Modular structure of a chicken lysozyme silencer: Involvement of an unusual thyroid hormone receptor binding site

Cell, Vol. 61, 505-514.

May 4, 1990, Copyright

0

1990 by Cell Press

Modular Structure of a Chicken Lysozyme Sirwet: lnvohrement of an Unusual Thyroid Hormone Fbceptor Binding Site Aria Baniahmad, Christof Steiner, Anja Carola Kohne, and Rainer Renkawitz Genzentrum Max-Planck-lnstitut fur Biochemie D-8033 Martinsried Federal Republic of Germany

Summary Silencer elements, by analogy to enhancer elements, function independently of their position and orientation. We show that the chicken lysozyme silencer S-2.4 kb has many other characteristics in common with enhancer elements. The silencer is comprised of modules that independently repress gene activityrepression being increased synergistically when different or identical modules are combined. Repression is effective both on a complete and on a minimal promoter consisting of a TATA box only. One silencer module is bound in vitro by a 75-93 kd protein, termed NePl; the other can be bound either by the product of the oncogene v-e&A or by the thyroid hormone receptor. This erbA binding site is unusual in that the palindromic sequence is inverted. Introduction Regulation of gene transcription can be controlled by positive and negative regulatory sequences; a combination of both is frequently responsible for the observed expression patterns. Negative regulation mediated via specific DNA sequences may be envisaged to involve either local position-dependent interference with positive regulatory factors or a distance-independent effect analogous to that of enhancers. Elements with these latter properties have been termed silencers (Brand et al., 1985) and have been found near a number of genes (Rosen et al., 1985; Miyazaki et al., 1986; Saffer and Thurston, 1989; Park and Craig, 1989; Hata et al., 1989). Although in many cases the term “silencer” has been used quite loosely for any negative element, we use this term here as it was originally defined: for an element mediating a position-and orientation-independent repression. Several enhancer and silencer elements have been described upstream of the chicken lysozyme gene (Theisen et al., 1986; Baniahmad et al., 1987; Steiner et al., 1987; Altschmied et al., 1989; for a review see Sippel and Renkawitz, 1989). Most of these elements show cell typespecific activities, with enhancer elements being active in promacrophages and mature macrophages and silencers being inactive in mature macrophages only. The combined activity of all of these elements control macrophagespecific expression of the lysozyme gene. In particular, we have been interested in analyzing the silencer at -2.4 kb upstream of the transcriptional start site, since its activity correlates with the presence of a DNAase I-hypersensi-

tive site in the chromatin (Steiner et al., 1987; Sippel et al., 1988) and it is located next to a macrophage-specific enhancer (E-2.7 kb; Steiner et al., 1987; Altschmied et al., 1989). We wanted to know whether this silencer acts via repression of enhancer activity or directly on the promoter and whether it binds nuclear factors, and, if so, whether binding sites for these factors are silencer specific or are also found in positive elements. Here we describe the modular structure of the silencer S-2.4 kb. We have found synergistic repression by these modules and determined that at least one of them can exert repression on the TATA box. This module is an unusual erbA binding site with an inverted palindromic sequence, which mediates a thyroid hormone response, and is a weak responsive element for the retinoic acid receptor. Results The Silencer “Core” Contains Two Nuclear Factor Binding Sites We have previously shown that a 300 bp fragment located 2.4 kb upstream of the lysozyme transcriptional start site reduces transcription from a heterologous promoter (Steiner et al., 1987). To identify the borders of a minimal functional silencer we generated and tested 5’ and 3’ deletions (Figure 1). For transfections we chose a chicken erythroblast cell line (HD3), since the silencer repressed transcription very strongly in these cells and chromatin analysis revealed a DNAase l-hypersensitive site at position -2.4 kb in erythroblast chromatin (Sippel et al., 1988). Transfection into HD3 cells revealed 5’ and 3’ borders of a functional silencer core, covering a region of about 100 bp. The smallest fragment in the 5’ deletion series retains weak tkCAT repression due to the presence of a part of the silencer core (see below). A complete silencer core element showed full transcriptional repression (compare S-2.4 kb with core in Figure 4). We performed footprinting experiments to identify HD3 nuclear proteins binding to this silencer core. We found two prominent footprints, Fl and F2 (Figure 2). Each of these was specifically competable by an oligonucleotide containing its own sequence (Figure 2) suggesting that the proteins binding to Fl and F2 are different. Since Fl covered a region of about 50 bp, we wondered whether this long stretch could be subdivided into several protein binding sites. Therefore, we competed the footprint reactions with small oligonucleotides representing only short stretches of region Fl (Fl-1 to Fl-4 in Figure 2A). An unspecific improvement of the footprint was observed with short oligonucleotides; competition was only seen with the complete Fl sequence. In addition, the S’deletion mutant -2400 of the silencer, which removes only the 5’ end of the Fl sequence, prevents the formation of the whole Fl footprint (Figures 28 and 2D) arrd is similarly impaired in silencing as a deletion of almost the complete Fl sequence (mutant -2372, Figure 1A). One possible interpretation of this result is that a single nuclear protein in-

Cdl 506

o.oJ... I....I.......,,....,I....’ -2500

-2450

-2400

-2350

-2300

-I ~~~~~~~~~~~IIIIIIIIII~IIII~.. 5*- Deletions

0.01

-2500

-2450

-2400

-2248-l

-2350

-2300

-1

c

Figure

-2547

1. Delineation

3’- Deletions of the Silencer

...~~~~ll~~~~~~~~~~~~~~~~~~~~~

Core

5’ and 3’ deletions of the S-2.4 kb silencer have been generated and fused to the tkCAT reporter gene. 5’ deletions (A) and 3’ deletions (6) were transfected into HD3 erythroblasts. CAT activities measured are calculated relative to tkCAT expression without silencer sequences. The silencer core region is indicated by dark stippling.

teracts with the DNA over the complete 50 bp of the Fl sequence. To analyze the binding to Fl in detail, we carried out band shift experiments (Fried and Crothers, 1981; Garner and Revzin, 1981) with the Fl probe (Figure 3A). Three retarded bands are apparent. One of them (arrowhead) could only be competed with the complete Fl sequence; competition with parts of the sequence or with binding sites for nuclear factor 1 and CAAT box binding protein did not compete the major band, whereas the other bands were competed unspecifically. To demonstrate that the major retarded band is generated by the same DNA-protein complex causing the Fl footprint, we used a band shift/footprint combination (Piette and Yaniv, 1988). As seen in Figure 38 the footprint of the isolated retarded complex is identical to the footprint obtained with total nuclear extract (Figure 2C). To address the question of whether the retarded complex contains multiple protein molecules, we used a linear dilution series of nuclear extract down to 0.08 ug of protein per band shift reaction but found no evidence for cooperative binding of multiple proteins (data not shown). In addition, we applied HD3 nu-

clear extract on an SDS-polyacrylamide gel and cut out gel slices containing different molecular weight fractions. Upon elution, denaturation, and renaturation, we tested each protein fraction in a band shift reaction. As a control, unfractionated nuclear extract was treated in this way (Figure 3C, lane 14) and showed the specifically retarded band, while some of the unspecific bands were diminished in intensity. Since asingle protein fraction with a molecular size of 75-93 kd generated the same band shift as seen with unfractionated nuclear extract (Figure 3C, lane 18; only two of the nonbinding fractions are shown), it is very likely that a single protein species generates the observed band shift. In some cases, binding of otherwise positive transcription factors has been seen within negative regulatory regions (Distel et al., 1987; Sassone-Corsi et al., 1987; Buchman et al., 1988; Weisinger et al., 1988; Goodbourn and Maniatis, 1988; Fujita et al., 1988; Lenardo et al., 1989; Konig et al., 1989; Shaw et al., 1989; Hay et al., 1989; Takimoto et al., 1989). Fl competitions with binding sites for activating proteins 1 to 4 (Apl, Ap2, Ap3, and Ap4), SV40 promoter protein 1 (Spl), octamer transcription factor 1, CAAT box binding protein, nuclear factor 1, or oligonucleotides containing a metal responsive element, the CACCC box, or the lysozyme silencer S-O.25 kb (Baniahmad et al., 1987) did not have any effect on the major retarded band (Figure 3A; only a few examples are shown). Since the protein binding to Fl appears to be a novel nuclear factor, we call it negative protein 1 (NePl). It should be noted that although the silencer S-2.4 kb is active in several cell types, with the exception of mature macrophages (Steiner et al., 1987), band shift experiments with nuclear protein extracts from chicken erythroblasts (HD3), primary chicken embryo fibroblasts (CHEF), or primary chicken mature macrophages (MPH) revealed in all cell types the presence of similar NePl binding activity in vitro (Figure 3A). A similar analysis of the F2 footprint region, which consists of a striking palindromic stretch of DNA (Figure 2D), revealed that either half of the palindrome (1/2F2-1 or 1/2F22) competed for the whole footprint window F2, although much less efficiently than did the complete palindrome (Figure 2C). Band shift experiments with the F2 probe resulted in one prominent retarded band, which could be specifically competed. Since F2 and a binding site for the positive transcription factor Ap4 (Mermod et al., 1988) are identical over 9 out of 10 nucleotides, we carried out band shift competitions with an Ap4 oligonucleotide. Surprisingly, this had no effect on the major retarded band (Figure 3D). Similarly, none of the other binding sequences listed above could compete (only Apl competition is shown in Figure 3D). Analysis of the tissue specificity revealed that the F2 binding activity is absent from nuclear extract from primary mature macrophages, which is the cell type lacking both S-2.4 kb silencer activity (Steiner et al., 1987) and a DNAase l-hypersensitive site at -2.4 kb in the chromatin (Fritton et al., 1984). We conclude that the functional core of the silencer S-2.4 kb is composed of two different nuclear factor binding sites, one for NePl and one for a factor that is specifi-

;;;ncer

Modules

B;2414

-2400Q

0

00

1 F2

F2

F2

a D

F2 ,",~-2400 F1 F ,,,*.."II,*"*""-"**W.""".,.,."".,.,,..~"."." ".,,~,,,,,,",,,,* ,,,,,,*,,*,,,,,*"l,,llll.l.**,,,**..,"".~,."".l.~.l*l.*"l.l~**~".l".~."~" CTCTRCTGGRTRGCTRTGGTRTTTRCRTTCTTTTTGCTTRGTTRCTTATTGRCCCCAtCTGAGGTC~GTTRCG -2326 -2417 4 GTRCTTCTTTRRCTCTGGRGRTGRCCTRTCGRTRCCRTRRRTGTRCRGRRRRRCGRRTCRRTGRRTRRCTGGGGTCGRCTCCRGTTCRRTGC ,,,,,,,.,,,,,,,,,,,,,,,,, .,.l.l..l.llll.l,llllll w,l,.l.lll."lllllllll*~~~~~~~~.~~~,,,,,,,,~~~~~~ 1.1111111,,,,,,,1.,,,,.,..,,,,.,,,,,,",,,,".,.,.,,,,,,,,,,,,,,~,~ 111111111111..1.".".,",,,,,,,. -2414

cRT&RTTGRGR

Fl

F2I

Fl-I-----

?F2-l-

-$F2-2-

Fl-2 -Fl-3Fl-4

Figure

2. Fl and F2 Footprints

on the S-2.4

kb Silencer

DNAase I footprints

after incubation of the DNA with HD3 nuclear extract or without extract (circled minus signs) are compared. No competitor (I), or Fl and F2 competitors as indicated in (D), or the mutagenized F2 oligonucleotide (FZmut), which is identical to F2 except for the palindromic part being exchanged with a different sequence (see Experimental Procedures), were used. Ten picomoles of competitor was added in all cases except for the lower of the two concentrations used with the MF2 oligonucleotides and the F2 competition on the antisense strand (3 pmol). The extent of the footprints is indicated next to the autoradiogram. Different probes were used for the footprint reactions: (A) Whole S-2.4 kb silencer, sense strand (s). (B) 5’ deletion mutants -2414 and -2400 of the silencer sense strand. (C) Whole silencer, antisense strand (a). (D) Sequence of the central part of the S-2.4 kb silencer with positions relative to the transcriptional start site. S’deletions -2414, -2400, and -2372 are indicated, footprint regions for both strands are shown above and below the sequence, and the palindromic sequence is pointed out by the two arrows. The oligonucleotides used are shown below the sequence

caky missing macrophages.

or is in a DNA nonbinding

form in mature

Fl and F2 Are Functional Silencer Modules The deletion experiments suggested that full silencing activity can only be achieved when both Fl and F2 footprint regions are intact. This is reminiscent of the modular structures described for enhancer sequences (for review see Dynan, 1989). To analyze the functional activity of Fl or F2 individually, we multimerized either Fl or F2 and cloned these fragments in front of the tkCAT fusion gene. Figure 4 shows the CAT activities achieved after transfection into HD3 cells. F2 as a single unit in sense or antisense orientation represses transcription to about onesixth of that of the tkCAT reference gene. Multimerization to a dimer or a trimer leads to a further reduction. As a control, we used a mutagenized F2 sequence (F2mut saa), in which the palindromic sequence was exchanged with a neutral sequence (C*; Schiile et al., 1988a). This construct does not reduce tkCAT expression. In addition, we cloned the trimer of F2 further upstream at position -360 bp. This construct showed reduced expression com-

parable with the full silencer S-2.4 kb cloned in sense or antisense at the same position. Half of the palindromic F2 sequence (V2F2-1) is negative by itself; the reduced expression is about one-half of the tkCAT activity. This silencing activity explains the weak repression seen with the smallest of the 5’ deletion constructs (compare Figure 1). Half palindrome multimers in head-to-tail orientation (sss) or head-to-head orientations (sa) show a reduction comparable with the original F2 sequenlce. Multimerization of the Fl sequence led to effects qualitatively similar to those seen with F2, although the degree of reduction was much lower. Thus, we conclude that the silencer core sequence is composed of two functional modules (Fl and F2) that reduce expression by themselves, upon multimerization, or if combined. To shed some light on the silencing mechanisms, it is important to know whether a silencer acts upon specific positive transcription factors within a promoter. In addition to the cloning sites at -360 and -109, we used 5’ deletions of the tk promoter retaining nucleotides up to position -95, -70, or -37, which have lost the distal Spl binding site, the CAAT box, and the proximal Spl site,

Cell 508

1234

5678

Fl Figure

91011

12 13

probe

3. Nuclear

14

16

Fl*

Extract

Binding

18

Fl

20

22

24

probe

26

28

F2 probe

to the Fl and F2 Probes

Nuclear extracts from HD3 erythroblasts (HD3), HDll promacrophages (HDll). primary chicken embryo fibroblasts (CHEF), or primary chicken mature macrophages (MPH) were incubated with the Fl or F2 probe and separated on a polyacrylamide gel. Two picomoles of each competitor oligonucleotide was used: Fl or F2 sequences (as In Figure ZD), APl, AP4, nuclear factor 1 (NFl). or CAAT box binding protein (CBP) sequences (see Experimental Procedures), or no competitor (I), as indicated above the lanes. (A) Nuclear extracts incubated with the Fl probe. (E) Cloned antisense Fl sequence (see Experimental Procedures) was incubated with HD3 nuclear extract (HD3) or without extract (circled minus sign), digested with DNAase I, and applied on a band shift gel. The retarded complex was isolated and loaded on a sequencing gel. The extent of the Fl footprint is indicated next to the autoradiogram. (C) Probe Fl incubated with denatured and renatured HD3 nuclear extract (lanes 14 and 15) or with SDS-polyacrylamide gel-purified protein fractions. Molecular sizes (in kd) are indicated at the top of the figure. (D) Nuclear extracts incubated with the F2 probe.

Relative 1 I

0.8 I

CAT activity 0.6 I

0.4 I

0.2 I

0 ,-lo9

ik CAT L

_/y H m -

+-H -

+ clll

4. Functional

Modules

of the Silencer

-2.24 -2.31 -a4P

xlQz%

/ $F2-1s $F2-1sa !F2-lsss H fF2-lsaaaa

FZaas FZaas FEaas FZaas Figure

-

FZS Fza F&S Fzaa I FZaas FEmuf saa

+ D-a

-4 +

S-2.4s -360 S-2.4a -360 FZaas -360 tk-109 tk-95 tk-70 ik-37

CAT

--_

-2.41 -

1 Fls Flas Flsss

-

Monomers into HD3 deletions endpoint. site, 250

-2.54

S-2.45 core

tk

L( H-

b

‘I--@~4

’O

M

-109 M

;;

-95 m

-70 w

-37

CAT CAT lk CAT tk CAT

Core

or mummers of the F2- or Fl-based oligonucleotides (see Figure 2) have been cells, CAT activities were calculated relative to tkCAT expression, except for the are always compared with mutagenized triple F2 sequences (FPmutsaa; stippled The orientation of the monomers is indicated (sense, s; antisense, a). For cloning bp upstream of position -109 of the promoter.

cloned in front of IkCAT. After transfection of constructs tkCAT promoter deletions (below the dotted line); these bars) cloned in front of each respective promoter deletion sequences at position -360, we utilized the vector Ndel

ziilncer

Modules

TREpai

Figure 5. Sequence Binding Site

agcttTcAGGTCATGACCtgAaagct

F2

ttatTfGI;ACCCCAqcTwagttacq

TRE /ap

agctT=cgTcAGGTCAagct

jF2-Isa

cagc~agttacgcgtaact~crcta

A~

respectively (McKnight, 1982). At these positions we cloned the trimeric F2 sequence (FPaas) and compared the activity of these constructs with the effect of the neutral, mutagenized F2 trimer (F2mut saa) on each of the promoter deletions. As seen in Figure 4, tkCAT activity is repressed in all of the FPaas constructs even when the promoter retained only a TATA box. Quantitatively, however, repression is stronger on the complete promoter (-109). These data show that many of the characteristics of a silencer are exactly the same as those described for enhancer elements: the silencer is made up of functional modules repressing gene activity by themselves or upon multimerization, and at least one module can repress gene activity from a distance or from a minimal promoter containing a TATA box only.

The palindromic erbr\ bindina site TREoal (Glass et al., 1988) is compared-with the F2 bequence. with an inverted TdlE sequence (TRElap). and with a dimar of two palindromic F2 half sites(1/zF2-1sa). Capital letters indicate homologies to the palindromic halves of the F2 sequence.

>

B

A

0

HD3

3 4

5 6

78

9.11

F2 Figure

with an e&l

vealed only two marked homologies with F2. One was the homology with an AP4 binding site that turned out to be of no apparent consequence, since an AP4 binding site did not compete for F2 band shifts (see Figure 3D). The other homology is indicated in Figure 5. Each half of the palindromic sequence F2 is homologous to both halves of a palindromic binding site for erbA or a thyroid hormone receptor (TREpal; Glass et al., 1988) but they are arranged in an inverted orientation. The erythroblast cell line HD3, in which the silencer S-2.4 kb is highly active, was generated by transformation with the avian erythroblastosis virus, a retrovirus containing the v-erbA gene (Beug et al., 1982). This raises the possibility that the v-erbA gene product contributes to the F2 binding activity. Therefore, we compared the binding of proteins to the F2 sequence with the binding to TREpal in band shift competitibns. Band shifts with either F2 or TREpal as a probe were competed by either oligonucleotide (Figure 6A). There is a difference in affinity: F2 competed the F2 band shift about lo-fold more

F2 Is an Unusual e&l Binding Site Extensive computer searches for transcription factor binding sites homologous to either Fl or F2 sequences re-

12

Comparison

6. Band Shift Experiments

.13.15

.17.

19.

TREpal Prove

HD3

21.

extract

23.

25

F2 the e&l

Binding

,

HD3

27

.29.31

+F2-1

hGR468

32

---

34

HD3

36

cos

38

v-erbA

40

42

F2

to the F2 Sequence

Nuclear extract from HD3 cells and whole-cell extracts from HD3 and COS cells were incubated with the probes indicated below the autoradiogram. Competitors used are indicated above the lanes (sequences are shown in Figures 2 and 5); no competitor (I) and no extract (circled minus signs) were included for comparison. (A) F2 and TREpalcomparison. Increasing concentrations of competitor (0.2.0.7, and 2 pmol) are indicated by gradients. Where no gradient is shown, 2 pmol was used. (B) The effect of a linear Increase in extract amount from 0.06 ug to 4 pg of protein per lane is shown. The specific band of idehtical size seen with VzF2-1 and F2 is indicated by the arrow. The band below is due to unspecific protein binding to single-stranded DNA within the double-stranded palrndromic probe used, caused by the low amount of unspecific competitor requrred to increase the sensitivity. Lane 27 contains the same amount and specific activities of the probe as lanes 28-31. Autoradiographic exposure is identical for lanes 27-31. (C) COSI cells were mock-transfected or transfected with expression vectors coding for v-e&I or hGR468, a human glucocort$oid receptor mutant (amino acids l-468) deficient in DNA binding. Whole-cell extracts of these or of HD3 cells were incubated with the F2 probe and the indicated competitors.

Cell 510

efficiently than TREpal, which in turn was about 5fold more effective than half of the palindromic F2 oligonucleotide (%F2-1). The somewhat weaker shift of the TREpal probe is efficiently competed with either oligonucleotide (Figure 6A), with F2 being the stronger competitor (data not shown). A different binding sequence (Spl) cannot compete. Apparently both palindromes bind and compete for the same factor(s), irrespective of the palindrome orientation. It has been shown that TREpal or similar sequences can be bound by the thyroid hormone receptor, by the v-e&A gene product, or by the retinoic acid receptor (Glass et al., 1987; Umesono et al., 1988; Damm et al., 1989; Graupner et al., 1989; Sap et al., 1989). Since it had been established that the palindromic binding sequence of several steroid receptors and related factors is bound by a dimeric protein complex, we wondered whether the increased binding affinity to F2 as compared with %F2-1 might be due to a cooperative binding of two protein molecules. This does not seem to be the case, since a linearly increased amount of nuclear extract leads to a linear increase in the amount of retarded F2 DNA (Figure 66) with the mobility of the complex being identical at all protein concentrations. This suggests that the palindromic F2 sequence binding protein is either a monomer or forms a dimer in solution before binding, as has been shown for the estrogen receptor (Kumar and Chambon, 1988; for review see Beato, 1989) and for a heterodimer of the receptors for thyroid hormone and retinoic acid (Glass et al., 1989). A dimerization before binding implies that half a palindromic sequence could be bound by a dimerit protein as well, leading to a band shift of identical mobility to that of the palindromic sequence. This is precisely what we found: F2 and %F2-1 show a retarded complex of identical mobility (Figure 66, lanes 27 and 28) although with a high difference in affinity. The %F2-1 complex can be competed by either half (%F2-2 or %F2-1) or by the palindromic F2 sequence. To directly prove that the shifted band formation is dependent on v-e&A expression, we transfected COS cells with a replicating expression vector coding for v-e&A. Incubation of whole-cell extract from these transfected cells with the F2 probe resulted in a retarded band identical to the one seen with HD3 extract. As a control, extracts from mock-transfected COS cells or from cells transfected with a vector expressing a nonbinding human glucocorticoid receptor mutant (hGR 468) did not generate such a band (Figure 6C). In summary, these data provide evidence that F2 with its inverted palindromic sequence binds v-e&I in vitro with even higher affinity than the previously published TRE palindrome.

son of negativity with inducibility by thyroid hormone (T3) or retinoic acid, since CHEF cells have both thyroid hormone and retinoic acid receptors and F9 cells have only retinoic acid receptors (Umesono et al., 1988). Figure 7A shows a summary of these transfections. Constructs containing either a TREpalor an F2 sequence showed similar repression, as did the TRElap sequence (Figure 5) which contains a perfect palindrome in an orientation identical to F2 and a sequence identical to TREpal. Synergism in repression (HD3) is seen from the F2 plus Fl combination (Figure 7A, core) or from trimerized F2 sequences. In general, the stronger the negativity, the higher are the T3 inductions. Fl, which itself is not T3 inducible (even upon trimerization; data not shown), not only synergizes with F2 in repression, but also in T3 induction. To demonstrate directly that the specific factor recognizing the F2 sequence is a member of the thyroid hormone receptor family, we carried out cotransfection experiments with expression vectors in CVl cells (Figure 78). The expression vectors code for v-e&A, for rat thyroid hormone receptor a (rTRa; Damm et al., 1989) or a nonbinding human glucocorticoid receptor mutant (hGR 468). Using the trimeric mutagenized F2 sequence construct (F2mut saa tkCAT) as a standard, the reporter construct with the functional F2 sequence (F2aas tkCAT) is repressed by both v-erbA or ligand-free rTRa expression. T3 induction is dependent on rTRa expression, whereas the control expression vector (hGR 468) conferred neither repression nor T3 induction. In a coexpression experiment the ARa-mediated T3 induction on the F2s tkCAT expression was repressed by v-e&A (Table 1). These data demonstrate that the inverted palindromic sequence (F2) is a functional equivalent of the published TRE sequence (Glass et al., 1988; Damm et al., 1989). A somewhat different picture emerges from the retinoic acid induction in F9 or CHEF cells. Both cell types are retinoic acid responsive, with F9 cells showing a much stronger effect. While TREpal mediated a strong retinoic acid response, the inducibility of a single F2 sequence was barely detectable, with trimerization being required to reach induction levels seen with a TREpal monomer (Figure 7A). In addition, T3 induction mediated by the F2aas trimer is seen when cloned in front of different 5’ deletions of the tk promoter (-95, -70, and -37; Figure 7C), showing that induction is effective on the TATA box. Control plasmids containing F2mut saa are not inducible. In summary, the FP-mediated repression or T3 induction is synergistically increased in combination with Fl, repression being dependent on the expression of either v-erbA or ligand-free thyroid hormone receptor.

The Inverted Palindromic F2 Sequence Is an erbA-Responsive Element Since thyroid hormone receptor binding sites have been shown to mediate a thyroid hormone or a retinoic acid response, we tested the functional relevance of the inverted F2 palindrome in hormonal induction. We transfected selected DNA constructs into chicken erythroblasts (HD3), primary chicken embryonal fibroblasts (CHEF), and mouse embryonal carcinoma (F9) cells. This enabled a compari-

Discussion Negative regulation may involve many different mechanisms of transcriptional repression. Position- and orientation-independent silencing was originally described for the yeast mating type loci HML and HMR (Brand et al., 1985). We have previously found that a negative element at position -2.4 kb upstream of the transcriptional start site of the chicken lysozyme gene acts as a silencer in

.S!;ncer

Modules

A.

HD3 Inserts in Front of tkCAT

CHEF 1

IWln byT3

Induct& bym

I

Induction bvRA

j

0.98

0.85

/

1.1

Repression

1.0

none core

4-j

19.8

4.45

0.88

Fls

4-k

1.3

0.81

0.58

F2s

5.9

2.20

0.73

1.2

TREpal

5.7

2.38

1.88

11.3

TRElap

11.0

2.40

0.86

F2aas w

40.0

3.50

1.20

13.0

4.70

3.50

198

TREpslr 3x

30.0 L

B’ Inserts in Front of tkCAT

F2mutsaa~

F2aas

0

C-

-

J

CVl

CVl

CVl

rTRw

hGR468

R~F+x&

U.&on bu T3

Repression

1.0

1.2

1.0

1.0

5.7

9.3

153

1.7

1.3

F2aas

I

tk

CAT

0.66

tk

CAT

5.90

tk

CAT

0.84

tk

CAT

4.94

w-37

tk

CAT

o-37

tk

CAT

-70 -70

lk-70

F2mutaaa F2a%s

-95

tk-70

tk-37

tk-37

chicken fibroblasts or promacrophages, but is inactive in mature macrophages (Steiner et al., 1987). This silencer activity correlates exactly with the presence of a DNAase l-hypersensitive site at this position within the chromatin of several cell types, including embryonic cells, erythroblasts, and immature macrophages, and with the disappearance of this hypersensitive site in mature macrophages (Fritton et al., 1984; Sippel et al., 1988). Here we describe the detailed analysis of this tissuespecific silencer S-2.4 kb. We have determined its modu-

1. Inhibition

of T3 Induction

c-erbA *

c-erbA

10.9

1.8

+ v-erbA’

and Hor-

CHEF In&&n

lk-95

FOmutaaa F2aas

+$c&p&

of Repression

Inckiuiin by T3

1.0

Constructs FPmutsaa tk-95

7. Comparison Induction

Selected tkCAT constructs (lysozyme silencer modules are indicated as in Figure 4) were transfected into HD3, CHEF, F9, and CVI cells. After transfection, cell cultures were treated without hormone, thyroid hormone (T3), or retinoic acid (RA). The calculated fold repression or induction is determined from the CAT activities from the induced hnd uninduced cultures. (A) Repression, T3, or retinmic acid induction of tkCAT constructs in HD3. CHEF, or F9 cells. (B) CVl cells were cotransfected with the indicated reporter constructs together with one of the indicated expression vectors coding for v-e&l, rTRa, or hGR468. Sepression is calculated relative to the unindueed F2mut saa construct. (C) T3 induction of promoter deletions in CHEF cells.

2.9

v-erbA Repession

Table

Figure monal

F9

by v-erbA v-erbA’ 1.3

* Expression vectors coding for v-erbA or c-erbA were cotransfected with the reported construct F2s tkCAT into CVl cells. Equal amounts of c-erbA and v-erbA were used in the mixed experiment. indicated values are calculated by dividing CAT activities of T3-treated cultures with activities from untreated cultures.

by T3

0.79 2.35

,

lar structure and found that two separate modules can function as silencers by themselves and $how synergistic repression after multimerization or combination. One of the modules is a thyroid hormone receptor binding site, which can exert repression or T3 induction on several promoter constructions, including a minimal promoter consisting of a TATA box only. Such a dual Function, repression and induction, has been described already for the thyroid hormone receptor (Damm et al., 1989). The other module is very likely bound by one proteim species, which we term NePl, with a molecular size of 75-93 kd. This module is characterized by its large footprint covering about 50 bp. It synergistically improves both thyroid hormone receptor-mediated repression and T3 induction. Such a synergism may be achieved by increased DNA binding affinities, as has been shown for the cooperativity of two palindromic steroid receptor binding sites (Tsai et al., 1989; Schmid et al., 1989), or by a functional synergism as seen for combinations of steroid receptor binding sites with other transcription factors (M. Muller, C. Baniahmad, C. Kaltschmidt, and R. R., submitted). All of these

Cell 512

characteristics are typical for enhancer modules (for a review see Dynan, 1989) and are different from the fine structure of the yeast mating type locus silencer. Detailed analysis of this yeast silencer revealed several functional elements for tfans-activation, for autonomous replication, and for chromatin loop formation (Brand et al., 1987; Shore et al., 1987; Buchmann et al., 1988; Hofmann et al., 1989), but none of these elements showed silencer activity by itself (Brand et al., 1987). The functional thyroid hormone receptor binding site within the lysozyme silencer S-2.4 kb is unusual in that its palindromic structure is inverted relative to the previously characterized binding sequence (Glass et al., 1988; Sap et al., 1989; lzumo and Mahdavi, 1988). Assuming that the thyroid hormone receptor may dimerize in solution, as has been shown for the estrogen receptor or a heterodimer of the receptors for retinoic acid and T3 (Kumar and Chambon, 1988; Glass et al., 1989), even half a palindromic sequence might bind a dimeric receptor, with only one monomer being involved in sequence-specific binding. With a complete palindromic binding site, two types of receptor/DNA interactions can be envisaged. Either a single dimer can contact both palindromic halves, or each palindromic half is bound by a separate receptor dimer. Our observation that a complete or half a palindromic F2 binding site generates a protein complex with identical gel mobility infers that both (the half and the complete sequence) are bound by a single receptor dimer. The published TRE sequence has been shown to respond similarly to retinoic acid and T3 induction (Umesono et al., 1988), whereas the thyroid hormone response element of the chicken lysozyme silencer confers only weak retinoic acid response in F9 cells. This might be due to the inverted palindromic structure. It remains to be shown how the thyroid hormone receptor can tolerate such a diversity of DNA sequence arrangements for binding. The correlation between silencer activity in different tissues, the presence of DNAase l-hypersensitive sites, and in vitro binding to the palindromic sequence in the S-2.4 kb silencer suggests that the inactivity of S-2.4 kb in mature macrophages is a consequence of the absence of specific binding activity of F2. In contrast, NePl binding activity is seen with extracts from all cell types tested. The silencing function of NePl in mature macrophages may be negligible, since the cooperative F2 module is inactive in these cells. It is not yet clear whether the factor(s) binding to this palindromic sequence in all nonmacrophage cells is identical, but our observation that the sequence binds thyroid hormone receptor and the fact that this receptor is one member of a large family of related proteins (Green and Chambon, 1986, 1988; for review see Evans, 1988) raises the possibility that the negativity may be mediated by different factors in different cell types. This would increase the versatility of a silencing system that would otherwise require the presence of a single specific activity in all cell types other than that in which the gene is expressed. Experimental

Procedures

Recombinant Plasmlds The 5’ (and 3’) deletion series of the S-2.4

kb lysozyme

silencer

was

created by exonuclease III digestion from the Hindlll (BarnHI) site of plys-2.541-2.25s tkCAT (Steiner et al., 1987). followed by BamHl (HindIll) digestion and insertion of the isolated lysozyme fragments between the filled-in Xbal and BamHl (filled-in Xbal and Hindlll) sites of pBLCAT2 (Luckow and Schlitz. 1987). The resulting endpoints of lysozyme sequences were determined by sequencing. Endpoints for the 5’ deletion series were: -2540, -2489, -2458, -2414, -2400, -2398, -2395, -2372, and -2341 bp. Endpoints for the 3’ deletion series were: -2283, -2273, -2290, -2291, -2310, -2339, -2383, and -2418 bp. The silencer core contains the lysozyme upstream sequences from -2414 to -2310 and was constructed by fusion of the lysozyme fragments from the corresponding deletion mutants via an internal Pvull site at -2342 bp. S-2.4 kb, the silencer core, monomers and multimers of blunt-end oligonucleotides spanning sequences from Fi, F2. and the mutated F2 (FPmut: TTATAGCTATAGTCTATGAGAAAGTTACG) were cloned into the filled-in Sall site of pBLCAT2 and of ptkCATAH/N (a Hindlll-Ndel deletion of vector sequences of pBLCAT2). In addition, F2 was inserted into the Sall site of pBLCAT2 opened by Hindll. Oligonucleotide insertions were verified by sequencing. To generate S-2.4-360 and F2aas-3601kCAT, the S-2.4 kb fragment was cut out using BamHl and Bglll. and FPaas was cut out using Hindlll and Xbal; each was inserted into the filled-in Ndel site of pBLCAT2. The tk promoter 5’ deletions were created from the tk linkerscans -95/-70/-37 (McKnight, 1982). from which the promoter was removed by BamHl and Bglll digestion and used to replace the tk promoter of pBLCAT2. FPaas and F2mut saa were inserted in front of these tk deletions as described above. Further oligonucleotides used for competitions are nuclear factor 1. CAAT box binding protein, SPl (as described by Schiile et al., 1988b), APl (CTCGAGCGTGACTCAGCGCGCGTCGAC) (Rauscher et al., 1988), and AP4 (GATCACCAGCTGTGGAAT) (Mermod et al.. 1988). Extract Preparation, DNAase I Footprinting, and Band Shift Assays Nuclear extract preparation, DNAase I footprinting, and band shift assays were performed as described by Altschmied et al. (1989) with the exceptions that the footprint probes were further purified by ethanol precipitation and 12,000 cpm of labeled DNA were added lo the reaction. Up to 4 pg of nuclear extract was used for the band shift assay. Whole-cell extract from transfeded COSl cells was prepared as described by Damm et al. (1989), with the modification that only 2 pg of total protein was used. Band shift/footprint combinations (Piette and Yaniv, 1986) were done using identical footprint conditions as described above. The probe was the 5’deletion clone -2458 labeled in the 5’polylinker and cut with Pvull. DNAase I digestion was slowed down after 90 s by adding 5 pg of dldC, 5 pg of denatured calf thymus DNA in 20 ~1 of buffer (Akschmied et al., 1989), and the mixture was immediately loaded on a 5% polyacrylamide gel with additional 0.5 mM EDTA in the running buffer (Altschmied et al., 1989). The retarded band was cu1 out and eluted in 300 ~1 by shaking overnight with 0.2% laurylsarcosine, 0.1 mM EDTA, 5 pg of glycogen, 5 pg of carrier DNA, 0.33 M sodium acetate, and 20 pg of proteinase K. The DNA was phenolized. precipitated.

and loaded on a denaturing polyacrylamide gel. Molecular Weight Estimation of NePl Based on the methods of Hager and Burgess (1980) and Baeuerle and Baltimore (1988), 100 pg of nuclear extract was separated on a 10% SDS-polyacrylamide gel. Elution of gel slices was done in 300 pl of elution buffer at room temperature for 2.5 hr. The proteins were acetone-precipitated overnight, the dried pellet dissolved in 2 ~1 of 6 M guanidinium hydrochloride, diluted with 200 pl of renaturation buffer (20 mM Tris [pH 7.5],2 mM HEPES [pH 7.9],100 mM NaCI, 10 mM KCI, 2 mM EDTA, 1 mM dithiothreitol, 50 WM phenylmethylsulfonyl fluoride, 0.1% NP40, and 12% glycerol), and renatured for 3 hr at 4OC. Specific DNA binding activity was detected by the band shift assay using 8.5 PI of the fractions. Cell Culture and DNA Transfections Avian erythroblastosis virus-transformed erythroblasts HD3 (Beug et al., 1982). the promacrophage cell line HDII (Beug et al., 1979), primary chicken embryo fibroblasts (CHEF) (Solomon, 1975), and primary chicken mature macrophages (MPH) were grown in Dulbecco’s modified Eagle’s medium (Biochrom) supplemented with 8% fetal calf

g;;ncer

Modules

serum, 2% chicken serum, 100 U/ml penicillin, and 100 pg/ml strep tomycin. CVl and F9 ceils were grown as described above but without chicken serum. For COSl cells, 5% fetal calf serum was used. MPH cells were isolated from peripheral blood using Ficoll-Paque (Pharmacia) according to the manufacturer’s protocol and cultured subsequently on dishes. Thyroid hormone depletion of serum was performed according to Samuels et al. (1979). DNA transfections of CHEF, F9, and CVl cells were performed as described by Steiner and Kaltschmidt (1989); transfections of HO3 and COSl cells were performed as described by Choi and Engel (1988). COSl cells were incubated with the DNA-diethylaminoethyl-dextran solution for 1 hr followed by a 2.5 min dimethyl sulfoxide shock. Total amount of 5 Kg (CVl) or 25 @g (COSl) of receptor expression vector was used in transfection assays per dish. After glycerol treatment, 10.’ M 3.5,3’ triiodothyronine or lO-‘j M retinoic acid was added. CAT assays were done as described by Gorman et al. (1982).

Acknowledgments We would like to thank our colleagues Michael Cross, Christian Kaltschmidt, and Marc Muller for critically reading the manuscript; Andrea Oswald for synthesizing oligonucleotides; Stanley Hollenberg and Ronald Evans for providing the expresion vectors pRS-verbA and pRSVrbeAl2B (rTRa); Marc Muller for pRShGR466; and Karin Schulz for excellent technical help. This work was supported by the Bundesministerium fijr Forschung und Technologie. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 16 USC. Section 1734 solely to indicate this fact. Received

November

1, 1969; revised

January

22, 1990

Distel. R. J., Ro, H.-S., Rosen, B. S., Groves, 0. L., and Spiegelman, B. M. (1987). Nucleoprotein complexes that regulate gene expression in adipocyte differentiation: direct participation of c-fos. Cell 49, 835644. Dynan, l-4. Evans, family.

W. S. (1989).

Modularity

R. M. (1988). The steroid Science 240, 889-895.

in promoters and thyroid

and enhancers. hormone

Fried, M., and Crothers, 0. M. (1981). Equilibria repressor operator interactions by polyacrylamide Nucl. Acids Res. 9, 8505-6525.

Cell 58,

receptor

super-

and kinetics of Lac gel electrophoresis.

Fritton. H. P.. Igo-Kemenes. T.. Novock, J., Strech-Jurk, U., Theisen, M.. and Sippel. A. E. (1964). Alternative sets of DNasel-hypersensitive sites characterize the various functional states of the chicken lysozyme gene. Nature 371, 163-165. Fujita, T.. Sakakibara, J., Sudo, Y., Miyamoto, M., Kimura, Y., and Taniguchi. T. (1988). Evidence for a nuclear factor($), IRF-1, mediating induction and silencing properties to human IFN-fi gene. EMBO J. 7; 3397-3405. Garner, M. M.. and Revzin, A. (1981). A gel etectroghoresis method for quantifying the binding of proteins to specific DNA legions: application to components of the E. coli lactose operon regulatory system. Nucl. Acids Res. 9, 3047-3060. Glass, C. K.. France, R., Weinberger, C.. Albert, V. R., Evans, R. M., and Rosenfeld, M. G. (1987). A c-e&I binding site in rat growth hormone gene mediates trans-activation by thyroid harmone. Nature 329, 738-741. Glass, C. K., Holloway, J. M., Devary, 0. V.. and Rosenfeld, M. G. (1988). The thyroid hormone receptor binds with opposite transcriptional effects to a common sequence motif in thyroid hormone and estrogen response elements. Cell 54, 313-323.

References

Glass, C. K.. Lipkin, S. M., Devary, 0. V., and Rosenfeld, M. G. (1989). F’ositive and negative regulation of gene transcrlption by a retinoic acid-thyroid hormone receptor heterodimer. Cell 69. 697-708.

Altschmied. J., Muller, M., Baniahmad. A., Steiner, Ch.. and Renkawitz, R. (1969). Cooperative interaction of chicken lysozyme enhancer sub-domains partially overlapping with a steroid receptor binding site. Nucl. Acids Res. 77, 4975-4991.

Goodbourn, S., and Maniatis, T. (1988). Overlappin$ positive and negative regulatory domains of the human !I%-interferoh gene. Proc. Natl. Acad. Sci. USA 85, 1447-1451.

Baeuerle, I? A., and Baltimore, 0. (1966). Activation of DNA-binding achvity in an apparently cytoplasmic precursor of the NF-KB transcription factor. Cell 53, 211-217. Baniahmad, A., Muller, M., Steiner, Ch., and Renkawitz, R. (1987). Activity of two different silencer elements of the chicken lysozyme gene can be compensated by enhancer elements. EMBO J. 6, 2297-2303. Beato. 344.

M. (1969). Gene

regulation

by steroid

hormones.

Cell 56, 335-

Eeug. H., von Kirchbach. A., Dbderlein, G., Conscience, J.-F., and Graf, T. (1979). Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 18. 375-390. Beug, H.. Dbderlein, G.. Freudenstein, C., and Graf, T (1982). Erythroblast cell lines transformed by a temperature-sensitive mutant of avian erythroblast virus: a model system to study erythroid differentiation in vitro. J. Cell. Physiol. Suppl. 7, 195-207. Brand, A. H., Breeden. L.. Abraham, J.. Sternglanz, K. (1985). Characterization of a “silencer” in yeast: with properties opposite to those of a transcriptional 41-48.

R., and Nasmyth, a DNA sequence enhancer. Cell 47.

Brand. A. H., Micklem, G., and Nasmyth, K. (1987). A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 57. 709-719. Buchman, A. R., Lue, N. F., and Kornberg, R. 0. (1988). Connections between transcriptional activators, silencers, and telomeres as revealed by functional analysis of a yeast DNA-binding protein. Mol. Cell. Biol. 8, 5066-5099. Chow, O.-R. B., and Engel, J. 0. (1988). Developmental 8-globin gene switching. Cell 55, 17-26. Damm, K., Thompson, C. C., and Evans, R. M. (1989). coded by v-srbA functions as a thyroid-hormone receptor Nature 339, 593-597.

regulation

of

Protein enantagonist.

Gorman, C. M., Moffat. L. F., and Howard, genomes which express chloramphenicol malian cells. Mol. Cell. Biol. 2, 1044-1051.

B. H. (11982). Recombinant acetyltransferase in mam-

Gorman, C. M., Rigby, I? W. J., and Lane, 0. P (1986). Negative regulation of viral enhancers in undifferentiated embryanic stem cells. Cell 42, 519-528. Graupner, G., Wills, K. N., Tzukerman, M., Zhang, X.-K.. and Pfahl, M. (1989). Dual regulatory role for thyroid-hormone receptors allows control of retinoic-acid receptor activity. Nature 340. 653-656. Green, S., and Chambon. genie hormone receptors.

P (1986). A superfamily Nature 324, 615-617.

of potentially

onco-

Green, S., and Chambon. l? (1988). Nuclear receptors enhance our understanding of transcription regulation. Trends Genet. 4, 309-314. Hager, 0. A., and Burgess, R. R. (1980). Elution of proteins from sodium dodecylsulfate-polyacrylamide gels, removal of sodium dodecylsulfate and renaturation of enzymatic activity: results with sigma subunit of E. coli RNA polymerase, wheat germ DNA topoisomerase. and other enzymes. Anal. Biochem. 709. 76-86. Hata, A., Ohno, S., Akita. Y., and Suzuki, K. (1989). Tandemly reiterated negative enhancer-like elements regulate transcription of a human gene for the large subunit of calcium-dependent protease. J. Biol. C hem. 264, 6404-6411. Hay, N., Takimoto, M., and Bishop, J. M. (1989). Afos protein is present in a complex that binds a negative regulator of mycC. Genes Dev. 3, 293-303. Hofmann, J. F.-X., Laroche, T., Brand, A. H.. and Gasser, S. M. (1989). RAP-1 factor is necessary for DNA loop formation in vitro at the silent mating type locus t/ML. Cell 57, 725-737. Izumo, S.. and Mahdavi. V. (1988). Thyroid hormone forms generated by alternative splicing differentiilly HC gene transcription. Nature 334, 539-542. K6nig,

H., Ponta,

H., Rahmsdorf,

U.. Biischer,

receptor a isoactivate myosin

M., Sch&tthal,

A.,

Cell 514

Rahmsdorf, H. J., and Herrlich, P (1989). Autoregulation dyad symmetry element as the major target of repression. 2559-2566. Kumar, V., and Chambon, l? (1988). The estrogen to its responsive element as a ligand-induced 145-156.

of fos: the EMBO J. 8,

receptor binds tightly homodimer. Cell 55,

Lenardo, M. J., Staudt, L., Robbins, P., Kuang, A., Mulligan, R. C., and Baltimore, D. (1989). Repression of the IgH enhancer in teratocarcinoma cells associated with a novel octamer factor, Science 243, 544546.

R. A. W., Puschel, A. W., Muller, A., Hecht. A., Stief, A., and Grussenmeyer, T. (1988). Regulatory function and molecular structure of DNasel-hypersensitive elements in the chromatin domain of a gene. In Architectureof Eukaryotic Genes, G. Kahl, ed. (Weinheim: VCH Verlagsgesellschaft), pp. 355-369. Solomon. J. J. (1975). Preparation of avian cell cultures. In TCA Manual, Vol. 1, V. J. Evans, V. l? Perry, and M. M. Vincent, eds. (Tissue Culture Association), pp. 7-11. Steiner, Ch., and Kaltschmidt, C. (1989). An automated method for calcium phosphate-mediated gene transfer. Trends Genet. 5, 138.

Luckow, B., and Schutz, G. (1987). CAT constructions with multiple unique restriction sites for the functional analysis of eucaryotic promoters and regulatory elements, Nucl. Acids Res. 75, 5490.

Steiner, Ch., Muller, M., Baniahmad, A., and Renkawitz, R. (1987). Lysozyme gene activity in chicken macrophages is controlled by positive and negative regulatory elements. Nucl. Acids Res. 15,4163-4178.

McKnight, S. L. (1982). Functional relationships between transcriptional control signals of the thymidine kinase gene of herpes simplex virus. Cell 37, 355-365.

Takimoto, M., Quinn, J. P., Farina, A. R., Staudt. L. M., and Levens, D. (1989). fosijun and octamer-binding protein interact with a common site in a negative element of the human c-myc gene. J. Biol. Chem. 264, 8992-8999.

Mermod, N., Williams, T. J., and Tjian, R. (1988). Enhancer binding tors AP-4 and AP-1 act in concert to activate SV40 late transcription vitro. Nature 332, 557-561.

facin

Miyazaki. J.-l., Appella, E., and Ozato, K. (1986). Negative regulation of the major histocompatibility class I gene in undifferentiated embryonal carcinoma cells. Proc. Nab. Acad. Sci. USA 83, 9537-9541. Park, H.-O., and Craig, E. A. (1989). Positive of basal expression of a yeast HSP70 gene. 2033.

and negative regulation Mol. Cell. Biol. 9. 2025-

Piette, J., and Yaniv, M. (1986). Molecular analysis of the interaction between an enhancer binding factor and its DNA target. Nucl. Acids Res. 74, 9595-9611. Rauscher, F. J., Ill, Sambucetti, L. C., Curran, T., Distel, R. J., and Spiegelman, B. M. (1988). A common DNA binding site for Fos protein complexes and transcription factor AP-1. Cell 52, 471-480. Rosen, C. A., Sodroski. J. G.. and Haseltine, W. A. (1985). Location of c&acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-IIIILAV) long terminal repeat. Cell 47, 813-823. Saffer, J. D., and Thurston, S. J. (1989). A negative regulatory element with properties similar to those of enhancers is contained within an A/u sequence. Mol. Cell. Biol. 9. 355-365. Samuels, H. H.. Frederick, S., and Casanova, J. (1979). Depletion of L-3,5,3’-triiodothyronine and L-thyroxine in euthyroid calf serum for use in cell culture studies of the action of thyroid hormone. Endocrinology 105, 80-85. Sap, J.. Munoz, A., Schmitt, J., Stunnenberg, H., and Vennstrbm, B. (1989). Repression of transcription mediated at a thyroid hormone response element by the v-e&A oncogene product. Nature 340, 242244. Sassone-Corsi. P., Fromental, C., and Chambon, P. (1987). A transacting factor represses the activity of the polyoma virus enhancer in undifferentiated embryonal carcinoma cells. Oncogene Res. I, 113119. Schmid. W., Strahle, U., Schutz, G., Schmitt, J., and Stunnenberg, H. (1989). Glucocorticoid receptor binds cooperatively to adjacent recog nition sites. EMBO J. 8. 2257-2263. Schiile, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988a). Cooperativity of the glucocorticoid receptor and the CACCC-box binding factor. Nature 332, 87-90. Schule, R., Muller, M., Kaltschmidt, C., and Renkawitz. R. (1988b). Many transcription factors interact synergistically with steroid receptors. Science 242, 1418-1420. Shaw, f? E., Frasch, S., and Nordheim, A. (1989). Repression of c-fos transcription is mediated through ~67~~~ bound to the SRE. EMBO J. 8. 2567-2574. Shore, D.. Stillmann, D. J., Brand, A. H.. and Nasmyth, K. A. (1987). Identification of silencer binding proteins from yeast: possible roles in SIR control and DNA replication. EMBO J. 6, 461-467. Sippel. A. E., and Renkawitz, R. (1989). The chicken In Tissue Specific Gene Expression, R. Renkawitz, VCH Verlagsgesellschaft), pp. 185-198. Sippel.

A. E., Theisen,

M.. Borgmeyer,

lysozyme gene. ed. (Weinheim:

U., Strech-Jurk.

U., Rupp,

Theisen, M., Stief, A., and Sippel, A. E. (1986). The lysozyme enhancer: cell-specific activation of the chicken lysozyme gene by a farupstream DNA element. EMBO J. 5, 719-724. Tsai, S. Y., Tsai, M.-J., and D’Malley, B. W. (1989). Cooperative binding of steroid hormone receptors contributes to transcriptional synergism at target enhancer elements. Cell 57, 443-448. Umesono, K., Giguere, V., Glass, C. K., Rosenfeld, M. G., and Evans, R. M. (1988). Retinoic acid and thyroid hormone induce gene expression through a common responsive eleme,nt. Nature 336, 242-265. Weisinger, G., Remmers, E. F., Hearing, f?. and Marcu, K. B. (1988). Multiple negative elements upstream of the murine c-myc gene share nuclear factor binding sites with SV40 and polyoma enhancers. Oncogene 3, 635-646.