- Email: [email protected]
Modulation of angiogenic factors by ursolic acid
Biochemical and Biophysical Research Communications 371 (2008) 556–560
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Modulation of angiogenic factors by ursolic acid M.S. Kiran, R.I. Viji, V.B. Sameer Kumar, P.R. Sudhakaran * Department of Biochemistry, University of Kerala, Thiruvananthapuram, Kerala 695 581, India
a r t i c l e
i n f o
Article history: Received 19 April 2008 Available online 28 April 2008
Keywords: Ursolic acid VEGF PI3K-Akt MAPK Angiogenesis VEGFR-2 FGF-2 FGFR-1 COXs Prostaglandins
a b s t r a c t Investigations were carried out to understand the molecular basis of the effect of ursolic acid on angiogenesis by analysing its effects on the expression of modulators of angiogenesis by HUVECs in culture. Treatment with ursolic acid increased the expression of adhesion molecules such as E-selectin, CD-31 and I-CAM, upregulated angiogenic growth factors such as VEGF and FGF-2 and their receptors and caused increase in the ratio of PGE2 to PGD2. Reversal of the effect of ursolic acid by inhibition of PI3K-Akt pathway and increase in the level of phospho Akt suggest that the ursolic acid effect is mediated through PI3K-Akt pathway. Ó 2008 Elsevier Inc. All rights reserved.
New blood vessels develop from the pre-existing vessels in both physiological as well as pathological conditions [1]. It is controlled under physiological conditions by maintaining a balance between the pro and anti-angiogenic factors [2]. Disruption of this leads to aberrant angiogenesis resulting in pathological conditions arising due to hypo or hyper angiogenesis [1]. Endothelial cells, the key type of cells involved in this process, respond to a number of cytokines and growth factors that modulate angiogenesis; VEGF and FGF-2 are the most potent angiogenic inducers produced by a variety of normal as well as tumour cells [3]. Much current research is on therapeutic approach to identify compounds which are able to modulate angiogenesis. Nutraceuticals have been shown to affect angiogenesis by modulating the endothelial cell behaviour [4]. Ursolic acid (3b-hydroxy-urs-12en-28-oic acid) is one such nutraceutical with several promising pharmacological properties [5,6]. It is a pentacyclic triterpenoid, a member of the cyclosqualenoid family, found in many kinds of medicinal plants and present in human diet [7]. It has been reported to exert a number of pharmacological effects including inhibition of neovascularisation in CAM assay [8,9]. Although ursolic acid has been reported to inhibit the proliferation and migration of bovine aortic endothelial cells, other key
* Corresponding author. Fax: +91 4712418078. E-mail addresses: [email protected], [email protected] (P.R. Sudhakaran). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.04.108
steps of angiogenesis such as extracellular matrix degradation by proteases and cell invasiveness studied in vitro, were reported to be stimulated by ursolic acid [8]. Further, ursolic acid which inhibited the differentiation of BAECs on matrigel [8] was reported to induce differentiation of F9 teratocarcinoma stem cells [10]; such pleiotropic effects, apparently due to different molecular mechanisms are shown by a number of different nutraceuticals. Recently we observed such opposing effects for curcumin, which inhibited the angiogenic process induced by exogenously supplemented growth factor while under unstimulated conditions it enhanced the endogenous growth factor production promoting angiogenesis [11]. To understand the molecular basis of the effect of ursolic acid on angiogenesis, the influence of ursolic acid on the production and action of the modulators of angiogenesis in endothelial cells was studied using HUVECs in culture and the results are presented here. Materials and methods The biochemical reagents and ursolic acid used for this study were procured from M/s Sigma–Aldrich Co (St. Louis, MO) and antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). ELISA and tissue culture plates were from NUNC A/S (Roskilde, Denmark). Isolation and culture of HUVECs. Endothelial cells were isolated by collagenase perfusion of umbilical vein as described before
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
[11,12]. Cells (1.5 106 per well) in serum free MCDB 131 medium were seeded in NUNC multi-well plates and allowed to attach for 5 h, unattached cells were removed, fresh medium was added and maintained in culture overnight before starting the experiment. RT-PCR analysis. Total RNA was isolated from HUVECs using Perfect RNA Mini isolation kits procured from Eppendorf according to manufacturer’s instruction. The primer pairs for human VEGF, VEGFR-2, FGF-2, FGFR-1, COX-1, COX-2 and GAPDH were as follows: VEGF (105 bp) Forward 50 ACGATCGATACAGAAACCACG30 Reverse 50 CTCTGCGCAGAGTCTCCTCT30 ; VEGFR-2 (216 bp) Forward 50 TGCACTGCAGACAGATATAC 30 Reverse 50 GCAGACATAGTCTCCTT GGT30 ; FGF-2 (100 bp) Forward 50 AGCAGCATCTGTAAGGTTCTTC30 Reverse 50 TGAAACATTGGGAGGGAAAC30 ; FGFR-1 (218 bp) Forward 50 CCTGAACAGGTGGTGGTATC30 Reverse 50 TTTGAACTTCACTGTCT TGGC30 ; COX-1 (299 bp) Forward 50 CAAACGCTCCCATTTTTACAC TC30 Reverse 50 TGGCATGTAGTAGTCTCTTGGCA30 ; COX-2 (452 bp) Forward 50 AATTCCTCATCCAACTATGTTCC30 Reverse 50 ATACTGTT CTCCGTACCTTCACC30 and GAPDH (680 bp) Forward 50 CGGAGT CAACGGATTTGGTCGTAT30 Reverse 50 GCAGGTCAGGTCCACCAC TAGC30 . The primer sequences were taken from NCBI nucleotide database and custom synthesized by Sigma–Aldrich Chemicals Bangalore, India. RT-PCR was performed in an Eppendorf thermocycler, using the C-Master RT Plus PCR kit (Eppendorf AG, Hamburg, Germany). Twenty microlitres (2 lg) of the isolated RNA was used as template for reverse transcription and amplification as described before [13]. Immunoblot analysis. Medium was removed, cell layer was washed with PBS, harvested and the cell pellets were lysed in Laemmli sample buffer. Protein equivalent amount of the lysates were subjected to SDS–PAGE and electroblotted onto NC membrane, probed with specific antibody and developed using HRP-conjugated secondary antibody [14]. Appropriate negative controls were taken without primary antibody. The band intensity was determined by Quantity One 4.5.0 Image acquisition and Analysis software (BioRad). Indirect ELISA was performed using specific antibodies as described before [13]. Analysis of intracellular signaling pathways. HUVECs in culture were treated with inhibitors of PI3K-Akt (LY294002), p38 MAPK (SB202190) and ERK (PD98059) at a concentration of 20 lM each for 48 h and the expression of angiogenic marker I-CAM was analysed by ELISA as described above. Activation of Akt and p38 by phosphorylation was studied by immunoblotting of equivalent amounts of cell lysates with specific antibodies as described before [11]. Estimation of prostaglandins, PGE2 and PGD2. The level of prostaglandins in the culture supernatants were estimated by HPLC [15]. The culture medium (adjusted to pH 3.5) was passed through 1 ml Sep Pak C18 columns equilibrated with 0.1% EDTA. Bound eicosanoids were eluted with 2 ml of methanol, concentrated under a stream of nitrogen and subjected to isocratic reversed-phase HPLC using C18 column at a flow rate of 2 ml/min and UV detection at 275 nm. The mobile phase consisted of acetonitrile:acetic acid:H2O (31.9:0.1:68 vol/vol pH 4.5). Appropriate standards of PGE2 and PGD2 (100 lg) were subjected to HPLC for calibration. Statistical analysis. The statistical significance of difference was analysed by Duncan’s one way Analysis of Variance (ANOVA) using SPSS10 Software.
557
expression of adhesion molecules involved in angiogenesis such as E-selectin, I-CAM and CD-31 was studied in HUVECs in culture. The amount of these markers steadily increased with the progression of the culture and was significantly high in cells treated with ursolic acid than the untreated control (Fig. 1). Increase in the expression of these proteins were synchronous with the morphological changes i.e. ECs treated with ursolic acid underwent morphological changes forming capillary network-like structure after 48 h when the level of these markers were very high. A 2-fold increase in the expression of these adhesion molecules was observed
Results and discussion Effect of ursolic acid on the production of cell-adhesion molecules involved in angiogenesis by HUVECs Cell–cell interaction mediated through cell-adhesion molecules is a key process in angiogenesis. The effect of ursolic acid on the
Fig. 1. Production of E-selectin, CD-31 and I-CAM by HUVECs: effect of ursolic acid. Cells were maintained in MCDB 131 medium with [10 (U10), 50 (U50) and 100 (U100) lM] and without (U0) ursolic acid for different time intervals. Medium was removed and the cell layer harvested at every 24 h and estimated the amount of Eselectin (total) (A), CD-31(B) and I-CAM (C) in cell layer by ELISA. Values given are the average of duplicate analysis of five experiments ± SEM. *Statistically significant when compared to control p < 0.05.
558
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
on the 2nd day of culture in cells treated with 50–100 lM concentrations of ursolic acid when compared with the controls. Although low concentration of ursolic acid (10 lM) did not affect the levels of total E-selectin (cell associated and shed) it decreased the levels of cell associated I-CAM and CD-31 at 10 lM concentration. It could be due to increase in the degradation of cell surface molecules by the action of proteases such as MMPs, which have been reported to increase at concentrations of ursolic acid as low as 5 lM [8]. We also found high levels of MMPs at low concentrations of ursolic acid where cell–cell contact was less; but MMPs were downregulated at higher concentration of ursolic acid when cell–cell contact was established (data not shown). Cell–cell contact associated downregulation of MMPs during angiogenesis has been reported [16]. Increase in the cell surface adhesion molecules produced by ursolic acid at higher concentrations may be due to a decrease in their proteolytic removal and an upregulation of their expression. Apart from their role in stabilizing cell–cell contact during angiogenesis, cell-adhesion molecules particularly, soluble secreted form of E-selectin [17] have been reported to increase the expression of VEGF in ECs by acting in an autocrine manner. CD-31 is essential for the migration and tubular structure formation and has been reported to increase prior to the network formation [18]. Effect of ursolic acid on the production of angiogenic growth factors The ability of HUVECs to produce different angiogenic growth factors such as FGF-2, VEGF and angiopoietin-1 (Ang-1) was studied in presence and absence of different concentrations of ursolic acid. The levels of FGF-2 and VEGF were significantly high in cells treated with ursolic acid compared with the untreated control (Fig. 2B). The amount of Ang-1 produced by cells was very low and ursolic acid treatment did not affect the production of Ang-1 in HUVECs. Immunoblot analysis further confirmed upregulation of the expression of VEGF and FGF-2 in cells treated with ursolic acid; no significant difference in their level was observed in cells treated with low concentrations of ursolic acid (less than 10 lM) compared with the respective control (Fig. 2A). RT-PCR analysis showed a higher expression of VEGF, FGF-2 and their receptor VEGFR-2 and FGFR-1 in cells treated with ursolic acid compared with the controls (Fig. 2C). VEGF produced by ECs in response to ursolic acid can act in an autocrine manner on ECs and promote angiogenic phenotype. The autocrine effect of VEGF was evidenced by increased expression of VEGFR-2 which is the endothelial specific receptor for VEGF whose binding to VEGFR-2 generates intracellular signal causing transition to angiogenic phenotype [19]. It therefore appears that ursolic acid may cause angiogenic effects by upregulation of the production of VEGF as well as an increase in its autocrine effect through upregulation of the EC specific receptor VEGFR-2. FGF-2 has been reported to be essential for differentiation of endothelial cells to form capillary network-like structure by acting both in paracrine and autocrine manner through its receptor FGFR-1 [20,21]. Further, there is synergism in the activities of both these growth factors [22]. Moreover, FGF-2 increases the expression of VEGFR-2 in endothelial cells [23]. These reports are consistent with our finding and suggest that ursolic acid mediates its angiogenic effect by modulating the production of both these growth factors. Effect of ursolic acid on the production of cyclooxygenase and prostaglandins Prostaglandins formed by the action of cyclooxygenase are important modulators of angiogenesis. The levels of proangiogenic PGE2 molecule was significantly high in cells treated with 50 and
Fig. 2. Effect of ursolic acid on the production of angiogenic growth factors: HUVECs were maintained in MCDB 131 medium with [10 (U10), 50 (U50) and 100 (U100) lM] and without (U0) ursolic acid. Cells and medium were harvested and subjected to Western blotting (A) and ELISA (B) to analyse the production of VEGF (a), FGF-2 (b) in the medium. *Statistically significant when compared to untreated control p < 0.05. (C) Expression of VEGF, FGF-2 FGFR-1 and VEGFR-2 in HUVECs— RT-PCR. Parallel cultures were maintained in presence [50 (U50) and 100 (U100) lM] and absence (U0) of ursolic acid for 48 h. Cells were harvested, total RNA was isolated subjected to RT-PCR and separated by electrophoresis in 1.75% agarose. Relative intensity of bands were quantitated and normalized with the intensity of band for internal control GAPDH and the results indicate significant upregulation in the expression of VEGF (2.5-fold), FGF-2 (3-fold), VEGFR-2 (3-fold) and FGFR-1 (2-fold) in cells treated with ursolic acid compared to control.
100 lM concentrations of ursolic acid while that of the anti-angiogenic PGD2 decreased when compared to control (Fig. 3B). RT-PCR analysis showed that the expression of COX-1 was not affected by treatment with ursolic acid. COX-2 mRNA increased by about 2.5fold in cells treated with ursolic acid when compared with the controls which may explain increase in the level of PGE2 (Fig. 3A). These results suggest that ursolic acid modulates the production
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
559
of angiogenic growth factors at transcriptional and translational level. Although the reported anti-inflammatory effects of ursolic acid involve the inhibition of COX [6,24], we observed significantly higher expression of COX-2 and increased production of PGE2 in endothelial cells. This effect could be either due to the cell type specificity or due to the fact that the cells used for this assay were free from exogenous stimuli as most of the nutraceuticals affect activation induced expression of inflammatory mediators [24]. PGE2 has been reported to exert a proangiogenic effect [25] whereas PGD2 inhibits angiogenesis [26]. Higher PGE2 to PGD2 ratio has been reported to upregulate the production of VEGF [25]. Consistent with this, ursolic acid was also found to increase the ratio of PGE2 to PGD2 in HUVECs which may be one of the reasons for the increased production of VEGF. VEGF has been reported to upregulate the expression of COX-2 and PGE2 through NFjB signaling pathways suggesting the existence of signaling loop between VEGF and PGE2 that is affected by ursolic acid. Intracellular signaling pathways as targets of ursolic acid
Fig. 3. Effect of ursolic acid on COXs expression (RT-PCR) and prostaglandin production. (A) Cells were maintained in MCDB 131 medium in presence of [50 (U50) and 100 (U100) lM] and absence (U0) of ursolic acid for 48 h. Medium was removed and the cell layer harvested and subjected to RT-PCR analysis. Relative intensity of bands were quantitated and normalized with the intensity of band for internal control GAPDH and the results indicate significant upregulation of the expression of COX-2 (2.5-fold) in cells treated with ursolic acid compared to control. (B) The level of prostaglandins in the medium was determined by HPLC analysis and expressed in micromoles/mg protein. Values given are the average of duplicate analysis of five experiments ± SEM. *Statistically significant when compared to controls p < 0.05.
To get an insight into the intracellular signaling pathways that are responsive to ursolic acid, the effect of inhibitors of certain signaling pathways involved in angiogenic process was studied by analysing the expression of the adhesion protein I-CAM which is involved in modulating cell adhesion in angiogenesis (Fig. 4A). Treatment of HUVECs with LY294002, an inhibitor of PI3K-Akt pathway and SB202190, an inhibitor of p38 MAPK caused a significant inhibition in the production of I-CAM whereas in cells supplemented with PD98059, an inhibitor of ERK-MAPK the inhibition was less pronounced. Treatment with LY294002 and SB202109 reversed the stimulatory effect of ursolic acid on I-CAM production and PD98059 did not produce any reversal of the stimulatory effect exerted by ursolic acid suggesting that PI3K-Akt and p38 MAPK path-
Fig. 4. Effect of ursolic acid on intracellular signaling pathways. (A) The effect of inhibition of PI3K-Akt and MAPK signaling pathways on the expression of the angiogenic marker I-CAM was studied by treating cells with LY294002, SB202109 and PD98059 (20 lM) in presence [10 (U10), 50 (U50) and 100 (U100) lM] and absence (U0) of various concentration of ursolic acid. After 48 h, cells were harvested and the amount of I-CAM in the cells was determined by ELISA. Values given are the average of quadruplicate experiments ± SEM. *Statistically significant when compared to cells maintained without inhibitor p < 0.05. The activation of Akt (B) and p38 (C) at different time intervals in presence [10 (U10), 50 (U50) and 100 (U100) lM] and absence (U0) of ursolic acid was analysed by immunoblotting of equivalent amounts of Akt and p38 by specific phospho Akt and phospho p38 antibodies.
560
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
way may be responsive to ursolic acid. This possibility was further examined by analysing the activation of Akt and p38 MAPK (Fig. 4B and C). Immunoblot analysis showed that treatment of cells with ursolic acid caused increase in the phosphorylation of Akt which steadily increased to attain a maximum level during later time intervals. Levels of phospho p38 were significantly high during the early time intervals (8 h) which decreased with the progression of culture and was very low after 24 h. Treatment with ursolic acid appeared to have less effect on the activation of p38. These results thus suggest that PI3K-Akt pathway is more active and sensitive to ursolic acid. VEGF by interacting with its receptor VEGFR-2 activates intracellular signaling pathways including PI3K-Akt, p38 MAPK, ERKMAPK causing downstream signaling leading to angiogenic events [27]. Increase in the level of activated phospho Akt in cells treated with ursolic acid and the reversal of the effect of ursolic acid on the production of I-CAM on inhibition of PI3K-Akt pathway suggest that ursolic acid treatment caused activation of PI3K-Akt pathway in HUVECs. However, the inhibition of production of I-CAM by SB202190 and PD98059, although not as profound as that observed with LY294002 in HUVECs in presence of ursolic acid does not exclude the role of MAPK pathway. PI3K-Akt signaling pathway regulates endothelial cell survival, migration and capillary-like structure formation which are critical steps in angiogenesis [28]. ERK1/2 signaling cascade specifically regulates network formation and inhibition of this pathway disrupted endothelial network formation [29]. But no activation of ERK1/2 was caused by ursolic acid, rather the level of activated p38 decreased by ursolic acid with progression of culture. It appears that this pathway is less sensitive to ursolic acid at the concentration tested. Modulation of the activity of transcription factors (NFjB and AP-1) downstream may contribute to differential expression of the genes that code for angiogenic modulators and angiogenic phenotype. This was suggested by the differential activation of these transcription factors by ursolic acid depending on the microenvironment of the cells (data not shown). Earlier report showed that ursolic acid even up to a concentration 50 lM had no effect on the activation of NFjB in unactivated Jurkat cells but in TNF-a activated Jurkat cells ursolic acid at 50 lM concentration caused inhibition of NFjB [24]. The results presented here indicate upregulation of angiogenic modulators in ECs treated with ursolic acid; low concentration of ursolic acid (less than 10 lM) had no effect on these modulators. The cells were maintained in culture in serum free unstimulated conditions. The changes in the angiogenic modulators correlated with the ability of ursolic acid to influence angiogenesis. Treatment with ursolic acid at higher concentrations promoted angiogenesis which was evidenced by (a) formation of capillary network-like structure by HUVECs, (b) greater extent of endothelial sprouting in rat aortic rings; but no such effects were observed at low concentration. However treatment of HUVECs and aortic rings, stimulated by maintaining in medium supplemented with serum, with ursolic acid caused inhibition of angiogenic phenotype (data not shown). This observation is similar to that reported earlier where the matrigel induced differentiation of bovine aortic endothelial cell was inhibited by ursolic acid [8]. In summary, these results suggest that the molecular mechanisms of the effect of ursolic acid on angiogenesis include modulation of the expression of angiogenic growth factors, particularly VEGF and prostaglandin and the response of signaling pathways particularly PI3K-Akt pathway. Acknowledgments Financial assistance in the form of SRF, from CSIR Government of India, to M.S. Kiran, R.I. Viji and V.B. Sameer Kumar is gratefully acknowledged. Support for infrastructure from DST, Government of India and UGC, New Delhi, is also gratefully acknowledged.
References [1] P. Carmeliet, Angiogenesis in health and disease, Nat. Med. 9 (2003) 653–660. [2] D. Hanahan, J. Folkman, Patterns and emerging mechanisms of the angiogenic switch during tumourigenesis, Cell 86 (1996) 353–364. [3] J. Folkman, Y. Shing, Angiogenesis, J. Biol. Chem. 267 (1992) 10931–10934. [4] J. Dulak, Nutraceuticals as anti-angiogenic agents: hopes and reality, J. Physiol. Pharmacol. 56 (2005) 51–69. [5] M.T. Huang, C.T. Ho, Z.Y. Wang, T. Ferraro, Y.R. Lou, K. Stauber, W. Ma, C. Georgiadis, J.D. Laskin, A.H. Conney, Inhibition of skin tumorigenesis by rosemary and its constituents carnosol and ursolic acid, Cancer Res. 54 (1994) 701–708. [6] K. Subbaramaiah, P. Michaluart, M.B. Sporn, A.J. Dannenberg, Ursolic acid inhibits cyclooxygenase-2 transcription in human mammary epithelial cells, Cancer Res. 60 (2000) 2399–2404. [7] J. Liu, Pharmacology of oleanolic acid and ursolic acid, J. Ethnopharmacol. 49 (1995) 57–68. [8] C. Cardenas, A.R. Quesada, M.A. Medina, Effects of ursolic acid on different steps of the angiogenic process, Biochem. Biophys. Res. Commun. 320 (2004) 402–408. [9] K.H. Sohn, H.Y. Lee, H.Y. Chung, H.S. Young, S.Y. Yi, K.W. Kim, Anti-angiogenic activity of triterpene acids, Cancer Lett. 94 (1995) 213–218. [10] H.Y. Lee, H.Y. Chung, K. H Kim, J.J. Lee, K.W. Kim, Differentiation induction of the F9 teratocarcinoma cells by triterpene acids, J. Cancer Res. Clin. Oncol. 120 (1994) 513–518. [11] M.S. Kiran, V.B. Kumar, R.I. Viji, G.T. Sherin, K.N. Rajasekharan, P.R. Sudhakaran, Opposing effects of curcuminoids on serum stimulated and unstimulated angiogenic response, J. Cell. Physiol. 215 (2008) 251–264. [12] E.A. Jaffe, R.L. Nachman, C.G. Becker, C.R. Minick, Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria, J. Clin. Invest. 52 (1973) 2745–2756. [13] V.B. Kumar, R.I. Viji, M.S. Kiran, P.R. Sudhakaran, Modulation of expression of LDH isoenzymes in endothelial cells by laminin: implications for angiogenesis, J. Cell. Biochem. 103 (2008) 1808–1825. [14] H. Towbin, T. Staehelin, J. Gordon, Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications, Proc. Natl. Acad. Sci. USA 76 (1979) 4350–4354. [15] H. Holtmann, Y. Shemer-Avni, K. Wessel, I. Sarov, D. Wallach, Inhibition of growth of Chlamydia trachomatis by tumor necrosis factor is accompanied by increased prostaglandin synthesis, Infect. Immun. 58 (1990) 3168–3172. [16] M.S. Kiran, V.B. Kumar, R.I. Viji, P.R. Sudhakaran, Temporal relationship between MMP production and angiogenic process in HUVECs, Cell Biol. Int. 30 (2006) 704–713. [17] B.M. Kraling, M.J. Razon, L.M. Boon, D. Zurakowski, C. Seachord, R.P. Darveau, J.B. Mulliken, C.L. Corless, J. Bischoff, E-selectin is present in proliferating endothelial cells in human hemangiomas, Am. J. Pathol. 148 (1996) 1181–1191. [18] S. Yang, J. Graham, J.W. Kahn, E.A. Schwartz, M.E. Gerritsen, Functional roles of PECAM-1 (CD-31 and VE-cadherin (CD-144) in tube assembly and lumen formation in three dimensional collagen gels, Am. J. Pathol. 155 (1999) 887–895. [19] M.S. Pepper, S.J. Mandriota, Regulation of vascular endothelial growth factor receptor-2 (Flk-1) expression in vascular endothelial cells, Exp. Cell Res. 24 (1998) 414–425. [20] A. Gualandris, M. Rusnati, M. Belleri, E.E. Nelli, M. Bastaki, M.P. MolinariTosatti, F. Bonardi, S. Parolini, A. Albini, L. Morbidelli, M. Ziche, A. Corallini, L. Possati, A. Vacca, D. Ribatti, M. Presta, Basic fibroblast growth factor overexpression in endothelial cells: an autocrine mechanism for angiogenesis and angioproliferative diseases, Cell Growth Differ. 7 (1996) 147–160. [21] F. Sola, A. Gualandris, M. Belleri, R. Giuliani, D. Coltrini, M. Bastaki, M.P. Tosatti, F. Bonardi, A. Vecchi, F. Fioretti, M. Ciomei, M. Grandi, A. Mantovani, M. Presta, Endothelial cells overexpressing basic fibroblast growth factor (FGF-2) induce vascular tumors in immunodeficient mice, Angiogenesis 1 (1997) 102–116. [22] J.C. Tille, J. Wood, S.J. Mandriota, C. Schnell, S. Ferrari, J. Mestan, Z. Zhu, L. Witte, M.S. Pepper, Vascular endothelial growth factor (VEGF) receptor-2 antagonists inhibit VEGF and basic fibroblast growth factor-induced angiogenesis in vivo and in vitro, J. Pharmacol. Exp. Ther. 299 (2001) 1073–1085. [23] S.J. Mandriota, M.S. Pepper, Vascular endothelial growth factor-induced in vitro angiogenesis and plasminogen activator expression are dependent on endogenous basic fibroblast growth factor, J. Cell Sci. 110 (1997) 2293–2302. [24] S. Shishodia, S. Majumdar, S. Banerjee, B.B. Aggarwal, Ursolic acid inhibits nuclear factor-kappaB activation induced by carcinogenic agents through suppression of IkappaBalpha kinase and p65 phosphorylation: correlation with down-regulation of cyclooxygenase 2, matrix metalloproteinase 9, and cyclin D1, Cancer Res. 63 (2003) 4375–4383. [25] R. Pai, I.L. Szabo, B.A. Soreghan, S. Atay, H. Kawanaka, A.S. Tarnawski, PGE(2) stimulates VEGF expression in endothelial cells via ERK2/JNK1 signaling pathways, Biochem. Biophys. Res. Commun. 286 (2001) 923–928. [26] W.S. Powell, 15-Deoxy-delta12,14-PGJ2: endogenous PPAR gamma ligand or minor eicosanoid degradation product?, J Clin. Invest. 112 (2003) 828–830. [27] R. Munoz-Chapulia, A.R. Quesada, A.M. Medina, Angiogenesis and signal transduction in endothelial cells, Cell. Mol. Life Sci. 61 (2004) 2224–2243. [28] I. Shiojima, K. Walsh, Role of Akt signaling in vascular homeostasis and angiogenesis, Circ. Res. 90 (2002) 1243–1250. [29] N.V. Bogatcheva, S.M. Dudek, J.G. Garcia, A.D. Verin, Mitogen-activated protein kinases in endothelial pathophysiology, J. Invest. Med. 51 (2003) 341–352.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Modulation of angiogenic factors by ursolic acid M.S. Kiran, R.I. Viji, V.B. Sameer Kumar, P.R. Sudhakaran * Department of Biochemistry, University of Kerala, Thiruvananthapuram, Kerala 695 581, India
a r t i c l e
i n f o
Article history: Received 19 April 2008 Available online 28 April 2008
Keywords: Ursolic acid VEGF PI3K-Akt MAPK Angiogenesis VEGFR-2 FGF-2 FGFR-1 COXs Prostaglandins
a b s t r a c t Investigations were carried out to understand the molecular basis of the effect of ursolic acid on angiogenesis by analysing its effects on the expression of modulators of angiogenesis by HUVECs in culture. Treatment with ursolic acid increased the expression of adhesion molecules such as E-selectin, CD-31 and I-CAM, upregulated angiogenic growth factors such as VEGF and FGF-2 and their receptors and caused increase in the ratio of PGE2 to PGD2. Reversal of the effect of ursolic acid by inhibition of PI3K-Akt pathway and increase in the level of phospho Akt suggest that the ursolic acid effect is mediated through PI3K-Akt pathway. Ó 2008 Elsevier Inc. All rights reserved.
New blood vessels develop from the pre-existing vessels in both physiological as well as pathological conditions [1]. It is controlled under physiological conditions by maintaining a balance between the pro and anti-angiogenic factors [2]. Disruption of this leads to aberrant angiogenesis resulting in pathological conditions arising due to hypo or hyper angiogenesis [1]. Endothelial cells, the key type of cells involved in this process, respond to a number of cytokines and growth factors that modulate angiogenesis; VEGF and FGF-2 are the most potent angiogenic inducers produced by a variety of normal as well as tumour cells [3]. Much current research is on therapeutic approach to identify compounds which are able to modulate angiogenesis. Nutraceuticals have been shown to affect angiogenesis by modulating the endothelial cell behaviour [4]. Ursolic acid (3b-hydroxy-urs-12en-28-oic acid) is one such nutraceutical with several promising pharmacological properties [5,6]. It is a pentacyclic triterpenoid, a member of the cyclosqualenoid family, found in many kinds of medicinal plants and present in human diet [7]. It has been reported to exert a number of pharmacological effects including inhibition of neovascularisation in CAM assay [8,9]. Although ursolic acid has been reported to inhibit the proliferation and migration of bovine aortic endothelial cells, other key
* Corresponding author. Fax: +91 4712418078. E-mail addresses: [email protected], [email protected] (P.R. Sudhakaran). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.04.108
steps of angiogenesis such as extracellular matrix degradation by proteases and cell invasiveness studied in vitro, were reported to be stimulated by ursolic acid [8]. Further, ursolic acid which inhibited the differentiation of BAECs on matrigel [8] was reported to induce differentiation of F9 teratocarcinoma stem cells [10]; such pleiotropic effects, apparently due to different molecular mechanisms are shown by a number of different nutraceuticals. Recently we observed such opposing effects for curcumin, which inhibited the angiogenic process induced by exogenously supplemented growth factor while under unstimulated conditions it enhanced the endogenous growth factor production promoting angiogenesis [11]. To understand the molecular basis of the effect of ursolic acid on angiogenesis, the influence of ursolic acid on the production and action of the modulators of angiogenesis in endothelial cells was studied using HUVECs in culture and the results are presented here. Materials and methods The biochemical reagents and ursolic acid used for this study were procured from M/s Sigma–Aldrich Co (St. Louis, MO) and antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). ELISA and tissue culture plates were from NUNC A/S (Roskilde, Denmark). Isolation and culture of HUVECs. Endothelial cells were isolated by collagenase perfusion of umbilical vein as described before
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
[11,12]. Cells (1.5 106 per well) in serum free MCDB 131 medium were seeded in NUNC multi-well plates and allowed to attach for 5 h, unattached cells were removed, fresh medium was added and maintained in culture overnight before starting the experiment. RT-PCR analysis. Total RNA was isolated from HUVECs using Perfect RNA Mini isolation kits procured from Eppendorf according to manufacturer’s instruction. The primer pairs for human VEGF, VEGFR-2, FGF-2, FGFR-1, COX-1, COX-2 and GAPDH were as follows: VEGF (105 bp) Forward 50 ACGATCGATACAGAAACCACG30 Reverse 50 CTCTGCGCAGAGTCTCCTCT30 ; VEGFR-2 (216 bp) Forward 50 TGCACTGCAGACAGATATAC 30 Reverse 50 GCAGACATAGTCTCCTT GGT30 ; FGF-2 (100 bp) Forward 50 AGCAGCATCTGTAAGGTTCTTC30 Reverse 50 TGAAACATTGGGAGGGAAAC30 ; FGFR-1 (218 bp) Forward 50 CCTGAACAGGTGGTGGTATC30 Reverse 50 TTTGAACTTCACTGTCT TGGC30 ; COX-1 (299 bp) Forward 50 CAAACGCTCCCATTTTTACAC TC30 Reverse 50 TGGCATGTAGTAGTCTCTTGGCA30 ; COX-2 (452 bp) Forward 50 AATTCCTCATCCAACTATGTTCC30 Reverse 50 ATACTGTT CTCCGTACCTTCACC30 and GAPDH (680 bp) Forward 50 CGGAGT CAACGGATTTGGTCGTAT30 Reverse 50 GCAGGTCAGGTCCACCAC TAGC30 . The primer sequences were taken from NCBI nucleotide database and custom synthesized by Sigma–Aldrich Chemicals Bangalore, India. RT-PCR was performed in an Eppendorf thermocycler, using the C-Master RT Plus PCR kit (Eppendorf AG, Hamburg, Germany). Twenty microlitres (2 lg) of the isolated RNA was used as template for reverse transcription and amplification as described before [13]. Immunoblot analysis. Medium was removed, cell layer was washed with PBS, harvested and the cell pellets were lysed in Laemmli sample buffer. Protein equivalent amount of the lysates were subjected to SDS–PAGE and electroblotted onto NC membrane, probed with specific antibody and developed using HRP-conjugated secondary antibody [14]. Appropriate negative controls were taken without primary antibody. The band intensity was determined by Quantity One 4.5.0 Image acquisition and Analysis software (BioRad). Indirect ELISA was performed using specific antibodies as described before [13]. Analysis of intracellular signaling pathways. HUVECs in culture were treated with inhibitors of PI3K-Akt (LY294002), p38 MAPK (SB202190) and ERK (PD98059) at a concentration of 20 lM each for 48 h and the expression of angiogenic marker I-CAM was analysed by ELISA as described above. Activation of Akt and p38 by phosphorylation was studied by immunoblotting of equivalent amounts of cell lysates with specific antibodies as described before [11]. Estimation of prostaglandins, PGE2 and PGD2. The level of prostaglandins in the culture supernatants were estimated by HPLC [15]. The culture medium (adjusted to pH 3.5) was passed through 1 ml Sep Pak C18 columns equilibrated with 0.1% EDTA. Bound eicosanoids were eluted with 2 ml of methanol, concentrated under a stream of nitrogen and subjected to isocratic reversed-phase HPLC using C18 column at a flow rate of 2 ml/min and UV detection at 275 nm. The mobile phase consisted of acetonitrile:acetic acid:H2O (31.9:0.1:68 vol/vol pH 4.5). Appropriate standards of PGE2 and PGD2 (100 lg) were subjected to HPLC for calibration. Statistical analysis. The statistical significance of difference was analysed by Duncan’s one way Analysis of Variance (ANOVA) using SPSS10 Software.
557
expression of adhesion molecules involved in angiogenesis such as E-selectin, I-CAM and CD-31 was studied in HUVECs in culture. The amount of these markers steadily increased with the progression of the culture and was significantly high in cells treated with ursolic acid than the untreated control (Fig. 1). Increase in the expression of these proteins were synchronous with the morphological changes i.e. ECs treated with ursolic acid underwent morphological changes forming capillary network-like structure after 48 h when the level of these markers were very high. A 2-fold increase in the expression of these adhesion molecules was observed
Results and discussion Effect of ursolic acid on the production of cell-adhesion molecules involved in angiogenesis by HUVECs Cell–cell interaction mediated through cell-adhesion molecules is a key process in angiogenesis. The effect of ursolic acid on the
Fig. 1. Production of E-selectin, CD-31 and I-CAM by HUVECs: effect of ursolic acid. Cells were maintained in MCDB 131 medium with [10 (U10), 50 (U50) and 100 (U100) lM] and without (U0) ursolic acid for different time intervals. Medium was removed and the cell layer harvested at every 24 h and estimated the amount of Eselectin (total) (A), CD-31(B) and I-CAM (C) in cell layer by ELISA. Values given are the average of duplicate analysis of five experiments ± SEM. *Statistically significant when compared to control p < 0.05.
558
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
on the 2nd day of culture in cells treated with 50–100 lM concentrations of ursolic acid when compared with the controls. Although low concentration of ursolic acid (10 lM) did not affect the levels of total E-selectin (cell associated and shed) it decreased the levels of cell associated I-CAM and CD-31 at 10 lM concentration. It could be due to increase in the degradation of cell surface molecules by the action of proteases such as MMPs, which have been reported to increase at concentrations of ursolic acid as low as 5 lM [8]. We also found high levels of MMPs at low concentrations of ursolic acid where cell–cell contact was less; but MMPs were downregulated at higher concentration of ursolic acid when cell–cell contact was established (data not shown). Cell–cell contact associated downregulation of MMPs during angiogenesis has been reported [16]. Increase in the cell surface adhesion molecules produced by ursolic acid at higher concentrations may be due to a decrease in their proteolytic removal and an upregulation of their expression. Apart from their role in stabilizing cell–cell contact during angiogenesis, cell-adhesion molecules particularly, soluble secreted form of E-selectin [17] have been reported to increase the expression of VEGF in ECs by acting in an autocrine manner. CD-31 is essential for the migration and tubular structure formation and has been reported to increase prior to the network formation [18]. Effect of ursolic acid on the production of angiogenic growth factors The ability of HUVECs to produce different angiogenic growth factors such as FGF-2, VEGF and angiopoietin-1 (Ang-1) was studied in presence and absence of different concentrations of ursolic acid. The levels of FGF-2 and VEGF were significantly high in cells treated with ursolic acid compared with the untreated control (Fig. 2B). The amount of Ang-1 produced by cells was very low and ursolic acid treatment did not affect the production of Ang-1 in HUVECs. Immunoblot analysis further confirmed upregulation of the expression of VEGF and FGF-2 in cells treated with ursolic acid; no significant difference in their level was observed in cells treated with low concentrations of ursolic acid (less than 10 lM) compared with the respective control (Fig. 2A). RT-PCR analysis showed a higher expression of VEGF, FGF-2 and their receptor VEGFR-2 and FGFR-1 in cells treated with ursolic acid compared with the controls (Fig. 2C). VEGF produced by ECs in response to ursolic acid can act in an autocrine manner on ECs and promote angiogenic phenotype. The autocrine effect of VEGF was evidenced by increased expression of VEGFR-2 which is the endothelial specific receptor for VEGF whose binding to VEGFR-2 generates intracellular signal causing transition to angiogenic phenotype [19]. It therefore appears that ursolic acid may cause angiogenic effects by upregulation of the production of VEGF as well as an increase in its autocrine effect through upregulation of the EC specific receptor VEGFR-2. FGF-2 has been reported to be essential for differentiation of endothelial cells to form capillary network-like structure by acting both in paracrine and autocrine manner through its receptor FGFR-1 [20,21]. Further, there is synergism in the activities of both these growth factors [22]. Moreover, FGF-2 increases the expression of VEGFR-2 in endothelial cells [23]. These reports are consistent with our finding and suggest that ursolic acid mediates its angiogenic effect by modulating the production of both these growth factors. Effect of ursolic acid on the production of cyclooxygenase and prostaglandins Prostaglandins formed by the action of cyclooxygenase are important modulators of angiogenesis. The levels of proangiogenic PGE2 molecule was significantly high in cells treated with 50 and
Fig. 2. Effect of ursolic acid on the production of angiogenic growth factors: HUVECs were maintained in MCDB 131 medium with [10 (U10), 50 (U50) and 100 (U100) lM] and without (U0) ursolic acid. Cells and medium were harvested and subjected to Western blotting (A) and ELISA (B) to analyse the production of VEGF (a), FGF-2 (b) in the medium. *Statistically significant when compared to untreated control p < 0.05. (C) Expression of VEGF, FGF-2 FGFR-1 and VEGFR-2 in HUVECs— RT-PCR. Parallel cultures were maintained in presence [50 (U50) and 100 (U100) lM] and absence (U0) of ursolic acid for 48 h. Cells were harvested, total RNA was isolated subjected to RT-PCR and separated by electrophoresis in 1.75% agarose. Relative intensity of bands were quantitated and normalized with the intensity of band for internal control GAPDH and the results indicate significant upregulation in the expression of VEGF (2.5-fold), FGF-2 (3-fold), VEGFR-2 (3-fold) and FGFR-1 (2-fold) in cells treated with ursolic acid compared to control.
100 lM concentrations of ursolic acid while that of the anti-angiogenic PGD2 decreased when compared to control (Fig. 3B). RT-PCR analysis showed that the expression of COX-1 was not affected by treatment with ursolic acid. COX-2 mRNA increased by about 2.5fold in cells treated with ursolic acid when compared with the controls which may explain increase in the level of PGE2 (Fig. 3A). These results suggest that ursolic acid modulates the production
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
559
of angiogenic growth factors at transcriptional and translational level. Although the reported anti-inflammatory effects of ursolic acid involve the inhibition of COX [6,24], we observed significantly higher expression of COX-2 and increased production of PGE2 in endothelial cells. This effect could be either due to the cell type specificity or due to the fact that the cells used for this assay were free from exogenous stimuli as most of the nutraceuticals affect activation induced expression of inflammatory mediators [24]. PGE2 has been reported to exert a proangiogenic effect [25] whereas PGD2 inhibits angiogenesis [26]. Higher PGE2 to PGD2 ratio has been reported to upregulate the production of VEGF [25]. Consistent with this, ursolic acid was also found to increase the ratio of PGE2 to PGD2 in HUVECs which may be one of the reasons for the increased production of VEGF. VEGF has been reported to upregulate the expression of COX-2 and PGE2 through NFjB signaling pathways suggesting the existence of signaling loop between VEGF and PGE2 that is affected by ursolic acid. Intracellular signaling pathways as targets of ursolic acid
Fig. 3. Effect of ursolic acid on COXs expression (RT-PCR) and prostaglandin production. (A) Cells were maintained in MCDB 131 medium in presence of [50 (U50) and 100 (U100) lM] and absence (U0) of ursolic acid for 48 h. Medium was removed and the cell layer harvested and subjected to RT-PCR analysis. Relative intensity of bands were quantitated and normalized with the intensity of band for internal control GAPDH and the results indicate significant upregulation of the expression of COX-2 (2.5-fold) in cells treated with ursolic acid compared to control. (B) The level of prostaglandins in the medium was determined by HPLC analysis and expressed in micromoles/mg protein. Values given are the average of duplicate analysis of five experiments ± SEM. *Statistically significant when compared to controls p < 0.05.
To get an insight into the intracellular signaling pathways that are responsive to ursolic acid, the effect of inhibitors of certain signaling pathways involved in angiogenic process was studied by analysing the expression of the adhesion protein I-CAM which is involved in modulating cell adhesion in angiogenesis (Fig. 4A). Treatment of HUVECs with LY294002, an inhibitor of PI3K-Akt pathway and SB202190, an inhibitor of p38 MAPK caused a significant inhibition in the production of I-CAM whereas in cells supplemented with PD98059, an inhibitor of ERK-MAPK the inhibition was less pronounced. Treatment with LY294002 and SB202109 reversed the stimulatory effect of ursolic acid on I-CAM production and PD98059 did not produce any reversal of the stimulatory effect exerted by ursolic acid suggesting that PI3K-Akt and p38 MAPK path-
Fig. 4. Effect of ursolic acid on intracellular signaling pathways. (A) The effect of inhibition of PI3K-Akt and MAPK signaling pathways on the expression of the angiogenic marker I-CAM was studied by treating cells with LY294002, SB202109 and PD98059 (20 lM) in presence [10 (U10), 50 (U50) and 100 (U100) lM] and absence (U0) of various concentration of ursolic acid. After 48 h, cells were harvested and the amount of I-CAM in the cells was determined by ELISA. Values given are the average of quadruplicate experiments ± SEM. *Statistically significant when compared to cells maintained without inhibitor p < 0.05. The activation of Akt (B) and p38 (C) at different time intervals in presence [10 (U10), 50 (U50) and 100 (U100) lM] and absence (U0) of ursolic acid was analysed by immunoblotting of equivalent amounts of Akt and p38 by specific phospho Akt and phospho p38 antibodies.
560
M.S. Kiran et al. / Biochemical and Biophysical Research Communications 371 (2008) 556–560
way may be responsive to ursolic acid. This possibility was further examined by analysing the activation of Akt and p38 MAPK (Fig. 4B and C). Immunoblot analysis showed that treatment of cells with ursolic acid caused increase in the phosphorylation of Akt which steadily increased to attain a maximum level during later time intervals. Levels of phospho p38 were significantly high during the early time intervals (8 h) which decreased with the progression of culture and was very low after 24 h. Treatment with ursolic acid appeared to have less effect on the activation of p38. These results thus suggest that PI3K-Akt pathway is more active and sensitive to ursolic acid. VEGF by interacting with its receptor VEGFR-2 activates intracellular signaling pathways including PI3K-Akt, p38 MAPK, ERKMAPK causing downstream signaling leading to angiogenic events [27]. Increase in the level of activated phospho Akt in cells treated with ursolic acid and the reversal of the effect of ursolic acid on the production of I-CAM on inhibition of PI3K-Akt pathway suggest that ursolic acid treatment caused activation of PI3K-Akt pathway in HUVECs. However, the inhibition of production of I-CAM by SB202190 and PD98059, although not as profound as that observed with LY294002 in HUVECs in presence of ursolic acid does not exclude the role of MAPK pathway. PI3K-Akt signaling pathway regulates endothelial cell survival, migration and capillary-like structure formation which are critical steps in angiogenesis [28]. ERK1/2 signaling cascade specifically regulates network formation and inhibition of this pathway disrupted endothelial network formation [29]. But no activation of ERK1/2 was caused by ursolic acid, rather the level of activated p38 decreased by ursolic acid with progression of culture. It appears that this pathway is less sensitive to ursolic acid at the concentration tested. Modulation of the activity of transcription factors (NFjB and AP-1) downstream may contribute to differential expression of the genes that code for angiogenic modulators and angiogenic phenotype. This was suggested by the differential activation of these transcription factors by ursolic acid depending on the microenvironment of the cells (data not shown). Earlier report showed that ursolic acid even up to a concentration 50 lM had no effect on the activation of NFjB in unactivated Jurkat cells but in TNF-a activated Jurkat cells ursolic acid at 50 lM concentration caused inhibition of NFjB [24]. The results presented here indicate upregulation of angiogenic modulators in ECs treated with ursolic acid; low concentration of ursolic acid (less than 10 lM) had no effect on these modulators. The cells were maintained in culture in serum free unstimulated conditions. The changes in the angiogenic modulators correlated with the ability of ursolic acid to influence angiogenesis. Treatment with ursolic acid at higher concentrations promoted angiogenesis which was evidenced by (a) formation of capillary network-like structure by HUVECs, (b) greater extent of endothelial sprouting in rat aortic rings; but no such effects were observed at low concentration. However treatment of HUVECs and aortic rings, stimulated by maintaining in medium supplemented with serum, with ursolic acid caused inhibition of angiogenic phenotype (data not shown). This observation is similar to that reported earlier where the matrigel induced differentiation of bovine aortic endothelial cell was inhibited by ursolic acid [8]. In summary, these results suggest that the molecular mechanisms of the effect of ursolic acid on angiogenesis include modulation of the expression of angiogenic growth factors, particularly VEGF and prostaglandin and the response of signaling pathways particularly PI3K-Akt pathway. Acknowledgments Financial assistance in the form of SRF, from CSIR Government of India, to M.S. Kiran, R.I. Viji and V.B. Sameer Kumar is gratefully acknowledged. Support for infrastructure from DST, Government of India and UGC, New Delhi, is also gratefully acknowledged.
References [1] P. Carmeliet, Angiogenesis in health and disease, Nat. Med. 9 (2003) 653–660. [2] D. Hanahan, J. Folkman, Patterns and emerging mechanisms of the angiogenic switch during tumourigenesis, Cell 86 (1996) 353–364. [3] J. Folkman, Y. Shing, Angiogenesis, J. Biol. Chem. 267 (1992) 10931–10934. [4] J. Dulak, Nutraceuticals as anti-angiogenic agents: hopes and reality, J. Physiol. Pharmacol. 56 (2005) 51–69. [5] M.T. Huang, C.T. Ho, Z.Y. Wang, T. Ferraro, Y.R. Lou, K. Stauber, W. Ma, C. Georgiadis, J.D. Laskin, A.H. Conney, Inhibition of skin tumorigenesis by rosemary and its constituents carnosol and ursolic acid, Cancer Res. 54 (1994) 701–708. [6] K. Subbaramaiah, P. Michaluart, M.B. Sporn, A.J. Dannenberg, Ursolic acid inhibits cyclooxygenase-2 transcription in human mammary epithelial cells, Cancer Res. 60 (2000) 2399–2404. [7] J. Liu, Pharmacology of oleanolic acid and ursolic acid, J. Ethnopharmacol. 49 (1995) 57–68. [8] C. Cardenas, A.R. Quesada, M.A. Medina, Effects of ursolic acid on different steps of the angiogenic process, Biochem. Biophys. Res. Commun. 320 (2004) 402–408. [9] K.H. Sohn, H.Y. Lee, H.Y. Chung, H.S. Young, S.Y. Yi, K.W. Kim, Anti-angiogenic activity of triterpene acids, Cancer Lett. 94 (1995) 213–218. [10] H.Y. Lee, H.Y. Chung, K. H Kim, J.J. Lee, K.W. Kim, Differentiation induction of the F9 teratocarcinoma cells by triterpene acids, J. Cancer Res. Clin. Oncol. 120 (1994) 513–518. [11] M.S. Kiran, V.B. Kumar, R.I. Viji, G.T. Sherin, K.N. Rajasekharan, P.R. Sudhakaran, Opposing effects of curcuminoids on serum stimulated and unstimulated angiogenic response, J. Cell. Physiol. 215 (2008) 251–264. [12] E.A. Jaffe, R.L. Nachman, C.G. Becker, C.R. Minick, Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria, J. Clin. Invest. 52 (1973) 2745–2756. [13] V.B. Kumar, R.I. Viji, M.S. Kiran, P.R. Sudhakaran, Modulation of expression of LDH isoenzymes in endothelial cells by laminin: implications for angiogenesis, J. Cell. Biochem. 103 (2008) 1808–1825. [14] H. Towbin, T. Staehelin, J. Gordon, Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications, Proc. Natl. Acad. Sci. USA 76 (1979) 4350–4354. [15] H. Holtmann, Y. Shemer-Avni, K. Wessel, I. Sarov, D. Wallach, Inhibition of growth of Chlamydia trachomatis by tumor necrosis factor is accompanied by increased prostaglandin synthesis, Infect. Immun. 58 (1990) 3168–3172. [16] M.S. Kiran, V.B. Kumar, R.I. Viji, P.R. Sudhakaran, Temporal relationship between MMP production and angiogenic process in HUVECs, Cell Biol. Int. 30 (2006) 704–713. [17] B.M. Kraling, M.J. Razon, L.M. Boon, D. Zurakowski, C. Seachord, R.P. Darveau, J.B. Mulliken, C.L. Corless, J. Bischoff, E-selectin is present in proliferating endothelial cells in human hemangiomas, Am. J. Pathol. 148 (1996) 1181–1191. [18] S. Yang, J. Graham, J.W. Kahn, E.A. Schwartz, M.E. Gerritsen, Functional roles of PECAM-1 (CD-31 and VE-cadherin (CD-144) in tube assembly and lumen formation in three dimensional collagen gels, Am. J. Pathol. 155 (1999) 887–895. [19] M.S. Pepper, S.J. Mandriota, Regulation of vascular endothelial growth factor receptor-2 (Flk-1) expression in vascular endothelial cells, Exp. Cell Res. 24 (1998) 414–425. [20] A. Gualandris, M. Rusnati, M. Belleri, E.E. Nelli, M. Bastaki, M.P. MolinariTosatti, F. Bonardi, S. Parolini, A. Albini, L. Morbidelli, M. Ziche, A. Corallini, L. Possati, A. Vacca, D. Ribatti, M. Presta, Basic fibroblast growth factor overexpression in endothelial cells: an autocrine mechanism for angiogenesis and angioproliferative diseases, Cell Growth Differ. 7 (1996) 147–160. [21] F. Sola, A. Gualandris, M. Belleri, R. Giuliani, D. Coltrini, M. Bastaki, M.P. Tosatti, F. Bonardi, A. Vecchi, F. Fioretti, M. Ciomei, M. Grandi, A. Mantovani, M. Presta, Endothelial cells overexpressing basic fibroblast growth factor (FGF-2) induce vascular tumors in immunodeficient mice, Angiogenesis 1 (1997) 102–116. [22] J.C. Tille, J. Wood, S.J. Mandriota, C. Schnell, S. Ferrari, J. Mestan, Z. Zhu, L. Witte, M.S. Pepper, Vascular endothelial growth factor (VEGF) receptor-2 antagonists inhibit VEGF and basic fibroblast growth factor-induced angiogenesis in vivo and in vitro, J. Pharmacol. Exp. Ther. 299 (2001) 1073–1085. [23] S.J. Mandriota, M.S. Pepper, Vascular endothelial growth factor-induced in vitro angiogenesis and plasminogen activator expression are dependent on endogenous basic fibroblast growth factor, J. Cell Sci. 110 (1997) 2293–2302. [24] S. Shishodia, S. Majumdar, S. Banerjee, B.B. Aggarwal, Ursolic acid inhibits nuclear factor-kappaB activation induced by carcinogenic agents through suppression of IkappaBalpha kinase and p65 phosphorylation: correlation with down-regulation of cyclooxygenase 2, matrix metalloproteinase 9, and cyclin D1, Cancer Res. 63 (2003) 4375–4383. [25] R. Pai, I.L. Szabo, B.A. Soreghan, S. Atay, H. Kawanaka, A.S. Tarnawski, PGE(2) stimulates VEGF expression in endothelial cells via ERK2/JNK1 signaling pathways, Biochem. Biophys. Res. Commun. 286 (2001) 923–928. [26] W.S. Powell, 15-Deoxy-delta12,14-PGJ2: endogenous PPAR gamma ligand or minor eicosanoid degradation product?, J Clin. Invest. 112 (2003) 828–830. [27] R. Munoz-Chapulia, A.R. Quesada, A.M. Medina, Angiogenesis and signal transduction in endothelial cells, Cell. Mol. Life Sci. 61 (2004) 2224–2243. [28] I. Shiojima, K. Walsh, Role of Akt signaling in vascular homeostasis and angiogenesis, Circ. Res. 90 (2002) 1243–1250. [29] N.V. Bogatcheva, S.M. Dudek, J.G. Garcia, A.D. Verin, Mitogen-activated protein kinases in endothelial pathophysiology, J. Invest. Med. 51 (2003) 341–352.