Modulating effect of inositol hexaphosphate on arachidonic acid-dependent pathways in colon cancer cells

Accepted Manuscript Title: MODULATING EFFECT OF INOSITOL HEXAPHOSPHATE ON ARACHIDONIC ACID-DEPENDENT PATHWAYS IN COLON CANCER CELLS Authors: Małgorzata Kapral, Joanna Wawszczyk, Stanisław So´snicki, Katarzyna Jesse, Ludmiła W˛eglarz PII: DOI: Reference:

S1098-8823(17)30038-2 http://dx.doi.org/doi:10.1016/j.prostaglandins.2017.08.002 PRO 6239

To appear in:

Prostaglandins and Other Lipid Mediators

Received date: Revised date: Accepted date:

23-2-2017 28-7-2017 3-8-2017

Please cite this article as: Kapral Małgorzata, Wawszczyk Joanna, So´snicki Stanisław, Jesse Katarzyna, W˛eglarz Ludmiła.MODULATING EFFECT OF INOSITOL HEXAPHOSPHATE ON ARACHIDONIC ACID-DEPENDENT PATHWAYS IN COLON CANCER CELLS.Prostaglandins and Other Lipid Mediators http://dx.doi.org/10.1016/j.prostaglandins.2017.08.002 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

MODULATING EFFECT OF INOSITOL HEXAPHOSPHATE ON ARACHIDONIC ACID-DEPENDENT PATHWAYS IN COLON CANCER CELLS

Małgorzata Kapral*, Joanna Wawszczyk, Stanisław Sośnicki, Katarzyna Jesse, Ludmiła Węglarz

Department of Biochemistry, Jedności 8, 41-200 Sosnowiec, Poland, School of Pharmacy with the Division of Laboratory Medicine in Sosnowiec, Medical University of Silesia, Katowice, Poland

Correspondence: *Małgorzata Kapral, Department of Biochemistry, Medical University of Silesia, 41-200 Sosnowiec, Jedności 8, Poland. telephone : +48 32 364 10 72 e-mail: [email protected]

1

Highlight -

The colon cancer cells Caco-2 constitutively express genes encoding COX-1 and COX-2 as well as all LOX isoforms (5-LOX, 12-LOX, 15-LOX).

-

Our data provide new knowledge of the effects of inositol hexaphosphate (IP6) on the expression of genes encoding COX and LOX isoforms and synthesis of their products (PGE2 and LTB4) in colon cancer cells.

-

Pro-inflammatory factors modulate mRNA expression of genes encoding COX and LOX isoforms in time-dependent manner.

-

IP6 inhibits the expression of mRNA and protein of COX-2 and subsequently synthesis of PGE2.

-

COX inhibition by IP6 leads to an increased availability of arachidonic acid for lipoxygenase pathway.

ABSTRACT Cyclooxygenase (COX) and lipoxygenase (LOX) are key enzymes of arachidonic acid metabolism. Their products, prostaglandins and leukotrienes, are involved in the pathogenesis of inflammatory bowel diseases and colorectal cancer. The aim of the study was to examine the influence of inositol hexaphosphate (IP6), a naturally occurring phytochemical, on the expression of genes encoding COX and LOX isoforms and synthesis of their products (PGE2 and LTB4) in colon cancer cell line Caco-2 stimulated with pro-inflammatory agents (IL1β/TNFα). Real-time RT-qPCR was used to validate mRNAs level of examined genes. The concentrations of COX-2 and 5-LOX proteins as well as PGE2 and LTB4 were determined by the ELISA method. Based on these studies it may be concluded that IP6 may limit inflammatory events in the colonic epithelium and prevent colon carcinomas by modulating the expression of genes encoding COX and LOX isoforms at both mRNA and 2

protein levels as well as by affecting the synthesis and secretion of prostaglandins and leukotrienes.

Keywords: colon cancer: IP6, cyclooxygenase; lipoxygenase; prostaglandin E2; Leukotriene B4;

3

1.

Introduction Colorectal cancer (CRC) is the third most commonly diagnosed cancer among people

of Western countries [1]. Although the prognosis for patients with CRC has improved substantially since 1960s, it is still the fourth leading cause of cancer-related death with the mortality rate up to 20,3 per 100,000 [2]. Several risk factors for colorectal cancer, both inherited and environmental, have been established by epidemiological studies. Among well recognized factors that have strong positive correlation with CRC are inflammatory bowel diseases (IBD), i.e., ulcerative colitis and Crohn`s disease [3]. The intestinal inflammation in IBD is controlled by a complex interplay of innate and adaptive immune mechanisms. Various activated immune cells are thought to be contributors to production of cytokines, chemokines, reactive oxygen and nitrogen species that are important mediators of chronic inflammatory response and have critical effects on malignant processes [4]. Key elements that sustain inflammatory responses include eicosanoids, lipid mediators synthesized from polyunsaturated fatty acids, such as arachidonic acid, by cyclooxygenase (COX) and lipoxygenase (LOX). COX-1 and COX-2, two isoforms of COX enzyme have been described. While COX-1, a constitutively expressed enzyme in most tissues is responsible for maintaining basal level of prostanoids, COX-2 is induced by proinflammatory stimuli such as IL-1, IFN-γ and TNF-α. Both COX isoforms convert arachidonic acid into an endoperoxide, that is further metabolized to several prostanoids including prostaglandins (PGs) and thromboxane A2 (TXA2) [5]. Among these products, prostaglandin E2 (PGE2), the main metabolite of COX-2, has the most pronounced impact on carcinogenesis [6]. Its concentration is increased in various types of human malignancies including colon, lung, breast, head and neck cancer. This mediator regulates cell proliferation, 4

migration and invasion by stimulating tumor epithelial cells to secrete several growth, angiogenic and pro-inflammatory factors. In addition, it serves as immunomodulator that changes tumor microenvironment in a way that results in an ineffective immunosurveillance [7]. A role of lipoxygenase in gastrointestinal tract malignancies is far more complex due to a variety of its isoforms described in humans. Human cells express six different LOXs (5LOX, 12-LOX, 12/15-LOX, 15-LOX-2, 12(R)-LOX, and epidermal LOX) [8]. Recent data from matched normal and cancer epithelial cells show that 15-LOX has generally anticarcinogenic effects, while increasing expression of 5-LOX and 12-LOX accompanies malignant phenotype of a tumor cells, their invasion and metastasis. Additionally, 5-LOX and 12-LOX are usually absent from normal epithelia and are induced, similarly to COX-2, by pro-inflammatory stimuli. Several studies conducted in both in vitro and in vivo conditions have shown that inhibition of these enzymes resulted in a decreased DNA synthesis and reduced tumor growth. Leukotriene B4 (LTB4) is one of the downstream products of 5-LOX pathway and its accumulation is known to contribute to cancer cells proliferation and apoptosis [9]. A body of evidence from randomized trials consistently shows that usage of specific drugs inhibiting pro-inflammatory responses is effective in reducing the risk and mortality of colorectal cancer, however possible adverse effects of these drugs preclude or restrict their use in primary prevention. Thus, utilization of chemopreventive agents that impede, arrest or hopefully reverse carcinogenesis is one of the most promising approaches to fight against a dreadful disease. Some dietary patterns characterized by high intake of fruits, vegetables, whole grain cereals can decrease the risk of colorectal cancer [3, 10]. Several components of such diet have been shown to possess antitumor efficacy. One of such substances is inositol hexaphosphate (IP6) (Fig. 1) which is abundantly present in many plant sources and certain 5

high fiber products. Exogenous IP6 is dephosphorylated to IP5 by phytases present in origin food and intestinal bacterial in the gut. IP6 is absorbed from the gastrointestinal tract and also taken up by malignant cells by the mechanisms involving pinocytosis and endocytosis. Various binding proteins which can transport IP6 across cell membranes (eg. clathrin adaptor complex AP2, AP180) have been discovered [11, 12]. In recurrent cycle of phosphorylation and dephosphorylation, IP6 pool is rapidly turning over. Almost all mammalian cells contain IP6 and its lower phosphorylated forms (IP1-5) that have been recognized as essential factors regulating vital cellular functions. Furthermore, a number of studies revealed the potential benefits of dietary IP6 related to antineoplastic activities against various types of cancer, including colon carcinomas [13]. IP6 has been shown to reduce proliferation of various malignant cells and induced their apoptosis and differentiation via affecting various signaling pathways, such as PI3K and Akt [14, 15]. Additionally, anti-inflammatory and antioxidative properties of IP6 and its contribution to anticancer activity have been described [16]. IP6 was shown to reduce the levels of pro-inflammatory cytokines, i.e., TNF-α, TGF-β and IL-6 in rats fed with high fat diet [17, 18]. The aim of the present study was to evaluate the impact of inositol hexaphosphate on the expression of cyclooxygenases and lipoxygenases and the synthesis of their metabolites, PGE2 and LTB4, respectively, in colorectal cancer cells stimulated with pro-inflammatory cytokines. 2.

Materials and methods

2.1.

Cell culture Human colon cancer Caco-2 cell line was obtained from the American Type Culture

Collection (ATCC) (Rockville, MD, USA). Cells were routinely grown in RPMI 1640 medium (Sigma Aldrich), supplemented with 10% fetal bovine serum (Biowest, Nuaillé, France), 100 U/ml penicillin and 100 μg/ml streptomycin (both from Sigma Aldrich, St. 6

Louis, MO, USA) and 10 mM HEPES (Sigma Aldrich) in a humidified atmosphere containing 5% CO2 and 95% air at 37 °C. 2.2.

IP6 solution A 250 mM stock solution of IP6 (dipotassium salt) (Sigma Aldrich) was prepared by

dissolving it in pyrogen-free water and adjusting to pH 7.4. It was then diluted with cell culture medium to achieve different concentrations of IP6. 2.3.

Total RNA extraction and quantitative real-time RT-PCR (RT-qPCR) To evaluate transcriptional activity of COX and LOX genes, the cells were seeded at a

density of 8105 onto 21,5 cm2 culture dishes (Nunc International, Rochester, NY, USA ) and allowed to grow to 80% confluence in 5 ml of medium. After three days the culture media were changed to media with 2% FBS and cells were cultured for subsequent 2 days. Then, they were pre-stimulated with a combination of cytokines consisting of 10 ng/ml IL-1β and 20 ng/ml TNF-α (Sigma Aldrich) for 30 min. Afterwards, IP6 at concentrations of 2.5 mM and 5 mM was added to cell cultures. Caco-2 cells were exposed to cytokines and IP6 for 3, 6 and 12 h. In separate cultures, cells were incubated with cytokines at the indicated concentrations and for the indicated times. The untreated cells were used as the control. Total RNA from the cells was extracted using TRI REAGENT (Zymo Research, Irvine, CA, USA) as per the manufacturer’s instructions. RNA concentration and purity were checked using the Shimadzu UV-1800 spectrophotometer (Shimadzu, Kyoto, Japan). Samples showing a ratio of Abs 260/280 nm between 1.8 and 2.0 were only used for experiments. Detection of the expression of examined genes was carried out using a RT-qPCR technique with a SYBR Green chemistry (SYBR Green Quantitect RT-PCR Kit) (Qiagen Inc., Valencia, CA, USA) and CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Equal quantities (0,1 µg) of total RNA from Caco-2 cells were applied to one-step RT-qPCR in a 20 l reaction volume. Oligonucleotide primers specific for human COX-1 and COX-2 mRNAs 7

were synthesized in Oligo.pl at the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences (Warsaw, Poland). Primers for 5-LOX, 12-LOX and 15-LOX were commercially available (Sigma Aldrich). Characteristics of primers are presented in Table 1. The thermal profile for RT-qPCR was as follows: 50˚C for 30 min for reverse transcription and 95˚C for 15 min followed by 45 cycles at 94˚C for 15 s, 55˚C for 30 s and 72˚C for 45 s for amplification. Following RT-qPCR, the samples were subjected to temperature ramp from 60˚C to 95˚C at the rate of 0.2˚C/s with continuous fluorescence monitoring for melting curve analysis. Each gene analysis was performed in triplicate. The mRNA copy numbers of examined genes were determined on the basis of the commercially available standard of actin (TaqMan DNA Template Reagent Kit, Carlsbad, CA, USA). The obtained results of mRNA copy numbers were recalculated per g of total RNA. The expression levels of examined genes in cultured cells were expressed as the fold change relative to the control. A value of fold change > 1 reflects increased expression of the target gene, and a value of fold change < 1 points to a decrease in the gene expression. 2.4. Measurement of COX-2 and 5-LOX Expression of COX-2 (ENZO Life Sciences, Farmingdale, NY, USA) and 5-LOX (Cloud-Clone Corp. Houston, TX, USA) proteins in Caco-2 cells were determined by commercially available ELISA kits. Prior to the experiments, the cells were seeded onto dishes at initial density of 3 × 106 cells and routinely cultured in 15 ml of RPMI medium for 48 h. Then, the media were replaced with the fresh ones with 2% serum and the cells were grown for 24h. Subsequently, Caco-2 cells were pre-stimulated with mixture of cytokines (10 ng/ml IL-1β and 20 ng/ml TNF-α) for 30 min and then IP6 at concentrations of 2.5 mM and 5 mM was added for 6 and 24 h. Afterwards, cells were washed with ice-cold PBS, scrapped from the dishes and centrifuged. They were then sonicated on ice in 5 cycles of 20 s bursts and 60 s rest intervals in RIPA buffer (25 mM Tris, pH 7,4, 0,15 M KCl, 1% NP-40, 5mM 8

EDTA) and 0.5% sodium deoxycholate and centrifuged at 10 000 x g for 10 min to sediment the particulate material. COX-2 and 5-LOX concentrations were measured by ELISA kits according to manufacturer’s protocols. The absorbance was measured using the multiplate reader Labtech LT-5000 (Labtech International Ltd,Uckfield, UK) at =450nm. The concentrations of COX-2 and 5-LOX were compared with standard curves generated under identical conditions and were expressed as ng/ml. 2.6

Assessment of Prostaglandin E2 and Leukotriene B4 Production The effect of IP6 on the production and release of eicosanoids from colon cancer cells

was evaluated using ELISA kits. Prior to the experiments, the cells were seeded onto 24-well plates at a density of 3 × 105 cells/well and routinely cultured in l ml of RPMI medium for 48 h. Then, fresh medium containing 2% serum was added and cells were incubated for an additional 24 h. Subsequently, Caco-2 cells were pre-stimulated with mixture of cytokines (10 ng/ml IL-1β and 20 ng/ml TNF-α) for 30 min and then IP6 at concentrations of 2.5 mM and 5 mM was added. After 6 and 24 h, the media were collected and level of both PGE2 (Cayman Chemical, Ann Arbor, MI, USA) and LTB4 (R&D Systems; Minneapolis, MN, USA) were determined according to the manufactures protocols. Colorimetric results were read on multiplate reader Labtech LT-5000. The data are presented as mean eicosanoids release [pg/ml]. 2.7

Statistical analysis The in vitro experiments were repeated three times in triplicates. Statistical analysis was

performed with the use of Statistica PL 10.0 software. All the results are expressed as means ± SD. One-way analysis of variance (ANOVA) with Tukey’s post-hoc test was used to evaluate significances between examined groups. Comparison of two data sets was performed by unpaired two-tailed t-test. Values of p<0.05 were considered as statistically significant. 3

Results 9

3.1

The influence of IP6 on mRNA expression of genes encoding COX and LOX isoforms in Caco-2 cells As shown in Figs. 2 and 3 the colon cancer cells Caco-2 constitutively expressed genes

encoding COX-1 and COX-2 as well as all three LOX isoforms. In one set of experiments, the effect of IP6 at concentrations of 2.5 mM and 5 mM on these genes expression has been evaluated. In parallel, the Caco-2 cells have been stimulated with IL-1 and TNF-, and then the potential influence of IP6 on the mRNA level of all 5 genes in cultures stimulated with pro-inflammatory factors has been assessed. In a time course experiment, IP6 had no influence on basal expression of COX-1 (p>0.05). On the contrary, the treatment of cells with IP6 at both concentrations (2.5 mM and 5 mM) up to 6 h decreased the amount of COX-2 mRNA in comparison to control (p<0.05) (Fig. 2A). Furthermore, IP6 up-regulated constitutive transcriptional activities of 5-LOX and 15-LOX genes in Caco-2, as compared to controls (Fig. 3A). Whereas a significant increase in the level of 5-LOX mRNA was observed with 2.5 mM IP6 at 3 h only, 5 mM IP6 increased transcription of this gene at all times of experiment. The strongest effect was observed in cells exposed to IP6 for 6 h. The transcription of 15-LOX was enhanced by 3 h treatment with IP6 at both concentrations and the lower IP6 concentration at 6 h (p<0.05). No marked changes in 12-LOX gene activity were demonstrated in cells treated with IP6 for 3-6-24 h (Fig. 3A). A stimulation of cells with pro-inflammatory factors (IL-1β and TNF-) resulted in a time-dependent up-expression of COX-1, COX-2, 5-LOX, 12-LOX mRNAs compared to control culture (p<0.001) (Fig. 2B, 3B). However, the 15-LOX expression was markedly decreased by IL-1β/TNF- at 12 h (Fig. 3B). Both cytokines stimulated the expression of COX-1 at 3 and 6 h and IP6 was able to markedly down-regulate their effect (p<0.05). At 12 h, the amount of COX-1 transcript was equal in unstimulated and stimulated with IL-1β/TNF- Caco-2 and IP6 did not change its 10

level (Fig. 2B, 2C). In a time course of experiment, IL-1β/TNF-α gradually upregulated COX2 expression. At 3 h, over 2-fold increase in the expression of COX-2 was observed and the prolongation of incubation time to 12 h led to its higher than 3-fold enhancement (Fig. 2B). As can be seen in Fig. 2C, the cells treated with both IL-1/TNF- and IP6 for 3 h, did not manifest any changes in COX-2 mRNA level. By comparison, longer incubation with IP6 decreased stimulated transcription of COX-2 (Fig. 2C). When 5 mM IP6 was added to stimulated cultures, the COX-2 mRNA showed lower level in comparison to that measured in cells treated with 2.5 mM (p<0.05) (Fig. 2C). Furthermore, cell cultures treated with proinflammatory factors manifested above 6-fold increase in 5-LOX mRNA expression compared to control culture at 3 h (p<0.0001) and IP6 markedly reduced IL-1β/TNF-α-induced expression of this isoform (p<0.05) (Fig. 3B, 3C). Similar effect was observed in case of 12LOX gene at 3 h, where IP6 decreased the expression of 12-LOX mRNA in relation to cells stimulated with pro-inflammatory agents only. At longer time periods (6 h and 12 h), IP6 augmented the up-regulatory effect of IL-1/TNF- on the expression of 5-LOX gene (p<0.0001), but it did not significantly change 12-LOX expression in those cultures (p>0.05). After 12 h incubation, IP6 significantly up-regulated 15-LOX transcription in cells treated with pro-inflammatory cytokines (Fig. 3C).

3.2

The influence of IP6 on the COX-2 and 5-LOX protein level in Caco-2 cells At the next step of the study, the effect of 2.5 mM and 5 mM IP6 on the concentration

of COX-2 and 5-LOX proteins in Caco-2 cells has been evaluated. The results are presented in Figures 4 and 5. Comparative analysis of COX-2 protein level revealed statistically significant diverse amounts in the control and the cells treated with IP6 at both concentrations for 6 h (p<0.05). Statistically significant decrease in COX-2 concentration was found in cells exposed to 5 mM 11

IP6 in relation to control (p<0.05). Pro-inflammatory cytokines increased level of COX-2 protein in Caco-2 (p<0.001). However, IP6 had no influence on stimulated COX-2 expression (Fig. 4A). In longer-lasting cultures (24 h), the similar level of COX-2 protein in control and cells exposed to IP6 was observed. The obtained results also revealed the higher concentration of this protein in IL-1/TNF--stimulated cells than in unstimulated cells (p<0.05) and its significant down-expression by 2.5 mM IP6 (p<0.05) (Fig. 4B). Comparative analysis of 5-LOX protein concentration revealed statistically significant diverse amounts in the control and the cells treated with IP6 for both 6 h (p<0.05) and 24 h (p<0.05) (Fig. 5). IP6 at a higher concentration induced a small, but significant, increase in 5LOX level in comparison with control cells (p<0.01) (Fig. 5A). Stimulation of Caco-2 with IL-1β and TNF-α resulted in an up-expression of 5-LOX protein as compared with untreated cells for both 6 h (p<0.0001) and 24 h (p<0.001). Incubation of cells with IP6 test concentrations of 2.5 mM and 5 mM, respectively, each elicited an increase in the level of this protein at both time points with the reference to cells stimulated with pro-inflammatory agents (Fig. 5B). 3.3

The influence of IP6 on the synthesis and secretion of PGE 2 and LTB4 in Caco-2 cells The effect of 2.5 mM and 5 mM IP6 on the synthesis of prostaglandin E2 and

leukotriene B4, as a function of the activity of COX-2 and 5-LOX respectively, in unstimulated and stimulated with pro-inflammatory cytokines Caco-2 has been evaluated. As indicated in Figure 6, unstimulated cells released basal levels of PGE2 into the media at both time points. IP6 at concentrations of 2.5 mM (p<0.05) and 5 mM (p<0.05) evoked marked decrease in the concentration of PGE2 in relation to control, at 6 h only. Incubation of these cells with IL-1β and TNF-α significantly increased the release of PGE2 at both 6 h (p<0.05) and 24 h (p<0.0001) and IP6 significantly decreased the synthesis and release of this 12

eicosanoid (Fig. 6). The study showed that neither unstimulated nor IL-1β/TNF-α-stimulated cells secreted LTB4 into the media after 6 h (data not shown). At 24 h, Caco-2 released LTB4 at low concentration (about 2.6 pg/ml) into culture media and IP6 contributed to significant increase in its level of secretion. Stimulation of cells with IL-1β and TNF-α resulted in an increase of LTB4 synthesis and secretion compared to control culture (p<0.001). IP6 downregulated the release of LTB4 challenged with pro-inflammatory agents, but statistical analysis revealed only a trend toward it (p<0.09) (Fig. 7). 4 Discussion The major focus of the present study was to investigate the effect of IP6 on COX and LOX expression and activity in the Caco-2 colon cancer cells. Epidemiological studies have shown that patients with long-lasting chronic intestinal inflammation have an increased risk of developing colorectal cancer. Metabolites of arachidonic acid are known to be inflammatory mediators produced and released in this setting and contributing to the development and progression of CRC [19]. Arachidonic acid can be metabolized via either the COX pathway to produce prostaglandins (PGs) or the LOX pathway to produce leukotrienes (LTs) and hydroperoxyeicosatetraenoic acids [20]. TNF-α, IL1-, IFN-γ and bacterial lipopolysaccharides are well known inducers of COX and LOX isoforms expression and their metabolites synthesis. These pro-inflammatory cytokines are frequently found in the microenvironment of CRC [21]. Maihöfner et al. [22] suggested a role of IL-1 in the regulation of COX-2 expression in human CRC. The results of their study showed a significant correlation between IL-1 and COX-2 expression in CRC. In our study we evaluated mRNA expression of COX-1, COX-2 and three isoforms of LOX in Caco-2 colon cancer cells unstimulated and stimulated with a mixture of IL-1 and TNF- cytokines. Furthermore, we also assessed the changes of COX-2 and 5-LOX protein level as well as the concentration of PGE2 and LTB4 released into culture media. The study of Smith 13

et al. [23] indicated that Caco-2 cells released significant amounts of PGE2 in response to stimulation with IL-1. Since LTB4 levels were not enhanced under the same conditions, it might suggest that the lipoxygenase arm of the arachidonic acid cascade did not respond in a similar manner to the agents used. Our study showed that even in the absence of proinflammatory factors, Caco-2 cells exhibited basal mRNA level of all examined COX and LOX isoforms. When IL-1 and TNF- were added to the cell cultures, transcriptional activity of the studied genes, except for 15-LOX, increased. Interestingly, the pattern of genes expression was time-dependent. Transcription of COX-2 increased gradually in a time course of the experiment, while the expression levels of others genes appeared to be the highest after 3 h of pro-inflammatory stimulation. In case of the gene encoding anti-inflammatory 15-LOX isoform, IL-1/TNF- decreased its transcriptional activity after long–term cells exposure. The results of our study also revealed detectable amounts of COX-2 and 5-LOX proteins in unstimulated Caco-2 after both 6 and 24 h and their increased concentrations under inflammatory conditions. IL-1 and TNF- enhanced the synthesis and release of PGE2 into the media at both time points. Furthermore, neither unstimulated nor IL-1β/TNF-α-stimulated cells secreted LTB4 after 6 h. At 24 h, Caco-2 released low amount of LTB4 and their stimulation with IL-1β/TNF-α resulted in an increase in LTB4 synthesis and secretion. Because inflammation is recognized to be critical component of cancer progression and metastasis, thus the control of this process is one of the methods for preventing CRC. Epidemiological and clinical studies have demonstrated that conventional nonsteroidal antiinflammatory drugs (NSAIDs) and COX-2 specific inhibitors (celecoxib, rofecoxib) which inhibited cyclooxygenases and decreased the synthesis of PGs may provide effective treatment against the development and progression of cancer [24, 25]. However, serious cardiovascular and gastrointestinal side effects limit their use [26, 27]. Therefore, nontoxic molecules that maintain the same efficacy as NSAIDs remain to be established. In contrast to 14

pharmacological drugs, natural, chemopreventive phytochemicals act at various levels of prevention. In addition, these components might simultaneously affect multiple targets in several cell signaling pathways [20, 28]. IP6, a natural, nontoxic phytochemical regularly consumed with foods containing cereals and legumes, has been described to have anti-cancer properties. Several previous studies revealed IP6 ability to modulate the expression and secretion of inflammatory mediators, independent of arachidonic acid pathway products, such as IL-6, IL-8, IL-10, TNF and its receptors as well as inducible nitric oxide synthase (iNOS) [29-33]. In the previous years, a plethora of phytochemicals, such as resveratrol [34, 35], curcumin [36], catechins [28, 37], genistein [38] and quercetin [39] have been reported to inhibit one or more isoforms of COX at either transcriptional or post-translational levels and to decrease secretion of PGE2 in in vitro and in vivo studies. Likewise, other studies demonstrated the inhibitory effect of naturally occurring compounds on the expression and activity of LOX isoforms [40-42]. Until now, only few studies regarding the influence of IP6 on COX-2 expression by the use of animal models have been published. Shafie et al. [43] reported that IP6 in a concentrationdependent manner down-regulated COX-2 expression gene at both mRNA and protein levels in rats with azoxymethane-induced colorectal cancer. Likewise, da Silva et al. [44] showed that IP6 at concentrations of 2.5 mM and 5 mM reduced the COX-2 expression in swine jejunal explants. However, studies upon the effect of IP6 on expression and activity of LOX isoforms are missing. COX-2 and 5-LOX have been shown to be simultaneously co-expressed and upregulated in cancer cells. Because these two enzymes share a common substrate, it is likely that the inhibition of one of them may lead to a metabolism shunt towards the other pathway in compensation for eicosanoids synthesis. Therefore, compounds that are able to equally

15

inhibit the synthesis or activation of both COX-2 and 5-LOX may present a superior anticancer efficacy to selective COX-2 or 5-LOX inhibitors [25, 45-48]. In our study, we aimed at evaluating whether IP6, as potential anticancer agent, alters the transcription of genes encoding COX and LOX isoforms in human colon cancer cell Caco-2 under normal and inflammatory conditions. The effect of IP6 on the expression of COX-2 and 5-LOX protein as well as activity of these enzymes on the basis of generation and secretion of their key metabolites was also examined. The concentrations of IP6 (2.5 and 5 mM) used in our in vitro study correspond to its concentrations in the lumen, reaching on average 4 mM [49]. The present study showed, that Caco-2 cells treated with IP6 for up to 6 h have decreased COX-2 gene expression. However, after 12 h no significant changes were observed, and thus, the effects of this compound on COX-2 transcription were instant but temporary. IP6 did not affect the expression of COX-1 gene, encoding constitutive isoform of this enzyme, independently of the time of incubation. The changes in COX-2 mRNA amount were related to IP6 concentration-dependent decrease in the level of COX-2 protein. Similarly to COX-2 mRNA expression longer treatment with IP6 failed to induce changes in the amount of the enzyme encoded by this gene. A decrease in the expression of inducible isoform of COX was accompanied by lower secretion of PGE2, a key metabolite of this enzyme. In cells stimulated with IL-1/TNF- IP6 decreased the transcriptional activities of genes encoding both constitutive (for 3 and 6 h) and inducible isoform of cyclooxygenase (for 6 and 12 h). Altered COX-2 gene expression was accompanied by a decrease in the amount of COX-2 protein after 24 h. After 6 h of treatment with IP6 no significant changes were observed in COX-2 protein level, which may be explained by its effect on COX-1 transcriptional activity during short term exposure. Modulating effects of IP6 on COX mRNA and protein expression in cells cultured at inflammatory conditions resulted in a time16

independent decrease in PGE2 secretion. The most pronounced inhibition of PGE2 secretion observed after 6 h of incubation with IP6 might be explained by its impact on both isoforms of COX enzyme. The results of this study revealed that IP6 in a concentration- and timeindependent manner decreased PGE2 synthesis and release in cells under inflammatory conditions. As observed in this study, IP6 had no influence on COX-2 mRNA after 3 h, while it downregulated 5-LOX expression in cells stimulated by cytokines. Moreover, a decrease in the transcriptional activity of the COX-2 gene accompanied with enhanced 5-LOX expression in stimulated cells. The outcomes of this study revealed that IP6 increased concentration of 5LOX in cytokine-stimulated cells, however, without statistically relevant changes in LTB4 production and secretion. On the other hand, cells treated only with IP6 secreted this mediator into culture media. Lepage et al. [50] demonstrated similar effect in HT-29 and HCT-116 colon cancer cells treated with steroidal saponin, i.e., diosgenin increased 5-LOX expression and enhanced leukotriene B4 production. 12-Lipoxygenase (12-LOX) was also found to be implicated in cancer cells growth and survival. Its inhibition caused a decrease in cell proliferation and induction of apoptosis in carcinoma cells [24]. In the current study, IP6 decreased 12-LOX mRNA expression level in Caco-2 cells stimulated with pro-inflammatory cytokines,and did not affect unstimulated cells. Since eicosanoids have been established as key mediators in the cascade of inflammatory events associated with colorectal cancer, anti-inflammatory treatment strategies based not only on inhibition of pro-inflammatory mediators but also on the induction of antiinflammatory or immunoregulatory molecules remain to be of interest. The findings of this study revealed that IP6 enhanced transcriptional activity of 15-LOX gene encoding antiinflammatory isoform of LOX. This observation is in line with the data published by Wang et

17

al. [51], who reported low expression level of anti-inflammatory 15-LOX in human colon epithelium and its induction by NSAIDs. In the present study we showed that IP6 inhibited COX expression and synthesis of PGE2. Furthermore, COX inhibition led to increased availability of arachidonic acid for lipoxygenase pathway and upregulation of leukotrienes production. Lee et al. [52] found out that NSAIDs, such as piroxicam and indomethacin, inhibited the secretion of PGE2 with simultaneous increase in LTB4 secretion by Caco-2 cells. Thus, we postulate the potential chemopreventive activity of IP6. It should be emphasized that IP6 is generally regarded as safe and devoid of side effects as opposed to NSAIDs. Molecular mechanisms of IP6 and NSAIDs are different. IP6 exerts influence on cells via phosphatidylinositol-3 kinase (PI3K), MAPK, PKC, AP-1, and NF-B [14, 15, 53, 54]. The promoter region of COX-2 gene contains binding sites for NF-B and AP-1 and these transcription factors can regulate the expression of COX-2 gene [20, 55]. On the other hand, NSAIDs action is based on the inhibition of COX activity, catalyzes the rate-limiting step in the conversion of arachidonic acid to prostaglandins [56]. Although different mechanisms are included, this phenomenon confirms the sophisticated crosstalk existing between two arms of arachidonic acid metabolism. Furthermore, it implicates the necessity of combining IP6, as a natural chemopreventive agent, with 5-LOX inhibitors to achieve effective therapy against inflammation-associated cancer. The present study showed the effect of IP6 on COX and LOX genes expression and secretion of their metabolites by colon cancer cells in vitro. Colorectal tumor development and progression may be controlled by eicosanoid formation and subsequent signaling from a variety of cells (immune cells including mast cells, neutrophils, macrophages or T cells, fibroblasts and other cells) in the tumor microenvironment. Therefore, studies in vitro have

18

some limitations due to a deficiency of interactions between cancer cells and cells invading the tumor microenvironment. In summary, metabolites of COXs and LOXs are believed to be involved in inflammation affected cancer cells proliferation as well as tumor growth and metastasis. The inhibition of expression and activity of these enzymes is a potential interest of the search for chemopreventive and chemotherapeutical agents. Based on these studies, it may be concluded that IP6 may limit inflammatory events in the intestinal mucosa and prevent colonic carcinomas by modulating the expression of genes encoding COX and LOX isoforms at both mRNA and protein level as well as by decreasing the synthesis and secretion of prostaglandins.

Conflict of Interests The authors report no conflict of interests related to this study or the findings specified in this paper.

Acknowledgments This work was supported by grants no. KNW-1-141/K/5/0, KNW-2-013/N/5/K from the Medical University of Silesia (Katowice, Poland).

References

1. F. A. Haggar, R. P. Boushey, Colorectal cancer epidemiology: incidence, mortality, survival, and risk factors, Clin. Colon Rectal Surg., 22(4) (2009) 191-197.

19

2. J. Ferlay, I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D. M. Parkin, D. Forman, F. Bray, Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012, Int. J. Cancer, 136(5) (2015) E359–E386. 3. H. Brenner, M. Kloor, C. P. Pox, Colorectal cancer, Lancet, 383(9927) (2014) 14901502. 4. N. B. Janakiram, C. V. Rao. The role of inflammation in colon cancer. Adv. Exp. Med. Biol., 816 (2014) 25-52. 5. R. N. Dubois, Role of inflammation and inflammatory mediators in colorectal cancer, Trans. Am. Clin. Climatol. Assoc., 125 (2014) 358-373. 6. D. Wang, R. N. DuBois, Eicosanoids and cancer. Nat. Rev. Cancer, 10(3) (2010) 181– 193. 7. D. Wang, R. Dubois, Inflammatory mediator prostaglandin E2 in colorectal cancer, Cancer J., 19(6) (2013) 502-510. 8. O. Rådmark, O. Werz, D. Steinhilber, B. Samuelsson, 5-Lipoxygenase, a key enzyme for leukotriene biosynthesis in health and disease, Biochim. Biophys. Acta, 1851(4) (2015) 331-339. 9. C. Rao, N.B. Janakiram, A. Mohammed, Lipoxygenase and cyclooxygenase pathways and colorectal cancer prevention, Curr. Colorectal Cancer Rep., 8(4) (2012) 316-324. 10. R. Baena, P. Salinas, Diet and colorectal cancer, Maturitas, 80(3) (2015) 258-264. 11. I. Vucenik, A.M. Shamsuddin, [3H]inositol hexaphosphate (phytic acid) is rapidly absorbed and metabolized by murine and human malignant cells in vitro. J. Nutr., 124 (6) (1994) 861-868.

20

12. X. Zi, R.P. Singh, R. Agarwal, Impairment of erbB1 receptor and fluid-phase endocytosis and associated mitogenic signaling by inositol hexaphosphate in human prostate carcinoma DU145 cells. Carcinogenesis, 21(12) (2000) 2225-2235. 13. I. Vucenik, A.M. Shamsuddin, Protection against cancer by dietary IP6 and inositol. Nutr. Cancer, 55(2) (2006) 109-125. 14. I. Vucenik, G. Ramakrishna, K. Tantivejkul, L.M. Anderson, D. Ramljak, Inositol hexaphosphate (IP6) blocks proliferation of human breast cancer cells through a PKCdelta-dependent increase in p27Kip1 and decrease in retinoblastoma protein (pRb) phosphorylation. Breast Cancer Res. Treat., 91(1) (2005) 35-45. 15. G. Liu, Y. Song, L. Cui, Z. Wen, X. Lu, Inositol hexaphosphate suppresses growth and induces apoptosis in HT-29 colorectal cancer cells in culture: PI3K/Akt pathway as a potential target. Int. J. Clin. Exp. Pathol., 8(2) (2015) 1402-1410. 16. O. Cecconi, R.M. Nelson, W.G. Roberts, K. Hanasaki, G. Mannori, C. Schultz, T.R. Ulich, A. Aruffo, M.P. Bevilacqua, Inositol polyanions. Noncarbohydrate inhibitors of L- and P-selectin that block inflammation, J. Biol. Chem. 269(21) (1994) 15060-15066. 17. G. Marks, R.D. Aydos, D.J. Fagundes, E.R. Pontes, L.C. Takita, E.G. Amaral, A. Rossini, C.M. Ynouye, Modulation of transforming growth factor beta2 (TGF-beta2) by inositol hexaphosphate in colon carcinogenesis in rats. Acta Cir. Bras.;21 (Suppl 4) (2006) 51-56. 18. Y. Okazaki, T. Katayama, Dietary phytic acid modulates characteristics of the colonic luminal environment and reduces serum levels of proinflammatory cytokines in rats fed a high-fat diet, Nutr. Res., 34(12) (2014) 1085-1091. 19. S. Kraus, N. Arber, Inflammation and colorectal cancer, Curr. Opin. Pharmacol, 9(4) (2009) 405–410.

21

20. A. Y. Issaa, S. R. Volatea, M. J. Wargovich, The role of phytochemicals in inhibition of cancer and inflammation: New directions and perspectives, J. Food Compost Anal., 19(5) (2006) 405–419. 21. S. Hong, H.J. Lee, S.J. Kim, K. B. Hahm, Connection between inflammation and carcinogenesis in gastrointestinal tract: Focus on TGF-β signaling, World J. Gastroenterol., 16(17) (2010) 2080-2093. 22. C. Maihöfner, M. P. Charalambous, U. Bhambra, T. Lightfoot, G. Geisslinger, N. J. Gooderhamet, Expression of cyclooxygenase-2 parallels expression of interleukin1beta, interleukin-6 and NF-kappaB in human colorectal cancer, Carcinogenesis, 24(4) (2003) 665-671. 23. G. S. Smith, C. Rieckenberg, W. E. Longo, D. L. Kaminski, J. E. Mazuski, Y. Deshpande, T. A. Miller, The effect of an interleukin receptor antagonist (IL-1ra) on colonocyte eicosanoid release, Mediators Inflamm., 5(6) (1996) 449-452. 24. E. R. Greene, S. Huang, C.N. Serhan, D. Panigrahy, Regulation of inflammation in cancer by eicosanoids, Prostaglandins and Other Lipid Mediat., 96(1-4) (2011) 27-36. 25. S. Tavolari, M. Bonafè, M. Marini, C. Ferreri, G. Bartolini, E. Brighenti, S. Manara, V. Tomasi, S. Laufer, T. Guarnieri, Licofelone, a dual COX/5-LOX inhibitor, induces apoptosis in HCA-7 colon cancer cells through the mitochondrial pathway independently from its ability to affect the arachidonic acid cascade, Carcinogenesis, 29(2) (2008) 371-380. 26. S. D. Solomon, J. J. McMurray, M. A. Pfeffer, J. Wittes, R. Fowler, P. Finn, W. F. Anderson, A. Zauber, E. Hawk, M. Bertagnolli, Cardiovascular risk associated with celecoxib in a clinical trial for colorectal adenoma prevention, N. Engl. J. Med., 352(11) (2005) 1071–1080.

22

27. J. A. Baron, R. S. Sandler, R.S. Bresalier, H. Quan, R. Riddell, A. Lanas, J. A. Bolognese, B. Oxenius, K. Horgan, S. Loftus, D. G. Morton, A randomized trial of rofecoxib for the chemoprevention of colorectal adenomas, Gastroenterol., 131(6) (2006) 1674–1682. 28. T. Hussain, S. Gupta, V. M. Adhami, H. Mukhtar, Green tea constituent epigallocatechin-3-gallate selectively inhibits COX-2 without affecting COX-1 expression in human prostate carcinoma cells, Int. J. Cancer, 113(4) (2005) 660-669. 29. P. Eggleton, Effect of IP6 on human neutrophil cytokine production and cell morphology, Anticancer Res., 19(5A) (1999) 3711-3715. 30. J.-M. Cherng, W. Chiang, L.-C. Chiang, Immunomodulatory activities of edible beans and related constituents from soybean. Food Chem., 104 (2) (2007) 613–618. 31. L. Węglarz, J. Wawszczyk, A. Orchel, M. Jaworska-Kik, Dzierzewicz, Phytic acid modulates in vitro IL-8 and IL-6 release from colonic epithelial cells stimulated with LPS and IL-1 Dig. Dis. Sci., 52(1) (2007) 93–102. 32. K. Cholewa, B. Parfiniewicz, I. Bednarek, L. Swiatkowska, E. Jezienicka, J. Kierot, L. Weglarz, The influence of phytic acid on TNF- and its receptors genes’ expression in colon cancer Caco-2 cells, Acta Pol. Pharm., 65(1) (2008) 75–79. 33. M. Kapral, J. Wawszczyk, S. Sośnicki, L. Węglarz, Down-regulation of inducible nitric oxide synthase expression by inositol hexaphosphate in human colon cancer cells, Acta Pol. Pharm., 72(4) (2015) 705-711. 34. T. A. Zykova, F. Zhu, X. Zhai, W. Y. Ma, S. P. Ermakova, K. W. Lee, A. M. Bode, Z. Dong, Resveratrol directly targets COX-2 to inhibit carcinogenesis, Mol. Carcinog., 47(10) (2008) 797-805.

23

35. D. Serra, A. T. Rufino, A. F. Mendes, L. M. Almeida, T. C. Dinis, Resveratrol modulates

cytokine-induced

Jak/STAT

activation

more

efficiently

than

5-

aminosalicylic acid: an in vitro approach, PLoS One, 9(10) (2014) e109048. 36. A. Goel, C. R. Boland, D. P. Chauhan, Specific inhibition of cyclooxygenase-2 (COX2) expression by dietary curcumin in HT-29 human colon cancer cells, Cancer Lett., 172(2) (2001) 111-118. 37. D. Porath, C. Riegger, J. Drewe, J Schwager, Epigallocatechin-3-gallate impairs chemokine production in human colon epithelial cell lines, J. Pharmacol. Exp. Ther., 315(3) (2005) 1172-1180. 38. F. Ye, J. Wu, T. Dunn, X. Tong, D. Zhang, Inhibition of cyclooxygenase-2 activity in head and neck cancer cells by genistein, Cancer Lett., 211(1) (2004) 39-46. 39. Y.-K. Lee, S. Y. Park, Y.-M. Kim, W. S. Lee, O. J. Park, AMP kinase/cyclooxygenase2 pathway regulates proliferation and apoptosis of cancer cells treated with quercetin, Exp. Mol. Med., 41(3) (2009) 201-207. 40. J. Honga, T. J. Smithb, C.-T. Hoc, D. A. Augustd, C. S. Yanga, Effects of purified green and black tea polyphenols on cyclooxygenase and lipoxygenase-dependent metabolism of arachidonic acid in human colon mucosa and colon tumor tissues, Biochem. Pharmacol., 62(9) (2001) 1175–1183. 41. J. Ju, Y. Liu, J. Hong, M. T. Huang, A. H. Conney, C. S. Yang,. Effects of green tea and high-fat diet on arachidonic acid metabolism and aberrant crypt foci formation in an azoxymethane-induced colon carcinogenesis mouse model, Nutr. Cancer, 46(2) (2003) 172–178.

24

42. B. B. Aggarwal, A. Bhardwaj, R. S. Aggarwal, N. P. Seeram, S. Shishodia, Y. Takada, Role of resveratrol in prevention and therapy of cancer: preclinical and clinical studies, Anticancer Res., 24(5A) (2004) 2783–2840. 43. N. H. Shafie, N. M. Esa, H. Ithnin, A. Md Akim, N. Saad, A. K. Pandurangan, Preventive inositol hexaphosphate extracted from rice bran inhibits colorectal cancer through involvement of Wnt/-catenin and COX-2 pathways, Biomed Res. Int., 2013 (2013) Article ID 681027, doi: 10.1155/2013/681027 44. E. O. da Silva, J. R. Gerez, A. P. F. R. L. Bracarense, Effect of phytic acid from rice and corn on morphology, cell proliferation, apoptosis and cyclooxygenase-2 expression in swine jejunal explants, Ciênc. Agrotec. Lavras, 38(3) (2014) 278-285. 45 G.F. Sud'ina, M. A. Pushkareva, P. Shephard, T. Klein, Cyclooxygenase (COX) and 5lipoxygenase (5-LOX) selectivity of COX inhibitors, Prostaglandins, Leukot. Essent. Fatty Acids, 78(2) (2008) 99-108. 46 F. Cianchi, C. Cortesini, L. Magnelli, E. Fanti, L. Papucci, N. Schiavone, L. Messerini, A. Vannacci, S. Capaccioli, F. Perna, M. Lulli, V. Fabbroni, G. Perigli, P. Bechi, E. Masini, Inhibition of 5-lipoxygenase by MK886 augments the antitumor activity of celecoxib in human colon cancer cells, Mol. Cancer Ther., 5(11) (2006) 2716–2726. 47 R. Ganesh, D. J. B. Marks, K. Sales, M. C. Winslet, A. M Seifalian. Cyclooxygenase/lipoxygenase

shunting

lowers

the

anti-cancer

effect

of

cyclooxygenase-2 inhibition in colorectal cancer cells, World J. Surg. Oncol., 10 (2012) 200, doi: 10.1186/1477-7819-10-200. 48 H. Y. Shi, F. J. Lv, S. T. Zhu, Q. G. Wang, S. T. Zhang, Dual inhibition of 5-LOX and COX-2 suppresses esophageal squamous cell carcinoma, Cancer Lett., 309(1) (2011) 19-26. 25

49 R.W. Owen, U.M. Weisgerber, B. Spiegelhalder, H. Bartsch, Faecal phytic acid and its relation to other putative markers of risk for colorectal cancer, Gut 38 (4) (1996):591– 597. 50 C. Lepage, B. Liagre, J. Cook-Moreau, A. Pinon, J. L. Beneytout, Cyclooxygenase-2 and 5-lipoxygenase pathways in diosgenin-induced apoptosis in HT-29 and HCT-116 colon cancer cells, Int. J Oncol., 36(5) (2010) 1183-1191. 51 L. S. Wang, C. T. Kuo, Y. W. Huang, G. D. Stoner, J. F. Lechner, Gene-Diet Interactions on Colorectal Cancer Risk, Curr. Nutr. Rep., 10(1) (2012) 132-141. 52 H. S. Lee, E. J. Kim, Y. S. Oh, H. J. Cho, J. H. Park, Effects of cyclooxygenase and lipoxygenase inhibitors on the proliferation of colon cancer cells and their production of eicosanoids, Cancer Res. Treat., 33(5) (2001) 404-413. 53 J. Liao, D. N. Seril, A. L. Yang, G. G. Lu, G.-Y. Yang, Inhibition of chronic ulcerative colitis associated adenocarcinoma development in mice by inositol compounds, Carcinogenesis, 28(2) (2007) 446–454. 54 S. Ferry, M. Matsuda, H. Yoshida, M. Hirata, Inositol hexakisphosphate blocks tumor cell growth by activating apoptotic machinery as well as by inhibiting the Akt/NFkappaB-mediated cell survival pathway. Carcinogenesis, 23(12) (2002) 20312041. 55 M. Kojima, T. Morisaki, K. Izuhara, A. Uchiyama, Y. Matsunari, M. Katano, M. Tanaka, Lipopolysaccharide increases cyclooxygenase-2 expression in a colon carcinoma cell line through nuclear factor-B activation, Oncogene, 19(9) (2000) 1225–1231. 56 Y.-J. Surh, K.-S. Chun, H.-H. Cha, S.S. Han, Y.S. Keum, K.K. Park, S.S. Lee, Molecular mechanisms underlying chemopreventive activities of anti-inflammatory 26

phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-B activation, Mutat. Res., 480–481 (2001) 243–268.

27

Figure legends: Figure 1. Structure of inositol hexaphosphate.

Figure 2. Expression of COX-1 and COX-2 genes in Caco-2 cells as determined by RT-qPCR. Changes in mRNAs expression in Caco-2 cells after treatment with (A) 2.5 mM and 5 mM IP6, (B) pro-inflammatory agents and (C) pro-inflammatory agents and 2.5 mM and 5 mM IP6 for 3 h, 6 h and 12 h. The results are presented as mean ± SD of three separate experiments; * p < 0.05 versus control Caco-2 cells; # p < 0.05 versus pro-inflammatory agents stimulated cells; ^ p < 0.05 cells treated with 2.5 mM versus 5 mM IP6.

Figure 3. Expression of 5-LOX, 12-LOX and 15-LOX genes in Caco-2 cells as determined by RT-qPCR. Changes in mRNAs expression in Caco-2 cells after treatment with (A) 2.5 mM and 5 mM IP6, (B) pro-inflammatory agents and (C) pro-inflammatory agents and 2.5 mM and 5 mM IP6 for 3 h, 6 h and 12 h. The results are presented as mean ± SD of three separate experiments; * p < 0.05 versus control Caco-2 cells; # p < 0.05 versus pro-inflammatory agents stimulated cells; ^ p < 0.05 cells treated with 2.5 mM versus 5 mM IP6.

Figure 4. Effect of IP6 on COX-2 concentration in Caco-2 cells unstimulated and stimulated with IL-1β/TNF-α for (A) 6 h and (B) 24 h. The results are presented as mean ± SD of three separate experiments; * p < 0.05 versus control Caco-2 cells; # p < 0.05 versus proinflammatory agents stimulated cells.

Figure 5. Effect of IP6 on 5-LOX concentration in Caco-2 cells unstimulated and stimulated with IL-1β/TNF-α for (A) 6 h and (B) 24 h. The results are presented as mean ± SD of three

28

separate experiments; * p < 0.05 versus control Caco-2 cells; # p < 0.05 versus proinflammatory agents stimulated cells.

Figure 6. Effect of IP6 on PGE2 secretion by Caco-2 cells unstimulated and stimulated with IL-1β/TNF-α for (A) 6 h and (B) 24 h. The results are presented as mean ± SD of three separate experiments; * p < 0.05 versus control Caco-2 cells; # p < 0.05 versus proinflammatory agents stimulated cells.

Figure 7. Effect of IP6 on LTB4 secretion by Caco-2 cells unstimulated and stimulated with IL-1β/TNF-α for 24 h. The results are presented as mean ± SD of three separate experiments; * p < 0.05 versus control Caco-2 cells; # p < 0.05 versus pro-inflammatory agents stimulated cells.

29

Figure 1

(A)

1.6

Relative mRNA expression (fold change)

1.4

COX-2

COX-1

1.2 1

**

0.8 0.6

*

^

*

0.4 0.2 0 3h

6h

12h

Control

(B)

2.5 mM IP6

6h

12h

5 mM IP6

4

COX-1

3.5

Relative mRNA expression (fold change)

3h

COX-2

*

3

*

2.5 2

*

* *

1.5 1 0.5 0 3h

6h

12 h Control

Relative mRNA expression (fold change)

(C)

3h

6h

12 h

IL-1b/TNFa

1.4

COX-1

COX-2

1.2 1 0.8

# ##

# ^ #

#

^ #

^ #

0.6 0.4 0.2 0 3h IL-1b/TNFa

6h

12h

IL-1b/TNFa + 2.5 mM IP6

Figure 2

3h

6h

IL-1b/TNFa + 5 mM IP6

12h

4.5

(A)

*

Relative mRNA expression (fold change)

4

5-LOX

12-LOX

15-LOX

*

3.5

*

3

*

*

2.5

^

2

*

1.5

* ^

1 0.5 0 3h

6h

12h

3h

Control

6h

2.5 mM IP6

12h

3h

6h

5 mM IP6

8

(B)

*

Relative mRNA expression (fold change)

7

5-LOX

15-LOX

12-LOX

6 5

*

4

*

3 2

*

*

*

1

*

0 3h

6h

12 h

3h Control

Relative mRNA expression (fold change)

(C)

12 h

6

^ #

5-LOX ^ #

5

6h

12 h

3h

6h

12 h

IL-1b/TNFa

12-LOX

15-LOX

4 3

#

#

##

2

1

##

##

0 3h

6h

12h

IL-1b/TNFa

3h

6h

IL-1b/TNFa + 2.5 mM IP6

Figure 3

12h

3h

IL-1b/TNFa + 5 mM IP6

6h

12 h

Concentration of COX-2 [ng/ml]

5 4.5

(A)

(B)

6h

24 h

4 3.5 3

#

2.5 2 1.5 1

*

0.5 0 Unstimulated cells

Stimulated cells

Control

2.5 mM IP6

Figure 4

Unstimulated cells

5 mM IP6

Stimulated cells

Concentration of 5-LOX [ng/ml]

120

(A)

6h

100

(B)

#

24 h

#

#

80

#

60 40 20

*

*

0 Unstimulated cells

Stimulated cells

Control

2.5 mM IP6

Figure 5

Unstimulated cells

5 mM IP6

Stimulated cells

Concentration of PGE2 [pg/ml]

120

(B)

6h

(A)

24 h

100

#

80

#

60 40 20

# #

* *

0 Unstimulated cells

Stimulated cells

Control

2.5 mM IP6

Figure 6

Unstimulated cells

5 mM IP6

Stimulated cells

concentration of LTB4 [pg/ml]

18

*

16

*

14 12

10 8 6 4 2 0

Unstimulated cells

Stimulated cells

Control

5 mM IP6

2.5 mM IP6

Figure 7

Table 1. Characteristics of primers used in the experiment Product size Gene

Primer sequence (bp) F: 5’TACTCACAGTGCGCTCCAAC3’

COX-1

167 R: 5’GCAACTGCTTCTTCCCTTTG3’ F: 5’ATCATAAGCGAGGGCCAGCT3’

COX-2

100 R: 5’AAGGCGCAGTTTACGCTGTC3’ F: 5’-AGCAAGGGAACATTTTCATC-3’

5-LOX

112 R: 5’-CTTATACAGCAAGCAGATGG -3’ F: 5’-GAACTGCCTAGAAGACTTTG-3’

12-LOX

99 R: 5’-GTAGCTGAACAACTCATCATC-3’ F: 5’-CTTCAAGCTTATAATTCCCCAC-3’ 87

15-LOX R: 5’-GAAAATTCCCATGTCAGAGAC-3’ bp – base pair;

30