- Email: [email protected]
mmu-miR-702 functions as an anti-apoptotic mirtron by mediating ATF6 inhibition in mice
Gene 531 (2013) 235–242
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
mmu-miR-702 functions as an anti-apoptotic mirtron by mediating ATF6 inhibition in mice Wei-guang Zhang a, Lin Chen b, Qin Dong a, Juan He a, Han-dong Zhao a, Feng-lan Li a, Hui Li a,⁎ a b
Department of Biochemistry and Molecular Biology, Basic Medical Science College, Harbin Medical University, Harbin 150081, China Department of Clinical Laboratory, Harbin Red-Cross Central Hospital, Harbin 150076, China
a r t i c l e
i n f o
Article history: Accepted 2 September 2013 Available online 10 September 2013 Keywords: Apoptosis MicroRNA miR-702 Isoproterenol Short hairpin introns
a b s t r a c t MicroRNAs (miRNAs) are a group of endogenous, small, noncoding RNAs that function as key posttranscriptional regulators. miRNAs are involved in many biological processes including apoptosis. In this study, mouse miR-702 (mmu-miR-702), a mirtron derived from the 13th intron of the Plod3 gene, was identified as a regulator of anti-apoptosis. mmu-miR-702 was down-regulated after treatment with the apoptosis-inducer isoproterenol both in vivo and in vitro. According to over-expression experiments, mmu-miR-702 inhibited apoptosis as well as the expression levels of a subset of apoptosis-related genes including activating transcription factor 6 (ATF6). An interaction between mmu-miR-702 and the ATF6 3′-UTR binding site was confirmed using luciferase reporter and western blot assays. This is the first report of ATF6 interaction with miRNA. Although the possible existence of miR-702 in the human genome is low, our results indicate that mirtrons also participate in the process of apoptosis and may provide a novel study strategy for apoptosis. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Cell apoptosis, the main form of programmed cell death, plays an important role in the progression of various diseases, including cardiovascular disease, degenerative disease, and tumorigenesis. Although there are abundant studies about the molecular mechanisms of apoptosis, controversies and unknowns still exist, especially in the early period of apoptosis. For cardiac myocytes, apoptosis is triggered by a loss of homeostasis, such as changes in physiological stresses and increased sympathetic activity (Logue et al., 2013; Vaughan et al., 2002). Various pathways and hallmarks are involved in the complex molecular mechanisms of apoptosis and stress, including activating transcription factor 6 (ATF6) (Galindo et al., 2012; Nakanishi et al., 2005; Yao et al., 2013). Activating transcription factor 6 (ATF6), a type II transmembrane protein embedded in the endoplasmic reticulum (ER), is a key stress sensor for initiation of the unfolded protein response (UPR) in ER stress (Haze et al., 1999; Lai et al., 2007). Under ER stress, ATF6 senses the accumulation of unfolded proteins in the ER through dissociation of the 78 kDa glucose-regulated protein (GRP78) from its lumenal domain. ATF6 then translocates from the ER to the Golgi where it is proteolytically processed from a 90 kDa protein to a 50 kDa protein to release its Abbreviations: mmu-miR-702, mouse microRNA-702; ATF6, activating transcription factor 6; ER, endoplasmic reticulum; UPR, unfolded protein response; GRP78, 78 kDa glucose-regulated protein; ERSE, endoplasmic reticulum stress response element; CHOP, C/EBP homologous protein; ISO, isoproterenol; XBP1, X-box binding protein 1; BCL2, Bcell CLL/lymphoma 2; BAX, BCL2-associated X protein; UTR, untranslated regions. ⁎ Corresponding author at: 194 Xuefu Road, Harbin 150081, China. Tel.: +86 451 86671684. E-mail address: [email protected] (H. Li). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.09.005
cytoplasmic domain. This truncated form enters the nucleus and binds the ER stress response element (ERSE) in target gene promoters and contributes to the reduction of misfolded protein levels (Adachi et al., 2008). The C/EBP homologous protein (CHOP; official symbol: DDIT3), which contains an ERSE in its promoter region, is an important target gene of ATF6. It also functions as a well-known transcription factor that mediates apoptosis (Tsukano et al., 2010; Yao et al., 2013). Although ATF6 is regarded as a protective protein in the ER stress response, its role in apoptosis has recently received increased attention (Galindo et al., 2012; Nakanishi et al., 2005; Yao et al., 2013). MicroRNAs (miRNAs) are a group of endogenous, small, noncoding RNAs that are found in eukaryotes. They function as key posttranscriptional regulators through base pairing to partially complementary sites, mainly in the untranslated region of mRNA (Ambros, 2003; Lee and Ambros, 2001). Mirtrons, a subset of miRNAs derived from short hairpin introns, also work by targeting mRNAs (Okamura et al., 2008; Westholm and Lai, 2011). Mouse miR-702 (mmu-mir-702; miRBase accession: MI0004686) derives from the 13th intron of the Plod3 gene of mice and belongs to mirtrons. mmu-mir-702 is not expressed in mouse oocyte, but it appears in 8-cell stage embryos and has a significantly up-regulation during embryogenesis in mouse heart (Mineno et al., 2006). Although mmu-miR-702 was reported to promote proliferation in Dgcr8-deficient embryonic stem cells in recent research (Kim and Choi, 2012), the function of it remains a mystery. As a microRNA, a classical molecular mechanism involves targeting mRNAs to inhibit their expression and subsequent biological roles. However, to this day, mmu-miR-702 has not been investigated in this respect. Stimulation of β-adrenergic receptors (β-AR) induces apoptosis in cardiac myocytes in vitro and in vivo (Iwai-Kanai et al., 1999; Singh
236
W. Zhang et al. / Gene 531 (2013) 235–242
et al., 2000). Given that three distinct β-AR subtypes exist in mammals, isoproterenol (ISO), as a traditional nonselective agonist of the β-AR, is more frequently used as an apoptosis inducer in many researches (Hsu et al., 2013; Jin et al., 2007; Zhuo et al., 2013). Moreover, ISO has been indicated as an apoptosis inducer not only in cardiac myocytes, but also in other cells (Hudecova et al., 2013; Liao et al., 2010). In our study, an ISO-induced apoptosis model was established in vivo and in vitro with the aim of determining a possible molecular regulatory mechanism of mmu-miR-702 in this process.
2. Materials and methods 2.1. Establishment of animal model Male C57Bl/6 mice were purchased from Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). All procedures were approved by the regulations and protocols of the ethics committee of the Harbin Medical University and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). The animals were kept with water and fed a standard laboratory diet for 1 week. Thereafter, mice were randomly divided into four groups (n = 6/group), including three treatment groups and one control group. For the treatment groups, ISO (Sigma, St. Louis, MO, USA), dissolved in 0.2 ml 0.9% NaCl, was injected (10 mg/kg) into the subcutaneous tissue twice 24 h apart. For the control group, an equal volume of saline was injected. The animals in the three treatment groups were sacrificed at 6, 12, and 24 h after the last injection, while the animals in the control group were sacrificed at 24 h after the last injection. The left ventricles of every animal were excised for experimental samples.
2.2. Examination by electron microscopy The left ventricles of mice were sliced into 1–3 mm cubes and fixed in 3% glutaraldehyde buffer overnight at 4 °C. Samples were processed by the Harbin Medical University Electron Microscopy Core facility. Sections were imaged on a Jeol 1200 EX TEM (Mitaka, Tokyo, Japan) at the indicated magnification.
Table 1 Amplification primers for PCR. Amplification Primer (5′-3′)
Product Annealing size temperature
mmu-miR702 U6 small nuclear RNA Bax
Forward: GAGTGCCCACCCTTTACC Reverse: CAGTGCGTGTCGTGGAGT Forward: GCTTCGGCAGCACATATACTAAAAT Reverse: CGCTTCACGAATTTGCGTGTCAT Forward: TTTGCTACAGGGTTTCATCCAG Reverse: TGTCCAGTTCATCTCCAATTCG Forward: CCTACGGATTGACATTCTCAGT Reverse: ACATAAGGCAACCACACCATC Forward: GCTGACTTCCTGTATGCTTACT Reverse: CGTTGCCACCTTCCTGTTAA Forward: GCTGGAAGCCTGGTATG Reverse: CTTTGGGATGTGCGTGT Forward: ACGCACTTGGAATGACC Reverse: TTCTTTCCCAAATACGC Forward: AGGGCATCTTGGGCTACAC Reverse: CATACCAGGAAATGAGCTTGA Forward: GAACCAGGAGTTAAGAACACG Reverse: AGGCAACAGTGTCAGAGTCC Forward: GAACCAGGAGTTAAGAACACG Reverse: AGGCAACAGTGTCAGAGTCC
64 bp
62 °C
89 bp
60 °C
140 bp
61 °C
168 bp
61 °C
165 bp
61 °C
183 bp
56 °C
192 bp
48 °C
132 bp
56 °C
179 bp
63 °C
205 bp
63 °C
Casp3 CHOP GRP78 GAPDH XBP1s XBP1u
Amplification primer (5′-3′) ATF6 site Forward: 1 CGACGCGTGCAACTCCAGGGGAAGAGGAA Reverse: CCCAAGCTTCAGAACCAACACCAGGCGACA ATF6 Forward: site CGACGCGTGGTCCCATTCCAGTAAGCACAA 2 Reverse: CCAAGCTTCCACAGCCACAGTCACATCCTC Forward: ATF6 CGACGCGTCCAGCCAGTGTCACAAAGCAA site 3 Reverse: CCAAGCTTTTCGGGCACTCTAAGCAAGCA Forward: ATF6 CGACGCGTATGGTGGATGGGGTATGTAG site 4 Reverse: CCCAAGCTTTATCCCTGGTTGACCCTTAA DDIT3 Forward: site CGACGCGTAGTGGGCATCACCTCCTGTC Reverse: CCCAAGCTTCAATGTACCGTCTATGTGCAAG
Product Annealing size temperature 155 bp
57 °C
423 bp
57 °C
504 bp
54 °C
180 bp
52 °C
170 bp
55 °C
2.3. Cell culture NIH 3T3 and HEK293T cell lines, obtained from the Chinese Academy of Sciences Shanghai Branch Cell Bank (Shanghai, China), were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 μg/ml streptomycin at 37 °C, 5% CO2. The NIH 3T3 cell line was transfected with mmumiR-702 mimics or negative control RNA (miR-NC) with Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. ISO treatment was performed with medium containing 10 μM ISO at 24 h after transfection. RNA and protein were harvested 48 h after transfection or after ISO treatment for 0.5, 1, 2, and 24 h. The efficiency of mmu-miR-702 transfection was determined by quantitative real-time PCR. HEK293T cells were used for luciferase assays. 2.4. Caspase 3 activity detection Caspase 3 activity in cardiac tissue extracts or NIH 3T3 cell proteins was detected by the Caspase 3 Activity Assay Kit (BestBio, Beijing, China), according to the manufacturer's protocol. The absorbance was measured at 405 nm, and the relative activity of Caspase 3 was determined. 2.5. RNA extraction and quantitative real-time PCR
Gene
Bcl2
Table 2 PCR amplification primers for obtaining the DNA insert fragment.
Total RNA samples were isolated from tissues or from cell lines using TRIzol (Invitrogen Life Technologies) and reverse transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions. The specific stem-loop primer designed for mmu-miR-702 reverse transcription was 5′-GTCGTATCCAGTGCGTGTCGTGGAGTCG GCAATTGCACTGGATACGACGAGCGG-3′. The primer designed for U6 small nuclear RNA reverse transcription was 5′-CGCTTCACGAAT TTGCGTGTCAT-3′. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) and the ABI 7500 Real-time PCR system (Applied Biosystems). Specific amplification primers were also designed for mmu-miR-702, U6 small nuclear RNA, BAX, BCL2, Caspase 3 (Casp3), CHOP, GRP78, and GAPDH (Table 1). U6 small nuclear RNA was used as a control for microRNA quantification, while GAPDH was employed as the endogenous control for other genes. PCR was performed according to the manufacturer's instructions. All assays, including those for the non-template control, were performed, at least, in triplicate. The relative expression levels were
W. Zhang et al. / Gene 531 (2013) 235–242
237
Fig. 1. Apoptosis arose in mouse cardiac tissues after injection with ISO. (A) Electron microscopy images of cardiomyocytes in mice after ISO treatment, compared with control group. (B) Relative expression level of Caspase 3 mRNA in mouse cardiac tissues was examined by real-time PCR after injection with ISO. GAPDH was used as an internal control. **P b 0.01 vs. control group. (C) Relative activity of Caspase 3 was examined in mouse cardiac tissues after injection with ISO. *P b 0.05, **P b 0.01 vs. control group. (D) The ratio of BAX to BCL2 mRNA expression levels in mouse cardiac tissues after injection with ISO. *P b 0.05 vs. control group.
then determined using the 2−ΔΔCt method (Livak and Schmittgen, 2001). For detection of the expression levels of spliced and unspliced forms of X-box binding protein 1 (XBP1) (XBP1s and XBP1u), semiquantitative PCR and agarose gel electrophoresis were performed using primers designed for the two XBP1 mRNA forms as described in Table 1.
Detection Kit, Abcam) and propidium iodide (PI) following the manufacturer's instructions. Apoptosis in cell samples was examined by double staining flow cytometry assays using FACSCanto Flow Cytometer and FACSDiva software (Becton Dickinson, Franklin Lakes, NJ, USA). 2.8. Target prediction and Luciferase reporter assay
2.6. Western blot assay Total protein samples were extracted from tissues or from cell lines using lysis buffer containing PMSF. The samples were mixed with loading buffer, denatured, and separated by electrophoresis in a 10% SDS-PAGE gel. They were then transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% nonfat milk for 2 h, and exposed to the appropriate primary antibodies (anti-ATF6 at 1:300, anti-GAPDH at 1:1000, Abcam, Cambridge, UK) for 12 h at 4 °C. After washing three times using TBST for 10 min each time, the membranes were incubated with the appropriate horseradish peroxidaseconjugated secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 1:8000 dilution for 2 h at 25 °C. Immunoreactive bands were visualized using a chemiluminescence solution. GAPDH was employed as an endogenous control. 2.7. Flow cytometry for cell apoptosis analysis Seventy-two hours after transfection, cells treated with or without ISO were stained with annexin V-FITC (Annexin V-FITC Apoptosis
Two microRNA target site prediction methods, TargetScanHuman software (Release 5.1) (Friedman et al., 2009) and RNAhybird software (Rehmsmeier et al., 2004), were used to predict mmu-miR-702 target candidates and putative binding sites in the 3′-untranslated region (3′-UTR) of genes. The fragments containing the putative target sites for mmu-miR-702 in the 3′-UTR of ATF6 or DDIT3 (also known as CHOP) were amplified using PCR with mouse cDNA as template. The primers used were shown in Table 2. The PCR products with MluI and HindIII restriction endonuclease cutting sites were inserted downstream of the luciferase gene in the pMIR-REPORT luciferase plasmid (Applied Biosystems). The constructs were verified by DNA sequencing. pMIR-ATF6-3′UTR plasmids containing correct constructs were named pMIR-ATF6-3′ UTR-1, pMIR-ATF6-3′UTR-2, pMIR-ATF6-3′UTR-3, and pMIR-ATF6-3′ UTR-4, and each contained one predicted binding site. The pMIRDDIT3-3′UTR plasmid contained two predicted binding sites. For luciferase assays, HEK293T cells were cultured in 35-mm dishes and transfected with pMIR-ATF6-3′UTR or pMIR-DDIT3-3′UTR, together with β-galactosidase control plasmids (Applied Biosystems) and RNA
238
W. Zhang et al. / Gene 531 (2013) 235–242
Fig. 2. ATF6 functions as a regulator in the process of apoptosis induced by ISO in mice. (A and B) Spliced XBP1 and total XBP1 mRNAs were examined by semiquantitative RT-PCR and agarose gel electrophoresis in mouse cardiac tissue after injection with ISO; GAPDH was employed as the internal control for normalization. *P b 0.05, **P b 0.01 vs. spliced XBP1 in control group. #P b 0.05 vs. total XBP1 in control group. (C) Relative expression level of CHOP mRNA in mouse cardiac tissue after injection with ISO was examined by real-time PCR. *P b 0.05, **P b 0.01 vs. control group. (D and E) Determination of relative ATF6 protein level in mouse cardiac tissue after injection with ISO. The band of GAPDH was employed as the internal control for normalization. *P b 0.05, **P b 0.01 vs. control group. (F) Relative expression level of GRP78 mRNA in mouse cardiac tissue after injection with ISO was examined by real-time PCR. **P b 0.01 vs. control group.
oligonucleotide (mmu-miR-702 mimics or negative control RNA, RiboBio, Guangzhou, China) using the Calcium Phosphate Cell Transfection Kit (Beyotime, Nanjing, China). The β-galactosidase reporter plasmid was designed for plasmid transfection normalization. Fortyeight hours after transfection, cells were lysed and luciferase activity was determined using a Luciferase Assay System (Promega, Fitchburg, WI, USA), while β-galactosidase activity was measured with the β-galactosidase Enzyme Assay System (Promega). 2.9. Statistical analysis Data are presented as means ± SD from at least three separate experiments. Statistical significance was determined using the ANOVA and Student's t-test, in which a P-value of b0.05 was considered significant. All statistical analyses were conducted using SPSS 11.0. 3. Results 3.1. ISO induces apoptosis in mouse cardiac tissues To examine the occurrence of apoptosis in mouse cardiac tissues damaged by ISO, morphology, zymology and molecular biological methods were performed. The ultrastructural organization of mouse cardiac tissues was examined by electron microscopy. At 6 h after the last injection with ISO, cardiomyocytes displayed slight expansion of the matrix network and loosely arranged local filaments. At 12 h after the last injection, compact chromatin was observed under the nuclear membrane, as well as increased perinuclear chromatin, slight shrinkage of nuclei, chromatin condensation, expansion of the rough ER, and local dissolution of focal myofilaments. At 24 h after the last injection, there were a clear expansion of the rough ER, expansion of the matrix network, local broken filaments filled with floc, chromatin condensation, nuclear condensation, the absence of the sarcomere band, dissolution of myofilament, and vacuolation of mitochondria (Fig. 1A).
Changes in the structure of the ER, compiled chromatin, and slight nuclear condensation indicate that apoptosis arose 12 h after treatment with ISO. The changes in the ER and mitochondria further indicate that apoptosis continued and intensified 24 h post-treatment (Fig. 1A). Caspase 3 is a common molecular biological hallmark of apoptosis (Maimaitiyiming et al., 2013; Vaughan et al., 2002). Both mRNA expression levels and relative activity of Caspase 3 were examined in cardiac tissues following ISO treatment. Caspase 3 mRNA was significantly upregulated at 24 h after treatment with ISO, compared with that of the control group (Fig. 1B; P b 0.01). The relative activity of Caspase 3 was also significantly increased at 12 h (P b 0.05) and 24 h (P b 0.01) after treatment with ISO compared with that of the control group (Fig. 1C). BCL2 and BAX are also important apoptosis-related hallmarks. The ratio of BAX to BCL2 is often used to evaluate tissue apoptosis (Maimaitiyiming et al., 2013; Quail et al., 2012; Teixeira et al., 2012). At 24 h after treatment with ISO, the ratio of BAX to BCL2 was significantly increased at the mRNA level, compared with that of the control group (Fig. 1D; P b 0.05). These data further indicate that ISO induced apoptosis in the tissues. 3.2. ATF6 may be a key regulator of ISO-induced apoptosis and the UPR Recent reports suggest that both the spliced variant of XBP1 and CHOP play important roles in the modulation of apoptotic signaling (Kurata et al., 2011; Logue et al., 2013; Oyadomari and Mori, 2004). Based on the observations from electron microscopy, detection of the spliced form of XBP1 was performed by semiquantitative RT-PCR and agarose gel electrophoresis. The results showed that the spliced form of XBP1 was generated after ISO stimulation at all time points. In contrast, both the spliced and unspliced forms of XBP1 mRNA were low in the control group (Figs. 2A and B). Similarly, the mRNA expression level of CHOP was remarkably up-regulated after treatment with ISO compared with that of the control group (Fig. 2C).
W. Zhang et al. / Gene 531 (2013) 235–242
239
Fig. 3. mmu-miR-702 was predicted to be the candidate miRNA that binds the 3′-UTR of ATF6, and its expression in mouse cardiac tissues after injection with ISO. (A) The location of mmumir-702 and rno-mir-702 in the Plod3 gene sequences (mouse Plod3 gene has two transcripts, one of them contain mmu-mir-702). (B) Predicted binding site of mmu-miR-702 in the 3′ UTR of ATF6 and DDIT3 mRNA by TargetScanHuman software (release 5.1) and RNAhybrid software. (C) Relative expression level of mmu-miR-702 in mouse cardiac tissues after injection with ISO was examined by real-time PCR. **P b 0.01 vs. control group.
Given that both XBP1 and CHOP mRNAs are regulated by ATF6 (Tsukano et al., 2010; Yao et al., 2013; Yoshida et al., 2001), we examined its protein expression level. The result showed that ATF6 was remarkably up-regulated after treatment with ISO, especially at 6 h after the last injection (Figs. 2D and E). GRP78, another important hallmark of UPR, lines with ATF6′s intra-ER domain, and is influenced by the expression level of ATF6 (Yao et al., 2013). As expected, the mRNA expression level of GRP78 was also up-regulated after treatment with ISO (Fig. 2F; P b 0.01). 3.3. mmu-miR-702 is down-regulated and regulates the expression of ATF6 in mice after ISO treatment Mouse miR-702 stem-loop (mmu-mir-702; miRBase accession: MI0004686) and rat miR-702 stem-loop (rno-mir-702; miRBase accession: MI0015464) constitute the mir-702 miRNA gene family (miRBase accession: MIPF0001163), both of them are microRNAs derived from the 13th intron of the Plod3 gene of mice or rat (Fig. 3A). Given that mmu-miR-702 was predicted to be the candidate miRNA that binds the 3′-UTR of ATF6 by TargetScanHuman software (release 5.1) and RNAhybrid software (Fig. 3B), its expression in mouse cardiac tissues was examined. The results displayed that mmu-miR-702 expression levels significantly decreased in left ventricle RNA extracts at 6 and 12 h after mice were treated with ISO (Fig. 3C; P b 0.01). We also examined the mmu-miR-702 RNA expression level as well as mRNA of Caspase 3, BAX and BCL2 in NIH 3T3 cells at different time points following treatment with ISO. The results showed that the expression level of mmu-miR-702 was significantly down-regulated
after ISO treatment (Fig. 4A; P b 0.01), while Caspase 3 was significantly up-regulated at 2 h (P b 0.01) and 24 h (P b 0.01) after ISO treatment (Fig. 4B). The increase in apoptosis was also verified by the elevated ratio of BAX to BCL2 (Fig. 4C). Moreover, assessment of the percentage of apoptotic cells by flow cytometry revealed that apoptotic cells significantly increased following treatment with ISO (Figs. 5A and B). These results indicate that a similar apoptosis to that observed in vivo also arose in NIH 3T3 cells after treatment with ISO, and that downregulation of mmu-miR-702 might be involved in this process. According to the prediction from databases, there are four candidate binding sites for mmu-miR-702 in the 3′-UTR of ATF6 (Fig. 3B). Luciferase analyses were performed to verify whether there was interaction between the candidate sites and mmu-miR-702. The results showed that mmu-miR-702 mimics remarkably repressed luciferase activity in HEK293T cells transfected with pMIR-ATF6-3′UTR-4 (corresponding to site 4; Fig. 3B), but not that of other recombinant plasmids (Fig. 4D; P b 0.01). To further confirm the mmu-miR-702-mediated inhibition of ATF6, we investigated ATF6 expression level after transfection with RNA oligonucleotide and ISO treatment in NIH 3T3 cells. As expected, ATF6 mRNA and protein expression levels were significantly upregulated in cells treated with ISO (Figs. 4E, F and G), while mmumiR-702 transfection significantly down-regulated ATF6 protein and mRNA expression levels in the cells treated with ISO compared with those transfected with the negative control RNA (Figs. 4E, F and G). In addition, GRP78 and CHOP, which are influenced by the expression level of ATF6, were also remarkably down-regulated following transfection with mmu-miR-702 (Fig. 4E). We next predicted the
240
W. Zhang et al. / Gene 531 (2013) 235–242
Fig. 4. mmu-miR-702 regulates the expression of ATF6 in cells. (A) Relative expression level of mmu-miR-702 in NIH 3T3 cells treated with ISO or transfection with RNA oligonucleotide. **P b 0.01 vs. control group; ##P b 0.01 vs. ISO group. (B and C) Relative expression level of Caspase 3 mRNA and the ratio of BAX to BCL2 in NIH 3T3 cells after treated with ISO. *P b 0.05, **P b 0.01 vs. control group. (D) Bar graph summarizing firefly luciferase activities in HEK293T cell normalized to β-galactosidase activities. pMIR-ATF6-3′UTR-1, pMIR-ATF6-3′UTR-2, pMIR-ATF6-3′UTR-3, pMIR-ATF6-3′UTR-4 and pMIR-DDIT3-3′UTR (contained two predicted sites for binding): cells were transfected with recombinant pMIR plasmid (the firefly luciferase reporter plasmid inserted with different fragments containing the putative target sites in the 3′ UTR of ATF6 or DDIT3). DDIT3: official symbol for CHOP. (E) Relative expression level of ATF6, CHOP and GRP78 mRNA in NIH 3T3 cells after treated with ISO and transfection with RNA oligonucleotide. *P b 0.05, **P b 0.01 vs. control group. #P b 0.05, ##P b 0.01 vs. ISO group. (F and G) Determination of relative ATF6 protein level in NIH 3T3 cells after treated with ISO and RNA oligonucleotide. The band of GAPDH was employed as the internal control for normalization. **P b 0.01 vs. control group; ##P b 0.01 vs. ISO group. miR-NC: negative control RNA.
possibility of whether mmu-miR-702 directly interacts with the 3′UTR of either GRP78 or CHOP using computer software. The TargetScan software and RNAhybrid software showed that CHOP might be a candidate target gene of mmu-miR-702 via two potential binding sites, although one site is close to an open reading frame (Fig. 3A). However, luciferase assay results showed no difference between the activity of cells expressing the sites after treatment with mmu-miR-702 mimics or negative control RNA (Fig. 4D). These data indicate that the aberrant expression of GRP78 and CHOP may be induced by the aberrant expression of ATF6 rather than mmu-miR-702, in accordance with previous research (Tsukano et al., 2010; Yao et al., 2013). 3.4. mmu-miR-702 acts as an anti-apoptotic microRNA in vitro Given that mmu-miR-702 was aberrantly expressed following ISO treatment and that it targets the apoptosis-related target gene ATF6,
we decided to examine whether mmu-miR-702 exhibited antiapoptotic functions in vitro. The expression level of mmu-miR-702 was significantly up-regulated after transfection with mmu-miR-702 mimics in NIH 3T3 cells (Fig. 4A; P b 0.01). As previously demonstrated, the mRNA expression level of Caspase 3 was up-regulated following treatment with ISO; however, this effect was significantly decreased by mmu-miR-702 transfection (Fig. 5C). A similar change was observed in the activity of Caspase 3 (Fig. 5D). Next, the percentage of apoptotic cells was assessed to further corroborate the anti-apoptotic functions of mmu-miR-702. The results showed that while the proportion of apoptotic cells significantly increased following ISO treatment, transfection with mmu-miR-702 remarkably decreased this number (Figs. 5A and B). The elevated ratio of BAX to BCL2 induced by ISO was also notably decreased after transfection with mmu-miR-702, indicating that apoptosis had been inhibited (Fig. 5E). Together, these results demonstrate that mmu-miR-702 significantly impairs ISO-induced apoptosis.
W. Zhang et al. / Gene 531 (2013) 235–242
241
Fig. 5. mmu-miR-702 inhibits cell apoptosis induced by ISO in vitro. (A and B) The population of annexin V+ apoptotic cells was evaluated by FCM using annexin V/PI staining after different treatments, after transfection with indicated RNA oligonucleotide and treated with ISO. The percentage of annexin V+ apoptotic cells increased after treated with ISO, while decreased after transfected with mmu-miR-702. **P b 0.01 vs. control group; ##P b 0.01 vs. ISO group. (C and D) Relative mRNA expression level and activity of Caspase 3 in NIH 3T3 cells were examined by real-time PCR after treated with ISO and RNA oligonucleotide. *P b 0.05, **P b 0.01 vs. control group. #P b 0.05 vs. ISO group. (E) The ratio of BAX to BCL2 in NIH 3T3 cells after treated with ISO and transfection with RNA oligonucleotide. **P b 0.01 vs. control group. ##P b 0.01 vs. ISO group. miR-NC: negative control RNA.
4. Discussion Apoptosis is an important pathological phenomenon in many diseases, such as cardiovascular disease. In the first stage of our study, we found a remarkable induction of apoptosis in ISO-treated mouse cardiomyocytes. In follow-up studies, aberrant expression of CHOP, GRP78 and the spliced variant of XBP1 was observed. Interestingly, all of these have close relations to ATF6 and ER (Tsukano et al., 2010; Yao et al., 2013; Yoshida et al., 2001). As a key sensor and hallmark of ER, ATF6 binds to ERSE and induces numerous genes at the transcriptional level, thus contributing to cell protection or damage (Galindo et al., 2012; Yao et al., 2013; Yoshida et al., 1998). Given that a subset of proteins regulated by ATF6 is apoptosis-related (Kurata et al., 2011; Oyadomari and Mori, 2004), and that all of these displayed an aberrant expression pattern in our ISO induction model, this suggests that ATF6 may function as a key regulator in the process of apoptosis induced by ISO. Indeed, although ATF6 had been primarily reported to function as a protective transcription factor in the process of ER stress, recent
studies have been focused on ATF6-mediated apoptosis (Galindo et al., 2012; Nakanishi et al., 2005; Yao et al., 2013). Previous research has suggested that microRNAs exert unique regulatory contributions in the process of apoptosis (Li, 2010). Although ATF6 has been reported to be a key sensor and hallmark of ER, few studies have focused on microRNAs that can interact with ATF6. Recently, miR-455 and some other microRNAs were reported to be downstream microRNAs of ATF6 (Belmont et al., 2012). However, until now, the microRNA that regulates the expression of ATF6 has not been reported. In our study, to explain the abnormal expression of ATF6 following ISO treatment, we used a computational approach and predicted that mmu-miR-702 is a candidate regulator of the protein. Although there were four candidate binding sites predicted by the database, in this study only one was identified as a positive binding site by luciferase assay. We also precluded the possibility that mmu-miR-702 influenced apoptosis through direct regulation of CHOP, although CHOP was also predicted as a target gene of mmu-miR-702 by software. Given that mmu-miR-702 mimics significantly repressed apoptosis induced by
242
W. Zhang et al. / Gene 531 (2013) 235–242
ISO in vitro, our study suggests that mmu-miR-702 uniformly functions as an anti-apoptotic microRNA in the process of ISO-induced apoptosis, independent of CHOP. Mirtrons derive from short hairpin introns (Okamura et al., 2008), a subset of miRNAs, and constitute 5–10% of miRNA genes in invertebrates and vertebrates (Glazov et al., 2008; Ruby et al., 2007). As a specific kind of miRNA, the processing of pri-miRNA into pre-miRNA in mirtrons is mediated by the “mirtron” pathway, which involves the action of splicing machinery and the lariat debranching enzyme rather than Drosha (Okamura et al., 2007; Westholm and Lai, 2011). Although mirtrons are expressed at much lower levels than typical canonical miRNAs, their regulatory influence has been gaining attention. mmu-miR-702, regarded as a mirtron, derives from the 13th intron of the Plod3 gene of mice. There are still limited details about the function of mmu-miR702 that have been reported, especially about the targeting mRNAs which are regulated by it. Our study corroborated the anti-apoptotic function of mmu-miR-702 in ISO-induced apoptosis and ATF6 is the targeting gene of mmu-miR-702 in this process. Although there are no reports about the existence of miR-702 in the human genome, other miRNAs that function similarly in place of mmu-miR-702 in humans couldn't be precluded. In summary, our results show that mmu-miR-702 functions as an anti-apoptotic mirtron in ISO-induced apoptosis, and this phenomenon may be mediated through ATF6 inhibition in mice. Conflict of interest There is no conflict of interest. The corresponding author of this article, Hui Li, is the holder of both the two projects. The study stated in this article was supported by the two foundations. Acknowledgments This study was supported by National Natural Science Foundation of China (No. 81172616 and No. 30771863). References Adachi, Y., Yamamoto, K., Okada, T., Yoshida, H., Harada, A., Mori, K., 2008. ATF6 is a transcription factor specializing in the regulation of quality control proteins in the endoplasmic reticulum. Cell Struct. Funct. 33, 75–89. Ambros, V., 2003. MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113, 673–676. Belmont, P.J., Chen, W.J., Thuerauf, D.J., Glembotski, C.C., 2012. Regulation of microRNA expression in the heart by the ATF6 branch of the ER stress response. J. Mol. Cell. Cardiol. 52, 1176–1182. Friedman, R.C., Farh, K.K., Burge, C.B., Bartel, D.P., 2009. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 19, 92–105. Galindo, I., Hernaez, B., Munoz-Moreno, R., Cuesta-Geijo, M.A., Dalmau-Mena, I., Alonso, C., 2012. The ATF6 branch of unfolded protein response and apoptosis are activated to promote African swine fever virus infection. Cell Death Dis. 3, e341. Glazov, E.A., Cottee, P.A., Barris, W.C., Moore, R.J., Dalrymple, B.P., Tizard, M.L., 2008. A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach. Genome Res. 18, 957–964. Haze, K., Yoshida, H., Yanagi, H., Yura, T., Mori, K., 1999. Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell. 10, 3787-99. Hsu, P.L., Su, B.C., Kuok, Q.Y., Mo, F.E., 2013. Extracellular matrix protein CCN1 regulates cardiomyocyte apoptosis in mice with stress-induced cardiac injury. Cardiovasc. Res. 98, 64–72.
Hudecova, S., Lencesova, L., Csaderova, L., Sedlak, J., Bohacova, V., Laukova, M., Krizanova, O., 2013. Isoproterenol accelerates apoptosis through the over-expression of the sodium/calcium exchanger in HeLa cells. Gen. Physiol. Biophys. 32, 311-23. Iwai-Kanai, E., Hasegawa, K., Araki, M., Kakita, T., Morimoto, T., Sasayama, S., 1999. Alphaand beta-adrenergic pathways differentially regulate cell type-specific apoptosis in rat cardiac myocytes. Circulation 100, 305–311. Jin, Y.T., et al., 2007. Magnesium attenuates isoproterenol-induced acute cardiac dysfunction and beta-adrenergic desensitization. Am. J. Physiol. Heart Circ. Physiol. 292, H1593–H1599. Kim, B.M., Choi, M.Y., 2012. Non-canonical microRNAs miR-320 and miR-702 promote proliferation in Dgcr8-deficient embryonic stem cells. Biochem. Biophys. Res. Commun. 426, 183–189. Kurata, M., et al., 2011. Anti-apoptotic function of Xbp1 as an IL-3 signaling molecule in hematopoietic cells. Cell Death Dis. 2, e118. Lai, E., Teodoro, T., Volchuk, A., 2007. Endoplasmic reticulum stress: signaling the unfolded protein response. Physiology (Bethesda) 22, 193–201. Lee, R.C., Ambros, V., 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862–864. Li, P., 2010. MicroRNAs in cardiac apoptosis. J. Cardiovasc. Transl. Res. 3, 219–224. Liao, X., Che, X., Zhao, W., Zhang, D., Bi, T., Wang, G., 2010. The beta-adrenoceptor antagonist, propranolol, induces human gastric cancer cell apoptosis and cell cycle arrest via inhibiting nuclear factor kappaB signaling. Oncol. Rep. 24, 1669–1676. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Logue, S.E., Cleary, P., Saveljeva, S., Samali, A., 2013. New directions in ER stress-induced cell death. Apoptosis 18, 537–546. Maimaitiyiming, H., Li, Y., Cui, W., Tong, X., Norman, H., Qi, X., Wang, S., 2013. Increasing cGMP-dependent protein kinase I activity attenuates cisplatin-induced kidney injury through protection of mitochondria function. Am. J. Physiol. Renal Physiol. 305, F88190. Mineno, J., et al., 2006. The expression profile of microRNAs in mouse embryos. Nucleic Acids Res. 34, 1765–1771. Nakanishi, K., Sudo, T., Morishima, N., 2005. Endoplasmic reticulum stress signaling transmitted by ATF6 mediates apoptosis during muscle development. J. Cell Biol. 169, 555–560. Okamura, K., Hagen, J.W., Duan, H., Tyler, D.M., Lai, E.C., 2007. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 130, 89–100. Okamura, K., Chung, W.J., Lai, E.C., 2008. The long and short of inverted repeat genes in animals: microRNAs, mirtrons and hairpin RNAs. Cell Cycle 7, 2840–2845. Oyadomari, S., Mori, M., 2004. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 11, 381–389. Quail, D.F., et al., 2012. Embryonic morphogen nodal promotes breast cancer growth and progression. PLoS One 7, e48237. Rehmsmeier, M., Steffen, P., Hochsmann, M., Giegerich, R., 2004. Fast and effective prediction of microRNA/target duplexes. RNA 10, 1507–1517. Ruby, J.G., Jan, C.H., Bartel, D.P., 2007. Intronic microRNA precursors that bypass Drosha processing. Nature 448, 83–86. Singh, K., Communal, C., Sawyer, D.B., Colucci, W.S., 2000. Adrenergic regulation of myocardial apoptosis. Cardiovasc. Res. 45, 713–719. Teixeira, M., et al., 2012. Cardiac antiapoptotic and proproliferative effect of recombinant human erythropoietin in a moderate stage of chronic renal failure in the rat. J. Pharm. Bioallied Sci. 4, 76–83. Tsukano, H., et al., 2010. The endoplasmic reticulum stress-C/EBP homologous protein pathway-mediated apoptosis in macrophages contributes to the instability of atherosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 30, 1925–1932. Vaughan, A.T., Betti, C.J., Villalobos, M.J., 2002. Surviving apoptosis. Apoptosis 7, 173–177. Westholm, J.O., Lai, E.C., 2011. Mirtrons: microRNA biogenesis via splicing. Biochimie 93, 1897–1904. Yao, S., et al., 2013. Activating transcription factor 6 mediates oxidized LDL-induced cholesterol accumulation and apoptosis in macrophages by up-regulating CHOP expression. J. Atheroscler. Thromb. 20, 94–107. Yoshida, H., Haze, K., Yanagi, H., Yura, T., Mori, K., 1998. Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors. J. Biol. Chem. 273, 33741–33749. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., Mori, K., 2001. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881–891. Zhuo, X.Z., et al., 2013. Isoproterenol instigates cardiomyocyte apoptosis and heart failure via AMPK inactivation-mediated endoplasmic reticulum stress. Apoptosis 18, 800–810.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
mmu-miR-702 functions as an anti-apoptotic mirtron by mediating ATF6 inhibition in mice Wei-guang Zhang a, Lin Chen b, Qin Dong a, Juan He a, Han-dong Zhao a, Feng-lan Li a, Hui Li a,⁎ a b
Department of Biochemistry and Molecular Biology, Basic Medical Science College, Harbin Medical University, Harbin 150081, China Department of Clinical Laboratory, Harbin Red-Cross Central Hospital, Harbin 150076, China
a r t i c l e
i n f o
Article history: Accepted 2 September 2013 Available online 10 September 2013 Keywords: Apoptosis MicroRNA miR-702 Isoproterenol Short hairpin introns
a b s t r a c t MicroRNAs (miRNAs) are a group of endogenous, small, noncoding RNAs that function as key posttranscriptional regulators. miRNAs are involved in many biological processes including apoptosis. In this study, mouse miR-702 (mmu-miR-702), a mirtron derived from the 13th intron of the Plod3 gene, was identified as a regulator of anti-apoptosis. mmu-miR-702 was down-regulated after treatment with the apoptosis-inducer isoproterenol both in vivo and in vitro. According to over-expression experiments, mmu-miR-702 inhibited apoptosis as well as the expression levels of a subset of apoptosis-related genes including activating transcription factor 6 (ATF6). An interaction between mmu-miR-702 and the ATF6 3′-UTR binding site was confirmed using luciferase reporter and western blot assays. This is the first report of ATF6 interaction with miRNA. Although the possible existence of miR-702 in the human genome is low, our results indicate that mirtrons also participate in the process of apoptosis and may provide a novel study strategy for apoptosis. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Cell apoptosis, the main form of programmed cell death, plays an important role in the progression of various diseases, including cardiovascular disease, degenerative disease, and tumorigenesis. Although there are abundant studies about the molecular mechanisms of apoptosis, controversies and unknowns still exist, especially in the early period of apoptosis. For cardiac myocytes, apoptosis is triggered by a loss of homeostasis, such as changes in physiological stresses and increased sympathetic activity (Logue et al., 2013; Vaughan et al., 2002). Various pathways and hallmarks are involved in the complex molecular mechanisms of apoptosis and stress, including activating transcription factor 6 (ATF6) (Galindo et al., 2012; Nakanishi et al., 2005; Yao et al., 2013). Activating transcription factor 6 (ATF6), a type II transmembrane protein embedded in the endoplasmic reticulum (ER), is a key stress sensor for initiation of the unfolded protein response (UPR) in ER stress (Haze et al., 1999; Lai et al., 2007). Under ER stress, ATF6 senses the accumulation of unfolded proteins in the ER through dissociation of the 78 kDa glucose-regulated protein (GRP78) from its lumenal domain. ATF6 then translocates from the ER to the Golgi where it is proteolytically processed from a 90 kDa protein to a 50 kDa protein to release its Abbreviations: mmu-miR-702, mouse microRNA-702; ATF6, activating transcription factor 6; ER, endoplasmic reticulum; UPR, unfolded protein response; GRP78, 78 kDa glucose-regulated protein; ERSE, endoplasmic reticulum stress response element; CHOP, C/EBP homologous protein; ISO, isoproterenol; XBP1, X-box binding protein 1; BCL2, Bcell CLL/lymphoma 2; BAX, BCL2-associated X protein; UTR, untranslated regions. ⁎ Corresponding author at: 194 Xuefu Road, Harbin 150081, China. Tel.: +86 451 86671684. E-mail address: [email protected] (H. Li). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.09.005
cytoplasmic domain. This truncated form enters the nucleus and binds the ER stress response element (ERSE) in target gene promoters and contributes to the reduction of misfolded protein levels (Adachi et al., 2008). The C/EBP homologous protein (CHOP; official symbol: DDIT3), which contains an ERSE in its promoter region, is an important target gene of ATF6. It also functions as a well-known transcription factor that mediates apoptosis (Tsukano et al., 2010; Yao et al., 2013). Although ATF6 is regarded as a protective protein in the ER stress response, its role in apoptosis has recently received increased attention (Galindo et al., 2012; Nakanishi et al., 2005; Yao et al., 2013). MicroRNAs (miRNAs) are a group of endogenous, small, noncoding RNAs that are found in eukaryotes. They function as key posttranscriptional regulators through base pairing to partially complementary sites, mainly in the untranslated region of mRNA (Ambros, 2003; Lee and Ambros, 2001). Mirtrons, a subset of miRNAs derived from short hairpin introns, also work by targeting mRNAs (Okamura et al., 2008; Westholm and Lai, 2011). Mouse miR-702 (mmu-mir-702; miRBase accession: MI0004686) derives from the 13th intron of the Plod3 gene of mice and belongs to mirtrons. mmu-mir-702 is not expressed in mouse oocyte, but it appears in 8-cell stage embryos and has a significantly up-regulation during embryogenesis in mouse heart (Mineno et al., 2006). Although mmu-miR-702 was reported to promote proliferation in Dgcr8-deficient embryonic stem cells in recent research (Kim and Choi, 2012), the function of it remains a mystery. As a microRNA, a classical molecular mechanism involves targeting mRNAs to inhibit their expression and subsequent biological roles. However, to this day, mmu-miR-702 has not been investigated in this respect. Stimulation of β-adrenergic receptors (β-AR) induces apoptosis in cardiac myocytes in vitro and in vivo (Iwai-Kanai et al., 1999; Singh
236
W. Zhang et al. / Gene 531 (2013) 235–242
et al., 2000). Given that three distinct β-AR subtypes exist in mammals, isoproterenol (ISO), as a traditional nonselective agonist of the β-AR, is more frequently used as an apoptosis inducer in many researches (Hsu et al., 2013; Jin et al., 2007; Zhuo et al., 2013). Moreover, ISO has been indicated as an apoptosis inducer not only in cardiac myocytes, but also in other cells (Hudecova et al., 2013; Liao et al., 2010). In our study, an ISO-induced apoptosis model was established in vivo and in vitro with the aim of determining a possible molecular regulatory mechanism of mmu-miR-702 in this process.
2. Materials and methods 2.1. Establishment of animal model Male C57Bl/6 mice were purchased from Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). All procedures were approved by the regulations and protocols of the ethics committee of the Harbin Medical University and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). The animals were kept with water and fed a standard laboratory diet for 1 week. Thereafter, mice were randomly divided into four groups (n = 6/group), including three treatment groups and one control group. For the treatment groups, ISO (Sigma, St. Louis, MO, USA), dissolved in 0.2 ml 0.9% NaCl, was injected (10 mg/kg) into the subcutaneous tissue twice 24 h apart. For the control group, an equal volume of saline was injected. The animals in the three treatment groups were sacrificed at 6, 12, and 24 h after the last injection, while the animals in the control group were sacrificed at 24 h after the last injection. The left ventricles of every animal were excised for experimental samples.
2.2. Examination by electron microscopy The left ventricles of mice were sliced into 1–3 mm cubes and fixed in 3% glutaraldehyde buffer overnight at 4 °C. Samples were processed by the Harbin Medical University Electron Microscopy Core facility. Sections were imaged on a Jeol 1200 EX TEM (Mitaka, Tokyo, Japan) at the indicated magnification.
Table 1 Amplification primers for PCR. Amplification Primer (5′-3′)
Product Annealing size temperature
mmu-miR702 U6 small nuclear RNA Bax
Forward: GAGTGCCCACCCTTTACC Reverse: CAGTGCGTGTCGTGGAGT Forward: GCTTCGGCAGCACATATACTAAAAT Reverse: CGCTTCACGAATTTGCGTGTCAT Forward: TTTGCTACAGGGTTTCATCCAG Reverse: TGTCCAGTTCATCTCCAATTCG Forward: CCTACGGATTGACATTCTCAGT Reverse: ACATAAGGCAACCACACCATC Forward: GCTGACTTCCTGTATGCTTACT Reverse: CGTTGCCACCTTCCTGTTAA Forward: GCTGGAAGCCTGGTATG Reverse: CTTTGGGATGTGCGTGT Forward: ACGCACTTGGAATGACC Reverse: TTCTTTCCCAAATACGC Forward: AGGGCATCTTGGGCTACAC Reverse: CATACCAGGAAATGAGCTTGA Forward: GAACCAGGAGTTAAGAACACG Reverse: AGGCAACAGTGTCAGAGTCC Forward: GAACCAGGAGTTAAGAACACG Reverse: AGGCAACAGTGTCAGAGTCC
64 bp
62 °C
89 bp
60 °C
140 bp
61 °C
168 bp
61 °C
165 bp
61 °C
183 bp
56 °C
192 bp
48 °C
132 bp
56 °C
179 bp
63 °C
205 bp
63 °C
Casp3 CHOP GRP78 GAPDH XBP1s XBP1u
Amplification primer (5′-3′) ATF6 site Forward: 1 CGACGCGTGCAACTCCAGGGGAAGAGGAA Reverse: CCCAAGCTTCAGAACCAACACCAGGCGACA ATF6 Forward: site CGACGCGTGGTCCCATTCCAGTAAGCACAA 2 Reverse: CCAAGCTTCCACAGCCACAGTCACATCCTC Forward: ATF6 CGACGCGTCCAGCCAGTGTCACAAAGCAA site 3 Reverse: CCAAGCTTTTCGGGCACTCTAAGCAAGCA Forward: ATF6 CGACGCGTATGGTGGATGGGGTATGTAG site 4 Reverse: CCCAAGCTTTATCCCTGGTTGACCCTTAA DDIT3 Forward: site CGACGCGTAGTGGGCATCACCTCCTGTC Reverse: CCCAAGCTTCAATGTACCGTCTATGTGCAAG
Product Annealing size temperature 155 bp
57 °C
423 bp
57 °C
504 bp
54 °C
180 bp
52 °C
170 bp
55 °C
2.3. Cell culture NIH 3T3 and HEK293T cell lines, obtained from the Chinese Academy of Sciences Shanghai Branch Cell Bank (Shanghai, China), were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 μg/ml streptomycin at 37 °C, 5% CO2. The NIH 3T3 cell line was transfected with mmumiR-702 mimics or negative control RNA (miR-NC) with Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. ISO treatment was performed with medium containing 10 μM ISO at 24 h after transfection. RNA and protein were harvested 48 h after transfection or after ISO treatment for 0.5, 1, 2, and 24 h. The efficiency of mmu-miR-702 transfection was determined by quantitative real-time PCR. HEK293T cells were used for luciferase assays. 2.4. Caspase 3 activity detection Caspase 3 activity in cardiac tissue extracts or NIH 3T3 cell proteins was detected by the Caspase 3 Activity Assay Kit (BestBio, Beijing, China), according to the manufacturer's protocol. The absorbance was measured at 405 nm, and the relative activity of Caspase 3 was determined. 2.5. RNA extraction and quantitative real-time PCR
Gene
Bcl2
Table 2 PCR amplification primers for obtaining the DNA insert fragment.
Total RNA samples were isolated from tissues or from cell lines using TRIzol (Invitrogen Life Technologies) and reverse transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions. The specific stem-loop primer designed for mmu-miR-702 reverse transcription was 5′-GTCGTATCCAGTGCGTGTCGTGGAGTCG GCAATTGCACTGGATACGACGAGCGG-3′. The primer designed for U6 small nuclear RNA reverse transcription was 5′-CGCTTCACGAAT TTGCGTGTCAT-3′. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) and the ABI 7500 Real-time PCR system (Applied Biosystems). Specific amplification primers were also designed for mmu-miR-702, U6 small nuclear RNA, BAX, BCL2, Caspase 3 (Casp3), CHOP, GRP78, and GAPDH (Table 1). U6 small nuclear RNA was used as a control for microRNA quantification, while GAPDH was employed as the endogenous control for other genes. PCR was performed according to the manufacturer's instructions. All assays, including those for the non-template control, were performed, at least, in triplicate. The relative expression levels were
W. Zhang et al. / Gene 531 (2013) 235–242
237
Fig. 1. Apoptosis arose in mouse cardiac tissues after injection with ISO. (A) Electron microscopy images of cardiomyocytes in mice after ISO treatment, compared with control group. (B) Relative expression level of Caspase 3 mRNA in mouse cardiac tissues was examined by real-time PCR after injection with ISO. GAPDH was used as an internal control. **P b 0.01 vs. control group. (C) Relative activity of Caspase 3 was examined in mouse cardiac tissues after injection with ISO. *P b 0.05, **P b 0.01 vs. control group. (D) The ratio of BAX to BCL2 mRNA expression levels in mouse cardiac tissues after injection with ISO. *P b 0.05 vs. control group.
then determined using the 2−ΔΔCt method (Livak and Schmittgen, 2001). For detection of the expression levels of spliced and unspliced forms of X-box binding protein 1 (XBP1) (XBP1s and XBP1u), semiquantitative PCR and agarose gel electrophoresis were performed using primers designed for the two XBP1 mRNA forms as described in Table 1.
Detection Kit, Abcam) and propidium iodide (PI) following the manufacturer's instructions. Apoptosis in cell samples was examined by double staining flow cytometry assays using FACSCanto Flow Cytometer and FACSDiva software (Becton Dickinson, Franklin Lakes, NJ, USA). 2.8. Target prediction and Luciferase reporter assay
2.6. Western blot assay Total protein samples were extracted from tissues or from cell lines using lysis buffer containing PMSF. The samples were mixed with loading buffer, denatured, and separated by electrophoresis in a 10% SDS-PAGE gel. They were then transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% nonfat milk for 2 h, and exposed to the appropriate primary antibodies (anti-ATF6 at 1:300, anti-GAPDH at 1:1000, Abcam, Cambridge, UK) for 12 h at 4 °C. After washing three times using TBST for 10 min each time, the membranes were incubated with the appropriate horseradish peroxidaseconjugated secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 1:8000 dilution for 2 h at 25 °C. Immunoreactive bands were visualized using a chemiluminescence solution. GAPDH was employed as an endogenous control. 2.7. Flow cytometry for cell apoptosis analysis Seventy-two hours after transfection, cells treated with or without ISO were stained with annexin V-FITC (Annexin V-FITC Apoptosis
Two microRNA target site prediction methods, TargetScanHuman software (Release 5.1) (Friedman et al., 2009) and RNAhybird software (Rehmsmeier et al., 2004), were used to predict mmu-miR-702 target candidates and putative binding sites in the 3′-untranslated region (3′-UTR) of genes. The fragments containing the putative target sites for mmu-miR-702 in the 3′-UTR of ATF6 or DDIT3 (also known as CHOP) were amplified using PCR with mouse cDNA as template. The primers used were shown in Table 2. The PCR products with MluI and HindIII restriction endonuclease cutting sites were inserted downstream of the luciferase gene in the pMIR-REPORT luciferase plasmid (Applied Biosystems). The constructs were verified by DNA sequencing. pMIR-ATF6-3′UTR plasmids containing correct constructs were named pMIR-ATF6-3′ UTR-1, pMIR-ATF6-3′UTR-2, pMIR-ATF6-3′UTR-3, and pMIR-ATF6-3′ UTR-4, and each contained one predicted binding site. The pMIRDDIT3-3′UTR plasmid contained two predicted binding sites. For luciferase assays, HEK293T cells were cultured in 35-mm dishes and transfected with pMIR-ATF6-3′UTR or pMIR-DDIT3-3′UTR, together with β-galactosidase control plasmids (Applied Biosystems) and RNA
238
W. Zhang et al. / Gene 531 (2013) 235–242
Fig. 2. ATF6 functions as a regulator in the process of apoptosis induced by ISO in mice. (A and B) Spliced XBP1 and total XBP1 mRNAs were examined by semiquantitative RT-PCR and agarose gel electrophoresis in mouse cardiac tissue after injection with ISO; GAPDH was employed as the internal control for normalization. *P b 0.05, **P b 0.01 vs. spliced XBP1 in control group. #P b 0.05 vs. total XBP1 in control group. (C) Relative expression level of CHOP mRNA in mouse cardiac tissue after injection with ISO was examined by real-time PCR. *P b 0.05, **P b 0.01 vs. control group. (D and E) Determination of relative ATF6 protein level in mouse cardiac tissue after injection with ISO. The band of GAPDH was employed as the internal control for normalization. *P b 0.05, **P b 0.01 vs. control group. (F) Relative expression level of GRP78 mRNA in mouse cardiac tissue after injection with ISO was examined by real-time PCR. **P b 0.01 vs. control group.
oligonucleotide (mmu-miR-702 mimics or negative control RNA, RiboBio, Guangzhou, China) using the Calcium Phosphate Cell Transfection Kit (Beyotime, Nanjing, China). The β-galactosidase reporter plasmid was designed for plasmid transfection normalization. Fortyeight hours after transfection, cells were lysed and luciferase activity was determined using a Luciferase Assay System (Promega, Fitchburg, WI, USA), while β-galactosidase activity was measured with the β-galactosidase Enzyme Assay System (Promega). 2.9. Statistical analysis Data are presented as means ± SD from at least three separate experiments. Statistical significance was determined using the ANOVA and Student's t-test, in which a P-value of b0.05 was considered significant. All statistical analyses were conducted using SPSS 11.0. 3. Results 3.1. ISO induces apoptosis in mouse cardiac tissues To examine the occurrence of apoptosis in mouse cardiac tissues damaged by ISO, morphology, zymology and molecular biological methods were performed. The ultrastructural organization of mouse cardiac tissues was examined by electron microscopy. At 6 h after the last injection with ISO, cardiomyocytes displayed slight expansion of the matrix network and loosely arranged local filaments. At 12 h after the last injection, compact chromatin was observed under the nuclear membrane, as well as increased perinuclear chromatin, slight shrinkage of nuclei, chromatin condensation, expansion of the rough ER, and local dissolution of focal myofilaments. At 24 h after the last injection, there were a clear expansion of the rough ER, expansion of the matrix network, local broken filaments filled with floc, chromatin condensation, nuclear condensation, the absence of the sarcomere band, dissolution of myofilament, and vacuolation of mitochondria (Fig. 1A).
Changes in the structure of the ER, compiled chromatin, and slight nuclear condensation indicate that apoptosis arose 12 h after treatment with ISO. The changes in the ER and mitochondria further indicate that apoptosis continued and intensified 24 h post-treatment (Fig. 1A). Caspase 3 is a common molecular biological hallmark of apoptosis (Maimaitiyiming et al., 2013; Vaughan et al., 2002). Both mRNA expression levels and relative activity of Caspase 3 were examined in cardiac tissues following ISO treatment. Caspase 3 mRNA was significantly upregulated at 24 h after treatment with ISO, compared with that of the control group (Fig. 1B; P b 0.01). The relative activity of Caspase 3 was also significantly increased at 12 h (P b 0.05) and 24 h (P b 0.01) after treatment with ISO compared with that of the control group (Fig. 1C). BCL2 and BAX are also important apoptosis-related hallmarks. The ratio of BAX to BCL2 is often used to evaluate tissue apoptosis (Maimaitiyiming et al., 2013; Quail et al., 2012; Teixeira et al., 2012). At 24 h after treatment with ISO, the ratio of BAX to BCL2 was significantly increased at the mRNA level, compared with that of the control group (Fig. 1D; P b 0.05). These data further indicate that ISO induced apoptosis in the tissues. 3.2. ATF6 may be a key regulator of ISO-induced apoptosis and the UPR Recent reports suggest that both the spliced variant of XBP1 and CHOP play important roles in the modulation of apoptotic signaling (Kurata et al., 2011; Logue et al., 2013; Oyadomari and Mori, 2004). Based on the observations from electron microscopy, detection of the spliced form of XBP1 was performed by semiquantitative RT-PCR and agarose gel electrophoresis. The results showed that the spliced form of XBP1 was generated after ISO stimulation at all time points. In contrast, both the spliced and unspliced forms of XBP1 mRNA were low in the control group (Figs. 2A and B). Similarly, the mRNA expression level of CHOP was remarkably up-regulated after treatment with ISO compared with that of the control group (Fig. 2C).
W. Zhang et al. / Gene 531 (2013) 235–242
239
Fig. 3. mmu-miR-702 was predicted to be the candidate miRNA that binds the 3′-UTR of ATF6, and its expression in mouse cardiac tissues after injection with ISO. (A) The location of mmumir-702 and rno-mir-702 in the Plod3 gene sequences (mouse Plod3 gene has two transcripts, one of them contain mmu-mir-702). (B) Predicted binding site of mmu-miR-702 in the 3′ UTR of ATF6 and DDIT3 mRNA by TargetScanHuman software (release 5.1) and RNAhybrid software. (C) Relative expression level of mmu-miR-702 in mouse cardiac tissues after injection with ISO was examined by real-time PCR. **P b 0.01 vs. control group.
Given that both XBP1 and CHOP mRNAs are regulated by ATF6 (Tsukano et al., 2010; Yao et al., 2013; Yoshida et al., 2001), we examined its protein expression level. The result showed that ATF6 was remarkably up-regulated after treatment with ISO, especially at 6 h after the last injection (Figs. 2D and E). GRP78, another important hallmark of UPR, lines with ATF6′s intra-ER domain, and is influenced by the expression level of ATF6 (Yao et al., 2013). As expected, the mRNA expression level of GRP78 was also up-regulated after treatment with ISO (Fig. 2F; P b 0.01). 3.3. mmu-miR-702 is down-regulated and regulates the expression of ATF6 in mice after ISO treatment Mouse miR-702 stem-loop (mmu-mir-702; miRBase accession: MI0004686) and rat miR-702 stem-loop (rno-mir-702; miRBase accession: MI0015464) constitute the mir-702 miRNA gene family (miRBase accession: MIPF0001163), both of them are microRNAs derived from the 13th intron of the Plod3 gene of mice or rat (Fig. 3A). Given that mmu-miR-702 was predicted to be the candidate miRNA that binds the 3′-UTR of ATF6 by TargetScanHuman software (release 5.1) and RNAhybrid software (Fig. 3B), its expression in mouse cardiac tissues was examined. The results displayed that mmu-miR-702 expression levels significantly decreased in left ventricle RNA extracts at 6 and 12 h after mice were treated with ISO (Fig. 3C; P b 0.01). We also examined the mmu-miR-702 RNA expression level as well as mRNA of Caspase 3, BAX and BCL2 in NIH 3T3 cells at different time points following treatment with ISO. The results showed that the expression level of mmu-miR-702 was significantly down-regulated
after ISO treatment (Fig. 4A; P b 0.01), while Caspase 3 was significantly up-regulated at 2 h (P b 0.01) and 24 h (P b 0.01) after ISO treatment (Fig. 4B). The increase in apoptosis was also verified by the elevated ratio of BAX to BCL2 (Fig. 4C). Moreover, assessment of the percentage of apoptotic cells by flow cytometry revealed that apoptotic cells significantly increased following treatment with ISO (Figs. 5A and B). These results indicate that a similar apoptosis to that observed in vivo also arose in NIH 3T3 cells after treatment with ISO, and that downregulation of mmu-miR-702 might be involved in this process. According to the prediction from databases, there are four candidate binding sites for mmu-miR-702 in the 3′-UTR of ATF6 (Fig. 3B). Luciferase analyses were performed to verify whether there was interaction between the candidate sites and mmu-miR-702. The results showed that mmu-miR-702 mimics remarkably repressed luciferase activity in HEK293T cells transfected with pMIR-ATF6-3′UTR-4 (corresponding to site 4; Fig. 3B), but not that of other recombinant plasmids (Fig. 4D; P b 0.01). To further confirm the mmu-miR-702-mediated inhibition of ATF6, we investigated ATF6 expression level after transfection with RNA oligonucleotide and ISO treatment in NIH 3T3 cells. As expected, ATF6 mRNA and protein expression levels were significantly upregulated in cells treated with ISO (Figs. 4E, F and G), while mmumiR-702 transfection significantly down-regulated ATF6 protein and mRNA expression levels in the cells treated with ISO compared with those transfected with the negative control RNA (Figs. 4E, F and G). In addition, GRP78 and CHOP, which are influenced by the expression level of ATF6, were also remarkably down-regulated following transfection with mmu-miR-702 (Fig. 4E). We next predicted the
240
W. Zhang et al. / Gene 531 (2013) 235–242
Fig. 4. mmu-miR-702 regulates the expression of ATF6 in cells. (A) Relative expression level of mmu-miR-702 in NIH 3T3 cells treated with ISO or transfection with RNA oligonucleotide. **P b 0.01 vs. control group; ##P b 0.01 vs. ISO group. (B and C) Relative expression level of Caspase 3 mRNA and the ratio of BAX to BCL2 in NIH 3T3 cells after treated with ISO. *P b 0.05, **P b 0.01 vs. control group. (D) Bar graph summarizing firefly luciferase activities in HEK293T cell normalized to β-galactosidase activities. pMIR-ATF6-3′UTR-1, pMIR-ATF6-3′UTR-2, pMIR-ATF6-3′UTR-3, pMIR-ATF6-3′UTR-4 and pMIR-DDIT3-3′UTR (contained two predicted sites for binding): cells were transfected with recombinant pMIR plasmid (the firefly luciferase reporter plasmid inserted with different fragments containing the putative target sites in the 3′ UTR of ATF6 or DDIT3). DDIT3: official symbol for CHOP. (E) Relative expression level of ATF6, CHOP and GRP78 mRNA in NIH 3T3 cells after treated with ISO and transfection with RNA oligonucleotide. *P b 0.05, **P b 0.01 vs. control group. #P b 0.05, ##P b 0.01 vs. ISO group. (F and G) Determination of relative ATF6 protein level in NIH 3T3 cells after treated with ISO and RNA oligonucleotide. The band of GAPDH was employed as the internal control for normalization. **P b 0.01 vs. control group; ##P b 0.01 vs. ISO group. miR-NC: negative control RNA.
possibility of whether mmu-miR-702 directly interacts with the 3′UTR of either GRP78 or CHOP using computer software. The TargetScan software and RNAhybrid software showed that CHOP might be a candidate target gene of mmu-miR-702 via two potential binding sites, although one site is close to an open reading frame (Fig. 3A). However, luciferase assay results showed no difference between the activity of cells expressing the sites after treatment with mmu-miR-702 mimics or negative control RNA (Fig. 4D). These data indicate that the aberrant expression of GRP78 and CHOP may be induced by the aberrant expression of ATF6 rather than mmu-miR-702, in accordance with previous research (Tsukano et al., 2010; Yao et al., 2013). 3.4. mmu-miR-702 acts as an anti-apoptotic microRNA in vitro Given that mmu-miR-702 was aberrantly expressed following ISO treatment and that it targets the apoptosis-related target gene ATF6,
we decided to examine whether mmu-miR-702 exhibited antiapoptotic functions in vitro. The expression level of mmu-miR-702 was significantly up-regulated after transfection with mmu-miR-702 mimics in NIH 3T3 cells (Fig. 4A; P b 0.01). As previously demonstrated, the mRNA expression level of Caspase 3 was up-regulated following treatment with ISO; however, this effect was significantly decreased by mmu-miR-702 transfection (Fig. 5C). A similar change was observed in the activity of Caspase 3 (Fig. 5D). Next, the percentage of apoptotic cells was assessed to further corroborate the anti-apoptotic functions of mmu-miR-702. The results showed that while the proportion of apoptotic cells significantly increased following ISO treatment, transfection with mmu-miR-702 remarkably decreased this number (Figs. 5A and B). The elevated ratio of BAX to BCL2 induced by ISO was also notably decreased after transfection with mmu-miR-702, indicating that apoptosis had been inhibited (Fig. 5E). Together, these results demonstrate that mmu-miR-702 significantly impairs ISO-induced apoptosis.
W. Zhang et al. / Gene 531 (2013) 235–242
241
Fig. 5. mmu-miR-702 inhibits cell apoptosis induced by ISO in vitro. (A and B) The population of annexin V+ apoptotic cells was evaluated by FCM using annexin V/PI staining after different treatments, after transfection with indicated RNA oligonucleotide and treated with ISO. The percentage of annexin V+ apoptotic cells increased after treated with ISO, while decreased after transfected with mmu-miR-702. **P b 0.01 vs. control group; ##P b 0.01 vs. ISO group. (C and D) Relative mRNA expression level and activity of Caspase 3 in NIH 3T3 cells were examined by real-time PCR after treated with ISO and RNA oligonucleotide. *P b 0.05, **P b 0.01 vs. control group. #P b 0.05 vs. ISO group. (E) The ratio of BAX to BCL2 in NIH 3T3 cells after treated with ISO and transfection with RNA oligonucleotide. **P b 0.01 vs. control group. ##P b 0.01 vs. ISO group. miR-NC: negative control RNA.
4. Discussion Apoptosis is an important pathological phenomenon in many diseases, such as cardiovascular disease. In the first stage of our study, we found a remarkable induction of apoptosis in ISO-treated mouse cardiomyocytes. In follow-up studies, aberrant expression of CHOP, GRP78 and the spliced variant of XBP1 was observed. Interestingly, all of these have close relations to ATF6 and ER (Tsukano et al., 2010; Yao et al., 2013; Yoshida et al., 2001). As a key sensor and hallmark of ER, ATF6 binds to ERSE and induces numerous genes at the transcriptional level, thus contributing to cell protection or damage (Galindo et al., 2012; Yao et al., 2013; Yoshida et al., 1998). Given that a subset of proteins regulated by ATF6 is apoptosis-related (Kurata et al., 2011; Oyadomari and Mori, 2004), and that all of these displayed an aberrant expression pattern in our ISO induction model, this suggests that ATF6 may function as a key regulator in the process of apoptosis induced by ISO. Indeed, although ATF6 had been primarily reported to function as a protective transcription factor in the process of ER stress, recent
studies have been focused on ATF6-mediated apoptosis (Galindo et al., 2012; Nakanishi et al., 2005; Yao et al., 2013). Previous research has suggested that microRNAs exert unique regulatory contributions in the process of apoptosis (Li, 2010). Although ATF6 has been reported to be a key sensor and hallmark of ER, few studies have focused on microRNAs that can interact with ATF6. Recently, miR-455 and some other microRNAs were reported to be downstream microRNAs of ATF6 (Belmont et al., 2012). However, until now, the microRNA that regulates the expression of ATF6 has not been reported. In our study, to explain the abnormal expression of ATF6 following ISO treatment, we used a computational approach and predicted that mmu-miR-702 is a candidate regulator of the protein. Although there were four candidate binding sites predicted by the database, in this study only one was identified as a positive binding site by luciferase assay. We also precluded the possibility that mmu-miR-702 influenced apoptosis through direct regulation of CHOP, although CHOP was also predicted as a target gene of mmu-miR-702 by software. Given that mmu-miR-702 mimics significantly repressed apoptosis induced by
242
W. Zhang et al. / Gene 531 (2013) 235–242
ISO in vitro, our study suggests that mmu-miR-702 uniformly functions as an anti-apoptotic microRNA in the process of ISO-induced apoptosis, independent of CHOP. Mirtrons derive from short hairpin introns (Okamura et al., 2008), a subset of miRNAs, and constitute 5–10% of miRNA genes in invertebrates and vertebrates (Glazov et al., 2008; Ruby et al., 2007). As a specific kind of miRNA, the processing of pri-miRNA into pre-miRNA in mirtrons is mediated by the “mirtron” pathway, which involves the action of splicing machinery and the lariat debranching enzyme rather than Drosha (Okamura et al., 2007; Westholm and Lai, 2011). Although mirtrons are expressed at much lower levels than typical canonical miRNAs, their regulatory influence has been gaining attention. mmu-miR-702, regarded as a mirtron, derives from the 13th intron of the Plod3 gene of mice. There are still limited details about the function of mmu-miR702 that have been reported, especially about the targeting mRNAs which are regulated by it. Our study corroborated the anti-apoptotic function of mmu-miR-702 in ISO-induced apoptosis and ATF6 is the targeting gene of mmu-miR-702 in this process. Although there are no reports about the existence of miR-702 in the human genome, other miRNAs that function similarly in place of mmu-miR-702 in humans couldn't be precluded. In summary, our results show that mmu-miR-702 functions as an anti-apoptotic mirtron in ISO-induced apoptosis, and this phenomenon may be mediated through ATF6 inhibition in mice. Conflict of interest There is no conflict of interest. The corresponding author of this article, Hui Li, is the holder of both the two projects. The study stated in this article was supported by the two foundations. Acknowledgments This study was supported by National Natural Science Foundation of China (No. 81172616 and No. 30771863). References Adachi, Y., Yamamoto, K., Okada, T., Yoshida, H., Harada, A., Mori, K., 2008. ATF6 is a transcription factor specializing in the regulation of quality control proteins in the endoplasmic reticulum. Cell Struct. Funct. 33, 75–89. Ambros, V., 2003. MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113, 673–676. Belmont, P.J., Chen, W.J., Thuerauf, D.J., Glembotski, C.C., 2012. Regulation of microRNA expression in the heart by the ATF6 branch of the ER stress response. J. Mol. Cell. Cardiol. 52, 1176–1182. Friedman, R.C., Farh, K.K., Burge, C.B., Bartel, D.P., 2009. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 19, 92–105. Galindo, I., Hernaez, B., Munoz-Moreno, R., Cuesta-Geijo, M.A., Dalmau-Mena, I., Alonso, C., 2012. The ATF6 branch of unfolded protein response and apoptosis are activated to promote African swine fever virus infection. Cell Death Dis. 3, e341. Glazov, E.A., Cottee, P.A., Barris, W.C., Moore, R.J., Dalrymple, B.P., Tizard, M.L., 2008. A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach. Genome Res. 18, 957–964. Haze, K., Yoshida, H., Yanagi, H., Yura, T., Mori, K., 1999. Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell. 10, 3787-99. Hsu, P.L., Su, B.C., Kuok, Q.Y., Mo, F.E., 2013. Extracellular matrix protein CCN1 regulates cardiomyocyte apoptosis in mice with stress-induced cardiac injury. Cardiovasc. Res. 98, 64–72.
Hudecova, S., Lencesova, L., Csaderova, L., Sedlak, J., Bohacova, V., Laukova, M., Krizanova, O., 2013. Isoproterenol accelerates apoptosis through the over-expression of the sodium/calcium exchanger in HeLa cells. Gen. Physiol. Biophys. 32, 311-23. Iwai-Kanai, E., Hasegawa, K., Araki, M., Kakita, T., Morimoto, T., Sasayama, S., 1999. Alphaand beta-adrenergic pathways differentially regulate cell type-specific apoptosis in rat cardiac myocytes. Circulation 100, 305–311. Jin, Y.T., et al., 2007. Magnesium attenuates isoproterenol-induced acute cardiac dysfunction and beta-adrenergic desensitization. Am. J. Physiol. Heart Circ. Physiol. 292, H1593–H1599. Kim, B.M., Choi, M.Y., 2012. Non-canonical microRNAs miR-320 and miR-702 promote proliferation in Dgcr8-deficient embryonic stem cells. Biochem. Biophys. Res. Commun. 426, 183–189. Kurata, M., et al., 2011. Anti-apoptotic function of Xbp1 as an IL-3 signaling molecule in hematopoietic cells. Cell Death Dis. 2, e118. Lai, E., Teodoro, T., Volchuk, A., 2007. Endoplasmic reticulum stress: signaling the unfolded protein response. Physiology (Bethesda) 22, 193–201. Lee, R.C., Ambros, V., 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862–864. Li, P., 2010. MicroRNAs in cardiac apoptosis. J. Cardiovasc. Transl. Res. 3, 219–224. Liao, X., Che, X., Zhao, W., Zhang, D., Bi, T., Wang, G., 2010. The beta-adrenoceptor antagonist, propranolol, induces human gastric cancer cell apoptosis and cell cycle arrest via inhibiting nuclear factor kappaB signaling. Oncol. Rep. 24, 1669–1676. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Logue, S.E., Cleary, P., Saveljeva, S., Samali, A., 2013. New directions in ER stress-induced cell death. Apoptosis 18, 537–546. Maimaitiyiming, H., Li, Y., Cui, W., Tong, X., Norman, H., Qi, X., Wang, S., 2013. Increasing cGMP-dependent protein kinase I activity attenuates cisplatin-induced kidney injury through protection of mitochondria function. Am. J. Physiol. Renal Physiol. 305, F88190. Mineno, J., et al., 2006. The expression profile of microRNAs in mouse embryos. Nucleic Acids Res. 34, 1765–1771. Nakanishi, K., Sudo, T., Morishima, N., 2005. Endoplasmic reticulum stress signaling transmitted by ATF6 mediates apoptosis during muscle development. J. Cell Biol. 169, 555–560. Okamura, K., Hagen, J.W., Duan, H., Tyler, D.M., Lai, E.C., 2007. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 130, 89–100. Okamura, K., Chung, W.J., Lai, E.C., 2008. The long and short of inverted repeat genes in animals: microRNAs, mirtrons and hairpin RNAs. Cell Cycle 7, 2840–2845. Oyadomari, S., Mori, M., 2004. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 11, 381–389. Quail, D.F., et al., 2012. Embryonic morphogen nodal promotes breast cancer growth and progression. PLoS One 7, e48237. Rehmsmeier, M., Steffen, P., Hochsmann, M., Giegerich, R., 2004. Fast and effective prediction of microRNA/target duplexes. RNA 10, 1507–1517. Ruby, J.G., Jan, C.H., Bartel, D.P., 2007. Intronic microRNA precursors that bypass Drosha processing. Nature 448, 83–86. Singh, K., Communal, C., Sawyer, D.B., Colucci, W.S., 2000. Adrenergic regulation of myocardial apoptosis. Cardiovasc. Res. 45, 713–719. Teixeira, M., et al., 2012. Cardiac antiapoptotic and proproliferative effect of recombinant human erythropoietin in a moderate stage of chronic renal failure in the rat. J. Pharm. Bioallied Sci. 4, 76–83. Tsukano, H., et al., 2010. The endoplasmic reticulum stress-C/EBP homologous protein pathway-mediated apoptosis in macrophages contributes to the instability of atherosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 30, 1925–1932. Vaughan, A.T., Betti, C.J., Villalobos, M.J., 2002. Surviving apoptosis. Apoptosis 7, 173–177. Westholm, J.O., Lai, E.C., 2011. Mirtrons: microRNA biogenesis via splicing. Biochimie 93, 1897–1904. Yao, S., et al., 2013. Activating transcription factor 6 mediates oxidized LDL-induced cholesterol accumulation and apoptosis in macrophages by up-regulating CHOP expression. J. Atheroscler. Thromb. 20, 94–107. Yoshida, H., Haze, K., Yanagi, H., Yura, T., Mori, K., 1998. Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors. J. Biol. Chem. 273, 33741–33749. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., Mori, K., 2001. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881–891. Zhuo, X.Z., et al., 2013. Isoproterenol instigates cardiomyocyte apoptosis and heart failure via AMPK inactivation-mediated endoplasmic reticulum stress. Apoptosis 18, 800–810.