Modular architecture of the conjugative plasmid pSVH1 from Streptomyces venezuelae

Plasmid 55 (2006) 201–209 www.elsevier.com/locate/yplas

Modular architecture of the conjugative plasmid pSVH1 from Streptomyces venezuelae Jens Reuther, Wolfgang Wohlleben, Günther Muth ¤ Microbiology/Biotechnology, Microbiological Institute, Faculty of Biology, University of Tübingen, Auf der Morgenstelle 28, D-72076 Tübingen, Germany Received 29 September 2005, revised 11 November 2005 Available online 24 January 2006 Communicated by C. Jeffrey Smith

Abstract The conjugative rolling circle replication (RCR) type plasmid pSVH1 from the chloramphenicol producer Streptomyces venezuelae was characterized by DNA sequence analysis and insertion/deletion analysis. Nucleotide sequence of the 12,652 bp pSVH1 revealed 11 open reading frames with high coding probability for which putative functions could be assigned. Beside the replication initiator gene rep for RCR, pSVH1 contained only genes involved in conjugative transfer. The transfer gene traB encoding the septal DNA translocator TraB is regulated by the GntR-type transcriptional regulator TraR. Six spd genes involved in intra-mycelial plasmid spreading are organized in two operons, consisting of two and three translationally coupled genes. Subcloning experiments demonstrated that the transfer gene traB represents a kill function and localized the pSVH1 minimal replicon consisting of rep and the dso origin to a 2072-bp fragment. Plasmid pSVH1 showed a modular architecture. Its replication region resembled that of the Streptomyces natalensis plasmid pSNA1, while the transfer and spread regions involved in conjugative plasmid transfer were highly similar to the corresponding regions of the Streptomyces ghanaensis plasmid pSG5. © 2005 Elsevier Inc. All rights reserved. Keywords: Streptomyces; Plasmid; Rolling-circle-replication; Conjugation; Plasmid transfer

1. Introduction A great variety of diVerent plasmids have been identiWed in mycelium forming streptomycetes (Hopwood and Kieser, 1993; Wohlleben and Muth, 1993). Several of these plasmids have been characterized in great detail and the function of many plasmid encoded genes was elucidated (Hagège et al., 1993; Kataoka et al., 1991; Maas et al., 1998; Servín*

Corresponding author. Fax: +497071 29 5979. E-mail address: [email protected] (G. Muth).

0147-619X/$ - see front matter © 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.plasmid.2005.11.007

González, 1993; Vrijbloed et al., 1995). In general, Streptomyces plasmids are conjugative and mobilize chromosomal markers (CMA) at high frequency (Kieser et al., 1982). They encode only functions involved in transfer, autonomous replication, or integration into the host chromosome (Grohmann et al., 2003). Only huge linear plasmids of several hundred kilo base pair in size carry additional genes and have been shown to encode whole antibiotic biosynthesis pathways (Kinashi and Shimaji, 1987). As in other gram-positive bacteria, most of the small Streptomyces plasmids replicate via the

202

J. Reuther et al. / Plasmid 55 (2006) 201–209

rolling-circle-mechanism (RCR). In contrast to the staphylococcal RCR plasmids the RCR plasmids from Streptomyces are not highly interrelated showing only limited sequence conservation. Despite the low sequence similarity the RCR plasmids encode the same set of functional homologous proteins: The Rep protein belongs to the pC194 family of RCR plasmids (RCR group III, www.essex.ac.uk/bs/staV/ osborn/DPR/DPR_RCRdata.htm; Muth et al., 1995). The transfer protein TraB, a septal DNA translocator protein of the FtsK family (Begg et al., 1995) is the only plasmid-encoded protein essential for the conjugative transfer (Kieser et al., 1982; Pettis and Cohen, 1994). traB of many plasmids represents a kill function and is therefore under transcriptional control of a regulator of the GntR family, which was found to bind to repetitive sequences in the overlapping promoter region of traB and traR (Kataoka et al., 1994b; Kendall and Cohen, 1987). In addition to traB, plasmid transfer requires a small non-coding sequence (clt) of unknown molecular function (Ducote et al., 2000; Pettis and Cohen, 1994; Servín-González, 1996). Beside traB, four to six spd genes are involved in conjugative plasmid transfer (Kataoka et al., 1994a; Vrijbloed et al., 1995). Whereas traB is the only gene that is essential for the plasmid transfer from the donor to the recipient, the spd genes are required for the subsequent spreading of the newly transferred plasmids within the recipient mycelium (Kieser et al., 1982). This plasmid spreading is associated with the formation of pock structures, inhibition zones surrounding the donor, where growth of the recipient mycelium is retarded (Bibb et al., 1981). One of the spread genes encodes a transcriptional repressor controlling spd gene expression (Pettis et al., 2001; Tai and Cohen, 1993). Plasmid pSVH1 is a conjugative pock forming plasmid with a high copy number that was isolated from the chloramphenicol producer Streptomyces venezuelae ETH14630 (Wohlleben et al., 1986). It has an estimated copy number of 75–100 (Labes et al., 1990) and was shown to be compatible with other Streptomyces plasmids such as pSG5 (Muth et al., 1988), pIJ101 (Kieser et al., 1982) and pSG2 (Wohlleben and Pühler, 1987). Vectors derived from pSVH1 were used for clNSoning of the phosphinothricin resistance gene pat from Streptomyces viridochromogenes (Strauch et al., 1988) and the lysozyme gene of Streptomyces coelicolor “Müller” DSM3030

(Birr et al., 1989). To gain a more profound knowledge of the biology of Streptomyces plasmids we started to characterize plasmid pSVH1 in more detail.

2. Material and methods 2.1. Sequencing and analysis Subclones for sequencing were generated by cloning restriction fragments of plasmid pSVH1 into plasmid pK18 (Pridmore, 1987) or ligating appropriate PCR fragments into pDrive (Qiagen). The complete nuclNSeotide sequence of both strands of pSVH1 was determined by an ALF express sequencer (Pharmacia) using the Sequenase kit and by the Automated DNA Sequencing Service at MWG Biotech, AG (Ebersberg, Germany). The Staden package (Staden et al., 2000) and the ArNStemis program (Rutherford et al., 2000) were used for sequence assembly and gene annotation, respectively. For coding region analysis, FramePlot (Ishikawa and Hotta, 1999) was also used. Sequence similarity searches were conducted using the BLAST programs at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST/). The nucleotide sequence of plasmid pSVH1 has been deposited in EMBL and carries Accession No. AM087403. 2.1.1. Strains and plasmids For propagation of plasmids Escherichia coli Xl1blue (Bullock et al., 2000) and Streptomyces lividans strains TK64 and TK23 (Hopwood et al., 1983) were used. Plasmids were pK18 (Pridmore, 1987), pSVH1 (Wohlleben et al., 1986), and pSLE41 (Wohlleben and Pühler, 1987). E. coli and S. lividans strains were cultivated as described by Sambrook et al. (1989) and Kieser et al. (2000), respectively. 2.1.2. pSVH1 subcloning experiments All pSVH1 fragments were subcloned into pK18 (Pridmore, 1987) using standard procedures (Sambrook et al., 1989). Cloning strategy is described in Table 1. Primers updsoE: gggaattcgtacaggtactgagac and lowrepB: aaggatcctggtctgtgcggtc were used to amplify the fragment inserted into plasmid pEB290. 2.1.3. Analysis of pock formation 106–107 spores of plasmid free S. lividans TK64 were plated onto R5 agar. Appropriate spore dilutions of S. lividans TK23 containing pSVH1 derivatives were subsequently streaked onto these plates to single colonies. After three to Wve days incubation at 30 °C the plates were analysed for the presence of circular inhibition zones (pocks) formed on the TK64 lawn.

J. Reuther et al. / Plasmid 55 (2006) 201–209

203

Table 1 pSVH1 derivatives constructed during this study Name

Size (bp)

pSVH1 fragment inserted into pK18

pEB211 pEB267 pEB277 pEB201 pEB231 pEB221 pEB203 pEB290 pEB213 pEB214

15,313 10,034 8,212 6,460 5,416 5,045 5,592 5,181 17,952 15,313

Fusion of pSVH1 with pK18 via NheI sites Insertion of the 7373 bp BglII fragment into the BamHI site of pK18 Deletion of the 1826 bp HindIII–BamHI fragment of pEB267a Ligation of the 3767 bp PstI–BglII fragment to BamHI/PstI digested pK18 Deletion of the 1048 bp HindIII–AgeI fragment of pEB201a Deletion of the 1415 bp HindIII–Bsp120 fragment of pEB201a Deletion of the 868 bp KpnI fragment of pEB201 Ligation of the 2547 bp PCR fragment to EcoRI/BamHI digested pK18 Insertion of pSLE41 into the single BclI site of pSVH1 Insertion of pK18 into the single PstI site of pSVH1

a

Religation after Klenow polymerase treatment.

3. Results 3.1. Nucleotide sequence analysis of pSVH1 The complete nucleotide sequence of pSVH1 was determined on both strands. According to the sequence pSVH1 had a molecular size of 12,652 bp and a GC content of 71.4%. 11 open reading frames with high coding probability were identiWed with FramePlot (Ishikawa and Hotta, 1999). A restriction map of pSVH1 is included in Fig. 4. Putative functions could be proposed for most genes by sequence similarity to other Streptomyces plasmid-encoded proteins (Table 2). 3.1.1. Replication The rep gene of pSVH1 encodes a protein of 517 aa. It contains all sequence motifs characteristic for Rep proteins of this plasmid group. Highest similar-

ity was observed to the Rep proteins of the S. natalensis plasmid pSNA1 (48% identity, AJ243257.1) and a small cryptic plasmid (34%) from the actinomycete Rhodococcus erythropolis (Kostichka et al., 2003). Fifty-three base pair upstream of the rep start codon there is a sequence with high similarity to the nicking sites of the pIJ101 and pJV1 dso regions (Fig. 1), where Rep nicks the DNA and becomes covalently attached to the 5⬘-end of the DNA (Servín-González, 1993). A 180-bp sequence, located between spdA and traR, resembles the consensus sequence of Streptomyces single stranded origins (sso) (Suzuki et al., 1997a). This sequence contains many direct and inverted repeats and has the ability to form secondary structures (Fig. 2). Downstream of the rep gene orf131 is localized which exhibits a high coding probability. However

Table 2 Characteristics of the pSVH1-encoded genes Name

Position

Length (aa)

aa identitya (%) / aa

To homologue

Putative function

pEN2701_p07 SpdA (pJV1) KorSA (S. avermitilis) SpdB3 (pSG5) Spd79 (pSG5) SpdB2 (pSG5) — TraB (pSG5) Orf193 (pSG5) — — Rep (pSNA1) —

Spreading, regulatory

spdA

1,273–1,764

163

traR

3,407–2,649

252

66/66 55/56 31/248

3,652–3,921 3,918–4,157 4,154–5,383 5,416–5,742 5,824–8,142 8,371–8,967 8,964–9,086 9,151–9,673 10,671–12,224 12,332–74

89 79 409 108 772 198 40 140 517 131

59/74 45/48 50/407 No similarity 72/746 61/144 No similarity No similarity 48%/429 No similarity

spdB3 spd79 spdB2 orf108 traB spd198 spd40 orf140 rep orf131 a

Identity revealed by BLASTp.

Regulator of traB Spreading Spreading Spreading Unknown Transfer Spreading Spreading Unknown Replication Unknown

204

J. Reuther et al. / Plasmid 55 (2006) 201–209

pJV1

CCGCCCCTGGCAAAAAGGGACG ---CCTAG GTA

pSVH1

CGGCGGTCATCAAAAAGGGACG CGGCCTTG GTA

pIJ101 CCGCCCGAGGCAAAAGCGAACA---CCTTG GGA Fig. 1. Proposed nicking site of the pSVH1 dso origin. A sequence located 53 bp upstream of rep of pSVH1 closely resembles the nicking sites of Streptomyces plasmids pIJ101 and pSVH1. Black arrows indicate the nicking sites for pJV1 and pIJ101, as determined by cointegrate experiments (Servín-González, 1993). Bold letters mark conserved residues.

Fig. 2. Conserved sso regions of Streptomyces RCR plasmids. The single stranded origin sso for the initiation of lacking strand synthesis is located between spdA and traR in plasmid pSVH1 and in most other Streptomyces RCR plasmids. Conserved nucleotides are marked by black boxes. Arrows above the aligned sequences indicate repetitive sequences.

BLAST analysis with the ORF131 sequence did not reveal any similarity to other proteins. Subcloning experiments showed that orf131 is not necessary for replication (see below). 3.1.2. Transfer Plasmid pSVH1 encodes a septal DNA translocator protein TraB. Highest similarity (72% over 746 aa) was found to the TraB protein of the Streptomyces ghanaensis plasmid pSG5, to a TraB homologue of the Streptomyces spp. plasmid pFP11 (63%) and to chromosomal FtsK proteins of diVerent bacteria (e.g., Frankia sp. EAN1pec. 33%). Upstream of traB there is a small orf108 without similarity to any protein in the databases.

A series of direct repeats and one inverted repeat are found immediately downstream of traB. Such repeats have been shown to be characteristic for clt loci, required for conjugal plasmid transfer of Streptomyces plasmids (Servín-González, 1996; Ducote et al., 2000). In all conjugative Streptomyces plasmids traB is under transcriptional control of a GntR-type regulator (TraR/KorA) that in most plasmids is divergently transcribed to the transfer gene tra. Also pSVH1 contains a gene (traR) on the opposite strand which encodes a GntR-type regulatory protein (32% identity to “putative GntR-family regulatory protein” SCO4215 of S. coelicolor; and 35% identity to SAV3736 of Streptomyces avermitilis).

J. Reuther et al. / Plasmid 55 (2006) 201–209

3.1.3. Pock formation Several genes with the characteristics of spd genes involved in pock formation and intra-mycelial plasmid spreading were identiWed. spdA encodes a protein of 163 aa with similarity to a 124 aa hypothetical protein of the Streptomyces plasmid pEN2701 (66%), to SpdA of plasmid pJV1 (55%) and to a regulator (43%, EAM82744.1) of Frankia sp. CcI3. Three further putative spd genes (spdB3, spd79, spdB2) possess overlapping start and stop codons, indicating translational coupling of the respective genes. spdB3 encodes an acidic (pI 4.0, 9.564 kDa) protein with an identity to the SpdB3 protein of pSG5 (59%) and to a hypothetical protein (FP11.23c) of plasmid pFP11 (48%). Spd79 contains one predicted transmembrane helix, has an alkaline pI (11.25) and is similar to pFP11.22c (63%) and to Orf80 of pSG5 (45%). SpdB2 is a 409 aa protein with a pI of 9.6. Its predicted structure with four transmembrane helices indicates that SpdB2 is an integral membrane protein. It shows a similarity of 66% over the total length to the SpdB2 protein of pSG5 and of 51% to the pFP11.21c protein. Three genes, probably involved in intra-mycelial plasmid spreading lie downstream of traB. spd198 encodes a protein (21.365 kDa, 10.29 pI) homologous to Orf193 of pSG5 (62% identity) and to a predicted permease (43%, Tfus02002516) of ThermobiWda fusca. The start codon of spd40 which codes for a protein of 40 aa (4.420 kDa, pI 3.43) that does not show any similarity to other proteins overlaps with the stop codon of spd198. Sixty-four base pairs downstream of spd40 lies orf140. The deduced protein (15.69 kDa, pI 4.28) possesses no striking characteristics and does not show any signiWcant similarity to other proteins in databases.

205

3.2. pSVH1 showed a modular composition pSVH1 is an extraordinary example for the modular architecture of Streptomyces plasmids that also was reported previously (Servín-González et al., 1995). As it is pointed out in Fig. 3, pSVH1 is composed of DNA fragments that have their counterparts in various other Streptomyces RCR plasmids. The replication initiator protein Rep is very similar (48% identity) to Rep of pSNA1. The transfer region comprising spdB3, spd79, spdB2, traB, and spd198 closely resembles that of pSG5 (Maas et al., 1998). The N-terminal half of spdA shows similarity to the corresponding region of pEN2701 (Coombs et al., 2003), whereas some non-coding regions are similar to regions from pJV1 (Fig. 3). 3.3. Localization of the minimal replicon of pSVH1 RCR plasmids of the pC194 family carry the double stranded origin dso including the nicking site upstream of the rep gene. Since dso regions are quite diverse and only the nicking sites of Streptomyces dsos show some sequence conservation (see above), it was not possible to identify the pSVH1 dso by similarity to dso regions of other Streptomyces plasmids. To localize the minimal region required for autonomous replication in Streptomyces, a series of subcloning experiments was performed. DiVerent fragments of pSVH1 (Table 1) were inserted into the E. coli vector pK18, carrying the kanamycin resistance gene aphII from Tn5. Because of aphII is expressed in S. lividans from its own promoter, the constructs could directly be tested for their replication ability in Streptomyces (Fig. 4). The 2415 bp ApaI–BglII fragment of pSVH1, carried in plasmid pEB221, mediated autonomous replication in S. lividans. Therefore, the dso of pSVH1 must be located within the 433 bp fragment upstream of rep.

pS VH 1

orf13 1

spdA sso

traR spdB3 spdB2 s pd79 orf108

traB

spd198 orf140 dso spd40

rep

Fig. 3. Modular composition of plasmid pSVH1. A linear map of plasmid pSVH1 is given. Genes are drawn as arrows, dso and sso regions as boxes. Bars above the map show regions of high similarity (>80% identity, BLASTn) to respective regions of other Streptomyces RCR plasmids. Black, similarity to pSNA1; red, to pIJ101; blue, to pEN270I; green, to pJV1; and pink, to pSG5.

206

J. Reuther et al. / Plasmid 55 (2006) 201–209 NheI BglII

BglII

(BamHI)

PstI (AgeI) (ApaI) KpnI BglII

p S VH 1 traR spdB3 spdB2 traB s pd 79 or f1 0 8

spd198 orf140 dso spd40

rep

orf131

spdA sso

(12652 bp)

pEB211 pEB267 pEB277 pEB201 pEB231 pEB221 pEB203 pEB290 Fig. 4. Localization of the pSVH1 minimal replicon by subcloning experiments. A linear restriction map of plasmid pSVH1 is shown. Genes are drawn as grey arrows, the putative sso as a Wlled box. Black bars indicate pSVH1 fragments that mediated autonomous replication in S. lividans, while open bars mark fragments that did not support replication. The dso region identiWed by the subcloning experiments is given as an open box. Restriction sites in parenthesis occur more than once.

3.4. traB represents a kill function Although plasmid pEB267 carried the complete minimal replicon of pSVH1 (Fig. 4) it was unable to replicate in S. lividans. Since plasmid pEB267 contained an intact traB gene but lacked the corresponding transcriptional regulator traR, it was concluded that unregulated expression of traB is toxic and represents a kill function, as it was previously shown for other Streptomyces traB genes (Kendall and Cohen, 1987; Hagège et al., 1993). This assumption was conWrmed by deleting the 5⬘-end of traB (subclone pEB277, Table 1) resulting in a plasmid capable of replication in Streptomyces (Fig. 4). 3.5. spdB79/spdB2 and spd198/spd40 are involved in pock formation Intra-mycelial plasmid spreading in Streptomyces is associated with pock formation. To conWrm the predicted function of the pSVH1 spd genes, inactivation experiments were performed. The spd79 gene was disrupted by the integration of plasmid pSLE41 into the single BclI site located within the spd79 coding region (pEB213, Table 1). Since spd79 probably is translationally coupled with spdB2, expression of spdB2 is also most likely aVected in plasmid pEB213. spd198 was inactivated by the integration of plasmid pK18 into the single PstI site (pEB214, Table 1).

This insertion should also aVect expression of the spd40 located immediately downstrem of spd198. Insertions within spd79 and spd198 abolished pock formation (data not shown), demonstrating that the proteins encoded by the putative spdB3spd79-spdB2 operon and spd198-spd40 are both involved in intra-mycelial plasmids spreading. 4. Discussion Sequence analysis identiWed pSVH1 as a typical Streptomyces RCR plasmid containing only genes involved in replication and conjugative transfer (Grohmann et al., 2003). With the exception of traR, encoding the transcriptional regulator of traB all genes are transcribed in the same orientation as rep. Such a gene organization has been also reported for B. subtilis plasmids and was suggested to be beneWcial for stable replication of RCR plasmids (Meijer et al., 1998). Also, stable replication of bifunctional shuttle vectors derived from the S. ghanaensis plasmid pSG5 (Muth et al., 1988) was increased in S. lividans if all genes were transcribed in the same direction as rep (Muth, unpublished). In agreement with the localization of the double stranded origin dso upstream of rep in the pC194 family of RCR plasmids (www.essex.ac.uk/bs/ staV/osborn/DPR/DPR_RCRdata.htm) the dso of pSVH1 was identiWed by subcloning experiments

J. Reuther et al. / Plasmid 55 (2006) 201–209

in a 433-bp fragment preceding rep. This fragment contains a sequence (Fig. 1) which Wts well to the nicking sites of plasmids pIJ101 and pJV1 that were experimentally determined by cointegration experiments (Servín-González, 1993). By site speciWc mutagenesis, the corresponding region of plasmid pSN22 was also shown to be critical for replication (Suzuki et al., 1997b). Beside the double stranded origin dso, RCR plasmids require a single stranded origin (sso) for the initiation of lagging strand synthesis. The key component of the sso is a ss-DNA promoter recognized by the host RNA-polymerase (Kramer et al., 1997). Alignment of the pSVH1 sequence to functionally characterized sso regions of the Streptomyces plasmids pIJ101 (Deng et al., 1988), pSN22 (Suzuki et al., 1997a) and pSG5 (unpublished results) identiWed a 180-bp region located between traR and spdA (Fig. 2) that displayed high similarity. This region is rich in secondary structures and contains highly conserved sequence motifs that are also found at the corresponding sites on other Streptomyces plasmids. The importance of sso regions for host range and plasmid stability is well documented (Kramer et al., 1999; Meijer et al., 1995). Also in Streptomyces, the incorporation of this sequence (in the correct orientation) in bifunctional shuttle plasmids enhanced stable maintenance by a factor of 100 in the absence of selection (Muth, unpublished). A more close sequence comparison revealed a modular architecture for pSVH1, as it was also previously reported for the replication and transfer functions of plasmids pSN22, pIJ101, and pJV1 (Kataoka et al., 1994a; Servín-González, 1993). pSN22 has a replication protein that is 98% identical to the pIJ101 Rep protein. Its transfer protein TraB, however, shows no similarity to the corresponding pIJ101 Tra (KilA) protein, but is very similar (74% identity) to TraB of pJV1 (Servín-González et al., 1995). Plasmid pSVH1 turned out to be a composite plasmid consisting of fragments that have counterparts in various diVerent plasmids. The plasmid region containing the rep gene shows the highest similarity to the corresponding region of plasmid pSNA1, whereas the transfer (tra) and spd region is more similar to that of plasmid pSG5. Interestingly, only the transfer gene and part of the putative spd genes show similarity to that of pSG5. The regulatory gene traR, controlling the expression of traB and the traB promoter region which probably contains the binding site of TraR are quite diverse sug-

207

gesting that the “transfer module” evolved independent of the regulatory region. The transfer protein TraB of pSVH1 belongs to the septal DNA translocator family of the FtsK family (Begg et al., 1995; Iyer et al., 2004). It contains a NTP-binding motif and two predicted transmembrane helices in its N-terminal half, suggesting that TraB is incorporated into the membrane. Membrane localization of TraB has been already demonstrated for Tra of pIJ101 (Pettis and Cohen, 1996) and TraB of pSN22 (Kosono et al., 1996). Kosono et al. (1996) showed that the NTP-binding site of pSN22 TraB is essential for conjugative transfer. Although TraB of pSVH1 and TraB of pSG5 are very similar (72% identity) in sequence, they show a striking diVerence. While unregulated expression of pSG5 traB only causes temporal retardation of morphological diVerentiation (Maas et al., 1998), pSVH1 TraB is a kill function, as it was also reported for the TraB homologues of other Streptomyces plasmids (Hagège et al., 1993; Kendall and Cohen, 1987; Servín-González et al., 1995). One explanation for the diVerent toxicity could be diVerent expression levels due to a gene dosage eVect, since pSVH1 has a higher copy number compared to pSG5 (Labes et al., 1990). Also the spread genes of pSG5 and pSVH1 have very similar sequences but have distinct functions. Plasmid pSVH1 is a pock forming plasmid, that produces macroscopic visible inhibition zones during transfer (Wohlleben et al., 1994), whereas conjugative transfer of pSG5 is not associated with pock formation (Maas et al., 1998). Missing promoter activity in front of the spdB3-orf80-spdB2 operon was speculated to be responsible for the defect in plasmid spreading (Grohmann et al., 2003). Because of expression of TraB of pSVH1 and other Streptomyces plasmids is toxic, traB expression is repressed by the GntR-type regulator TraR. The signal responsible for traB induction during conjugation is not known. For the integrative plasmid pSAM2 a plasmid encoded nudix hydrolase (pif) was shown to be involved in the repression of conjugal transfer (Possoz et al., 2003). This suggested the substrate (a nucleotide diphosphate linked to some other moiety x) of the nudix hydrolase to be involved in the regulation of plasmid excision and transfer. However, such nudix hydrolases are only encoded by integrative plasmids as pMEA (Vrijbloed et al., 1995), pSAM2(Possoz et al., 2003), pSA1.1(Tomura et al., 1993), pSLS (AB093554) but are not found on pSVH1 or any other Streptomyces

208

J. Reuther et al. / Plasmid 55 (2006) 201–209

plasmid. Therefore it is unlikely that such nucleotide diphosphates play a general role in controlling Streptomyces conjugation. Acknowledgments Thanks to Eriko Takano for fruitful discussion and many helpful comments on the manuscript and to Michaela Meyfeld for excellent technical assistance. This research was supported by the Landesstiftung Baden-Württemberg GmbH “Kompetenznetzwerk Resistenz.” References Begg, K.J., Dewar, S.J., Donachie, W.D., 1995. A new Escherichia coli cell division gene, ftsK. J. Bacteriol. 177, 6211–6222. Bibb, M.J., Ward, J.M., Kieser, T., Cohen, S.N., Hopwood, D.A., 1981. Excision of chromosomal DNA sequences from Streptomyces coelicolor forms a novel family of plasmids detectable in Streptomyces lividans. Mol. Gen. Genet. 184, 230–240. Birr, E., Wohlleben, W., Aufderheide, K., Schneider, T., Pühler, A., Bräu, B., Marquardt, R., Woehner, G., Praeve, P., Schlingmann, M., 1989. Isolation and complementation of mutants of Streptomyces coelicolor “Mueller” DSM3030 deWcient in lysozyme production. Appl. Microbiol. Biotechnol. 30, 358–363. Bullock, W.O., Fernandez, J.M., Short, M.J., 2000. XL1-blue, a high eYciency plasmid transforming recA Escherichia coli strain with beta galactosidase selection. Bio/Techniques 5, 376–378. Coombs, J.T., Franco, C.M., Loria, R., 2003. Complete sequencing and analysis of pEN2701, a novel 13-kb plasmid from an endophytic Streptomyces sp. Plasmid 49, 86–92. Deng, Z.X., Kieser, T., Hopwood, D.A., 1988. “Strong incompatibility” between derivatives of the Streptomyces multi-copy plasmid pIJ101. Mol. Gen. Genet. 214, 286–294. Ducote, M.J., Prakash, S., Pettis, G.S., 2000. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region. J. Bacteriol. 182, 6834–6841. Grohmann, E., Muth, G., Espinosa, M., 2003. Conjugative plasmid transfer in gram-positive bacteria. Microbiol. Mol. Biol. Rev. 67, 277–301. table. Hagège, J., Pernodet, J.-L., Sezonov, G., Gerbaud, C., Friedmann, A., Guérineau, M., 1993. Transfer functions of the conjugative integrating element pSAM2 from Streptomyces ambofaciens: characterization of a kil-kor system associated with transfer. J. Bacteriol. 175, 5529–5538. Hopwood, D.A., Kieser, T., 1993. Conjugative plasmids of Streptomyces. In: Clewell, D.B. (Ed.), Bacterial Conjugation. Plenum Press, New York, pp. 293–311. Hopwood, D.A., Kieser, T., Wright, H.M., Bibb, M.J., 1983. Plasmids, recombination and chromosome mapping in Streptomyces lividans 66-. J. Gen. Microbiol. 129, 2257–2269. Ishikawa, J., Hotta, K., 1999. FramePlot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G + C content. FEMS Microbiol. Lett. 174, 251–253.

Iyer, L.M., Makarova, K.S., Koonin, E.V., Aravind, L., 2004. Comparative genomics of the FtsK-HerA superfamily of pumping ATPases: implications for the origins of chromosome segregation, cell division and viral capsid packaging. Nucleic Acids Res. 32, 5260–5279. Kataoka, M., Kiyose, Y.M., Michisuji, Y., Horiguchi, T., Seki, T., Yoshida, T., 1994a. Complete nucleotide sequence of the Streptomyces nigrifaciens plasmid, pSN22: genetic organization and correlation with genetic properties. Plasmid 32, 55– 69. Kataoka, M., Kosono, S., Seki, T., Yoshida, T., 1994b. Regulation of the transfer genes of Streptomyces plasmid pSN22: in vivo and in vitro study of the interaction of TraR with promoter regions. J. Bacteriol. 176, 7291–7298. Kataoka, M., Seki, T., Yoshida, T., 1991. Regulation and function of the Streptomyces plasmid pSN22 genes involved in pock formation and inviability. J. Bacteriol. 173, 7975–7981. Kendall, K.J., Cohen, S.N., 1987. Plasmid transfer in Streptomyces lividans: IdentiWcation of a kil-kor system associated with the transfer region of pIJ101. J. Bacteriol. 169, 4177–4183. Kieser, T., Hopwood, D.A., Wright, H.M., Thompson, C.J., 1982. pIJ101, a multi-copy broad host-range Streptomyces plasmid: functional analysis and development of DNA cloning vectors. Mol. Gen. Genet. 185, 223–238. Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., Hopwood, D.A., 2000. Practical Streptomyces Genetics. The John Innes Foundation, Norwich. Kinashi, H., Shimaji, M., 1987. Detection of giant linear plasmids in antibiotic producing strains of Streptomyces by the ofage technique. J. Antibiot. (Tokyo) 40, 913–915. Kosono, S., Kataoka, M., Seki, T., Yoshida, T., 1996. The TraB protein, which mediates the inter-mycelial transfer of the Streptomyces plasmid pSN22, has functional NTP-binding motifs and is localized to the cytoplasmic membrane. Mol. Microbiol. 19, 397–405. Kostichka, K., Tao, L., Bramucci, M., Tomb, J.F., Nagarajan, V., Cheng, Q., 2003. A small cryptic plasmid from Rhodococcus erythropolis: characterization and utility for gene expression. Appl. Microbiol. Biotechnol. 62, 61–68. Kramer, M.G., Khan, S.A., Espinosa, M., 1997. Plasmid rolling circle replication: identiWcation of the RNA polymerasedirected primer RNA and requirement for DNA polymerase I for lagging strand synthesis. EMBO J. 16, 5784–5795. Kramer, M.G., Espinosa, M., Misra, T.K., Khan, S.A., 1999. Characterization of a single-strand origin, ssoU, required for broad host range replication of rolling-circle plasmids. Mol. Microbiol. 33, 466–475. Labes, G., Simon, R., Wohlleben, W., 1990. A rapid method for the analysis of plasmid content and copy number in various Streptomycetes grown on agar plates. Nucleic Acids Res. 18, 2197. Maas, R.M., Goetz, J., Wohlleben, W., Muth, G., 1998. The conjugative plasmid pSG5 from Streptomyces ghanaensis DSM 2932 diVers in its transfer functions from other Streptomyces rolling-circle-type plasmids. Microbiology 144, 2809–2817. Meijer, W.J., van der Lelie, D., Venema, G., Bron, S., 1995. EVects of the generation of single-stranded DNA on the maintenance of plasmid pMV158 and derivatives in Lactococcus lactis. Plasmid 33, 91–99. Meijer, W.J., Wisman, G.B., Terpstra, P., Thorsted, P.B., Thomas, C.M., Holsappel, S., Venema, G., Bron, S., 1998. Rolling-circle plasmids from Bacillus subtilis: complete nucleotide sequences

J. Reuther et al. / Plasmid 55 (2006) 201–209 and analyses of genes of pTA1015, pTA1040, pTA1050 and pTA1060, and comparisons with related plasmids from grampositive bacteria. FEMS Microbiol Rev. 21, 337–368. Muth, G., Farr, M., Hartmann, V., Wohlleben, W., 1995. Streptomyces ghanaensis plasmid pSG5: nucleotide sequence analysis of the self-transmissible minimal replicon and characterization of the replication mode. Plasmid 33, 113–126. Muth, G., Wohlleben, W., Pühler, A., 1988. The minimal replicon of the Streptomyces ghanaensis plasmid pSG5 identiWed by subcloning and Tn5 mutagenesis. Mol. Gen. Genet. 211, 424– 429. Pettis, G.S., Cohen, S.N., 1994. Transfer of the pIJ101 plasmid in Streptomyces lividans requires a cis-acting function dispensable for chromosomal gene transfer. Mol. Microbiol. 13, 955– 964. Pettis, G.S., Cohen, S.N., 1996. Plasmid transfer and expression of the transfer (tra) gene product of plasmid plJ101 are temporally regulated during the Streptomyces lividans life cycle. Mol. Microbiol. 19, 1127–1135. Pettis, G.S., Ward, N., Schully, K.L., 2001. Expression characteristics of the transfer-related kilB gene product of Streptomyces plasmid pIJ101: implications for the plasmid spread function. J. Bacteriol. 183, 1339–1345. Possoz, C., Gagnat, J., Sezonov, G., Guerineau, M., Pernodet, J.L., 2003. Conjugal immunity of Streptomyces strains carrying the integrative element pSAM2 is due to the pif gene (pSAM2 immunity factor). Mol. Microbiol. 47, 1385–1393. Pridmore, R.D., 1987. New and versatile cloning vectors with kanamycin-resistance marker. Gene 56, 309–312. Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M.A., Barrell, B., 2000. Artemis: sequence visualization and annotation. Bioinformatics 16, 944–945. Sambrook, J., Fritsch, E.F., Manatis, T., 1989. Molecular cloning. A laboratory manual, second ed. Cold Spring Harbour, USA. Servín-González, L., 1993. Relationship between the replication functions of Streptomyces plasmids pJV1 and pIJ101. Plasmid 30, 131–140. Servín-González, L., 1996. IdentiWcation and properties of a novel clt locus in the Streptomyces phaeochromogenes plasmid pJV1. J. Bacteriol. 178, 4323–4326. Servín-González, L., Sampieri, A., Cabello, J., Galván, L., Juárez, V., Castro, C., 1995. Sequence and functional analysis of the

209

Streptomyces phaeochromogenes plasmid pJV1 reveals a modular organization of Streptomyces plasmids that replicate by rolling circle. Microbiology 141, 2499–2510. Staden, R., Beal, K.F., BonWeld, J.K., 2000. The Staden package, 1998. Methods Mol. Biol. 132, 115–130. Strauch, E., Wohlleben, W., Pühler, A., 1988. Cloning of a phosphinothricin N-acetyltransferase gene from Streptomyces viridochromogenes Tu494 and its expression in Streptomyces lividans and Escherichia coli. Gene 63, 65–74. Suzuki, I., Kataoka, M., Seki, T., Yoshida, T., 1997a. Three singlestrand origins located on both strands of the Streptomyces rolling circle plasmid pSN22. Plasmid 37, 51–64. Suzuki, I., Seki, T., Yoshida, T., 1997b. Nucleotide sequence of a nicking site of the Streptomyces plasmid pSN22 replicating by the rolling circle mechanism. FEMS Microbiol. Lett. 150, 283– 288. Tai, J.T.N., Cohen, S.N., 1993. The active form of the KorB protein encoded by the Streptomyces plasmid pIJ101 is a processed product that binds diVerentially to the two promoters it regulates. J. Bacteriol. 175, 6996–7005. Tomura, T., Kishino, H., Doi, K., Hara, T., Kuhara, S., Ogata, S., 1993. Sporulation-inhibitory gene in pock-forming plasmid pSA1.1 of Streptomyces azureus. Biosci. Biotechnol. Biochem. 57, 438–443. Vrijbloed, J.W., Van der Put, N.M.J., Dijkhuizen, L., 1995. IdentiWcation and functional analysis of the transfer region of plasmid pMEA300 of the methylotrophic actinomycete Amycolatopsis methanolica. J. Bacteriol. 177, 6499–6505. Wohlleben, W., Hartmann, V., Hillemann, D., Krey, K., Muth, G., Nussbaumer, B., Pelzer, S., 1994. Transfer and establishment of DNA in Streptomyces (a brief review). Acta Microbiol. Immunol. Hung. 41, 381–389. Wohlleben, W., Muth, G., 1993. Streptomyces plasmid vectors. In: Hardy, K.G. (Ed.), Plasmids: A Practical Approach. Oxford University Press, Oxford, pp. 147–175. Wohlleben, W., Muth, G., Birr, E., Pühler, A. (1986). A vector system for cloning in Streptomyces and Escherichia coli. In: Proc. Int. Symp. Biol. Actinomycetes. Akademiai Kiado, Budapest, pp. 99–102. Wohlleben, W., Pühler, A., 1987. The Streptomyces ghanaensis low copy plasmid pSG2 and its use for vector construction. Arch. Microbiol. 148, 298–304.