, it has been challenging to pinpoint the functional significance of mitotic retention. Our study revealed that mitotic retention of Pros is largely dependent on its LLPS ability. It is likely that phase-separated condensates highly concentrate Pros protein, resulting in markedly increased DNA-binding ability per spatial unit that allows Pros droplet as a whole to grip and retain on chromosomes. The lineage composition and progression of fly intestinal stem cells (ISCs) at pupal stages resemble larval NSC lineages (Figure S1E) (Guo and Ohlstein, 2015). Remarkably, while Pros localized to the basal cortex of dividing ISCs (Guo and Ohlstein, 2015; Xu et al., 2018), it formed foci and retained in mitotic chromosomes of dividing intestinal precursors (Figure S1F), further supporting the idea that mitotic implantation is an intrinsic property of Pros protein. It is tempting to speculate that many other retaining transcription factors might utilize a similar LLPS-based tactic to guarantee their mitotic retention and heterochromatin reorganization function. In sum, our unexpected observations led us to unveil how biophysical properties of transcription factor(s) can greatly influence heterochromatin reorganization and cell fate decisions, offering a fresh perspective on functional significance and dynamic orchestration of heterochromatin during cell fate specification and commitment. Developmental Cell 52, 1–17, February 10, 2020 13

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Figure 7. Mitotic Implantation of Prox1 via LLPS Ensures Terminal Differentiation (A and B) Larval brain lobes of indicated genotypes were stained for Dpn and Elav (A). Quantification of total NSC number per brain lobe of indicated genotypes is shown in (B). **p < 0.0001 (n = 6–10); NS, not significant. (C and D) Mitotic retention of GFP-Prox1 transgene in NSCs in comparison to GFP-Pros upon transient expression (C). Quantification of the percentage of Pros or Prox1 mitotic retention is shown in (D). n = 30–50. (E) OptoDroplet assay performed in HEK293T cells. (F) CoIP of HA-tagged mouse Prox1 and Flag-tagged human HP1a in 293T cells. (G) Time-lapse images of dividing NSCs expressing GFP-Prox1 transgene and RFP-HP1a BAC line. Time in min:sec. (H and I) Expression levels and pattern of H3K9me3 in Elav+ neurons of indicated genotypes (H). Quantification of the relative area ratio between the H3K9me3+ heterochromatin regions and neuronal nuclei of indicated genotypes is shown in (I). n = 100–170. See also STAR Methods. (J) A schematic model depicting LLPS-dependent functions of Pros in driving terminal neuronal differentiation. Scale bar, 50 mm (A); 5 mm (C, E, G, and H).

14 Developmental Cell 52, 1–17, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

STAR METHODS

REFERENCES

Detailed methods are provided in the online version of this paper and include the following:

Abdusselamoglu, M.D., Landskron, L., Bowman, S.K., Eroglu, E., Burkard, T., Kingston, R.E., and Knoblich, J.A. (2019). Dynamics of activating and repressive histone modifications in Drosophila neural stem cell lineages and brain tumors. Development. dev.183400. https://doi.org/10.1242/dev.183400.

d d d

d

d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Fly Lines B Fly Genetics METHOD DETAILS B Cloning B Immunohistochemistry of Drosophila Larval Brain B Live Imaging B Fluorescence Recovery after Photobleaching (FRAP) Analysis B OptoDroplet Assay B MARCM Clonal Analysis B Dual-Luciferase Reporter Assay B Protein Purification and Labeling B In Vitro Phase Separation Assay B Mitotic Chromosome Spreading B Coimmunoprecipitation B DamID-seq B DNA FISH QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION

Al-Sady, B., Madhani, H.D., and Narlikar, G.J. (2013). Division of labor between the chromodomains of HP1 and Suv39 methylase enables coordination of heterochromatin spread. Mol. Cell 51, 80–91. Alberti, S., Gladfelter, A., and Mittag, T. (2019). Considerations and Challenges in Studying Liquid-Liquid Phase Separation and Biomolecular Condensates. Cell 176, 419–434. Allshire, R.C., and Madhani, H.D. (2018). Ten principles of heterochromatin formation and function. Nat. Rev. Mol. Cell Biol. 19, 229–244. Aughey, G.N., Estacio Gomez, A., Thomson, J., Yin, H., and Southall, T.D. (2018). CATaDa reveals global remodelling of chromatin accessibility during stem cell differentiation in vivo. eLife 7, e32341. Baena-Lopez, L.A., Alexandre, C., Mitchell, A., Pasakarnis, L., and Vincent, J.P. (2013). Accelerated homologous recombination and subsequent genome modification in Drosophila. Development 140, 4818–4825. Banani, S.F., Lee, H.O., Hyman, A.A., and Rosen, M.K. (2017). Biomolecular condensates: organizers of cellular biochemistry. Nat. Rev. Mol. Cell Biol. 18, 285–298. Bantignies, F., Roure, V., Comet, I., Leblanc, B., Schuettengruber, B., Bonnet, J., Tixier, V., Mas, A., and Cavalli, G. (2011). Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell 144, 214–226. Becker, J.S., Nicetto, D., and Zaret, K.S. (2016). H3K9me3-Dependent Heterochromatin: Barrier to Cell Fate Changes. Trends Genet. 32, 29–41. Betschinger, J., Mechtler, K., and Knoblich, J.A. (2006). Asymmetric segregation of the tumor suppressor brat regulates self-renewal in Drosophila neural stem cells. Cell 124, 1241–1253.

Supplemental Information can be found online at https://doi.org/10.1016/j. devcel.2019.11.019.

Biteau, B., Hochmuth, C.E., and Jasper, H. (2008). JNK activity in somatic stem cells causes loss of tissue homeostasis in the aging Drosophila gut. Cell Stem Cell. 3, 442–455.

ACKNOWLEDGMENTS

Bowman, S.K., Rolland, V., Betschinger, J., Kinsey, K.A., Emery, G., and Knoblich, J.A. (2008). The tumor suppressors Brat and Numb regulate transit-amplifying neuroblast lineages in Drosophila. Dev. Cell 14, 535–546.

We are grateful to Drs. A.H. Brand, C.P. Brangwynne, C.Q. Doe, Y.N. Jan, X. Ji, T. Lee, Y. Li, L. Luo, Y. Rao, G.M. Rubin, C. Tang, and H. Wu; University of Iowa DSHB; VDRC; Bloomington Drosophila Stock Center; and the TRiP at Harvard Medical School and Tsinghua University for fly stocks and reagents. We thank Dr. D.J. Pan for critical reading of the manuscript, Dr. Y. Zheng for insightful discussion, Q. Zhu for technical assistance, and members of the Song lab for discussions and help. This work was supported by the National Natural Science Foundation of China (31471372 and 31771629 to Y.S.), the Peking-Tsinghua Joint Center for Life Sciences (to Y.S.), and the Ministry of Education Key Laboratory of Cell Proliferation and Differentiation (to Y.S.). AUTHOR CONTRIBUTIONS X.L., J.S., and Y.S. conceived experiments. X.L., J.S., Z.W., C.W., Y.L., and X.Z. performed fly genetics, imaging, molecular biology, and biochemical experiments. L.X. and P.L. performed in vitro phase separation assays. X.L., J.S., and Y.S. wrote the manuscript with contributions from all authors. DECLARATION OF INTERESTS

Brower-Toland, B., Findley, S.D., Jiang, L., Liu, L., Yin, H., Dus, M., Zhou, P., Elgin, S.C., and Lin, H. (2007). Drosophila PIWI associates with chromatin and interacts directly with HP1a. Genes Dev. 21, 2300–2311. Cabernard, C., and Doe, C.Q. (2013). Live imaging of neuroblast lineages within intact larval brains in Drosophila. Cold Spring Harb. Protoc. 2013, 970–977. Caravaca, J.M., Donahue, G., Becker, J.S., He, X., Vinson, C., and Zaret, K.S. (2013). Bookmarking by specific and nonspecific binding of FoxA1 pioneer factor to mitotic chromosomes. Genes Dev. 27, 251–260. Case, L.B., Ditlev, J.A., and Rosen, M.K. (2019). Regulation of Transmembrane Signaling by Phase Separation. Annu. Rev. Biophys. 48, 465–494. Choksi, S.P., Southall, T.D., Bossing, T., Edoff, K., de Wit, E., Fischer, B.E., van Steensel, B., Micklem, G., and Brand, A.H. (2006). Prospero acts as a binary switch between self-renewal and differentiation in Drosophila neural stem cells. Dev. Cell 11, 775–789. Doe, C.Q., Chu-LaGraff, Q., Wright, D.M., and Scott, M.P. (1991). The prospero gene specifies cell fates in the Drosophila central nervous system. Cell 65, 451–464.

The authors declare no competing interests.

Elsir, T., Smits, A., Lindstro¨m, M.S., and Niste´r, M. (2012). Transcription factor PROX1: its role in development and cancer. Cancer Metastasis Rev. 31, 793–805.

Received: December 16, 2018 Revised: October 9, 2019 Accepted: November 26, 2019 Published: December 19, 2019

Guo, Z., and Ohlstein, B. (2015). Stem cell regulation. Bidirectional Notch signaling regulates Drosophila intestinal stem cell multipotency. Science 350. Published online November 20, 2015. https://doi.org/10.1126/science. aab0988.

Developmental Cell 52, 1–17, February 10, 2020 15

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Hirata, J., Nakagoshi, H., Nabeshima, Y., and Matsuzaki, F. (1995). Asymmetric segregation of the homeodomain protein Prospero during Drosophila development. Nature 377, 627–630.

Ming, G.L., and Song, H. (2011). Adult neurogenesis in the mammalian brain: significant answers and significant questions. Neuron 70, 687–702.

Holguera, I., and Desplan, C. (2018). Neuronal specification in space and time. Science 362, 176–180.

Molliex, A., Temirov, J., Lee, J., Coughlin, M., Kanagaraj, A.P., Kim, H.J., Mittag, T., and Taylor, J.P. (2015). Phase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillization. Cell 163, 123–133.

Homem, C.C., Repic, M., and Knoblich, J.A. (2015). Proliferation control in neural stem and progenitor cells. Nat. Rev. Neurosci. 16, 647–659. €licher, F. (2014). Liquid-liquid phase separaHyman, A.A., Weber, C.A., and Ju tion in biology. Annu. Rev. Cell Dev. Biol. 30, 39–58. Ikeshima-Kataoka, H., Skeath, J.B., Nabeshima, Y., Doe, C.Q., and Matsuzaki, F. (1997). Miranda directs Prospero to a daughter cell during Drosophila asymmetric divisions. Nature 390, 625–629. Inaba, M., Yuan, H., and Yamashita, Y.M. (2011). String (Cdc25) regulates stem cell maintenance, proliferation and aging in Drosophila testis. Development 138, 5079–5086. Jiang, H., Wang, S., Huang, Y., He, X., Cui, H., Zhu, X., and Zheng, Y. (2015). Phase transition of spindle-associated protein regulate spindle apparatus assembly. Cell 163, 108–122. Kadauke, S., Udugama, M.I., Pawlicki, J.M., Achtman, J.C., Jain, D.P., Cheng, Y., Hardison, R.C., and Blobel, G.A. (2012). Tissue-specific mitotic bookmarking by hematopoietic transcription factor GATA1. Cell 150, 725–737. Knoblich, J.A., Jan, L.Y., and Jan, Y.N. (1995). Asymmetric segregation of Numb and Prospero during cell division. Nature 377, 624–627. Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359. Larson, A.G., Elnatan, D., Keenen, M.M., Trnka, M.J., Johnston, J.B., Burlingame, A.L., Agard, D.A., Redding, S., and Narlikar, G.J. (2017). Liquid droplet formation by HP1a suggests a role for phase separation in heterochromatin. Nature 547, 236–240. Lee, T., and Luo, L. (1999). Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron 22, 451–461. Lerit, D.A., Plevock, K.M., and Rusan, N.M. (2014). Live imaging of Drosophila larval neuroblasts. J. Vis. Exp. Published online July 7, 2014. https://doi.org/ 10.3791/51756.

Nott, T.J., Petsalaki, E., Farber, P., Jervis, D., Fussner, E., Plochowietz, A., Craggs, T.D., Bazett-Jones, D.P., Pawson, T., Forman-Kay, J.D., and Baldwin, A.J. (2015). Phase transition of a disordered nuage protein generates environmentally responsive membraneless organelles. Mol. Cell 57, 936–947. Oliver, G., Sosa-Pineda, B., Geisendorf, S., Spana, E.P., Doe, C.Q., and Gruss, P. (1993). Prox 1, a prospero-related homeobox gene expressed during mouse development. Mech. Dev. 44, 3–16. Pak, C.W., Kosno, M., Holehouse, A.S., Padrick, S.B., Mittal, A., Ali, R., Yunus, A.A., Liu, D.R., Pappu, R.V., and Rosen, M.K. (2016). Sequence Determinants of Intracellular Phase Separation by Complex Coacervation of a Disordered Protein. Mol. Cell 63, 72–85. Palozola, K.C., Lerner, J., and Zaret, K.S. (2019). A changing paradigm of transcriptional memory propagation through mitosis. Nat. Rev. Mol. Cell Biol. 20, 55–64. Patel, A., Lee, H.O., Jawerth, L., Maharana, S., Jahnel, M., Hein, M.Y., Stoynov, S., Mahamid, J., Saha, S., Franzmann, T.M., et al. (2015). A Liquidto-Solid Phase Transition of the ALS Protein FUS Accelerated by Disease Mutation. Cell 162, 1066–1077. Robinson, J.T., Thorvaldsdo´ttir, H., Winckler, W., Guttman, M., Lander, E.S., Getz, G., and Mesirov, J.P. (2011). Integrative genomics viewer. Nat. Biotechnol. 29, 24–26. Ryter, J.M., Doe, C.Q., and Matthews, B.W. (2002). Structure of the DNA binding region of prospero reveals a novel homeo-prospero domain. Structure 10, 1541–1549. Schindler, U., Menkens, A.E., Beckmann, H., Ecker, J.R., and Cashmore, A.R. (1992). Heterodimerization between light-regulated and ubiquitously expressed Arabidopsis GBF bZIP proteins. EMBO J. 11, 1261–1273.

Liu, B., Zheng, Y., Yin, F., Yu, J., Silverman, N., and Pan, D. (2016). Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila. Cell 164, 406–419.

Shen, C.P., Jan, L.Y., and Jan, Y.N. (1997). Miranda is required for the asymmetric localization of Prospero during mitosis in Drosophila. Cell 90, 449–458.

Liu, K., Shen, D., Shen, J., Gao, S.M., Li, B., Wong, C., Feng, W., and Song, Y. (2017). The Super Elongation Complex Drives Neural Stem Cell Fate Commitment. Dev. Cell 40, 537–551.e6.

Shin, Y., and Brangwynne, C.P. (2017). Liquid phase condensation in cell physiology and disease. Science 357. Published online September 22, 2017. https://doi.org/10.1126/science.aaf4382.

Luo, L., Liao, Y.J., Jan, L.Y., and Jan, Y.N. (1994). Distinct morphogenetic functions of similar small GTPases: Drosophila Drac1 is involved in axonal outgrowth and myoblast fusion. Genes Dev. 8, 1787–1802.

Shin, Y., Berry, J., Pannucci, N., Haataja, M.P., Toettcher, J.E., and Brangwynne, C.P. (2017). Spatiotemporal control of intracellular phase transitions using light-activated optoDroplets. Cell 168, 159–171.e114.

Marshall, O.J., and Brand, A.H. (2015). damidseq_pipeline: an automated pipeline for processing DamID sequencing datasets. Bioinformatics 31, 3371–3373.

Smothers, J.F., and Henikoff, S. (2000). The HP1 chromo shadow domain binds a consensus peptide pentamer. Curr. Biol. 10, 27–30.

Marshall, O.J., and Brand, A.H. (2017). Chromatin state changes during neural development revealed by in vivo cell-type specific profiling. Nat. Commun. 8, 2271. Marshall, O.J., Southall, T.D., Cheetham, S.W., and Brand, A.H. (2016). Cell-type-specific profiling of protein-DNA interactions without cell isolation using targeted DamID with next-generation sequencing. Nat. Protoc. 11, 1586–1598. Maurange, C., Cheng, L., and Gould, A.P. (2008). Temporal transcription factors and their targets schedule the end of neural proliferation in Drosophila. Cell 133, 891–902. McSwiggen, D.T., Mir, M., Darzacq, X., and Tjian, R. (2019). Evaluating phase separation in live cells: diagnosis, caveats, and functional consequences. Genes Dev. https://doi.org/10.1101/gad.331520.119. Micchelli, C.A., and Perrimon, N. (2006). Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature 439, 475–479.

16 Developmental Cell 52, 1–17, February 10, 2020

Southall, T.D., and Brand, A.H. (2009). Neural stem cell transcriptional networks highlight genes essential for nervous system development. EMBO J. 28, 3799–3807. Song, Y., and Lu, B. (2011). Regulation of cell growth by Notch signaling and its differential requirement in normal vs. tumor-forming stem cells in Drosophila. Genes Dev. 25, 2644–2658. Southall, T.D., Gold, K.S., Egger, B., Davidson, C.M., Caygill, E.E., Marshall, O.J., and Brand, A.H. (2013). Cell-type-specific profiling of gene expression and chromatin binding without cell isolation: assaying RNA Pol II occupancy in neural stem cells. Dev. Cell 26, 101–112. Spana, E.P., and Doe, C.Q. (1995). The prospero transcription factor is asymmetrically localized to the cell cortex during neuroblast mitosis in Drosophila. Development 121, 3187–3195. Strom, A.R., Emelyanov, A.V., Mir, M., Fyodorov, D.V., Darzacq, X., and Karpen, G.H. (2017). Phase separation drives heterochromatin domain formation. Nature 547, 241–245.

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Tiwary, A.K., and Zheng, Y. (2019). Protein phase separation in mitosis. Curr. Opin. Cell Biol. 60, 92–98. Vaessin, H., Grell, E., Wolff, E., Bier, E., Jan, L.Y., and Jan, Y.N. (1991). prospero is expressed in neuronal precursors and encodes a nuclear protein that is involved in the control of axonal outgrowth in Drosophila. Cell 67, 941–953. Vermaak, D., and Malik, H.S. (2009). Multiple roles for heterochromatin protein 1 genes in Drosophila. Annu. Rev. Genet. 43, 467–492. Vogel, M.J., Peric-Hupkes, D., and van Steensel, B. (2007). Detection of in vivo protein-DNA interactions using DamID in mammalian cells. Nat. Protoc. 2, 1467–1478. Wang, L., Gao, Y., Zheng, X., Liu, C., Dong, S., Li, R., Zhang, G., Wei, Y., Qu, H., Li, Y., et al. (2019). Histone Modifications Regulate Chromatin Compartmentalization by Contributing to a Phase Separation Mechanism. Mol Cell. 76, 646–659. Wen, B., Wu, H., Shinkai, Y., Irizarry, R.A., and Feinberg, A.P. (2009). Large histone H3 lysine 9 dimethylated chromatin blocks distinguish differentiated from embryonic stem cells. Nat. Genet. 41, 246–250.

Wolfram, V., Southall, T.D., Brand, A.H., and Baines, R.A. (2012). The LIM-homeodomain protein islet dictates motor neuron electrical properties by regulating K(+) channel expression. Neuron 75, 663–674. Xu, K., Liu, X., Wang, Y., Wong, C., and Song, Y. (2018). Temporospatial induction of homeodomain gene cut dictates natural lineage reprogramming. eLife 7, e33934. Yasugi, T., Fischer, A., Jiang, Y., Reichert, H., and Knoblich, J.A. (2014). A regulatory transcriptional loop controls proliferation and differentiation in Drosophila neural stem cells. PLoS One 9, e97034. Zaidi, S.K., Young, D.W., Montecino, M.A., Lian, J.B., van Wijnen, A.J., Stein, J.L., and Stein, G.S. (2010). Mitotic bookmarking of genes: a novel dimension to epigenetic control. Nat. Rev. Genet. 11, 583–589. Zhao, R., Nakamura, T., Fu, Y., Lazar, Z., and Spector, D.L. (2011). Gene bookmarking accelerates the kinetics of post-mitotic transcriptional re-activation. Nat. Cell Biol. 13, 1295–1304. Zhu, S., Lin, S., Kao, C.F., Awasaki, T., Chiang, A.S., and Lee, T. (2006). Gradients of the Drosophila Chinmo BTB-zinc finger protein govern neuronal temporal identity. Cell 127, 409–422.

Developmental Cell 52, 1–17, February 10, 2020 17

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

STAR METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Mouse anti-Pros

Developmental Studies Hybridoma Bank [DSHB]

Cat# MR1A; RRID: AB_528440

Rabbit anti-phospho-Histone H3

Cell Signaling

Cat# 9701; RRID: AB_331535

Mouse anti-phospho-Histone H3

Cell Signaling

Cat# 9706s; RRID: 331748

Chicken anti-GFP

Abcam

Cat# Ab13970; RRID: AB_300798

Mouse anti-Myc

CW Biotech

Cat# cw0299A

Rabbit anti-Myc

Cell signaling

Cat# 2278S; RRID: AB_490778

Rabbit anti-Dpn

Gift from Dr. YN Jan

N/A

Mouse anti-Elav

DSHB

Cat# 9F8A9-c, RRID: AB_2314364

Rabbit anti-H3K9Me3

Abcam

Cat# ab8898; RRID: AB_306848

Rabbit anti-H3K4Me3

Abcam

Cat# ab8580; RRID: AB_306649

Rat anti-Miranda

Abcam

Cat# Ab197788

Anti-FLAG M2 affinity gels

Sigma-Aldrich

Cat#A2220; RRID: AB_10063035

Rabbit anti-FLAG

Cell Signaling Technology

Cat# 2368S; RRID: AB_2217020

Rabbit anti HA

Cell Signaling Technology

Cat# 3724; RRID: AB_1549585

TransGen Biotech

Cat# CD601-02

Sigma-Aldrich

Cat# S9895

Antibodies

Bacterial and Virus Strains BL21 (DE3) Chemicals, Peptides, and Recombinant Proteins S2 medium 8% paraformaldehyde

Electron Microscopy Sciences

Cat# 157-8

Halocarbon oil 700

Sigma Aldrich

Cat# H8898

Ascorbic acid

Sigma

Cat# A4034

Lumox tissue culture dish 50x12mm

Sarstedt

Cat# 94.6077.410

Glass coverslips,22x22mm

Sigma Aldrich

Cat# 12-540-B Cat# EH10125

Syringe filter unit, 0.22 mm

Merck Millipore

4-Chamber Glass Bottom Dish

Cellvis

Cat# D35C4-20-1.5-N

DMEM medium

Thermo Fisher Scientific

Cat# C11995500BT

Fetal Bovine Serum

Thermo Fisher Scientific

Cat# 10099141

1,6-Hexandiol

Sigma Aldrich

Cat# 240117

2,5-Hexandiol

Sigma Aldrich

Cat# H11904

IPTG

AMRESCO

Cat# 0487

Protease inhibitor cocktail

Sigma-Aldrich

Cat# P8340

Quick ligation kit

NEB

Cat# M2200S

RNase A

Thermo Scientific

Cat# EN0531

T4 DNA ligase

Thermo Scientific

Cat# EL0011

DpnI

NEB

Cat# R0176L

DpnII

NEB

Cat# R0543S

Advantage 2 Polymerase Mix

Clontech Laboratories

Cat# 639207

AlwI

NEB

Cat# R0513S

Agencourt AMPure XP Beads

Beckman Coulter

Cat# A63880

Klenow fragment

NEB

Cat# M0212S

Klenow 3‘-50 exo-enzyme

NEB

Cat# M0210S

T4 polynucleotide kinase

NEB

Cat# M0201S

NEB next high-fidelity 2XPCR mastermix

NEB

Cat# M0541S (Continued on next page)

e1 Developmental Cell 52, 1–17.e1–e8, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

QIAquick PCR purification kit

QIAGEN

Cat# 28104

DNeasy Blood and Tissue Kit

QIAGEN

Cat# 69504

Dual Luciferase Assay system

Promega

Cat# E1910

FISH Tag DNA Multicolor Kit

Invitrogen life technologies

Cat# F32951

ATCC

CRL-1573

Critical Commercial Assays

Experimental Models: Cell Lines HEK293 Experimental Models: Organisms/Strains Drosophila, insc-GAL4

Luo et al., 1994

N/A

Drosophila, esg-Gal4, tubP-Gal80ts, UAS-GFP

Gifts from Drs. H Jasper (Biteau et al., 2008) and C Micchelli (Micchelli and Perrimon, 2006)

N/A

Drosophila, UAS-GFP-Pros-FL

This paper

N/A

Drosophila, UAS-GFP-Pros-DN7

This paper

N/A

Drosophila, UAS-GFP-Pros-DN3

This paper

N/A

Drosophila, UAS-Myc-Pros-FL

This paper

N/A

Drosophila, UAS-Myc-Pros-DN1

This paper

N/A

Drosophila, UAS-Myc-Pros-DN2

This paper

N/A

Drosophila, UAS-Myc-Pros-DN3

This paper

N/A

Drosophila, UAS-Myc-Pros-DN4

This paper

N/A

Drosophila, UAS-Myc-Pros-DN5

This paper

N/A

Drosophila, UAS-Myc-Pros-DN6

This paper

N/A

Drosophila, UAS-Myc-Pros-DN7

This paper

N/A

Drosophila, UAS-Myc-Pros-DHPD

This paper

N/A

Drosophila, UAS-GFP-Pros-DHPD

This paper

N/A

Drosophila, UAS-Myc-Pros.3 m(HPD)

This paper

N/A

Drosophila, UAS-hnRNPA1c-GFP-Pros-DN7

This paper

N/A

Drosophila, UAS-LZ-GFP-Pros-DN7

This paper

N/A

Drosophila, UAS-GFP-Pros.5 m(N7)

This paper

N/A

Drosophila, UAS-hnRNPA1C-GFP-Pros.5 m(N7)

This paper

N/A

Drosophila, UAS-Myc-Prox1

This paper

N/A

Drosophila, UAS-GFP-Prox1

This paper

N/A

Drosophila, GFP-Pros-KI

This paper

N/A

Drosophila, Myc-Pros-KI

This paper

N/A

Drosophila, Myc-Pros-DN7-KI

This paper

N/A

Drosophila, Myc-Pros.5 m(N7)-KI

This paper

N/A

Drosophila, GFP-Pros-DN7-KI

This paper

N/A N/A

Drosophila, Myc-LZ-Pros-DN7-KI

This paper

Drosophila, GFP-LZ-Pros-DN7-KI

This paper

N/A

Drosophila, UAS-Dam

Liu et al., 2017

N/A

Drosophila, UAS-Dam-Pros-FL

This paper

N/A

Drosophila, UAS-Dam-Pros-DN7

This paper

N/A

Drosophila, UAS-Dam-HP1a

This paper

N/A

Drosophila, RFP-HP1a

Bloomington

BDSC Cat# 30562; RRID: BDSC_30562

Drosophila, UAS-His2A-RFP

Bloomington

BDSC Cat# 56555; RRID: BDSC_56555

Drosophila, UAS-pros-IR

Vienna Drosophila Resource Center [VDRC]

VDRC Cat# 101477; RRID: VDRC_101477

Drosophila, stg-GFP

Bloomington

BDSC Cat# 50879; RRID: BDSC_50879 (Continued on next page)

Developmental Cell 52, 1–17.e1–e8, February 10, 2020 e2

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

50 FAM-(AATAT)6

This paper

N/A

50 FAM-(AAGAG)6

This paper

N/A

50 FAM-Prod

This paper

N/A

Oligonucleotides

50 FAM-359 bp probe

This paper

N/A

gRNAs for generating pros-KO, sequences provided in Table S1

This paper

N/A

Primers for cloning, sequences provided in Table S1

This paper

N/A

pHR-mCherry-Cry2

Gift from CP Brangwynne (Shin et al., 2017) and X Ji

N/A N/A

Recombinant DNA

pHR-hnRNPA1C-mCherry-Cry2

This paper

pHR-Pros-FL-mCherry-Cry2

This paper

N/A

pHR-Pros-N1-mCherry-Cry2

This paper

N/A

pHR-Pros-N2-mCherry-Cry2

This paper

N/A

pHR-Pros-C-mCherry-Cry2

This paper

N/A

pHR-Pros-M-mCherry-Cry2

This paper

N/A

pHR-Pros-N2A-mCherry-Cry2

This paper

N/A

pHR-Pros-N2B-mCherry-Cry2

This paper

N/A

pHR-Pros-N2B-DN7-mCherry-Cry2

This paper

N/A

pHR-Pros-N2B-DN6-mCherry-Cry2

This paper

N/A

pHR-Pros-N2B.5m-mCherry-Cry2

This paper

N/A

pHR-Pros-N7-mCherry-Cry2

This paper

N/A

pHR-Pros-N6-mCherry-Cry2

This paper

N/A

pHR-Pros-DN3-mCherry-Cry2

This paper

N/A N/A

pHR-LZ-Pros-DN3-mCherry-Cry2

This paper

pHR-Pros-DHPD-mCherry-Cry2

This paper

N/A

pHR-Prox1-mCherry-Cry2

This paper

N/A

pHR-Prox1-DHPD-mCherry-Cry2

This paper

N/A

pcDNA3-His-miRFP

This paper

N/A

Plasmid: UAS-GFP-Pros-FL

This paper

N/A

Plasmid: UAS-GFP-Pros-DN7

This paper

N/A

Plasmid: UAS-GFP-Pros-DN3

This paper

N/A

Plasmid: UAS-Myc-Pros-FL

This paper

N/A

Plasmid: UAS-Myc-Pros-DN1

This paper

N/A

Plasmid: UAS-Myc-Pros-DN2

This paper

N/A

Plasmid: UAS-Myc-Pros-DN3

This paper

N/A

Plasmid: UAS-Myc-Pros-DN4

This paper

N/A

Plasmid: UAS-Myc-Pros-DN5

This paper

N/A

Plasmid: UAS-Myc-Pros-DN6

This paper

N/A

Plasmid: UAS-Myc-Pros-DN7

This paper

N/A

Plasmid: UAS-Myc-Pros-DHPD

This paper

N/A

Plasmid: UAS-GFP-Pros-DHPD

This paper

N/A

Plasmid: UAS-Myc-Pros.3 m(HPD)

This paper

N/A

Plasmid: UAS-hnRNPA1c-GFP-Pros-DN7

This paper

N/A

Plasmid: UAS-LZ-GFP-Pros-DN7

This paper

N/A

Plasmid: UAS-GFP-Pros.5 m(N7)

This paper

N/A (Continued on next page)

e3 Developmental Cell 52, 1–17.e1–e8, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Plasmid: UAS-hnRNPA1C-GFP-Pros.5m(N7)

This paper

N/A

Plasmid: UAS-Myc-Prox1

This paper

N/A

Plasmid: UAS-GFP-Prox1

This paper

N/A

Plasmid: GFP-Pros-KI

This paper

N/A

Plasmid: Myc-Pros-KI

This paper

N/A

Plasmid: Myc-Pros-DN7-KI

This paper

N/A

Plasmid: Myc-Pros.5m(N7)-KI

This paper

N/A

Plasmid: GFP-Pros-DN7-KI

This paper

N/A

Plasmid: Myc-LZ-Pros-DN7-KI

This paper

N/A

Plasmid: GFP-LZ-Pros-DN7-KI

This paper

N/A

Plasmid: UAS-Dam

Gift from Dr. AH Brand (Southall et al., 2013)

N/A

Plasmid: UAS-Dam-Pros-FL

This paper

N/A

Plasmid: UAS-Dam-Pros-DN7

This paper

N/A

Plasmid: UAS-Dam-HP1a

This paper

N/A

pBSK(pros 50 arm-attP-loxP-3xP3-RFPloxP-Pros 30 arm)

This paper

N/A

RIV(myc-Pros, mini-white)

This paper

N/A

RIV(myc-Pros-DN7, mini-white)

This paper

N/A

RIV[myc-Pros.5m(N7), mini-white]

This paper

N/A

RIV(EGFP-Pros, mini-white)

This paper

N/A

RIV(EGFP-Pros-DN7, mini-white)

This paper

N/A

RIV(Myc-LZ -Pros-DN7, mini-white)

This paper

N/A

RIV(LZ -EGFP-Pros-DN7, mini-white)

This paper

N/A

Software and Algorithms EDIUS

Video Editing

EDIUS 6

Photoshop CS5

Adobe

http://www.adobe.com

PONDR

http://www.pondr.com/

Damidseq_pipeline

Marshall and Brand, 2015

find_peaks

Wolfram et al., 2012

http://owenjm.github.io/damidseq_pipeline/ https://github.com/owenjm/find_peaks

bowtie2

Langmead and Salzberg, 2012

http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml

IGV

Robinson et al., 2011

http://software.broadinstitute.org/software/igv/

This paper

https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE136413

Leica TCS SP8 inverted confocal microscope

Leica Microsystems

N/A

40x, 1.3 NA oil-immersion objective

Leica Microsystems

N/A

63x, 1.4 NA oil-immersion objective

Leica Microsystems

N/A

Data and Software Availability DamID-seq data Other

LEAD CONTACT AND MATERIALS AVAILABILITY All unique/stable reagents generated in this study are available from the Lead Contact without restriction. Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yan Song (yan.song@pku. edu.cn).

Developmental Cell 52, 1–17.e1–e8, February 10, 2020 e4

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

EXPERIMENTAL MODEL AND SUBJECT DETAILS Fly Lines Drosophila stocks used in this study include: pros17(Doe et al., 1991); insc-Gal4 (Luo et al., 1994); ase-Gal4 (Zhu et al., 2006); RFPHP1a (BL 30562). Full-length, truncated or mutated versions of UAS-GFP-Pros (PJ) or UAS-Myc-Pros; UAS-hnRNPA1C-GFP-ProsDN7; UAS-LZ-GFP-Pros-DN7; UAS-hnRNPA1C-GFP-Pros-N7.5 m; pros-KO; GFP-Pros-FL-KI; GFP-Pros-DN7-KI; Myc-Pros-FL-KI; Myc-Pros-DN7-KI; Myc-Pros.5 m(N7)-KI; Myc-LZ-Pros-DN7-KI and GFP-LZ-Pros-DN7-KI were generated in this study. Note that GFP-Pros-DN7-KI and GFP-Pros.5 m(N7)-KI fly lines are homozygous lethal at early developmental stages. UAS-Dam, UAS-Dam-Pros, UAS-Dam-Pros-DN7 or UAS-Dam-HP1a transgenic fly lines were generated by PhiC31 transgenic integration. Fly Genetics Fly culture and crosses were performed according to standard procedures. Flies were raised on a standard sucrose cornmeal medium (45 g agar, 155 g yeast, 516 g glucose, 258 g sucrose and 858 g cornmeal in 8.5 L water). All fly crosses were maintained at 25 C unless noted otherwise. For Pros transient overexpression experiments, eggs were collected at 22 C for 4-6 h and kept at 18 C for 9, 8 or 6 days. The hatched larvae were then shifted to 29 C for 8-10, 18 and 48 h respectively before larval brain dissection (hereafter referred to as ‘‘29 C for 8-10 hr’’; ‘‘29 C for 18 hr’’; or ‘‘29 C for 48 hr’’). The detailed genotypes and experimental conditions are listed in the Table S2. Flies were not sexed and a mixed population of male and female larval brains was analyzed unless noted otherwise. For results shown in Figures 1D, 2I, 3G, 3Q, 4I, 5A, 6D, S1D, and S4A, only male larval brains were analyzed. METHOD DETAILS Cloning CRISPR-Cas9-based pros knock-out line was generated as previously described (Baena-Lopez et al., 2013). A 3200-bp pros genomic DNA sequence including pros promoter, 50 UTR, ATGs and a part of first exon was replaced with attP-loxP-3xP3-RFPloxP to generate pros KO line. attP-loxP-3xP3-RFP-loxP DNA fragment was amplified from the pEASY-attP-loxP-3xP3-RFP-loxP plasmid (a Gift from Dr. Yi Rao), assembled with pros 50 arm and 30 arm via the Gibson Assembly and fully sequenced. Synthesized Cas9 mRNA, gRNAs and pBSK(pros 50 arm-attP-loxP-3xP3-RFP-loxP-Pros 30 arm) plasmid were injected into w1118 embryos. 3xP3RFP+ candidates were further confirmed by genomic DNA PCR. The cloning primer and gRNA sequences are provided in Table S1. pros-KO line was used as a host for generating site-directed pros-KI lines. To generate RIV(EGFP-Pros, mini-white) reintegration plasmid, EGFP cDNA, full-length of pros-RJ cDNA, along with 2039 bp sequence upstream of pros-RJ ATG site including pros intron, promoter and 50 UTR and 3265 bp pros 30 UTR were assembled together into RIV(MCS; mini-white). Plasmids RIV(myc-Pros, miniwhite), RIV(myc-Pros-DN7, mini-white) and RIV[myc-Pros.5 m(N7), mini-white] were constructed using a similar strategy. All reintegration plasmids were verified by DNA sequencing before germline transformation. For transgenic fly lines, full-length, truncated or mutated versions of Myc-Pros or GFP-Pros were cloned into the pJFRC8110XUAS-IVS-Syn21-GFP-p10 vector (Addgene #36432, a gift from Dr. Y. Rao) for phiC31-mediated integration into attP2 or attP40 landing sites. For replacement assay, DNA fragments encoding IDRs of human hnRNPA1C (aa 186-320), leucine zipper domain of Arabidopsis GBF1 protein (aa 244-315) were synthesized with codon optimization (GENEWIZ). The replacement DNA fragments were added to the N terminus of GFP-Pros-DN7 or GFP-Pros.5 m(N7) via Gibson assembly method. For luciferase reporter assay, full-length Gal4 was added to the N terminus of EnRD, VP16 or truncated versions of Pros, before being cloned into the pcDNA3.1 vector (Invitrogen). For coimmunoprecipitation experiments, full-length, truncated or mutated versions of Pros, Prox1 or HP1 isoforms were cloned into the pcDNA3.1 vector respectively (Invitrogen) and fully sequenced. To generate pUASTattB-Dam-Pros and pUASTattB-Dam-HP1a constructs, full length version of Pros and HP1a was cloned into the pUASTattB-Dam vector respectively. Immunohistochemistry of Drosophila Larval Brain For fly larval brain immunostaining, larvae were dissected in Schneider’s Insect Medium (Sigma-Aldrich) and proceeded as previously described (Song and Lu, 2011; Liu et al., 2017). Briefly, larval brains were fixed with 4% paraformaldehyde in PEM buffer (100 mM PIPES at pH 6.9, 1 mM EGTA, 1 mM MgCl2) for 21 min at room temperature. Brains were washed several times with PBST buffer (1x PBS plus 0.1% Triton X-100) and were incubated with appropriate primary antibody overnight at 4 C, labeled with secondary antibodies according to standard procedures, and mounted in Vectashield (Vector Laboratories). For immunostaining of KI lines, after fixation, larval brains were blocked in 3% BSA/PBST for 2 h at room temperature before being incubated with rabbit anti-Myc (1:100) or chicken anti-GFP (1:1000, Abcam) in 3% BSA/PBST for 12 h at 4 C. After washing with PBST buffer, brains were blocked in 3% BSA/PBST for 1 h at room temperature before being incubated with secondary antibody in PBST for 2 h at room temperature. Images were obtained on a Leica TCS SP8 AOBS confocal microscope and were processed with LAS AF (Leica) and Adobe Photoshop CS5. Other primary antibodies used for immunohistochemistry of fly larval brain were mouse anti-Pros (1:100, Developmental Studies Hybridoma Bank [DSHB]), mouse anti-Elav (1:100, DSHB), rat anti-Miranda (1:200, Abcam), rabbit anti-Dpn (1:1000, Y.N. Jan), rabbit e5 Developmental Cell 52, 1–17.e1–e8, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

anti-phospho-Histone H3 (1:1000, CST), rabbit anti H3K9me3 (1:200, Abcam), mouse anti-phospho-Histone H3 (1:200, CST). The outline of individual, dispersed neuroblast lineages was determined by the staining pattern of general cell cortex marker F-actin or CD8-GFP and marked by white dashed line. Live Imaging Live imaging of dividing type I neuroblasts in intact larval brains was performed as previously described (Cabernard and Doe, 2013; Lerit et al., 2014; Liu et al., 2017). The larval brains of third instar larvae were dissected and mounted in explant solution [0.5 mM ascorbic acid (Sigma-Aldrich) and 1% HyClone bovine growth serum (Thermo Scientific) in Schneider’s insect medium (Sigma-Aldrich) on gas-permeable culture dish (Sarstedt). The coverslip was encircled with halocarbon oil (Sigma-Aldrich) to prevent evaporation of the explant solution. Images were recorded with a Leica SP8 inverted confocal microscope using 40x, 1.3 NA oil-immersion objective. Laser power settings, gain and exposure time were optimized to avoid cytotoxicity. Fluorescence Recovery after Photobleaching (FRAP) Analysis Third instar larval brains were dissected in explant solution and mounted on gas-permeable culture dish. FRAP analysis of GFP-Pros was performed using the Leica SP8 system, with laser at 488 nm. Laser power for bleaching was attenuated to 7.5% (Caravaca et al., 2013). For each experiment, 4-6 images were acquired before an area of 3.84 3 3.84 mm was bleached. Images were collected every 0.581 s for 2 min after photobleaching. FRAP analysis of HP1a was performed with laser at 568 nm. Laser power for bleaching was attenuated to 2%–5%. Images were collected every 10 s for 2 min after photobleaching. OptoDroplet Assay The optoDroplet assay was adapted from previous study (Shin et al., 2017). Plasmids were co-transfected with PEI transfection reagent in 293T cells. For transfection, 293T cell were plated 24 h prior to transduction in 4-chamber glass bottom dish (Cellvis). After transfection, the dishes were cultured in 37 C incubator for 20-24 h. Imaging was performed on Leica SP8 confocal. For global activation and imaging, cells were imaged typically by use of two laser wavelengths. Droplet formation was induced by 488nm light for Cry2 activation with the increasing activation intervals of 10 s, 20 s, 30 s, 40 s, 50 s and 60 s. mCherry imaging was stimulated with 568nm light. MARCM Clonal Analysis Type I NSC (neuroblast) MARCM clones were generated as previously described (Lee and Luo, 1999; Song and Lu, 2011). Briefly, newly-hatched larvae were heat-shocked at 37 C for 80 min and further aged at 25 C for 96 h before dissection. Dual-Luciferase Reporter Assay Luciferase assay was performed as previously described (Liu et al., 2016). Briefly, HEK293T cells were transfected with 0.5 mg experimental plasmids, luciferase reporter construct pGL4.35 (Promega) together with 50 ng Renilla luciferase reporter plasmid (as the internal control) using standard polyethylenimine (PEI) protocol. Luciferase assay was performed at 24 h post transfection using Dual Luciferase Assay system (Promega) following the manufacturer’s instructions. Protein Purification and Labeling GFP-Pros-N2B and GFP-Pros-N2B.5 m fragments were cloned into pETDuet vector (Novagen) with a MBP-tag in the N terminus and a His-tag in the C terminus. Proteins were expressed in E. coli BL21 (DE3). After induction with 0.5 mM IPTG at 18 C overnight and ultrasonic break down and centrifuge, the supernatant was purified with Ni resin and MBP chromatography before being stored in 20 mM Tris (pH 7.4), 200 mM NaCl, and 1 mM DTT. For protein labeling, full-length HP1a was cloned into pRSFDuet-1 (Novagen) vector and protein was purified from E. coli BL21 (DE3). Purified HP1a protein was exchanged into reaction buffer (20 mM HEPES pH 7.4, 200 mM NaCl) using a Superdex 200 increase 10/300 (SD200, GE Healthcare) gel filtration column. For protein labeling, 1:1 molar ratio of Alexa Fluor 568 carboxylic acid (Succinimidyl Ester, Thermo Fisher Scientific) was mixed with 2 mg of HP1a protein and incubated for 1 h at room temperature with continuous stirring, before purified with a SD200 column. After elution, labeled HP1a protein was stored in 20 mM HEPES (pH 7.4), 200 mM NaCl at
80 C. 5% labeled HP1a was mixed with non-labeled HP1a before being used. In Vitro Phase Separation Assay Before phase separation assay, purified MBP-tagged GFP-Pros-N2B or GFP-Pros-N2B.5 m was incubated with TEV at a ratio of 1:20 for 3-4 h at 4 C to remove the MBP-tag. Phase separation assay was performed in 20 mM Tris (pH 7.4), 200 mM NaCl, and 1 mM DTT at indicated protein concentrations. For co-phase separation assay, MBP-tagged GFP-Pros-N2B or GFP-Pros-N2B.5 m and labeled HP1a at indicated concentrations were mixed before TEV cleavage. All experiments were recorded on 384 low-binding multi-well 0.17 mm microscopy plates (In Vitro Scientific, Cellvis). Images were taken by a NIKON A1 microscope equipped with a 60 3 oil immersion objective. Mitotic Chromosome Spreading Late third-instar larval brains were dissected in saline solution and transferred into Hypotonic Solution (0.5% sodium citrate) and incubated at room temperature for 10 min. The samples were then fixed in 45% acetic acid containing 2% formaldehyde for Developmental Cell 52, 1–17.e1–e8, February 10, 2020 e6

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

8 min on a coverslip. After squashing, immunostaining of the samples was performed according to standard procedures. Hoechst (Life Technologies) was added in the wash step with a dilution of 1:3000 for DNA staining. Coimmunoprecipitation 48 h after transfection, HEK293T cells were harvested, washed and resuspended in lysis buffer [50 mM Tris-HCl (pH 8.0); 120 mM NaCl; 5 mM EDTA; 1% NP-40; 10% glycerol; protease inhibitor cocktail (Sigma-Aldrich); 2 mM Na3VO4] and kept on ice for 20 min. Cell extracts were sonicated with Bioruptor Plus (Biosense) at 4 C, clarified by centrifugation, and proteins immobilized by binding to anti-FLAG M2 (Sigma-Aldrich) affinity gel for 4 h at 4 C. Beads were washed and proteins recovered directly in SDS-PAGE sample buffer. Rabbit anti-FLAG (Cell Signaling Technology) or rabbit anti-HA (Cell Signaling Technology) were used for western blot analysis. DamID-seq UASTattB-Dam, UASTattB-Dam-Pros-FL, UASTattB-Dam-Pros-DN7 or UASTattB-Dam-HP1a flies were crossed with GMR71C09Gal4; Gal80ts flies to achieve NP-and neuron-specific and temporally-restricted expression of Dam or Dam-fusion proteins. Embryos were collected over 4 h period at 25 C and then shifted to 18 C and kept at 18 C for 9 days. Hatched larvae were then shifted to 29 C for 24 h before dissection at late third instar larval stage. 60 larval brains were dissected for each sample. The genomic DNA extraction and the processing and amplification of methylated DNA were performed as previously described (Southall et al., 2013, Vogel et al., 2007), except following modifications: After Dpn II digestion, DamID PCR amplification was performed using optimized cycle number. The PCR products were purified using QIAquick PCR purification kit (QIAGEN). The next-generation sequencing (NGS) libraries were generated as previously described (Marshall et al., 2016) for Illumina sequencing via HiSeq 2500. Sequencing libraries were multiplexed to yield at least 20 million mapped reads per sample. Using damidseq_pipeline (http://owenjm.github.io/damidseq_pipeline/) (Marshall and Brand, 2015), NGS reads in FASTQ format were aligned to the Drosophila melanogaster reference genome version r6.06 using bowtie2 (Langmead and Salzberg, 2012) to generate a final log2 ratio file in bedgraph format. Datasets were visualized using IGV (Robinson et al., 2011). Following ratio file generation, peaks with an FDR < 0.01 were identified using the find_peaks software (http://github.com/owenjm/find_peaks). All DamID-seq analyses were repeated three times with independent biological replicates. The resulting gatc.bedgraph dataset replicates were compared via Pearson’s correlation and replicates averaged. The mean correlation between replicates was 0.84, with the minimum correlation being 0.74. DNA FISH Two-color FISH was performed as previously described with modifications (Bantignies et al., 2011). Briefly, after larval brain dissection and fixation with 4% paraformaldehyde in PBS, brains were treated with 200 mg/mL RNaseA in PBST for 2 h at RT. Tissues were then sequentially transferred into a pre-Hybridization Mixture (pHM: 50% formamide; 4XSSC; 100 mM NaH2PO4, pH 7.0; 0.1% Tween 20). Tissue DNA was denatured in pHM at 80 C for 8 min. Heterochromatic repeat probes and target gene probes were diluted in the FISH Hybridization Buffer (FHB: 10% dextransulfat; 50% deionize formamide; 2XSSC; 0.5 mg/mL Salmon Sperm DNA) and denatured at 72 C for 10 min, before being added to the tissues without prior cooling. Hybridization was performed at 37 C for 16-20 h. Post-hybridization washes were performed, starting with 50% formamide, 2XSSC, 0.3% CHAPS and sequentially returning to PBSTr. As for DNA FISH coupled with immunostaining, after post-hybridization washes, brains were blocked in PBSTr-10% BSA (Sigma) for 2 h at RT and then incubated overnight at 4 C with mouse anti-pH3 antibody at a dilution of 1: 50 in PBSTr-10% BSA. Brains were washed several times in PBSTr, and incubated for 2 h at RT with 647 Goat anti-mouse secondary antibody (Jackson Laboratories) at a dilution of 1:50 in PBST. Hoechst (Life Technologies) was added in the wash step with a dilution of 1:3000 for DNA staining. FISH Probes were labeled with Alexa Fluor 488 or Alexa Fluor 555 dye using the FISH Tag DNA Multicolor Kit (Invitrogen life technologies, F32951) following manufacturers’ instructions. Approximately 100 ng of each labeled probe diluted in 20 ml of FHB was used for each hybridization. For heterochromatic repeat probes, 50 FAM-(AATAT)6, 50 FAM-(AAGAG)6, 50 FAM-AATAACATAGAATAA CATAGAATAACATAG (Prod) and 50 FAM-AGGATTTAG GGAAATTAATTTTTGGATCAATTTTCGCATTTTTTGTAAG (359 bp) were synthesized. 40 ng of each probe were combined to label chromocenters. For labeling Pros target gene loci, FISH probes were made of genomic PCR fragments. Each probe covered 9.5 to 13 kb of the relevant genomic region. QUANTIFICATION AND STATISTICAL ANALYSIS For NSC quantification, embryos of various genotypes were collected for 4-6 h and allowed to develop to the 3rd instar larval stage (96 h or 120 h after larval hatching). 10-20 larvae of each genotype were dissected and stained with anti-Dpn and anti-Elav antibodies to distinguish various cell types within NB lineages. For quantification of the intensity of antibody staining, images were taken with the same confocal settings and the mean fluorescence intensity was measured with NIH ImageJ or the Histogram function of Adobe Photoshop. For quantification of the relative fluorescent intensity (FI) of HP1a crescents, the FI of three points in each HP1a crescent, both end points and the middle point, were measured (FI1, FI2 and FI3). The mean value of FI1, FI2 and FI3 was regarded as the average e7 Developmental Cell 52, 1–17.e1–e8, February 10, 2020

Please cite this article in press as: Liu et al., Mitotic Implantation of the Transcription Factor Prospero via Phase Separation Drives Terminal Neuronal Differentiation, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.11.019

fluorescent intensity of the crescent. The relative FI compared to the FI of HP1a crescents in dividing WT NSCs was then quantified. As for quantification of the discontinuity of HP1a crescents, the difference between the biggest and smallest value of FI1, FI2 and FI3 was quantified (FIDiscontinuity = FImax – FImin). A bigger differential FI here indicated a more discontinuous HP1a crescent. The relative FIDiscontinuity compared to the FIDiscontinuity of HP1a crescents in dividing WT NSCs was then quantified. For quantification of the H3K9me3+ heterochromatin domains in neurons, the total area of the H3K9me3+ heterochromatin domains in each neuron and the neuronal nuclear area of indicated genotypes were measured by NIH ImageJ. Note that transient overexpression of functional Pros transgenes, Pros-FL, e.g., led to premature differentiation of NSCs, causing the formation of Elav+ neurons of increased cellular sizes. The area ratio between H3K9me3+ heterochromatin domains and neuronal nucleus was then quantified and regarded as the value to indicate the relative expansion or shrinkage of the H3K9me3+ heterochromatin domains per neuron. For quantification of the percentage of gene locus positioned within or overlapping with chromocenters, 3D images of NSC lineages were taken. Only neurons (small-nucleus, DAPI+, pH3- cells) with heterochromatic repeat probe signal colocalized with DAPI-labeled condensed regions were counted. Since only 4 heterochromatic repeat probes were used in the study, the chromocenters labeled by the heterochromatic repeat probes sometimes appeared to be smaller than DAPI-labeled condensed regions. In this case, DAPI-labeled condensed areas were regarded as chromocenters. The percentage of target gene loci positioned within or overlapping with chromocenters was quantified accordingly. As for quantification of optodroplet number, the total increased droplet number per cell from preactivation to 210 s after light induction was quantified. The only exception is ProsN2B-DN6-Cry2, which led to prominent droplet formation in HEK293T cells even without light induction. In this case, the total droplet number per cell without light induction was quantified. As for statistical analyses of Pros-FL versus Pros-DN7 occupancy on negative control and self-renewal/cell-cycle target gene loci in neural precursors and neurons, as shown in Figure S4D, quantification was performed using DamID-seq data points of 3 independent biological repeats. Considering that Pros preferentially binds to consensus sequence in its target genes (Choksi et al., 2006), only peak sites in Dam-Pros versus Dam-Pros-DN7 profiles were used for quantification here. Unpaired Student’s t tests were used for statistical analysis between two groups. DATA AND CODE AVAILABILITY The accession number for DamID-seq results reported in this paper is GEO (Gene Expression Omnibus): GSE136413.

Developmental Cell 52, 1–17.e1–e8, February 10, 2020 e8