Moderate overexpression of AIB1 triggers pre-neoplastic changes in mammary epithelium

FEBS Letters 580 (2006) 5222–5226

Moderate overexpression of AIB1 triggers pre-neoplastic changes in mammary epithelium ´ lvaro Avivara, Marı´a Carmen Garcı´a-Maciasc, Emma Ascasoa, Guadalupe Herrerab, A Jose´-Enrique O’Connorb, Jaime Font de Moraa,* a

Laboratory of Cellular and Molecular Biology, Centro de Investigacion Principe Felipe (CIPF), Autopista del Saler, 16, 46013 Valencia, Spain b Laboratory of Cytomics, Mixed Unit CIPF-UVEG, Autopista del Saler, 16, 46013 Valencia, Spain c Department of Pathology, University Hospital of Salamanca, 47007 Salamanca, Spain Received 15 June 2006; revised 16 August 2006; accepted 24 August 2006 Available online 5 September 2006 Edited by Veli-Pekka Lehto

Abstract Here we report a new model of pre-clinical breast cancer which has been generated by overexpressing the steroid receptor coactivator AIB1 at moderate levels in breast epithelium. Transgenic female mice display mammary hyperplasia at the onset of puberty, consistent with enhanced proliferation of primary mammary epithelial cultures and augmented levels of cyclin D1 and E-cadherin. Studies of BrdU incorporation revealed that AIB1 localizes to the nucleus during or after S phase, implicating a new role for AIB1 in cell-cycle progression subsequent to G1. Our findings suggest that moderate overexpression of AIB1 may represent one of the pre-neoplastic changes in breast tissue.  2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: AIB1; Mammary hyperplasia; Nuclear transport; E-cadherin

Several mechanisms have been postulated to explain the role(s) of AIB1 breast cancer. Consistent with data from knock-out mice [16], we have observed that transgenic mice overexpressing AIB1 display increased levels of IGF-I, thereby augmenting the IGF-I signaling pathways [14]. However, the function of AIB1 in IGF-I-mediated signaling, proliferation and cell survival in human breast cancer cells is independent of its role in estrogen receptor signaling [17]. Other studies have demonstrated a more direct role in cell-cycle machinery; AIB1 is an important factor in regulating the activated promotor of cyclin D1 [18] and furthermore, promotes cell-cycle progression and cell survival by coactivating the transcriptional factors E2F1 and ER81 [19,20]. E2F1 is a key regulator of the cell cycle that mediates G1 progression; AIB1 can function as a coactivator by stimulating the transcription of a subset of E2F-responsive genes that are associated with the G1/S transition.

2. Materials and methods 1. Introduction Tumor progression is a multi-step process by which gain of chromosome instabilities and modifications drive the positive selection of the cancerous cells. To study this process of tumor development, a broad variety of animal models have been developed harboring modified oncogenes and tumor suppressor genes. It is believed that these original modifications are responsible for chromosome instability and thus, favor the new genetic changes that define cancer progression. AIB1 (SRC-3/p/CIP/ACTR/RAC3/TRAM-1) [1–6] is a nuclear receptor coactivator that is overexpressed in several types of cancers including breast and ovarian cancer [1,7], prostate [8], gastric [9], pancreas [10,11] and liver [12]. In human breast cancer cell lines such as MCF-7 AIB1 is a major coactivator for the estrogen receptor (ER) [13]. We have recently shown that overexpression of the esteroid receptor coactivator AIB1 in the murine mammary gland results in the development of adenocarcinomas of different subtypes [14]. In contrast, AIB1 ablation impairs mammary tumorogenesis [15] indicating that AIB1 is an oncogene.

*

Corresponding author. Fax: +34 96 328 9701. E-mail address: [email protected] (J.F. de Mora).

2.1. Generation of mice Transgenic mice were generated as previously described [14] on a C57/Bl6 genetic background. Integration of the transgene into the genome of the offspring was assessed by Southern blot and PCR analysis of genomic DNA from tail biopsies using the following primers 5 0 GGCCCCGGCCCCCAAGCTTG3 0 and 5 0 CGTGAATCACTGGCCAGTGGATCC3 0 . 2.2. Real-time PCR Isolated RNA (TRIzol, Invitrogen) from tissues was digested with DNAse followed by purification through QIAGEN columns (RNeasy kit). Subsequently, the RT reaction (Superscript, Invitrogen) was done with 0.5 lg of total RNA and oligo (dT). Real Time-PCR was performed with 10 ng cDNA using the oligos: 5 0 GGCCAGTGATTCACGAAAACG3 0 and 5 0 ACTTTCCTGCTCCCGTCTCC3 0 for AIB1; 5 0 CAAATGCTGGACCAAACACAA3 0 and 5 0 GCCATCCAGCCACTCAGTCT3 0 for cyclophilin; 5 0 GCTCCCGTCTCCGTTTTTCT3’ and 5’ATTTGCTGAACAGTGGACTCC3’ for p/CIP. 2.3. In vivo BrdU labeling Four hours before sacrifice, WT and AIB1-tg mice at 10 weeks of age were injected with 100 lg/g of body weight of BrdU (Sigma). Tissues were fixed for 6 h in 10% neutralized buffered formalin and embedded in paraffin by standard procedures. Sections of 5 lm thickness were processed for immunohistochemistry analysis following antigen retrieval. 2.4. Antibodies Cross-sections were stained with Rat anti-BrdU antibody (Accurate Chemical & Scientific Corp.) and counterstained with hematoxylin.

0014-5793/$32.00  2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.08.057

A´. Avivar et al. / FEBS Letters 580 (2006) 5222–5226 Polyclonal anti-AIB1 that detects both human AIB1 and endogenous p/CIP was generated in our laboratory. Monoclonal anti-AIB1 that recognizes primarily human AIB1, anti-E-Cadherin (1:1000; BD Transduction Laboratories). Monoclonal b-tubulin (D-10), monoclonal cyclin D1 (72-13G) and goat polyclonal CK14 (Santa Cruz). 2.5. Primary cultures and small interfering RNA (siRNA) Mammary glands from 12-week-old virgin females were collected from sacrificed animals, carefully minced in DMEM/F12 media without serum and digested with 2 mg/ml Collagenase A (Boehringer– Mannheim) for 30 min at 37 C. Digested tissue was washed once and resuspended in DMEM/F12 media supplemented with 10% FBS, 5 lg/ml insulin, 10 lg/ml hydrocortisone, 10 ng/ml murine EGF and 5 lg/ml linoleic acid. Mammary epithelial cells were grown in incubators at 37 C with 5% CO2. Duplex siRNA oligonucleotides (100 nM) targeting siAIB1 mRNA 5 0 AGACUCCUUAGGACCGCUUdTdT3 0 (Ambion) was transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Cells were harvested 48 h post-transfection. Cells were lysed in ice-cold RIPA buffer including protease inhibitor cocktail (Roche). Lysates were centrifuged at 14 000 rpm for 15 min 50 lg of protein was separated on SDS–PAGE gel and transferred to nylon membranes. 2.6. Laser Scanning Cytometry (LSC) Primary cells were seeded in chamber slides. Media were replaced next day and cultures were incubated for another 24 h. Cells were washed with PBS and fixed with 70% ethanol for 30 min at 4 C. Cells were then washed three times with PBS and incubated for 30 min with a solution of PBS containing 0.1 mg/ml RNAse A, 50 lg/ml propidium iodide and 0.1% Triton X-100. Cells were covered with Dako fluorescent mounting media containing 50 lg/ml of propidium iodide and fluorescence was determined in a CompuCyte Laser Scanning Cytometer.

3. Results and discussion Genetically modified animals constitute powerful tools for in vivo studies of human pathologies and drug development. To better understand the contribution of AIB1 in mammary gland development and in breast cancer, we have analyzed the cellular and biochemical consequences of overexpressing

5223

low levels of AIB1 in the mouse breast epithelium. In contrast to previous reported lines where transgenic mice consistently expressed high levels of AIB1 plus p/CIP expression as compared with WT animals (7.6 fold increase) [14], here we study a transgenic line with only a 2.5 ± 0.3 fold increase (P = 0.01 in a paired t-test) in recombinant AIB1 expression. Similar to this previous report, AIB1 and endogenous p/CIP mRNA levels were determined in mammary glands of tg animals at 10 weeks of age using real-time PCR and primers specific for p/CIP or AIB1. Results were normalized with cyclophilin and averaged for four different experiments. A total of 28 AIB1-tg and 22 WT females were maintained for at least two years to study the development of tumors. No differences were observed between these two experimental groups, indicating that low levels of AIB1 overexpression are not sufficient to trigger the full development of tumors. However, ductal outgrowth was consistently increased in AIB1-tg mice. Beginning with the early stages of puberty (4-weeksold, Fig. 1A), AIB1-tg epithelium exhibited extensive ductal branching with prominent terminal end buds (TEBs). In contrast to WT control females, ductal outgrowth extended further than the lymph node in all AIB1-tg mice and TEBs displayed an increase in number as well as size (compare magnified panels on the right of Fig. 1). These characteristics of the AIB1-tg epithelium also persisted in fully mature mammary glands (Fig. 1B); at 12 weeks of age, mammary epithelium in AIB1-tg also exhibited increased fat pad occupancy as well as secondary branching. Following this pattern of development, nursing AIB1-tg mammary glands displayed higher occupancy of the fat pad (Fig. 1C). These results demonstrate that even small increases in AIB1 expression may significantly augment lateral branching and TEBs during development and increase epithelial content of the fat pad at maturity. We further quantified the percentage of filled fat pad during adulthood. Consistent with the morphology, AIB1-tg displayed a 25% increase in the area occupied by the fat pad (Fig. 2A). This increased occupancy of the fat pad correlated

Fig. 1. Mammary hyperplasia in AIB1 transgenic mice. Whole mount staining of transgenic and wildtype mammary glands of littermates at different stages of development: (A) 4-week-old virgins, n = 6 WT and 6 AIB1-tg; (B) 12-week-old virgins, n = 6 WT and 6 AIB1-tg; (C) lactating mothers, n = 3 WT controls and 3 AIB1-tg. Right panels represent a magnification of the framed area in the whole mammary gland. Mammary glands were dissected, mounted on glass slides, and stained as described at http://mammary.nih.gov/tools/histological/Histology/index.html.

5224

A´. Avivar et al. / FEBS Letters 580 (2006) 5222–5226

Fig. 2. Increased fat pad occupancy and cell proliferation in AIB1-tg. (A) Percentage of filled fat pad (PFPF) was measured in three 10-week-old WT and three AIB1-tg littermates by the ductal system of outgrowth. PFPF was estimated by measuring the distance the ductal outgrowth extended across the fat pad divided by the length of the fat pad. *P = 0.02. (B) BrdU incorporation was measured by counting positive nuclei in mammary gland tissue sections. DAPI-stained nuclei were scored as a reference for total cell number. The number of BrdU-positive cells in WT and AIB1-tg samples was counted in 10 fields per slide, under 20· magnification. Final results represent the average of 3 independent experiments, representing a total of 9 WT controls and 9 AIB1-tg. **P = 0.04.

with a higher BrdU incorporation (Fig. 2B), indicating that AIB1-tg epithelial cells have an increased proliferation rate, thereby providing an explanation for the greater occupancy of the fat pad. These observations suggest a role for AIB1 in pre-tumoral lesions and demonstrate that sub-clinical levels of AIB1 overexpression in mammary epithelial cells produces hyperplasia and indicates that additional genetic/epigenetic modifications are subsequently required to trigger and develop breast tumors. Interestingly, staining with antibodies which detect both AIB1 and p/CIP revealed that incorporation of BrdU correlated strongly with nuclear localization of AIB1 (Fig. 3). This observation was similar in both transgenic and control animals (compare upper panels versus lower panels), although both nuclear localization and proliferation were more frequent in AIB1-tg (Figs. 2B and 3B). This correlation between proliferation and nuclear staining for AIB1 was independent of the status of mammary gland development as we observed this relationship in females of puberty, adulthood and lactation (Fig. 3A). Since BrdU incorporation occurs during S-phase of the cell cycle, these studies suggest that nuclear import of AIB1 is a general mechanism that occurs predominantly during or after S-phase. Consistent with this notion, non-proliferative cells contained lower levels of AIB1 which were restricted to the cytoplasm (Fig. 3). However, AIB1 expression potently increased in proliferative cells, consistent with a recent report [20] demonstrating a feedback loop whereby AIB1 levels are elevated at G1/S phase through coactivation of E2F1. Hence, our data reveal a novel function for AIB1 during or after S-phase, in addition to its role during G1 progression where it coactivates E2F [21] and favors cyclin D1 transcription [18]. To further study the molecular characteristics of AIB1-tg cells, we isolated and cultured breast epithelium for no more than two passages. We first confirmed the growth characteristics of AIB1-tg cells by Laser Scanning Cytometry (LSC). As expected, AIB1-tg primary cultures displayed a significant

reduction in the percentage of cells in G0/G1 and a corresponding increase in the G2/M population, thereby supporting the mammary hyperplasia observed in vivo (Fig. 4A). Similar to previous reports [14], Western blot analysis from primary cultures revealed an increase in the expression of cyclin D1 when AIB1 is overexpressed (Fig. 4B). This increase in cyclin D expression was diminished when cultures were transfected with small interference RNA for AIB1 (siAIB1). As a loading control, we used antibodies against the epithelial specific marker cytokeratin 14 (CK14). Interestingly, in cultures of AIB1-tg epithelial cells, we also observed increased levels of E-cadherin, an epithelial specific cell-to-cell adhesion molecule that acts as a reservoir for b-catenin and is down-regulated in many breast tumors. Transfection with siAIB1 also diminished E-cadherin levels. Our results suggest that AIB1 may participate in the ER-mediated repression of the transcription factor Snail [22] by releasing E-cadherin from Snail repression [23]. Interestingly, although loss of E-cadherin expression in epithelial cells has been postulated to occur during the later stages of tumorigenesis concomitant with the loss of epithelial features [24–26], modest upregulation of this molecule by AIB1 may represent another molecular change in early stages of abnormal mammary growth. Snail is sufficient to promote mammary tumor recurrence in vivo [27], and high levels of Snail predict decreased relapsed-free survival in women with breast cancer. AIB1 overexpression has also been associated with recurrence due to tamoxifen resistance [28,29]. One interesting possibility is that AIB1-mediated pre-tumor lesions require the additional up-regulation of Snail to reduce E-cadherin levels. Although these transgenic animals do not develop breast tumors as has been observed in transgenic lines which overexpress AIB1 at high levels [14], they display mammary hyperplasia from the onset of puberty, suggesting that they may constitute a new model for investigating the early steps of AIB1-induced breast cancer. Nuclear localization of AIB1 strongly correlated with BrdU incorporation, suggesting that

A´. Avivar et al. / FEBS Letters 580 (2006) 5222–5226

5225

Fig. 3. Nuclear staining for AIB1 correlates with entry in S-phase of the cell cycle. (A) Double immunofluorescence staining of mammary gland tissue sections from 10-week-old (puberty) and 2 days nursing (lactation) WT and AIB1-tg littermates was performed, as indicated. Slides were stained with polyclonal rabbit anti-AIB1 antibody (1:200; produced in our laboratory) that recognizes both AIB1 and endogenous p/CIP and with anti-BrdU. (B) Positive BrdU nuclei were counted for concomitant nuclear AIB1 (open bars) or cytoplasmic AIB1 staining (stripped bars). Shown are representative stainings of 3 WT and 3 AIB1-tg animals. *P = 10e6; **P = 10e3; ***P = 100e7; ****P = 10e3.

Fig. 4. Overexpression of AIB1 enhances cell-cycle progression and increases cyclin D1 and E-cadherin expression in mammary epithelial cultures. (A) Primary epithelial cells were seeded in chamber slides (5000 cells/cm2) and grown for two days prior to LSC analysis. *P = 0.0004; **P = 0.14; ***P = 0.04. Shown is a representative of three independent experiments. (B) Representative Western blot showing increased cyclin D1 and E-cadherin levels in AIB1-tg cells. Four mice of each genotype were used for cell preparations. Blots were probed with the antibodies indicated and developed with chemiluminescent detection system (GE Healthcare).

major nuclear transport of AIB1 occurs during or after Sphase of the cell cycle and this mechanism remains unaltered in the transgenic animals. Taken all together, our observations suggest that low-level overexpression of AIB1 may predispose for breast cancer development, but that additional genetic– epigenetic alterations are required to progress from pre-neoplastic changes in mammary epithelium to pathological stages

of breast cancer. In fact, AIB1 overexpression is frequent in the precursor lesions of pancreatic adenocarcinoma [11]. Thus, our results support the idea that AIB1 may also contribute to the early stages of breast cancer. Identification of the additional alterations which are required in this progression from epithelial hyperplasia to cancerous growth will help to predict the clinical outcome of breast tumors including the response to

A´. Avivar et al. / FEBS Letters 580 (2006) 5222–5226

5226

established therapies. Therefore, these new pathways which interact with AIB1 during tumor progression constitute potential targets for improving both diagnostic tools and therapies for breast cancer. Acknowledgements: This work was partially supported by Grants SAF 2002-00808 and SAF 2005-03499 from MCYT and FIS PI030818 (Spain). J.F.d.M. is also supported by the Ramo´n y Cajal Program of the MCYT (Spain). We thank Ana Flores for help with LSC experiments.

[14]

[15]

[16]

References [1] Anzick, S.L., Kononen, J., Walker, R.L., Azorsa, D.O., Tanner, M.M., Guan, X.Y., Sauter, G., Kallioniemi, O.P., Trent, J.M. and Meltzer, P.S. (1997) AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, 965–968. [2] Chen, H., Lin, R.J., Schiltz, R.L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, L., Nakatani, Y. and Evans, R.M. (1997) Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/ CAF and CBP/p300. Cell 90, 569–580. [3] Li, H., Gomes, P.J. and Chen, J.D. (1997) RAC3, a steroid/ nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc. Natl. Acad. Sci. USA 94, 8479–8484. [4] Suen, C.S., Berrodin, T.J., Mastroeni, R., Cheskis, B.J., Lyttle, C.R. and Frail, D.E. (1998) A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J. Biol. Chem. 273, 27645–27653. [5] Takeshita, A., Cardona, G.R., Koibuchi, N., Suen, C.S. and Chin, W.W. (1997) TRAM-1, A novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J. Biol. Chem. 272, 27629–27634. [6] Torchia, J., Rose, D.W., Inostroza, J., Kamei, Y., Westin, S., Glass, C.K. and Rosenfeld, M.G. (1997) The transcriptional coactivator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387, 677–684. [7] Kurebayashi, J., Otsuki, T., Kunisue, H., Tanaka, K., Yamamoto, S. and Sonoo, H. (2000) Expression levels of estrogen receptor-alpha, estrogen receptor-beta, coactivators, and corepressors in breast cancer. Clin. Cancer Res. 6, 512–518. [8] Gnanapragasam, V.J., Leung, H.Y., Pulimood, A.S., Neal, D.E. and Robson, C.N. (2001) Expression of RAC 3, a steroid hormone receptor co-activator in prostate cancer. Br. J. Cancer 85, 1928–3196. [9] Sakakura, C., Hagiwara, A., Yasuoka, R., Fujita, Y., Nakanishi, M., Masuda, K., Kimura, A., Nakamura, Y., Inazawa, J., Abe, T. and Yamagishi, H. (2000) Amplification and over-expression of the AIB1 nuclear receptor co-activator gene in primary gastric cancers. Int. J. Cancer 89, 217–223. [10] Ghadimi, B.M., Schrock, E., Walker, R.L., Wangsa, D., Jauho, A., Meltzer, P.S. and Ried, T. (1999) Specific chromosomal aberrations and amplification of the AIB1 nuclear receptor coactivator gene in pancreatic carcinomas. Am. J. Pathol. 154, 525–536. [11] Henke, R.T., Haddad, B.R., Kim, S.E., Rone, J.D., Mani, A., Jessup, J.M., Wellstein, A., Maitra, A. and Riegel, A.T. (2004) Overexpression of the nuclear receptor coactivator AIB1 (SRC-3) during progression of pancreatic adenocarcinoma. Clin. Cancer Res. 10, 6134–6142. [12] Wang, Y., Wu, M.C., Sham, J.S., Zhang, W., Wu, W.Q. and Guan, X.Y. (2002) Prognostic significance of c-myc and AIB1 amplification in hepatocellular carcinoma. A broad survey using high-throughput tissue microarray. Cancer 95, 2346–2352. [13] Tikkanen, M.K., Carter, D.J., Harris, A.M., Le, H.M., Azorsa, D.O., Meltzer, P.S. and Murdoch, F.E. (2000) Endogenously expressed estrogen receptor and coactivator AIB1 interact in

[17]

[18] [19]

[20]

[21]

[22]

[23]

[24] [25]

[26] [27]

[28]

[29]

MCF-7 human breast cancer cells. Proc. Natl. Acad. Sci. USA 97, 12536–12540. Torres-Arzayus, M.I., Font de Mora, J., Yuan, J., Vazquez, F., Bronson, R., Rue, M., Sellers, W.R. and Brown, M. (2004) High tumor incidence and activation of the PI3K/AKT pathway in transgenic mice define AIB1 as an oncogene. Cancer Cell 6, 263– 274. Kuang, S.Q., Liao, L., Zhang, H., Lee, A.V., O’Malley, B.W. and Xu, J. (2004) AIB1/SRC-3 deficiency affects insulin-like growth factor I signaling pathway and suppresses v-Ha-ras-induced breast cancer initiation and progression in mice. Cancer Res. 64, 1875–1885. Xu, J., Liao, L., Ning, G., Yoshida-Komiya, H., Deng, C. and O’Malley, B.W. (2000) The steroid receptor coactivator SRC-3 (p/ CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc. Natl. Acad. Sci. USA 97, 6379– 6384. Oh, A., List, H.J., Reiter, R., Mani, A., Zhang, Y., Gehan, E., Wellstein, A. and Riegel, A.T. (2004) The nuclear receptor coactivator AIB1 mediates insulin-like growth factor I-induced phenotypic changes in human breast cancer cells. Cancer Res. 64, 8299–8308. Planas-Silva, M.D., Shang, Y., Donaher, J.L., Brown, M. and Weinberg, R.A. (2001) AIB1 enhances estrogen-dependent induction of cyclin D1 expression. Cancer Res. 61, 3858–3862. Goel, A. and Janknecht, R. (2004) Concerted activation of ETS protein ER81 by p160 coactivators, the acetyltransferase p300 and the receptor tyrosine kinase HER2/Neu. J. Biol. Chem. 279, 14909–14916. Louie, M.C., Revenko, A.S., Zou, J.X., Yao, J. and Chen, H.W. (2006) ACTR/AIB1 functions as an E2F1 coactivator to promote breast cancer cell proliferation and antiestrogen resistance. Mol. Cell. Biol. 26, 3810–3823. Louie, M.C., Zou, J.X., Rabinovich, A. and Chen, H.W. (2004) ACTR/AIB1 functions as an E2F1 coactivator to promote breast cancer cell proliferation and antiestrogen resistance. Mol. Cell. Biol. 24, 5157–5171. Fujita, N., Jaye, D.L., Kajita, M., Geigerman, C., Moreno, C.S. and Wade, P.A. (2003) MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell 113, 207–219. Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J. and Garcia De Herreros, A. (2000) The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol. 2, 84–89. Shiozaki, H., Oka, H., Inoue, M., Tamura, S. and Monden, M. (1996) E-cadherin mediated adhesion system in cancer cells. Cancer 77, 1605–1613. Vleminckx, K., Vakaet Jr., L., Mareel, M., Fiers, W. and van Roy, F. (1991) Genetic manipulation of E-cadherin expression by epithelial tumor cells reveals an invasion suppressor role. Cell 66, 107–119. Perl, A.K., Wilgenbus, P., Dahl, U., Semb, H. and Christofori, G. (1998) A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 392, 190–193. Moody, S.E., Perez, D., Pan, T.C., Sarkisian, C.J., Portocarrero, C.P., Sterner, C.J., Notorfrancesco, K.L., Cardiff, R.D. and Chodosh, L.A. (2005) The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 8, 197–209. Osborne, C.K., Bardou, V., Hopp, T.A., Chamness, G.C., Hilsenbeck, S.G., Fuqua, S.A., Wong, J., Allred, D.C., Clark, G.M. and Schiff, R. (2003) Role of the estrogen receptor coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J. Natl. Cancer Inst. 95, 353–361. Shou, J., Massarweh, S., Osborne, C.K., Wakeling, A.E., Ali, S., Weiss, H. and Schiff, R. (2004) Mechanisms of tamoxifen resistance: increased estrogen receptor-HER2/neu cross-talk in ER/HER2-positive breast cancer. J. Natl. Cancer Inst. 96, 926– 935.