- Email: [email protected]
Modern histochemical methods using enzymes as markers
Journal of Immunological Methods. 150 (1992) 151- 158 © 1992 Elsevier SciencePublishersB.V. All rights reserved0022-1759/92/$05.00
15I
JIM06338
Modern histochemical methods using enzymes as markers Paul K. N a k a n e Department of Anatomy, Nagasaki University School of Medicine, Nagasaki 852, Japan
(Accepted 12 February 1992)
In the 25 years since the idea that histochemically detectable enzymes could serve as a marker of ligands, the world of histochemistry has undergone a dramatic change. Today slides of immunostained tissue sections may be filed together with hematoxylin- and eosin-stained slides and may be examined at one's leisure. Antigens are now localized at the uitrastructural level as well as at the light microscopic level permitting one to wonder about the intricacies and beauties of living creatures. Genes which mandate our body since the day of conception to the day of death can now easily be probed with enzyme markers. Even with all these success stories, some dreams which I had hoped to accomplish with the method are not yet realized. Unlike the chemical and physical properties of inert objects, living organisms are provided with a fixed genetic program. By recognizing the point in the program which is being executed, one can deduce the potential FUTURE activities of the cells and tissues. I hypothesize that this is not an impossible task since (1) histochemistry and immunohistochemistry already provide us information on the PAST activities of cells and tissues, (2) in situ hybridization describes PRESENT gene activities, and (3) newer methods allow for the determination of potential gene function. Thus it is possible to peek at the future. Key words: Immunohistochemistry;In situ hybridization;Oligonucleotidehistochemistry;In situ nick translation
PAST -- PRESENT -- FUTURE Correspondence to: P.K. Nakane, Department of Anatomy 1II, Nagasaki UniversitySchoolof Medicine, 12-4 Sakamotomaehi, Nagasaki 852, Japan (Tel.: 0958-47-2111, ext. 2130; Fax: 0958-47-8514). Abbreviations: T-T, thymine-thymine; T-T DNA, T-T dimerized probe DNA; mRNA, messengerRNA; ON-DNA, oligo nucleotide DNA; ASON-DNA, anti-sense oligonucleotide DNA; SON-DNA, sense oligonueleotide DNA; R anti-T-T, rabbit anti-T-Tdimer DNA antibody;HRP-G anti-R IgG, goat anti-rabbit IgG conjugated with HRP; Ach R, asubunit of mouse nicotinic acetylcholine receptor; HRP, horseradish peroxidase; REBP, regulatory element binding proteins; RE, regulatory element; CREBP, cyclic AMP responsive element binding protein; CRE, cyclicAMP responsive element; GREBP, glucocorticoidreceptor protein; GRE, glucocorticoidregulatory element.
The eyes of an experienced histologist see motion in histological preparations as others see movements in the paintings of impressionists. Such imagination is possible because, unlike chemical and physical substances, living organisms are provided with a time-dependent genetic program. Thus it is possible that from the PAST and PRESENT gene activities of histological preparations, one can deduce the FUTURE gene activities of the cells and tissues. Immunohistochemical techniques using enzymes as the reporting marker (Nakane and Pierce, 1966) yield much information on the past cell and tissue activities and
152 some information on PRESENT activities, however a specific method which is designed to predict the FUTUREgene activity is still on the drawing board. In this review I subdivide those methods into a group of techniques which are good for the recognition of the eAST activities, those good for determination of PRESENTgene activities, and give thought to those techniques which might permit us to PEEK at FUTUREgene activities in histological preparations. It has been my dream for some time to develop such FUTURE PEEKING methods and as this review will show, this now appears feasible. Most of the currently available histological methods are good for the recognition of the PAST gene activities of cells and tissues. A listing of histochemical techniques to observe previous cell activity would be: Ways to see THE PAST Histology Histochemistry Organic histochemistry Enzyme histochemistry Affinity histochemistry Immunohistochemistry Lectin histochemistry etc. During the past 25 years, the major modifications on the affinity histochemistry in the 'ways to see "mE PAST' have been focused on the secondary reaction rather than the primary reaction, e.g., peroxidase-anti-peroxidase method (Sternberger et al., 1970) and avidin-biotin complex method (Hsu and Raine, 1981). While these work well for the localization of antigenic molecules, none of them have been effective in demonstrating the site of synthesis of the molecules. Such ability is thus a method of determining present cell activity. A listing of these approaches would be: Ways to see THE PRESENT D N A - D N A in situ hybridization cDNA-mRNA in situ hybridization cRNA-mRNA in situ hybridization
To demonstrate the active synthesizing sites, the in situ hybridization method was introduced (Brigati et al., 1983). This method takes advantage of that amino acid sequences of all protein are based on the nucleotide sequence of m R N A and at the site of protein synthesis the mRNAs are present. By localizing the mRNA, one not only demonstrates the sites of synthesis of the protein, but also documents that the proteins were being produced when the ceils and tissues were removed from the organism, i.e., the PRESENT gene activities. We have used two methods for the analysis of D N A and mRNA.
(l) In situ hybridization using T-T dimerized DNA probes. Varieties of radioactive as well as non-radioactive substances have been used to label nucleic acid probes for visualization of in situ hybridization reactions. The presence of protruding non-radioactive markers on the probe has been attributed to the cause for the loss of sensitivity and specificity of hybridization. In search of a non-protruding non-radioactive marker, we investigated the use of the T-T dimer which can be generated easily in D N A and is a sensitive marker for D N A (Nakane et al., 1987). T-T dimer in probe D N A was generated by UV irradiation (254 /~m). Following hybridization with complementary D N A or R N A in cells and tissues, T-T D N A was detected immunohistochemically using rabbit anti-T-T D N A and peroxidase-labeled goat anti-rabbit IgG. It was found that the use of T-T as a marker offers several advantages over other markers: (1) it appears not to interfere with hybridization efficiency; (2) it is simple to make; and (3) it can be detected by the target nucleic acids with high sensitivity. Using this method, it was possible to localize the type 1 D N A of human simplex virus in the latent phase infection and the viral m R N A in the replicating phase (Takahashi and Nakane, 1988). In another application the c-myc m R N A in HL60 cells was localized using this approach (Izumi et al., 1988; Koji et al., 1989). This technique was also found useful in studies of human hepatitis C virus where R N A was found in hepatocytes as expected, but also, unexpectedly, in the infiltrating leukocytes (Nakane et al., 1991a). More recently this technology allowed for the possibility
153
to localize m R N A at the electron microscopic level. (Nakane et al., 1991b).
(2) Quantification of c-myc mRNA in HL60 cells. In theory, the amount of m R N A present in a given cell is proportional to the rate of synthesis of the coded protein. Thus it is possible to quantify the amount of protein antigen by measuring the amount of m R N A in a given cell. This approach may be better than direct measurement of antigens. During the past several decades, many investigators have attempted to quantify antigens in cellular and histological preparations, but faced practical as well as theoretical difficulties. It has been our experience as well as others that the retention of antigenicity of a given antigen varied considerably depending on the type of fixatives used. In addition, in a given fixative the retention of antigenicity of one antigen differed from that of another. Furthermore it has been a common finding that sensitivity of a given fixative varies depending upon the site of antigen in cells, e.g., usually antigens in Golgi sacculus are more sensitive to fixative than when they are present in endclalasmic reticulum or in secretion granules. Also, accessibility of antibodies to antigens varies from one locality to another in cells and tissues. It is known that there may be incomplete formation of the immune complex with the antigens of membranous cell organelles compared to those free in the cell nucleus or cytoplasm. Immunohistochemically processed specimens stain structures with varying degrees of signal intensity which results in the visual impression that an area with more signal intensity contains more antigen than an area with less signal. With a modern densitometric instrument one can obtain numbers which confirm the visual impression. However, when the above mentioned problems of quantifying antigen are considered, it is difficult to justify the signal intensity as a quantitative fact. On the other hand, mRNAs, although different from one
another with respect to the nucleic acid sequences, are chemically similar, if not identical, and thus the effect of fixatives on them are expected to be the same. In addition most mRNAs are situated in cytoplasm complexed with ribosomes and not enclosed by. membran,us structure. Because of the similarities between m R N A structures, it should be possible to better control the in situ hybridization between the complementary nucleic acid probes and cytoplasmic mRNAs. Once the conditions of fixation, removal of m R N A associated proteins, optimal size of the probes, and condition for an equal accessibility of the probe to cytoplasmic mRNA are standardized, the signal intensity may be converted to a quantitative information. With this concept in mind, we attempted to determine the number of copies of c-myc m R N A present in HL60 cells in vitro (Levine et al., 1966) as a model system, since the HL60 are known to contain about 20 times normal copies of c-myc DNA, and to express about ten times normal copies of c-myc m R N A (Shibuya et al., 1985). The expression of c-myc m R N A was considered important for the maintenance of the neoplastic state of the cell and the quantitation of m R N A per cell was essential in order to characterize the physiology of the cell. As the first step, ASON-DNA probes corresponding to the third exon of c-myc cDNA from 803 through 867 (Fig. 1) (Watt et al., 1983) were synthesized. This sequence was selected since it contained several possible sites for T-T dimerization (Fig. 1). ASON-DNA was placed in a flat siliconized quartz dish and irradiated with ultraviolet light of 253.7 nm. For this c-myc ASON-DNA, an optimal dose of ultraviolet was about 7000 J / m 2. Various concentrations of single stranded sense or anti-sense c-myc DNA of the third exon c-myc were dotted on strips of nitrocellulose filters and were hybridized with the T-T dimerized c-myc
(867)3'-**** **** TTTTCTCCGTCCGAGGACCGTTTTCCAGTCTCAGACCTAGTGGAAGACGACCTCCGGTGTCGTTT-5'(803) Fig. I. ASON-DNA probes corresponding to the third e×on of c-myc cDNA from 803 through 867. * indicates ~ssible sites of ~ T ~ation.
ASON-DNA. In addition to the ASON-DNA, the dot hybridization was carried out with extracted total RNA from a known number of HL60 cells. To immunohistochemically localize the hybridized T-T timers, R anti-T-T and HRP-G antiR lgG (Wilson and Nakane, 1978) were reacted sequentially and the HRP was visualized with 3,3'-diaminobenzidine in the presence of nickel and cobalt ions (Adams, 1981). The images of blots were recorded and total densities of each blot were determined using an image analyzer. A standard curve was made by plotting against the number of copies of c-myc eDNA and this was used to calculate the number of copies of m R N A in the HL60 extract. Using this procedure, it was found that the HL60 cell line maintair, ed in our laboratory contained an average of 439 copies of c-myc mRNA per cell (Nakane, 1990a). Using conditions similar to that of the dot blot hybridization, an aliquot of formaldehyde-fixed HL60 cells were hybridized in situ with the c-myc ASON-DNA. The total cell number in a field and density of the stain contributed by hybridization for each cell in the field was determined at 400 × magnification using an Olympus light microscope attached with the image analyzer. From the data, an average of density contributed by the hybridization per cell was calculated. Since 439 copies of c-myc mRNA per HL60 cell were found by the dot hybridization analysis, it was assumed that the average density per cell obtained by in situ hybridization represented the same number of c-myc mRNA copies per cell. The densities of each cell were converted to c-myc mRNA copies in each of the cells and the distribution was calculated. It was found that most of the HL60 cells contained between 0 and 50 copies of c-myc mRNA and a smaller portion between 100 and 300 copies. Occasional cells contained more than 1000 copies of the RNA. The activation of c-myc gene is known to take place at the boundary between G O and G~ phase (Le Gros et al., 1985) and therefore those cells containing more than 200 copies may be considered to be in this boundary phase since a population of ATL cells expressing normal copies of c-myc mRNA maximally contain about 200 copies. Those HL60 cells expressing between 0 and 50 copies of c-myc mRNA may be considered to be in phases of the
cell cycle other than the boundary phase. A significant number of HL60 cells contained an unusually high number of c-myc m R N A copies. Whether the nature of neoplasia differs between those HL60 cells with normal number of copies and those which contained an unusually large quantity of c-myc mRNA copies remains to be established. Since other cell lines such as 4-1-ST cell with excess copies of c-myc (Shibuya et al., 1985) also contain a subpopulation of cells with a more than usual number of c-myc m R N A copies, it is possible that the number of c-myc m R N A copies present may relate to the proliferative activity of the cell line. Ultrastructural localization of mRNA. For the localization of specific m R N A at the ultrastructural level, the physical dimensions of the m R N A as well as that of probe become critical. Unlike antigens in the lumen of endoplasmic retieulum, the local concentration of any given specific mRNA is extremely low. The following calculation illustrates the problem. Assuming that the average length of m R N A is about 2000 bases and also that when mRNA is complexed with the polyribosome, the diameter of the whirl-like structure is about 200 nm. The distance between centers of the structures is about 200 nm when the structures are dispersed on cytoplasmic surface of rough endoplasmic reticulum as is the case when exportable proteins are synthesized. In addition, in the structures, a stretch of at least 20-25 nucleotides of m R N A (this is more than 10 nm!) must be present in order for the hybridization to be base sequence specific. From these assumptions it is clear that frequency of a specific stretch of m R N A to be in a 100 nm thick ultrathin section is reduced. Furthermore, the chance that the stretch is on or near the surface of etched ultrathin section is even less. With all these considerations it is clear that it may not be possible to recognize the presence of specific m R N A in a cell when the ultrathin sections are used. One way to circumvent this difficulty is to use 1-2 p.m thick sections of polymer embedded tissues. In this method, the sections were mounted on a light microscopic glass slide and m R N A was exposed to probes by etching. In our laboratory, fixed tissues were embedded in JB4 and 2 /zm thick section were prepared. After adherence to a
155 glass slide, the sections were exposed to a mixture of chloroform and isoamyl alcohol to partially dissolve the JB4. The sections were treated further with diluted HCI and digested with proteinase K to remove proteins and to expose mRNAs. In situ hybridization is carried out on the treated section, using the T-T dimerized oligonucleotide probes with a method similar to that used for the light microscopic in situ hybridization. The sites of T-T dimers were localized immunohistochemically using either peroxidaselabeled antibodies or colloidal gold labeled antibodies. When the peroxidase-labeled antibodies were used, the reaction products of peroxidase were made electron dense. The osmicated reaction products or colloidal gold was visualized by using the back scattered electron detection mode of the scanning electron microscope (lzumi et al., 1990). This was a convenient way to localize specific m R N A since the tissue sections could be observed directly both by light and electron microscopy. Another potential way to localize m R N A was by the use of 'pre-embedding immun o e l e c t r o n microscopy' (Mazurkiewicz a n d Nakane, 1972) this method was applied to the localization of the m R N A of nicotinic acetylcholine receptor at the neuro-muscular junction of mouse muscle cells. A S O N - D N A and SON-DNA probes corresponding ~.o the nucleotide sequence # 3 8 2 - # 4 2 0 of Ach R (Fig. 2) (Isenberg et al., 1986) were synthesized. At the time of synthesis, a sequence of A-T-T was added three times at the 3' end of the probes since, unlike that of c-myc ASONDNA, these O N - D N A sequences did not contain the sites for T-T dimerization (Fig. 2).
The optimal UV dose for Ach R ASON-DNA as well as for Ach R-SON-DNA was about 7000 After performing the dot blot hybridization, as done for c-myc ASON-DNA, in situ hybridization was performed. Pieces of mouse skeletal muscle perfused with 4% formaldehyde were removed, and sections of 6 p.m thickness prepared using a cryostat. The sections were mounted on gelatin coated light microscopic glass slides. The m R N A specific for Ach R was localized on the sections by in situ hybridization using the T-T dimerized Ach R-ON-DNA and the pre-embedding immunoperoxidase method. The m R N A for Ach R was found in areas near the edge of muscle bundles in a fashion much like that of the distribution of acetyl-choline esterase (Karnovsky, 1964). At the ultrastructural level, the reaction products of H R P were found in the soleplasma of motor endplate and in areas between muscle fibers situated near the motor endplates. When the ultrathin section was counterstained with lead and uranium, the sites of the reaction products coincided with that of polyribosome in soleplasma and sarcoplasmic reticulum. By using ON-DNA and peroxidase-labeled antibodies which are smaller than cDNA and colloidal gold-labeled antibodies, respectively, we were able to utilize the 'pre-embedding method'. Since the reaction products of peroxidase are visible by a light microscope and the method utilized sections of tissues as well as cell monolayers, one has an advantage of examining the hybridized sections by the light microscope and then being able to trim the desired area for electron microscopic examination. Although an extensive investigation on the opitimization of
j/m z.
5'-TGTGAGATCATTGTCACTCACTTTCCCTTCGATGAGCAGATTATTATT-3' Anti-sense 3'
probe
(420-382):
TTATTATTAACACTCTAGTAACAGTGAGTGAAAGGGAAGCTACTCGTC
5'
Fig. 2. ASON-DNA and SON-DNA probes corresponding to the nucleotide sequence #380-#420 of Ac' R. These ON-DNA sequences do not contain sites for T-T dimerization( * ).
156 conditions remains to be carried out, our results on the localization of mRNa at the ultrastructural level are quite encouraging. Ways to see THE FUTURE Live material UV induced cell differentiation Chemically induced cell differentiation Fixed material In situ nick translation Oligonucleotide histochemistry Selectively extract inactive chromatin The acquisition of information on the FUTURE activities of the histological preparation requires new and imaginative approaches. In living cells and tissues, it has been demonstrated that potentially expressive genes may be activated when single stranded breaks are introduced into the genomic DNA by ultraviolet or by some chemicals (Tanno et al., 1987). Hence, by exposing cells or tissues to ultraviolet light and observing what genes are activated, one can predict some future activity of living cells, howcver this approach can not be used for fixed cells or histological preparations. We are developing methods to identify genes which are either active or can be activated, in fixed cells or tissues. One method (Koji et al., 1987) is based on the assumption that single stranded DNA breaks which occur during cell differentiation and maturation are present in the active nuclear chromatin DNAs or in the inactive chromatin DNAs. When these nicks are used as initiating points for in situ nick translation, those situated in the active chromatin are translated quickly since the nuclear chromatin is loose and DNA polymerase is able to bind to the breaks. On the other hand those breaks in the inactive chromatin DNAs are covered with basic nuclear proteins, such as H1 histone, and cannot be repaired since the polymerase is not able to gain access to them. By identifying which genes are translated, one can predict some of the present as well as potential future activity of the cells. In situ nick translation. In this method, a mixture of DNA polymerase I, dATP, dGTP, dCTP and biotin and biotin-ll-dUTP (or "ITP) was applied to sections of fixed tissues. In this first
step, the D N A polymerase I acted upon the single stranded D N A breaks and incorporated biotin-1 l-dUTP. The biotin incorporated into D N A was then detected immunohistochemically using HRP labeled anti-biotin antibody. It was found that the terminally differentiated cells such as nerve cells contained more single stranded D N A breaks in the inactive chromatin than the cells with potential to differentiate, i.e., peripheral lymphocytes. This was partly confirmed by selectively extracting the inactive chromatin using a modified Stratling method (1987) which extracted most of the D N A breaks from the tissue section. What remains to be completed is a quick method to identify which genes are situated in the active and inactive chromatins.
Oligonucleotide histochemistry Another way to see THE FUTURE is the use of oligonucleotide histochemistry (Koji et al., 1990) and is based on a principle that many gene transcriptions are modulated by binding a specific protein to a 'specific DNA sequence, i.e., cyclicAMP activates transcription of a wide spectrum of genes through a binding of specific protein, CREBP, to C R E on D N A with palindromic nucleotide sequence of T G A C G T C A (Angel et al., 1987). Hence, cells which contain REBP have a potential to respond when proper stimuli reach the cell. By capitalizing on the specific affinity between REBP and the regulatory element (RE), REBP may be localized by reacting synthetic oligo-RE D N A with REBP in cells and tissues. Two applications using this concept have been performed for the localization of CREBP. The TTAq~FA'ITA nuc!eotide sequence was added onto the 5' end of T G A C G T C A during synthesis. For the localization of GREBP, fragmented pBR 322 D N A which contains G R E sequences (Tully and Cidlowski, 1987) were used. These DNAs were exposed to ultraviolet light to form T-T dimers between the adjacent T-Ts (Nakane et al., 1987). Excised tissues were sectioned, frozen and fixed. The sections were reacted with the D N A probes without dissociating to single strands. The sites the probes bound were recognized by localizing the T-T dimer using anti-T-T dimer antibody (Nakane et al., 1987). It was found that CRE sequence bound mainly to the nuclei of
e p i t h e l i a l c e l l s in s m a l l i n t e s t i n e , a n d t o n u c l e i o f h e p a t o c y t e s a n d l i t t o r a l c e l l s in l i v e r o f t h e a d r e n a l e c t o m i z e d rat. T h e s t a i n i n g w i t h p B R 322 D N A w a s f o u n d in b o t h n u c l e i a n d c y t o p l a s m i c a r e a o f h e p a t o c y t e s o f t h e a d r e n a l e c t o m i z e d rat, though the interpretation of the staining was s o m e w h a t c o m p l i c a t e d b e c a u s e p B R 322 D N A c o n t a i n s o n e C R E s e q u e n c e as well. T h e p a t t e r n s of staining were altered when the rats were either stimulated or suppressed endocrinologically. Recently because several more specific REBP as well as RE have been identified and their physiological roles have become more clear (Hori, 1991) t h i s m e t h o d t o i d e n t i f y t h e p o t e n t i a l g e n e expression of cells should become popular.
Conclusion By e m p l o y i n g t h e s e v a r i o u s n e w h i s t o l o g i c a l p r o c e d u r e s in c o m b i n a t i o n , o n e is n o w a b l e t o a s s e s s t h e PAST, t h e PRESENT a n d t h e FUTURE a c t i v i t i e s o f h i s t o l o g i c p r e p a r a t i o n s a n d it is n o w possible to trace the dynamic sequence of events o f b i o l o g i c a l s y s t e m s in o t h e r w i s e s t a t i c p r e p a r a tions.
References Adams, J.C. (1981) Heavy metal intensification of DAB-based HRP reaction product. J. Histochem. Cytochem. 29, 775. Angel, P., lmagawa, M., Chiu, R., Stein, B., Imbra, R.J.. Rahmsdorf, H.J., Jonat, C., Herrlich, P. and Karin, M. (1987) Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49, 729-739. Brigati, D.J., Myerson. D., Leary, J.J., Spalholz, B., Travis, S.Z., Fong, C.K.Y., Hsiung, G.D. and Ward, D.C. 0983) Detection of viral genomes in cultured cells and paraffinembedded tissue sections using biotin-labeled hybridization probes. Virology 126, 32. Hori, K. (1991) Gene structure and regulatory mechanism of gene expression. In: K. Tabuchi (Ed.), Biological Aspects of Brain Tumors. Springer-Verlag, Tokyo, p. 38. Hsu, H.M. and Raine, L. (1981) Protein A, avidine, and biotin in immunohistochemistry. J. Histochem. Cytochem. 29, 1349. lsenberg, K.E., Mudd, J., Shah, V. and Merlie, J.P. 119861 Nucleotide sequence of the mouse muscle nicotinic acetylcholine receptor alpha subunit. Nucleic Acids Res. 14, 5111.
Izumi, S., Moriuchi, T., Koji, T., Tanno, M., Terashima, K., lguchi, K., Mochizuki, T., Yanaihara, C., Yanaihara, T,, Abe, K. and Nakane, P.K. 11988) Localization of c-myc in HL-6(} cells, neoplastic and normal tissues: An immunohistochemistry and in situ hybridization study. Acta tlistochem. Cytochcm. 211,327. lzumi, S., Koji, T. and Nakane, P.K. 0990) In situ Iocalizatkm of mRNA visualized by backscattered clcctron imaging. J. Histochem. Cytochcm. 38, 1052. Karnovsky, M.J. 0964)The localization of cholinesterase activity in rat cardiac muscles by electron microscopy. J, Cell Biol. 23, 217. Koji, T., lshibuchi, T. and Nakane, P.K. (1989a) Localization of single-strand breakes of DNA by in situ nick translation (INT). Cell Struct. Funct. 14, 959. Koji, T., Sugawar'~ l., Kimure, M. and 1~ akane, P.K. (1989b) In situ Iocalizat,,,n of c-myc in HL60 cells using non-radioactive synthetic oligonucleotide probes. Acta Histochem. C~toehem. 22, 295. Koji, T., Yamada, S., lzumi, S. and Nakane, P.K. 09911) Oligo histochcmistry: A new approach to localize DNA-binding proteins. J. Histochem. Cytochem. 38, 11152. Le Gros, J., De Feyter, R. and Ralph, R.K. 119851 Cyclic AMP and c-myc gene expression in PY815 mouse mastcytoma cell. FEBS Lctt. 186, 13. Levinc, L., Seaman, E., Hammerschlag, E. and Von Vunakis, H. (1966) Antibodies to photoproduct of deoxyribonucleic acids irradiated with ultraviolet. Science 153, 1666. Mazurkiewicz, J.E. and Nakanc, P.K. (1972) Light and electron microscopic localization of antigens in tissues embedded in polyethene glycol with a peroxidase-labcled antibody method. J. Histochem. Cytochem. 20, 967. Nakanc, P.K. (1991) Modern histochemical methods in mucosal immunology. In: M. Tsuchiya (Ed.) Frontiers of Mucosal Immunology, Vol. I. Elsevier, Tokyo, p. 21. Nakane, P.K. and Pierce, G.B. (19661 En~me-labeled antibodies: Preparation and application for localization of antigens. J. Histochem. Cytochem. 14, 929. Nakane. P.K., Moriuchi, T., Koji, T., Tanno. M. and Abe, K. (19871 In situ localization of mRNA using thymine-thymine dimerized eDNA. Acta Histochem. Cytochem. 211,229. Nakane, P.K., Koji, T., and Shin, M. (1991a) In situ hybridization using T-T dimerized non-radioactive probes. In: Cancer Chemotherapy, Vol. 6, Challenge for the Future. Excerpta Medica. Tokyo, p.46. Nakane, P.K., Matsumura, H. and Koji, T. (1991b) In situ hybridization using T-T dimerized non-radioactive probes. In: K. Tabuchi (Ed.), Biological Aspects of Brain Tumors. Springer-Verlag, Tokyo, p. 52. Stratling, W.H. (1987) Gene-specific differences in the supranucleosomal organization of rat liver chromatin. Biochemistry 26, 7893. Shibuya, M., Yokota, J. and Ueyama, Y. 119851 Amplification and expression of a cellular oncogene (c-myc) in human gastric adenocarcmoma cells. Mol. Cell. Biol. 5, 414. Stenberger, L.A., Hardy, Jr., P.H., Cuculis, J.J. and Howard, G.M. (1970) The unlabeled antibody-enzyme method of immunohistochemistry. Preparation and properties of sol-
uble antigen-antibody complex (horseradish peroxidaseantihnrscradish peroxidase) and its use in identification of spirochetes. J. Histochem. Cytochem. 18, 315. Takahashi. S. and Nakane, K. (1988) Detection of viral genes in the ti,~sues by in situ hybridization. Clin. Immunol. 20, 172. Tanuo, M., Koji, T., lzumi, S, Moriuchi, T., Sekino, M., Amvrozaitis, A. and Nakanc, P.K. (1987) Kinetics of PCNA/cyclin expression in time of DNA synthesis. Cell Struct. Funct. 12, 626. Tully, D.B. and Cidlowski, J.A. (1987) pBR322 contains glucocorticoid regulatory element DNA consecsus sequences. Biochem. Biophys. Res. Commun. 144, I. Watt. R.. Stanton, L.W., Marcu, K.B., Gallo, R.C.. Croce,
C.M. and Rovera, G. (1983) Nucleotide sequence of cloned eDNA of human c-myc oncogene. Nature 303, 725. Westin, E., Wong-Staal, F., Gelmann. E.P., Dalla Favara, R., Papas, T.K., Lautenberger, J.A., Eva, A., Reddy, E.P., Tronick, S.R., Aaronson, S.A. and Gallo, R.C. (1982) Expression of cellular homologues of retroviral one genes in human hematopoietic cells. Proc. Natl. Acad. Sci. USA 79, 2490. Wilson, M.B. and Nakane, P.K.: Recent developments in the periodate method of conjugating horseradish peroxidase (HRPO) to antibodies. (1978) In: W. Knapp, K. Holubar and G. Wick (Eds.) lmmunofluorescence and Related Staining Techniques. Elsevier, Amsterdam, p. 215.
15I
JIM06338
Modern histochemical methods using enzymes as markers Paul K. N a k a n e Department of Anatomy, Nagasaki University School of Medicine, Nagasaki 852, Japan
(Accepted 12 February 1992)
In the 25 years since the idea that histochemically detectable enzymes could serve as a marker of ligands, the world of histochemistry has undergone a dramatic change. Today slides of immunostained tissue sections may be filed together with hematoxylin- and eosin-stained slides and may be examined at one's leisure. Antigens are now localized at the uitrastructural level as well as at the light microscopic level permitting one to wonder about the intricacies and beauties of living creatures. Genes which mandate our body since the day of conception to the day of death can now easily be probed with enzyme markers. Even with all these success stories, some dreams which I had hoped to accomplish with the method are not yet realized. Unlike the chemical and physical properties of inert objects, living organisms are provided with a fixed genetic program. By recognizing the point in the program which is being executed, one can deduce the potential FUTURE activities of the cells and tissues. I hypothesize that this is not an impossible task since (1) histochemistry and immunohistochemistry already provide us information on the PAST activities of cells and tissues, (2) in situ hybridization describes PRESENT gene activities, and (3) newer methods allow for the determination of potential gene function. Thus it is possible to peek at the future. Key words: Immunohistochemistry;In situ hybridization;Oligonucleotidehistochemistry;In situ nick translation
PAST -- PRESENT -- FUTURE Correspondence to: P.K. Nakane, Department of Anatomy 1II, Nagasaki UniversitySchoolof Medicine, 12-4 Sakamotomaehi, Nagasaki 852, Japan (Tel.: 0958-47-2111, ext. 2130; Fax: 0958-47-8514). Abbreviations: T-T, thymine-thymine; T-T DNA, T-T dimerized probe DNA; mRNA, messengerRNA; ON-DNA, oligo nucleotide DNA; ASON-DNA, anti-sense oligonucleotide DNA; SON-DNA, sense oligonueleotide DNA; R anti-T-T, rabbit anti-T-Tdimer DNA antibody;HRP-G anti-R IgG, goat anti-rabbit IgG conjugated with HRP; Ach R, asubunit of mouse nicotinic acetylcholine receptor; HRP, horseradish peroxidase; REBP, regulatory element binding proteins; RE, regulatory element; CREBP, cyclic AMP responsive element binding protein; CRE, cyclicAMP responsive element; GREBP, glucocorticoidreceptor protein; GRE, glucocorticoidregulatory element.
The eyes of an experienced histologist see motion in histological preparations as others see movements in the paintings of impressionists. Such imagination is possible because, unlike chemical and physical substances, living organisms are provided with a time-dependent genetic program. Thus it is possible that from the PAST and PRESENT gene activities of histological preparations, one can deduce the FUTURE gene activities of the cells and tissues. Immunohistochemical techniques using enzymes as the reporting marker (Nakane and Pierce, 1966) yield much information on the past cell and tissue activities and
152 some information on PRESENT activities, however a specific method which is designed to predict the FUTUREgene activity is still on the drawing board. In this review I subdivide those methods into a group of techniques which are good for the recognition of the eAST activities, those good for determination of PRESENTgene activities, and give thought to those techniques which might permit us to PEEK at FUTUREgene activities in histological preparations. It has been my dream for some time to develop such FUTURE PEEKING methods and as this review will show, this now appears feasible. Most of the currently available histological methods are good for the recognition of the PAST gene activities of cells and tissues. A listing of histochemical techniques to observe previous cell activity would be: Ways to see THE PAST Histology Histochemistry Organic histochemistry Enzyme histochemistry Affinity histochemistry Immunohistochemistry Lectin histochemistry etc. During the past 25 years, the major modifications on the affinity histochemistry in the 'ways to see "mE PAST' have been focused on the secondary reaction rather than the primary reaction, e.g., peroxidase-anti-peroxidase method (Sternberger et al., 1970) and avidin-biotin complex method (Hsu and Raine, 1981). While these work well for the localization of antigenic molecules, none of them have been effective in demonstrating the site of synthesis of the molecules. Such ability is thus a method of determining present cell activity. A listing of these approaches would be: Ways to see THE PRESENT D N A - D N A in situ hybridization cDNA-mRNA in situ hybridization cRNA-mRNA in situ hybridization
To demonstrate the active synthesizing sites, the in situ hybridization method was introduced (Brigati et al., 1983). This method takes advantage of that amino acid sequences of all protein are based on the nucleotide sequence of m R N A and at the site of protein synthesis the mRNAs are present. By localizing the mRNA, one not only demonstrates the sites of synthesis of the protein, but also documents that the proteins were being produced when the ceils and tissues were removed from the organism, i.e., the PRESENT gene activities. We have used two methods for the analysis of D N A and mRNA.
(l) In situ hybridization using T-T dimerized DNA probes. Varieties of radioactive as well as non-radioactive substances have been used to label nucleic acid probes for visualization of in situ hybridization reactions. The presence of protruding non-radioactive markers on the probe has been attributed to the cause for the loss of sensitivity and specificity of hybridization. In search of a non-protruding non-radioactive marker, we investigated the use of the T-T dimer which can be generated easily in D N A and is a sensitive marker for D N A (Nakane et al., 1987). T-T dimer in probe D N A was generated by UV irradiation (254 /~m). Following hybridization with complementary D N A or R N A in cells and tissues, T-T D N A was detected immunohistochemically using rabbit anti-T-T D N A and peroxidase-labeled goat anti-rabbit IgG. It was found that the use of T-T as a marker offers several advantages over other markers: (1) it appears not to interfere with hybridization efficiency; (2) it is simple to make; and (3) it can be detected by the target nucleic acids with high sensitivity. Using this method, it was possible to localize the type 1 D N A of human simplex virus in the latent phase infection and the viral m R N A in the replicating phase (Takahashi and Nakane, 1988). In another application the c-myc m R N A in HL60 cells was localized using this approach (Izumi et al., 1988; Koji et al., 1989). This technique was also found useful in studies of human hepatitis C virus where R N A was found in hepatocytes as expected, but also, unexpectedly, in the infiltrating leukocytes (Nakane et al., 1991a). More recently this technology allowed for the possibility
153
to localize m R N A at the electron microscopic level. (Nakane et al., 1991b).
(2) Quantification of c-myc mRNA in HL60 cells. In theory, the amount of m R N A present in a given cell is proportional to the rate of synthesis of the coded protein. Thus it is possible to quantify the amount of protein antigen by measuring the amount of m R N A in a given cell. This approach may be better than direct measurement of antigens. During the past several decades, many investigators have attempted to quantify antigens in cellular and histological preparations, but faced practical as well as theoretical difficulties. It has been our experience as well as others that the retention of antigenicity of a given antigen varied considerably depending on the type of fixatives used. In addition, in a given fixative the retention of antigenicity of one antigen differed from that of another. Furthermore it has been a common finding that sensitivity of a given fixative varies depending upon the site of antigen in cells, e.g., usually antigens in Golgi sacculus are more sensitive to fixative than when they are present in endclalasmic reticulum or in secretion granules. Also, accessibility of antibodies to antigens varies from one locality to another in cells and tissues. It is known that there may be incomplete formation of the immune complex with the antigens of membranous cell organelles compared to those free in the cell nucleus or cytoplasm. Immunohistochemically processed specimens stain structures with varying degrees of signal intensity which results in the visual impression that an area with more signal intensity contains more antigen than an area with less signal. With a modern densitometric instrument one can obtain numbers which confirm the visual impression. However, when the above mentioned problems of quantifying antigen are considered, it is difficult to justify the signal intensity as a quantitative fact. On the other hand, mRNAs, although different from one
another with respect to the nucleic acid sequences, are chemically similar, if not identical, and thus the effect of fixatives on them are expected to be the same. In addition most mRNAs are situated in cytoplasm complexed with ribosomes and not enclosed by. membran,us structure. Because of the similarities between m R N A structures, it should be possible to better control the in situ hybridization between the complementary nucleic acid probes and cytoplasmic mRNAs. Once the conditions of fixation, removal of m R N A associated proteins, optimal size of the probes, and condition for an equal accessibility of the probe to cytoplasmic mRNA are standardized, the signal intensity may be converted to a quantitative information. With this concept in mind, we attempted to determine the number of copies of c-myc m R N A present in HL60 cells in vitro (Levine et al., 1966) as a model system, since the HL60 are known to contain about 20 times normal copies of c-myc DNA, and to express about ten times normal copies of c-myc m R N A (Shibuya et al., 1985). The expression of c-myc m R N A was considered important for the maintenance of the neoplastic state of the cell and the quantitation of m R N A per cell was essential in order to characterize the physiology of the cell. As the first step, ASON-DNA probes corresponding to the third exon of c-myc cDNA from 803 through 867 (Fig. 1) (Watt et al., 1983) were synthesized. This sequence was selected since it contained several possible sites for T-T dimerization (Fig. 1). ASON-DNA was placed in a flat siliconized quartz dish and irradiated with ultraviolet light of 253.7 nm. For this c-myc ASON-DNA, an optimal dose of ultraviolet was about 7000 J / m 2. Various concentrations of single stranded sense or anti-sense c-myc DNA of the third exon c-myc were dotted on strips of nitrocellulose filters and were hybridized with the T-T dimerized c-myc
(867)3'-**** **** TTTTCTCCGTCCGAGGACCGTTTTCCAGTCTCAGACCTAGTGGAAGACGACCTCCGGTGTCGTTT-5'(803) Fig. I. ASON-DNA probes corresponding to the third e×on of c-myc cDNA from 803 through 867. * indicates ~ssible sites of ~ T ~ation.
ASON-DNA. In addition to the ASON-DNA, the dot hybridization was carried out with extracted total RNA from a known number of HL60 cells. To immunohistochemically localize the hybridized T-T timers, R anti-T-T and HRP-G antiR lgG (Wilson and Nakane, 1978) were reacted sequentially and the HRP was visualized with 3,3'-diaminobenzidine in the presence of nickel and cobalt ions (Adams, 1981). The images of blots were recorded and total densities of each blot were determined using an image analyzer. A standard curve was made by plotting against the number of copies of c-myc eDNA and this was used to calculate the number of copies of m R N A in the HL60 extract. Using this procedure, it was found that the HL60 cell line maintair, ed in our laboratory contained an average of 439 copies of c-myc mRNA per cell (Nakane, 1990a). Using conditions similar to that of the dot blot hybridization, an aliquot of formaldehyde-fixed HL60 cells were hybridized in situ with the c-myc ASON-DNA. The total cell number in a field and density of the stain contributed by hybridization for each cell in the field was determined at 400 × magnification using an Olympus light microscope attached with the image analyzer. From the data, an average of density contributed by the hybridization per cell was calculated. Since 439 copies of c-myc mRNA per HL60 cell were found by the dot hybridization analysis, it was assumed that the average density per cell obtained by in situ hybridization represented the same number of c-myc mRNA copies per cell. The densities of each cell were converted to c-myc mRNA copies in each of the cells and the distribution was calculated. It was found that most of the HL60 cells contained between 0 and 50 copies of c-myc mRNA and a smaller portion between 100 and 300 copies. Occasional cells contained more than 1000 copies of the RNA. The activation of c-myc gene is known to take place at the boundary between G O and G~ phase (Le Gros et al., 1985) and therefore those cells containing more than 200 copies may be considered to be in this boundary phase since a population of ATL cells expressing normal copies of c-myc mRNA maximally contain about 200 copies. Those HL60 cells expressing between 0 and 50 copies of c-myc mRNA may be considered to be in phases of the
cell cycle other than the boundary phase. A significant number of HL60 cells contained an unusually high number of c-myc m R N A copies. Whether the nature of neoplasia differs between those HL60 cells with normal number of copies and those which contained an unusually large quantity of c-myc mRNA copies remains to be established. Since other cell lines such as 4-1-ST cell with excess copies of c-myc (Shibuya et al., 1985) also contain a subpopulation of cells with a more than usual number of c-myc m R N A copies, it is possible that the number of c-myc m R N A copies present may relate to the proliferative activity of the cell line. Ultrastructural localization of mRNA. For the localization of specific m R N A at the ultrastructural level, the physical dimensions of the m R N A as well as that of probe become critical. Unlike antigens in the lumen of endoplasmic retieulum, the local concentration of any given specific mRNA is extremely low. The following calculation illustrates the problem. Assuming that the average length of m R N A is about 2000 bases and also that when mRNA is complexed with the polyribosome, the diameter of the whirl-like structure is about 200 nm. The distance between centers of the structures is about 200 nm when the structures are dispersed on cytoplasmic surface of rough endoplasmic reticulum as is the case when exportable proteins are synthesized. In addition, in the structures, a stretch of at least 20-25 nucleotides of m R N A (this is more than 10 nm!) must be present in order for the hybridization to be base sequence specific. From these assumptions it is clear that frequency of a specific stretch of m R N A to be in a 100 nm thick ultrathin section is reduced. Furthermore, the chance that the stretch is on or near the surface of etched ultrathin section is even less. With all these considerations it is clear that it may not be possible to recognize the presence of specific m R N A in a cell when the ultrathin sections are used. One way to circumvent this difficulty is to use 1-2 p.m thick sections of polymer embedded tissues. In this method, the sections were mounted on a light microscopic glass slide and m R N A was exposed to probes by etching. In our laboratory, fixed tissues were embedded in JB4 and 2 /zm thick section were prepared. After adherence to a
155 glass slide, the sections were exposed to a mixture of chloroform and isoamyl alcohol to partially dissolve the JB4. The sections were treated further with diluted HCI and digested with proteinase K to remove proteins and to expose mRNAs. In situ hybridization is carried out on the treated section, using the T-T dimerized oligonucleotide probes with a method similar to that used for the light microscopic in situ hybridization. The sites of T-T dimers were localized immunohistochemically using either peroxidaselabeled antibodies or colloidal gold labeled antibodies. When the peroxidase-labeled antibodies were used, the reaction products of peroxidase were made electron dense. The osmicated reaction products or colloidal gold was visualized by using the back scattered electron detection mode of the scanning electron microscope (lzumi et al., 1990). This was a convenient way to localize specific m R N A since the tissue sections could be observed directly both by light and electron microscopy. Another potential way to localize m R N A was by the use of 'pre-embedding immun o e l e c t r o n microscopy' (Mazurkiewicz a n d Nakane, 1972) this method was applied to the localization of the m R N A of nicotinic acetylcholine receptor at the neuro-muscular junction of mouse muscle cells. A S O N - D N A and SON-DNA probes corresponding ~.o the nucleotide sequence # 3 8 2 - # 4 2 0 of Ach R (Fig. 2) (Isenberg et al., 1986) were synthesized. At the time of synthesis, a sequence of A-T-T was added three times at the 3' end of the probes since, unlike that of c-myc ASONDNA, these O N - D N A sequences did not contain the sites for T-T dimerization (Fig. 2).
The optimal UV dose for Ach R ASON-DNA as well as for Ach R-SON-DNA was about 7000 After performing the dot blot hybridization, as done for c-myc ASON-DNA, in situ hybridization was performed. Pieces of mouse skeletal muscle perfused with 4% formaldehyde were removed, and sections of 6 p.m thickness prepared using a cryostat. The sections were mounted on gelatin coated light microscopic glass slides. The m R N A specific for Ach R was localized on the sections by in situ hybridization using the T-T dimerized Ach R-ON-DNA and the pre-embedding immunoperoxidase method. The m R N A for Ach R was found in areas near the edge of muscle bundles in a fashion much like that of the distribution of acetyl-choline esterase (Karnovsky, 1964). At the ultrastructural level, the reaction products of H R P were found in the soleplasma of motor endplate and in areas between muscle fibers situated near the motor endplates. When the ultrathin section was counterstained with lead and uranium, the sites of the reaction products coincided with that of polyribosome in soleplasma and sarcoplasmic reticulum. By using ON-DNA and peroxidase-labeled antibodies which are smaller than cDNA and colloidal gold-labeled antibodies, respectively, we were able to utilize the 'pre-embedding method'. Since the reaction products of peroxidase are visible by a light microscope and the method utilized sections of tissues as well as cell monolayers, one has an advantage of examining the hybridized sections by the light microscope and then being able to trim the desired area for electron microscopic examination. Although an extensive investigation on the opitimization of
j/m z.
5'-TGTGAGATCATTGTCACTCACTTTCCCTTCGATGAGCAGATTATTATT-3' Anti-sense 3'
probe
(420-382):
TTATTATTAACACTCTAGTAACAGTGAGTGAAAGGGAAGCTACTCGTC
5'
Fig. 2. ASON-DNA and SON-DNA probes corresponding to the nucleotide sequence #380-#420 of Ac' R. These ON-DNA sequences do not contain sites for T-T dimerization( * ).
156 conditions remains to be carried out, our results on the localization of mRNa at the ultrastructural level are quite encouraging. Ways to see THE FUTURE Live material UV induced cell differentiation Chemically induced cell differentiation Fixed material In situ nick translation Oligonucleotide histochemistry Selectively extract inactive chromatin The acquisition of information on the FUTURE activities of the histological preparation requires new and imaginative approaches. In living cells and tissues, it has been demonstrated that potentially expressive genes may be activated when single stranded breaks are introduced into the genomic DNA by ultraviolet or by some chemicals (Tanno et al., 1987). Hence, by exposing cells or tissues to ultraviolet light and observing what genes are activated, one can predict some future activity of living cells, howcver this approach can not be used for fixed cells or histological preparations. We are developing methods to identify genes which are either active or can be activated, in fixed cells or tissues. One method (Koji et al., 1987) is based on the assumption that single stranded DNA breaks which occur during cell differentiation and maturation are present in the active nuclear chromatin DNAs or in the inactive chromatin DNAs. When these nicks are used as initiating points for in situ nick translation, those situated in the active chromatin are translated quickly since the nuclear chromatin is loose and DNA polymerase is able to bind to the breaks. On the other hand those breaks in the inactive chromatin DNAs are covered with basic nuclear proteins, such as H1 histone, and cannot be repaired since the polymerase is not able to gain access to them. By identifying which genes are translated, one can predict some of the present as well as potential future activity of the cells. In situ nick translation. In this method, a mixture of DNA polymerase I, dATP, dGTP, dCTP and biotin and biotin-ll-dUTP (or "ITP) was applied to sections of fixed tissues. In this first
step, the D N A polymerase I acted upon the single stranded D N A breaks and incorporated biotin-1 l-dUTP. The biotin incorporated into D N A was then detected immunohistochemically using HRP labeled anti-biotin antibody. It was found that the terminally differentiated cells such as nerve cells contained more single stranded D N A breaks in the inactive chromatin than the cells with potential to differentiate, i.e., peripheral lymphocytes. This was partly confirmed by selectively extracting the inactive chromatin using a modified Stratling method (1987) which extracted most of the D N A breaks from the tissue section. What remains to be completed is a quick method to identify which genes are situated in the active and inactive chromatins.
Oligonucleotide histochemistry Another way to see THE FUTURE is the use of oligonucleotide histochemistry (Koji et al., 1990) and is based on a principle that many gene transcriptions are modulated by binding a specific protein to a 'specific DNA sequence, i.e., cyclicAMP activates transcription of a wide spectrum of genes through a binding of specific protein, CREBP, to C R E on D N A with palindromic nucleotide sequence of T G A C G T C A (Angel et al., 1987). Hence, cells which contain REBP have a potential to respond when proper stimuli reach the cell. By capitalizing on the specific affinity between REBP and the regulatory element (RE), REBP may be localized by reacting synthetic oligo-RE D N A with REBP in cells and tissues. Two applications using this concept have been performed for the localization of CREBP. The TTAq~FA'ITA nuc!eotide sequence was added onto the 5' end of T G A C G T C A during synthesis. For the localization of GREBP, fragmented pBR 322 D N A which contains G R E sequences (Tully and Cidlowski, 1987) were used. These DNAs were exposed to ultraviolet light to form T-T dimers between the adjacent T-Ts (Nakane et al., 1987). Excised tissues were sectioned, frozen and fixed. The sections were reacted with the D N A probes without dissociating to single strands. The sites the probes bound were recognized by localizing the T-T dimer using anti-T-T dimer antibody (Nakane et al., 1987). It was found that CRE sequence bound mainly to the nuclei of
e p i t h e l i a l c e l l s in s m a l l i n t e s t i n e , a n d t o n u c l e i o f h e p a t o c y t e s a n d l i t t o r a l c e l l s in l i v e r o f t h e a d r e n a l e c t o m i z e d rat. T h e s t a i n i n g w i t h p B R 322 D N A w a s f o u n d in b o t h n u c l e i a n d c y t o p l a s m i c a r e a o f h e p a t o c y t e s o f t h e a d r e n a l e c t o m i z e d rat, though the interpretation of the staining was s o m e w h a t c o m p l i c a t e d b e c a u s e p B R 322 D N A c o n t a i n s o n e C R E s e q u e n c e as well. T h e p a t t e r n s of staining were altered when the rats were either stimulated or suppressed endocrinologically. Recently because several more specific REBP as well as RE have been identified and their physiological roles have become more clear (Hori, 1991) t h i s m e t h o d t o i d e n t i f y t h e p o t e n t i a l g e n e expression of cells should become popular.
Conclusion By e m p l o y i n g t h e s e v a r i o u s n e w h i s t o l o g i c a l p r o c e d u r e s in c o m b i n a t i o n , o n e is n o w a b l e t o a s s e s s t h e PAST, t h e PRESENT a n d t h e FUTURE a c t i v i t i e s o f h i s t o l o g i c p r e p a r a t i o n s a n d it is n o w possible to trace the dynamic sequence of events o f b i o l o g i c a l s y s t e m s in o t h e r w i s e s t a t i c p r e p a r a tions.
References Adams, J.C. (1981) Heavy metal intensification of DAB-based HRP reaction product. J. Histochem. Cytochem. 29, 775. Angel, P., lmagawa, M., Chiu, R., Stein, B., Imbra, R.J.. Rahmsdorf, H.J., Jonat, C., Herrlich, P. and Karin, M. (1987) Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49, 729-739. Brigati, D.J., Myerson. D., Leary, J.J., Spalholz, B., Travis, S.Z., Fong, C.K.Y., Hsiung, G.D. and Ward, D.C. 0983) Detection of viral genomes in cultured cells and paraffinembedded tissue sections using biotin-labeled hybridization probes. Virology 126, 32. Hori, K. (1991) Gene structure and regulatory mechanism of gene expression. In: K. Tabuchi (Ed.), Biological Aspects of Brain Tumors. Springer-Verlag, Tokyo, p. 38. Hsu, H.M. and Raine, L. (1981) Protein A, avidine, and biotin in immunohistochemistry. J. Histochem. Cytochem. 29, 1349. lsenberg, K.E., Mudd, J., Shah, V. and Merlie, J.P. 119861 Nucleotide sequence of the mouse muscle nicotinic acetylcholine receptor alpha subunit. Nucleic Acids Res. 14, 5111.
Izumi, S., Moriuchi, T., Koji, T., Tanno, M., Terashima, K., lguchi, K., Mochizuki, T., Yanaihara, C., Yanaihara, T,, Abe, K. and Nakane, P.K. 11988) Localization of c-myc in HL-6(} cells, neoplastic and normal tissues: An immunohistochemistry and in situ hybridization study. Acta tlistochem. Cytochcm. 211,327. lzumi, S., Koji, T. and Nakane, P.K. 0990) In situ Iocalizatkm of mRNA visualized by backscattered clcctron imaging. J. Histochem. Cytochcm. 38, 1052. Karnovsky, M.J. 0964)The localization of cholinesterase activity in rat cardiac muscles by electron microscopy. J, Cell Biol. 23, 217. Koji, T., lshibuchi, T. and Nakane, P.K. (1989a) Localization of single-strand breakes of DNA by in situ nick translation (INT). Cell Struct. Funct. 14, 959. Koji, T., Sugawar'~ l., Kimure, M. and 1~ akane, P.K. (1989b) In situ Iocalizat,,,n of c-myc in HL60 cells using non-radioactive synthetic oligonucleotide probes. Acta Histochem. C~toehem. 22, 295. Koji, T., Yamada, S., lzumi, S. and Nakane, P.K. 09911) Oligo histochcmistry: A new approach to localize DNA-binding proteins. J. Histochem. Cytochem. 38, 11152. Le Gros, J., De Feyter, R. and Ralph, R.K. 119851 Cyclic AMP and c-myc gene expression in PY815 mouse mastcytoma cell. FEBS Lctt. 186, 13. Levinc, L., Seaman, E., Hammerschlag, E. and Von Vunakis, H. (1966) Antibodies to photoproduct of deoxyribonucleic acids irradiated with ultraviolet. Science 153, 1666. Mazurkiewicz, J.E. and Nakanc, P.K. (1972) Light and electron microscopic localization of antigens in tissues embedded in polyethene glycol with a peroxidase-labcled antibody method. J. Histochem. Cytochem. 20, 967. Nakanc, P.K. (1991) Modern histochemical methods in mucosal immunology. In: M. Tsuchiya (Ed.) Frontiers of Mucosal Immunology, Vol. I. Elsevier, Tokyo, p. 21. Nakane, P.K. and Pierce, G.B. (19661 En~me-labeled antibodies: Preparation and application for localization of antigens. J. Histochem. Cytochem. 14, 929. Nakane. P.K., Moriuchi, T., Koji, T., Tanno. M. and Abe, K. (19871 In situ localization of mRNA using thymine-thymine dimerized eDNA. Acta Histochem. Cytochem. 211,229. Nakane, P.K., Koji, T., and Shin, M. (1991a) In situ hybridization using T-T dimerized non-radioactive probes. In: Cancer Chemotherapy, Vol. 6, Challenge for the Future. Excerpta Medica. Tokyo, p.46. Nakane, P.K., Matsumura, H. and Koji, T. (1991b) In situ hybridization using T-T dimerized non-radioactive probes. In: K. Tabuchi (Ed.), Biological Aspects of Brain Tumors. Springer-Verlag, Tokyo, p. 52. Stratling, W.H. (1987) Gene-specific differences in the supranucleosomal organization of rat liver chromatin. Biochemistry 26, 7893. Shibuya, M., Yokota, J. and Ueyama, Y. 119851 Amplification and expression of a cellular oncogene (c-myc) in human gastric adenocarcmoma cells. Mol. Cell. Biol. 5, 414. Stenberger, L.A., Hardy, Jr., P.H., Cuculis, J.J. and Howard, G.M. (1970) The unlabeled antibody-enzyme method of immunohistochemistry. Preparation and properties of sol-
uble antigen-antibody complex (horseradish peroxidaseantihnrscradish peroxidase) and its use in identification of spirochetes. J. Histochem. Cytochem. 18, 315. Takahashi. S. and Nakane, K. (1988) Detection of viral genes in the ti,~sues by in situ hybridization. Clin. Immunol. 20, 172. Tanuo, M., Koji, T., lzumi, S, Moriuchi, T., Sekino, M., Amvrozaitis, A. and Nakanc, P.K. (1987) Kinetics of PCNA/cyclin expression in time of DNA synthesis. Cell Struct. Funct. 12, 626. Tully, D.B. and Cidlowski, J.A. (1987) pBR322 contains glucocorticoid regulatory element DNA consecsus sequences. Biochem. Biophys. Res. Commun. 144, I. Watt. R.. Stanton, L.W., Marcu, K.B., Gallo, R.C.. Croce,
C.M. and Rovera, G. (1983) Nucleotide sequence of cloned eDNA of human c-myc oncogene. Nature 303, 725. Westin, E., Wong-Staal, F., Gelmann. E.P., Dalla Favara, R., Papas, T.K., Lautenberger, J.A., Eva, A., Reddy, E.P., Tronick, S.R., Aaronson, S.A. and Gallo, R.C. (1982) Expression of cellular homologues of retroviral one genes in human hematopoietic cells. Proc. Natl. Acad. Sci. USA 79, 2490. Wilson, M.B. and Nakane, P.K.: Recent developments in the periodate method of conjugating horseradish peroxidase (HRPO) to antibodies. (1978) In: W. Knapp, K. Holubar and G. Wick (Eds.) lmmunofluorescence and Related Staining Techniques. Elsevier, Amsterdam, p. 215.