150

Neuropharmacology 47 (2004) 764–778 www.elsevier.com/locate/neuropharm

Modulation of dopamine mediated phosphorylation of AMPA receptors by PSD-95 and AKAP79/150 Richard D. Swayze, Marie-France Lise´, Joshua N. Levinson, Anthony Phillips, Alaa El-Husseini
Department of Psychiatry and the Brain Research Centre, 2255 Wesbrook Mall, University of British Columbia, Vancouver, BC, Canada V6T 1Z3 Received 3 May 2004; received in revised form 8 July 2004; accepted 9 July 2004

Abstract Communication between dopaminergic and glutamatergic synapses is critical for several functions related to cognition and emotion. Here, we examined whether dopamine receptor activity regulates phosphorylation and trafficking of the a-amino-3hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor subunit, GluR1. We find treatment with a dopamine D1 receptor agonist enhanced GluR1 phosphorylation at Ser845, the PKA phosphorylation site, in both striatal and prefrontal cortical neurons. Enhanced phosphorylation of GluR1 also correlated with increased amounts of GluR1 on the cell surface. These effects were disrupted by expression of mutant forms of the A-kinase anchoring protein (AKAP79/150) and the postsynaptic density protein, PSD-95, that fail to target synaptic sites. Similar enhancement of the phosphorylation of GluR1 was observed in the nucleus accumbens upon stimulation of dopamine release in vivo using electrical stimulation of dopamine cell bodies in the ventral tegmental area. These results suggest in vivo stimulation of dopamine release directly influences AMPA receptor phosphorylation and together with in vitro data indicate that coupling of the AMPA receptor to AKAP79/150 and PSD-95 modulate this process. # 2004 Elsevier Ltd. All rights reserved. Keywords: AMPA receptor; Phosphorylation; Dopamine receptors; AKAP79/150

1. Introduction The nucleus accumbens (NAc) and the prefrontal cortex (PFC) are two major brain structures where communication between the dopaminergic and glutamatergic systems is thought to be critical for neural processes that control cognition, emotion and reward responses (Laakso et al., 2002; Wise, 2002). Importantly, dysfunction in the communication between the glutamatergic and dopaminergic systems has been proposed to result in behavioral changes associated with Abbreviations: GFP, green fluorescent protein; NMDA, N-methyld-aspartic acid; PSD-95, postsynaptic density-95; PDZ, (PSD-95, Dlg, ZO-1) homology; AMPA, a-amino-3-hydroxy-5-methylisoxazole-4propionic acid; D1, dopamine receptor 1; ICSS, intracranial selfstimulation; AKAP79/150, A-kinase anchoring protein
Corresponding author. Tel.: +1-604-822-7526; fax: +1-604-8227981. E-mail address: [email protected] (A. El-Husseini). 0028-3908/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2004.07.014

addiction and schizophrenia (Berke and Hyman, 2000; Hyman and Malenka, 2001; Tamminga, 1998). These observations led us to investigate how dopamine receptor activity regulates clustering and function of glutamate receptors. Dopamine receptor activity may affect glutamate receptor function by regulation of glutamate receptor phosphorylation by protein kinases and/or by regulation of the number of glutamate receptors available at the synapse through changes in receptor internalization by endocytosis or retention by recruiting proteins containing PDZ domains. Activation of D1-type dopamine receptors triggers cAMP production and activation of cAMP-dependent protein kinase (PKA). In contrast, activation of D2-type dopamine receptors inhibits the production of cAMP (Creese, 1987). Indeed, recent studies have shown that phosphorylation of specific a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) and N-methyl-daspartic acid (NMDA) receptor subunits occurs in

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

both striatal and prefrontal cortical neurons in response to dopamine D1 receptor stimulation (Chen et al., 2004; Dudman et al., 2003; Mangiavacchi and Wolf, 2004; Price et al., 1999). Although these findings show the involvement of dopamine signaling in regulating glutamate receptor phosphorylation, the molecular mechanisms involved remain unclear. Earlier studies showed that proper targeting of PKA is required for modulation of AMPA receptors in the hippocampus (Rosenmund et al., 1994). In neurons, PKA targeting is mediated by A-kinase anchoring protein (AKAP79/150), a dendritically targeted, scaffolding protein that binds to the regulatory (RII) subunit of PKA (Colledge et al., 2000; Scott, 2003). A candidate protein that can mediate crosstalk between dopamine and glutamate receptors is postsynaptic density-95 (PSD-95), a protein that recruits PKA to the glutamate receptor complex through interaction with AKAP79/150 (Colledge et al., 2000; Scott, 2003). Indeed, studies in heterologous cells show that PSD95/AKAP79/150 association is required for the regulation of AMPA receptor activity through a PKAmediated protein phosphorylation (Colledge et al., 2000). PSD-95 is indirectly coupled to AMPA receptors through interaction with the tetraspanin protein, stargazin (Chen et al., 2000, 2003; Schnell et al., 2002). Stargazin mediated synaptic targeting of AMPA receptors in turn requires association with PDZ domains of PSD-95 (Chen et al., 2000; Schnell et al., 2002). Furthermore, synaptic targeting of PSD-95 requires protein palmitoylation, and palmitate cycling on PSD95 regulates retention/removal of PSD-95 and AMPA receptor subunits (El-Husseini and Bredt, 2002; El-Husseini et al., 2002). Thus, regulated synaptic clustering of PSD-95 may alter glutamate receptor activity by two mechanisms. First, through palmitoylationmediated cycling at the synapse, PSD-95 can regulate the number of cell surface glutamate receptors. Second, through recruitment of AKAP79/150 and cAMP-binding proteins activated by the dopaminergic system, PSD-95 can regulate glutamate receptor phosphorylation and activity. Here, we examined whether cAMP and dopamine D1 receptor activity regulate AMPA receptor phosphorylation and trafficking to the synapse, and whether this process requires synaptic clustering of PSD-95 and assembly of the AKAP79/150/PKA/glutamate receptor complex. Our analysis shows that phosphorylation at Ser845 site and surface expression of the glutamate receptor subunit GluR1 were enhanced upon treatment with D1 receptor agonists. These effects were blocked by D1 receptor antagonist and the membrane-permeable PKA inhibitor, Rp-cAMPS, in both striatal and prefrontal cortical neurons. Overexpression of mutant forms of AKAP79/150 and PSD-95 significantly attenuated the effects of D1 receptor agonist on GluR1

765

phosphory-lation and surface expression. Moreover, disrupting protein palmitoylation with 2-bromo palmitate, a treatment that disperses synaptic clusters of PSD95, blocked D1-mediated phosphorylation of GluR1. These results suggest that PSD-95 and the associated AKAP79/150 are critical for mediating crosstalk between the dopaminergic and glutamatergic systems through modulation of AMPA receptor trafficking. 2. Materials and methods 2.1. Materials and antibodies Where discussed, the D1 receptor agonist, SKF 38393 (Sigma) was used at 10 lM, IBMX (Sigma) was used at 50 lM, and Rp-cAMPS (BioMol) was used at 100 lM. The 2-bromo palmitate was obtained from Aldrich Chemical Co. The following primary antibodies were used: 1:200 monoclonal anti-PSD-95 (ABR, CA), 1:2000 anti-AKAP79/150 (Dr. Yvonne Lai, ICOS, Bothel, WA), 1:1000 anti-GluR1 (Upstate Biotechnology), 1:1000 anti-GluR2/3 (Chemicon), and 1:200 anti-GluR4 (Chemicon), 1:200 anti-phosphoSer845 GluR1 (Upstate Biotechnology), and 1:1000 anti-transferrin (Zymed). 2.2. cDNA constructs, mutagenesis and virus preparation Construction of wild-type and non-targeting AKAP79/ 150-GFP have been described previously (Dell’Acqua et al., 1998). Construction of viral PSD-95 (C3,5S)GFP was performed with PCR using a XhoI forward primer (CCCGGGCTCGAGGCCACCATGGACAGTCTCATGATAGTGACAACC) and a NotI reverse primer (CCCATAGTTTAGCGGCCGCATTTACTTGTACAGCTCGTCCATCCC). The PCR product of PSD-95 (C3,5S)-GFP, and wild type and non-targeting AKAP-GFP, were subcloned into the XhoI/NotI sites of Semliki forest virus vector (pSFV-PD). All constructs were verified by DNA sequencing. 2.3. Primary neuronal culture, viral infection, and immunocytochemistry Neuronal cultures were prepared from E18/E19 Wistar rats. Striatal and prefrontal cortical neurons were dissociated by enzyme digestion with papain followed by brief mechanical trituration. Cells were plated on poly-D lysine (Sigma) pre-treated 10 cm plates, six well plates or 24 well plates with glass coverslips (12 mm in diameter), and then were maintained in neurobasal medium (Gibco) supplemented with B27, penicillin, streptomycin, and l-glutamine as described in Brewer et al. (1993). Semliki forest virus (SFV) particles were prepared as follows. 2.5 lg of purified, NruI-linearized pSFV

766

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

plasmids was incubated with 70 U of SP6 RNA polymerase (Roche), 75 U of protector RNA inhibitor (Roche), 5 ll rNTP mix (Roche) and 10 mM capping v reagent m7G(50 )ppp(50 )G (Amersham) at 37 C for 60 min in 100 ll. BHK21 cells suspended in PBS were electroporated with the above SFV RNA and Helper RNA using a BioRad Gene Pulser (1000 V; 25 lF; 1 X) in a 0.4 cm gap cuvette. BHK21 cells were incuv bated at 31 C (5% CO2) for 48 h, and the supernatant was collected. The virus was activated by adding 0.5 mg/ml of a-chymotrypsin (Sigma) to the supernatant, and the 30 min reaction at RT was stopped with 0.25 mg/ml of aprotinin (Sigma). For viral infection of the above constructs, cultures were exposed for 1–2 h to medium containing enough viral particles to infect about 40–60% of the cells. Viral medium was then replaced with fresh neurobasal medium, and experiments were carried out 24 h later. To perform immunocytochemistry, coverslips were removed from culture wells and fixed in methanol for v 10 min at 20 C. The cells were washed with phosphate-buffered saline containing 0.1% Triton X-100 (PBST), and blocked for 1 h in PBST with 3% normal goat serum (blocking solution). Primary antibodies mixed with the blocking solution were incubated with cells for 1 h at RT followed by 1 h in blocking solution containing secondary antibodies conjugated to Cy3 or Alexa 488 fluorophores (diluted 1:200; Jackson ImmunoResearch and 1:1000; Molecular Probes, respectively). Coverslips were then mounted on slides (Frost Plus; Fisher) with Fluoromount-G (Southern Biotechnology) and images were taken under fluorescence microscopy with a 63 objective affixed to a Zeiss Axiovert inverted microscope. 2.4. Quantitative analysis of surface labeling using immunofluorescence Surface GluR1 was labeled by incubating live culv tures for 20 min at 37 C with antibody recognizing the extracellular portion of GluR1 (Oncogene, San Diego, CA, USA; 1:20). Cells were fixed with 2% paraformaldehyde and 4% sucrose in PBS for 15 min at room temperature. Cells were then washed three times with PBS and incubated for 1 h at room temperature with donkey anti-rabbit secondary antibodies conjugated to Cy3 (Jackson ImmunoResearch; 1:200 in blocking solution). For surface GluR1 analysis, images were taken under fluorescence microscopy with a 63objective affixed to Zeiss Axiovert microscope. All images were acquired with a CCD camera at identical settings, using the same exposure times. Average pixel intensities were calculated using the Northern Eclipse software, based on a threshold of a least two times higher than dendritic background. Average puncta intensity was calculated by

calculating the ratio of summary average gray of cells vs. background. Results are expressed as the as percent of the untreated control group run in the same experiment. The data were analyzed with by unpaired t-test. 2.5. Immunoblotting For immunoblotting, protein samples were harvested in lysis buffer containing (in mM) 25 Tris, 150 NaCl, 3 KCl, 1 EGTA, 1 EDTA, 0.5 phenylmethylsulfonyl fluoride (Sigma), 1% Triton X-100 and 1 protease inhibitor cocktail tablet/10 ml (Roche). Samples were sonicated; then protein concentrations were measured with a BCA protein assay kit (Peirce) and samples equally adjusted. Samples were boiled for 3 min in sample buffer (62.5 mM Tris–HCl, 2% SDS, 1% b-mercaptoethanol, 7.5% glycerol, 15 lM bromophenol blue), and proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes (Amersham). Non-specific binding was blocked by incubating membranes with 10% powder milk in Tris buffered saline with 0.1% Tween-20 (TBS-T) for 30 min. After three washes in TBS-T, primary antibodies diluted in Odyssey blocking buffer ðLi-CorÞ þ 0:1% Tween-20 were incubated with memv branes for 1 h to overnight at 4 C. Membranes were washed three times in TBS-T, incubated for 30 min in TBS-T with 1% powder milk and a 1:10,000 dilution of secondary antibody. Using secondary antibodies conjugated with fluorescent dyes (anti-mouse Alexa680, Molecular Probes; anti-rabbit IRD800, Rockland Immunochemicals), labeled bands were visualized with the Odyssey Infrared Imaging system (Li-Cor). 2.6. Measurement of surface GluR1 using biotinylation assays Neurons (DIV 20–28) were stimulated for 15 min in neurobasal medium containing vehicle control (1% ethanol) or SKF 38393 with the phosphodiesterase inhibitor, IBMX. After washing the live neurons with PBS, surface GluR1 was labeled by biotinylating the e-amine of extracellular surface lysine residues during a v 4 C incubation for 15 min with a PBS solution containing 1.5 mg/ml Sulfo-NHS-SS-Biotin (Pierce). A soluble lysate was then prepared from striatal neurons with the above lysis buffer. This starting lysate represents total GluR1. Biotinylated surface proteins were then isolated by incubating 100–150 lg of the starting lysate with UltraLink Immobilized NeutrAvidin Plus v beads (Pierce) for 2 h at 4 C, followed by several washes in lysis buffer, and then elution of surface proteins from the beads into sample buffer. Isolated surface proteins (Surface) along with 4%, 8% and 16% of the starting lysate (Total) was separated via SDSPAGE, transferred to nitrocellulose, and subjected to western blot analysis with an antibody for the GluR1

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

receptor. GluR1 bands were visualized using a secondary antibody conjugated with a fluorescent dye that is detectable using the Odyssey Infrared Imaging system (Li-Cor). Using the Odyssey Infrared Imaging software, GluR1 bands were selected and the integrated intensity (the sum of the intensity values for all pixels multiplied by the selected area) for the selected region were measured after subtracting the average background. Integrated intensity values for each calibration standard (4%, 8% and 16%) are plotted against their respective amounts of total protein in order to calculate the ratio for the amount of surface GluR1 with respect to its corresponding starting lysate (total GluR1). Surface GluR1 values for control and SKF 38393 treatments were normalized to a percentage of the average amount of surface GluR1 in the control, and values were subjected to a Mann–Whitney twotailed test (a ¼ 0:05). Western blots of surface protein elutions were probed with a phospho-specific antibody raised against the GluR1 PKA phosphorylation site, Ser845. The integrated intensity values for phospho-GluR1 were expressed as a ratio to the integrated intensity values of GluR1. Phospho-GluR1 to total GluR1 ratios were then normalized to a percentage of the average amount of phospho-GluR1 in the control. Phosphorylation ratio values were subjected to a Mann–Whitney twotailed test ða ¼ 0:05Þ. 2.7. In vivo stimulation Male Long–Evans rats (Charles River, St. Constance, Quebec) were anaesthetized with isoflurane and each subject was implanted with a single bipolar stimulating electrode (Plastic Products Co.), into the ventral tegmental area (VTA), under stereotaxic control. The coordinates from interaural line with a flat skull were anterior +3.5 mm, dorsal +1.8 mm, and 0.5 mm lateral from midline. Each electrode was secured to the skull by four screws and dental acrylic. Following recovery from surgery (5 days), each rat was screened for intracranial self-stimulation (ICSS) by operant training to activate a lever in a Plexiglas chamber (24 cm  25 cm  30 cm), which in turn triggered a train of electrical stimulation (60 Hz sine wave, 200 ms train, current intensity 8–28 lA, delivered to the implanted electrode via a commutator and flexible cable. Rate–intensity curves were obtained for three rats that displayed reliable ICSS behavior without a motor artifact. Three rats with electrodes that did not support ICSS behavior served as implanted controls. During the experimental test session, current intensities (mean ¼ 12 lA) were selected for each rat to ensure ICSS rates of 800–1000 responses in the 10 min test session. Control rats were connected to the flexible cable (stimulator off) and remained in the operant

767

chamber for 10 min. Immediately following completion of the 10 min test session, each rat was decapitated and the brain was removed and placed into a cold metal mold to facilitate preparation of 400 lm coronal sections. A coronal section from each brain containing both dorsal and ventral striatum was transferred onto a cold glass surface and samples of tissue containing the NAc, ipsilateral to the stimulating electrode placement in the VTA or from the contralateral hemisphere were rapidly dissected from the coronal section of the brain and frozen in liquid nitrogen. Control tissue from the ipsilateral and contralateral dorsal striata were also collected for biochemical analyses. 3. Results 3.1. Activation of D1 receptors enhances GluR1 phosphorylation and surface expression Recent studies have shown that stimulation of striatal dopamine receptors by D1 agonists, can enhance cAMP accumulation, and subsequent PKA activation. Using electrophysiology and imaging techniques, in combination with western blot analysis of whole-cell lysates, these studies have shown that PKA-mediated phosphorylation of serine 845 (Ser845) on GluR1 receptors plays an important role in enhancing current amplitude and promoting receptor insertion into the synaptic membrane (Chao et al., 2002; Mangiavacchi and Wolf, 2004; Price et al., 1999; Wolf et al., 2003). To characterize changes in surface GluR1 biochemically, we utilized a biotinylation assay in conjunction with western blot analysis of phospho-Ser845 on surface GluR1 receptors to confirm that D1 activation leads to an increase in Ser845 phosphorylation of surface GluR1. Fig. 1A shows western blot analysis of the three standards representing total protein from the starting lysate, along with the corresponding isolated surface proteins probed with an antibody raised against the GluR1 or transferrin receptor. Surface GluR1 and transferrin values for control and SKF 38393 treatments were normalized to 100% of the average amount of surface protein in the control, and plotted in the histogram in panel B. This analysis revealed that the D1 agonist significantly enhanced surface GluR1 receptors to 146 11% above control (100 9%; p < 0:05), whereas surface transferrin receptors were not affected by SKF 38393 treatment (p ¼ 0:7). These results further support the role of D1-mediated enhancement of surface GluR1 receptors. To further determine whether D1 activation and subsequent enhancement of surface GluR1 receptors occurs in conjunction with PKA-induced phosphorylation of Ser845, blots were probed with a phosphospecific antibody raised against the GluR1 PKA phosphorylation site, Ser845 (Fig. 1C). Equal protein

768

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

Fig. 1. Dopaminergic activation by SKF 38393 enhances Ser845 phosphorylation and surface expression of GluR1. (A) Striatal cultures incubated with control or SKF 38393 þ IBMX for 15 min were subjected to a biotinylation assay, and western blot analysis using anti-GluR1 and anti-transferrin antibody. Band intensities corresponding to the total protein (total: 4%, 8%, 16%) from the starting lysate were used to plot a standard calibration curve, which was then used to determine the ratio of isolated surface protein (surface) to total protein. (B) Surface GluR1 and transferrin receptor (TfR) values quantified from the western blot in panel A were normalized to 100% of control, and plotted in the histogram as means SEM (n ¼ 3). (C) Isolated surface proteins were also probed with phospho-Ser845 GluR1 (Ser845 GluR1) or with anti-TfR as a loading control. (D) Phosphorylation ratios were derived from the Ser845 GluR1 bands shown in panel C. Means SEM were normalized to 100% of the control, and SKF 38393 values were found to be statistically significant from over control values (n ¼ 3). (E) SKF 38393 treatment cause an increase in GluR1 surface intensity (right panel), compared to cells treated with vehicle (left panel). (F) A graph summarizes the quantitative changes in the intensity of surface GluR1 labeling. (SKF treated ¼ 124 1:8). Analysis is based on field (n ¼ 13) images taken from two independent experiments. Scale bar, 10 lm.
p < 0:05,


p < 0:001.

loading was confirmed by stripping these blots and reprobing them for GluR1. Phospho-Ser845 GluR1 to total GluR1 ratios were then normalized to 100% of the average amount of phospho-GluR1 in the control, and are shown in the histogram in Fig. 1D. This analy-

sis illustrates that D1 activation significantly increased surface GluR1 phosphorylation at Ser845 by 455

174% above control values (100 23%). In contrast, 50 lM IBMX alone had negligible effects on surface and GluR1 phosphorylation levels, whereas 10 lM SKF

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

38393 or 100 lM 8-bromo cAMP produced an effect that was similar, but to a lesser extent than both reagents combined (data not shown). Next, we used antibodies that recognize the extracellular domain of GluR1 followed by immunostaining under non-permeabilization conditions to verify that D1 stimulation increases surface GluR1 (Fig. 1E). Quantification of these images revealed a significant increase in surface GluR1 puncta intensity in SKF 38393 treated cells. Together, these results demonstrate that D1-mediated increase in surface GluR1 receptors correlates with an enhanced PKA-mediated Ser845 phosphorylation levels. 3.2. Reduction of synaptic clustering of PSD-95 attenuates responses to D1 receptors The postsynaptic density protein, PSD-95, selectively enhances the clustering and function of GluR1 receptors (El-Husseini et al., 2000, & 2002). Given the complementary role that PSD-95 plays in glutamatergic signaling, we further characterized the localization of GluR1–4 in relation to PSD-95 in cultured striatal neurons. Fig. 2 illustrates that AMPA receptor subtypes 1–4 are all expressed with a punctate pattern that co-localized with PSD-95. Both medium spiny neurons and interneurons expressed GluR1 and GluR2/3 subunits. In contrast, GluR4 positive staining was mainly detected in interneurons (data not shown). In such an arrangement, PSD-95 may be centrally involved in the formation macromolecular complexes with AMPA receptors, thereby regulating their surface expression and function in response to D1 activation. Given the effects of 2-bromo palmitate treatment on synaptic localization of PSD-95, we wondered whether this treatment will uncouple PSD-95 from the GluR1 protein complex, thereby disrupting dopamine mediated effects (El-Husseini and Bredt, 2002). To investigate the effects of 2-bromo palmitate treatment on D1-mediated increase in GluR1 phosphorylation, cultured striatal neurons were incubated with either vehicle or with 100 lM 2-bromo palmitate 7–8 h prior to stimulation of D1 receptors (Fig. 3). After stimulating the neurons for 15 min with either control (1% ethanol) or SKF 38393, samples were analyzed for changes in the levels of phospho-Ser845 GluR1 (Fig. 3A). Our analysis revealed a significant reduction in basal (~63%) and D1stimulated phosphorylation levels (~146%) upon treatment with 2-bromo palmitate (Fig. 3B). To determine whether blocking PSD-95 palmitoylation attenuates D1-mediated increase in surface GluR1 receptors, we assessed changes in surface GluR1 upon treatment with 2-bromo palmitate. Our analysis revealed a significant reduction in D1-mediated increase in surface GluR1 receptors from 154 6% to 107 10%, as a result of 2-bromo palmitate treatment

769

(Fig. 3C). Together, these results indicate that synaptic localization and coupling of PSD-95 to GluR1 are critical for mediating dopaminergic regulation of GluR1 receptor trafficking and function. 3.3. Enhancement of GluR1 phosphorylation by D1 agonists in both striatal and prefrontal cortical neurons requires a PKA-dependent pathway Besides the striatum, dopaminergic modulation of GluR1 receptors is also a firmly established signaling pathway in the PFC (Gurden et al., 2000). To further characterize this signaling pathway, we compared D1mediated effects on GluR1 phosphorylation in cultured striatal and prefrontal cortical neurons in the presence or absence of the membrane-permeable PKA inhibitor, Rp-cAMPS. Phospho-Ser845 GluR1 to total GluR1 ratios were then calculated as described earlier, and normalized to 100% of the vehicle control. Remarkably, the PKA inhibitor, Rp-cAMPs significantly reduced D1-stimulated PKA phosphorylation in both culture systems (Fig. 4). Interestingly, D1-mediated GluR1 phosphorylation was much more robust in the striatum (~600% above control), as compared to that observed in the PFC (~100% above control). In contrast, treatment with IBMX alone had a small effect on GluR1 phosphorylation. More importantly, the D1-antagonist (SCH23390; 10 lM) reduced SKF 38393 þ IBMX mediated effects on GluR1 phosphorylation to levels observed with PKA inhibitor, RpcAMPs. Collectively, these results show that the obtained SKF 38393 effects represents specific stimulation of a D1-mediated pathway via PKA activation. 3.4. Expression of a palmitoylation deficient form of PSD-95 attenuates D1 dependent phosphorylation and surface expression of GluR1 Given the functional importance of palmitoylation in targeting PSD-95 to the synapse, we wondered whether overexpression of a palmitoylation deficient form of PSD-95 could disrupt dopamine mediated effects on GluR1 in prefrontal cortical neurons. For these experiments, we used an SFV expressing green fluorescent protein (GFP) alone or GFP-tagged palmitoylation deficient form of PSD-95. This mutant lacks the cysteine residues 3 and 5 (C3,5S), thereby preventing PSD-95 palmitoylation and subsequent targeting of PSD-95. Twenty-four hours post-infection, cells were incubated with vehicle (1% ethanol) or 10 lM SKF 38393 þ 50 lM IBMX (Fig. 5A). GluR1 phosphorylation ratios for Ser845 were calculated, and normalized to 100% of the GFP control (Fig. 5B). Indeed, we find that overexpression of the PSD-95 (C3,5S) mutant significantly inhibited the D1-mediated increase in Ser845 phosphorylation when compared to the GFP

770

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

Fig. 2. Expression of endogenous glutamate receptor subunits and PSD-95 in cultured striatal neurons. (A) Primary striatal neurons (DIV 14–18) were immunostained with antibodies raised against GluR1, GluR2/3, or GluR4 along with PSD-95. Results show co-localization of various AMPA receptor subunits with PSD-95. Scale bars, overview panels; 10 lm, magnified panels; 1 lm.

controls stimulated with SKF 38393. Together, the 2-bromo palmitate and PSD-95 (C3,5S) mutant results strongly support the proposed importance of PSD-95 in dopaminergic regulation of glutamate receptors. 3.5. PSD-95 and A-kinase anchoring protein are co-associated in vivo Dopaminergic signaling through PKA lead us to investigate the obvious role of other key scaffolding

proteins such as the A-kinase anchoring protein, AKAP79/150. It is well established that A-kinase anchoring proteins act as a scaffold for the regulatory subunit of PKA (Scott, 2003). Moreover, recent coimmunoprecipitation evidence illustrated a synaptic coassociation between the regulatory subunit of PKA, AKAP79/150, and PSD-95, along with demonstrated interactions between AKAP79/150 and GluR1 (Colledge et al., 2000). To confirm the existence of an in vivo interaction between AKAP79/150 and PSD-95

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

771

Fig. 3. Blocking palmitoylation significantly attenuates dopamine agonist-mediated increases in GluR1 phosphorylation and surface expression. Primary striatal neurons were incubated with 100 lM palmitate (control) or 100 lM 2-bromo palmitate for 8 h, followed by a 15 min incubation with vehicle or SKF 38393 þ IBMX. (A) Following a biotinylation assay, samples were examined via western blot analysis of Ser845 GluR1 and surface GluR1. (B) Phosphorylation ratios for Ser845 GluR1 to total GluR1 were normalized to palmitate treated cells and expressed as the means SEM. Statistically Significant differences were observed between control and SKF 38393 when comparing palmitate to 2-bromo palmitate (n ¼ 4 6). (C) The ratio of biotinylated surface GluR1 to total GluR1 values were normalized to control values and expressed as the means SEM (n ¼ 4 5). In the presence of 2-bromo palmitate, there was a significant reduction in the D1-mediated increase in surface GluR1.
p < 0:05.

at synaptic sites, we prepared synaptic membrane fractions from rat brain extracts. Consistent with the previously published observations (Colledge et al., 2000), our analysis revealed that AKAP79/150 and PSD-95 are present in synaptic fractions as a complex (data not shown). Further, immunofluorescent examination of

cultured striatal neurons also illustrates co-localization of endogenous AKAP79/150 and PSD-95 puncta in the spines of medium spiny neurons (Fig. 6A). Collectively, these results provide strong support for AKAP79/150 and PSD-95 coupling at synapses of striatal neurons.

772

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

Fig. 4. Dopamine agonist-mediated phosphorylation of Ser845 GluR1 involves a D1 and PKA-dependent pathway in both striatal and prefrontal cortical neurons. (A, B) Cultured neurons were pre-incubated in the presence or absence of D1-antagonist (SCH23390) or Rp-cAMPS for 30 min, followed by a 15 min incubation in the presence of either control, or SKF 38393 þ IBMX. Ser845 GluR1 to total GluR1 ratios were calculated as described in methods, and normalized to 100% of the vehicle control. Average values SEM (n ¼ 3) are shown in neuronal cultures from the striatum (A) and prefrontal cortex (B). SKF 38393 þ IBMX treatment significantly increased GluR1 phosphorylation as compared to IBMX alone. In contrast, a significant reduction in D1-mediated GluR1 phosphorylation at Ser845 was observed in the presence of Rp-cAMPS and SCH23390.
p < 0:05.

3.6. Expression of a mutant form of AKAP79/150 reduces D1 dependent phosphorylation and surface expression of GluR1 To further address the importance of AKAP79/150 in D1-mediated phosphorylation of GluR1, we took advantage of a previously characterized mutant form of AKAP79/150 (Gomez et al., 2002). Deletion of first 107 N-terminal amino acids results in a non-targeting form of AKAP79/150 (NT-AKAP) that remains cytoplasmic (Gomez et al., 2002). Initial characterization of the virally expressed NT-AKAP confirmed that this mutant displayed a diffuse pattern when compared to

wild type AKAP79/150 expressing neurons (Fig. 6B). Remarkably, NT-AKAP significantly attenuated D1mediated GluR1 phosphorylation when compared to uninfected and GFP infected striatal cultures treated with the D1 agonist (Fig. 6C). Biotinylation analysis of surface GluR1 further revealed that NT-AKAP significantly attenuated D1-mediated surface GluR1 elevation in a fashion that closely parallels the effects of this mutant on GluR1 phosphorylation at Ser845 (Fig. 6D). The novel effects of this mutant form emphasize the functional importance of AKAP79/150 in mediating signal transduction between the dopaminergic and glutamatergic systems.

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

773

phospho-Ser845 GluR1 in the NAc (Fig. 7; panel A), but not in adjacent regions of the dorsal striatum (Fig. 7; panel B).

4. Discussion

Fig. 5. Expression of the palmitoylation deficient form of PSD-95 attenuates D1-mediated effects on GluR1 phosphorylation. (A, B) Neurons were infected with SFV virus expressing GFP alone or a GFP-tagged palmitoylation mutant form of PSD-95 (C3,5S) for one day before subjected to treatment with SKF 38393 þ IBMX. A significant reduction in D1-mediated Ser845 GluR1 phosphorylation was observed in neurons expressing PSD-95 (C3,5S) but not GFP. Normalized GluR1 phosphorylation ratios are expressed as means

SEM (n ¼ 3 4).
p < 0:05.

3.7. Self-stimulation of dopaminergic neurons in the VTA in freely moving rats enhances GluR1 phosphorylation Previous studies demonstrated a significant increase in dopamine efflux in the NAc during sessions of ICSS at sites in the VTA (Fiorino et al., 1993). Therefore, we hypothesized that similar behavioral activation of dopamineregic neurons in vivo would enhance GluR1 phosphorylation in the ventral striatum. Accordingly, following a 10 min ICSS session with active or control electrodes in the VTA, the NAc and a comparably sized portion of the dorsal striatum of stimulated and contralateral hemispheres were rapidly dissected on ice and frozen in liquid nitrogen. In an effort to preserve changes in GluR1 phosphorylation at Ser845, tissue was v removed from 80 C and immediately homogenized in ice-cold lysis buffer. Phospho-Ser845 GluR1 and total GluR1 ratios were calculated as described earlier, and normalized to 100% of the contralateral control. When compared to tissue from the contralateral control hemisphere, ICSS lead to a significant increase in

In this work, we present novel evidence that AKAP79/150 and PSD-95 are involved in mediating D1 receptor effects on GluR1 phosphorylation and surface expression in both striatal and prefrontal cortical neurons. These findings provide a unique insight into some of the fundamental mechanisms that may underlie defects in the interaction between the dopaminergic and glutamatergic neurons in psychiatric disorders such as schizophrenia and addiction. Our findings are consistent with previous studies which demonstrated that activation of D1 receptors enhances AMPA GluR1 phosphorylation and surface expression through a PKA-mediated pathway (Chao et al., 2002; Mangiavacchi and Wolf, 2004; Wolf et al., 2003). In addition, other findings demonstrated that D1-mediated increases in Ser845 phosphorylation in whole-cell lysates along with electrophysiological data demonstrating D1-mediated increases in GluR1 current amplitude in the striatal cultures (Price et al., 1999). Moreover, studies by Esteban et al. (2003) showed that enhanced phosphorylation of GluR1 at Ser845 is necessary for insertion of GluR1 at the synapse. Overall, these findings suggest a correlation between enhanced GluR1 phosphorylation at Ser845 and an increase in the number and activity of surface GluR1 receptors. However, the increase in GluR1 phosphorylation was several folds higher than the increase in surface GluR1. This difference is most likely due to an enhanced phosphorylation of both intracellular and cell surface receptors, which includes synaptic as well as extrasynaptic GluR1 subunits. It is also possible that robust insertion of Ser845 GluR1 requires other mechanisms that involve CaMK-II dependent phosphorylation (Esteban et al., 2003). Thus, the modest increase in surface GluR1 subunits may have resulted from the lack of activation of other signaling pathways important for efficient insertion of AMPA receptors at the synapse. Despite the recent reports on D1-mediated phosphorylation of AMPA receptors, the molecular mechanism for coupling D1 receptor activation to changes in AMPA receptor phosphorylation remained unclear. Our data provide evidence that the PDZ protein PSD95 is a candidate mediator of these effects. By interacting with glutamate receptors, kinase anchoring proteins, and cytoskeletal elements, PSD-95 is thought to assemble a large protein complex that regulates the function of glutamate receptors (Lee and Sheng, 2000). Accumulating evidence shows that PSD-95 selectively enhances clustering and function of AMPA receptors

774

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

Fig. 6. Expression of a non-targeting form AKAP79/150 attenuates D1-mediated effects on GluR1 phosphorylation. (A) Co-localization of AKAP79/150 (AKAP) and PSD-95 in striatal cultures. Neurons were fixed and stained with antibodies against AKAP and PSD-95. Enlarged images of boxed area are shown to the right. (B) Distribution of GFP-tagged wild type (AKAP WT) and a non-targeting form of AKAP (NT-AKAP) that fails to localize to dendritic spines. (C, D) Neurons were infected with SFV expressing either GFP alone or NT-AKAP. One day post-infection, neurons were subjected to treatment with SKF 38393 þ IBMX. (C) A significant reduction in D1-mediated GluR1 phosphorylation at Ser845 was observed in neurons expressing NT-AKAP but not in uninfected or cells infected with GFP. (D) A biotinylation assay revealed a significant reduction in D1 effects on surface GluR1 when neurons were infected with NT-AKAP. Values are presented as means SEM (n ¼ 4 7).
p < 0:05. Scale bars, overview panels; 10 lm, magnified panels; 1 lm.

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

775

Fig. 7. In vivo stimulation of dopamine release triggers rapid phosphorylation of GluR1. Following a 10 min ICSS session with active or control electrodes in the VTA, the nucleus accumbens and a comparably sized portion of the dorsal striatum of stimulated and contralateral hemispheres were analyzed for changes in GluR1 phosphorylation at Ser845. (A, B) Results show enhanced phosphorylation of GluR1 upon stimulation of dopamine release in the nucleus accumbens (A) but not in dorsal striatum (B).
p < 0:05.

(Ehrlich and Malinow, 2004; El-Husseini et al., 2000; Schnell et al., 2002; Stein et al., 2003). Moreover, studies by Ehrlich and Malinow (2004) elucidated the important role of PSD-95 in AMPA receptor delivery during experience-driven plasticity. These findings indicate that PSD-95 is critical for glutamate signaling pathways involved in synaptic plasticity. Our previous work showed that palmitate cycling occurs in an activity-dependent fashion, and that acutely disrupting palmitoylation with 2-bromo palmitate can disperse synaptic clusters of PSD-95 (El-Husseini et al., 2002). This activity-dependent dispersion of PSD-95 results in a selective loss of AMPA receptor subunits and AMPA receptor activity at synapses. Remarkably, the palmitoylation deficient form of PSD-95 was sufficient to block experience-dri-

ven potentiation of synapses (Ehrlich and Malinow, 2004). As one of the major targets affected by stimulation of dopamine receptors, PSD-95 appears to be an important mediator of dopamine effects on AMPA mediated synaptic plasticity. In this study, we find that PSD-95 modulates dopamine mediated synaptic insertion of AMPA receptors in both striatal and prefrontal cortical neurons. Dopamine effects can be attenuated by expressing a cysteine mutant form of PSD-95 that fails to target to synaptic sites. Similar effects were obtained by blocking protein palmitoylation with 2-bromo palmitate. These results indicate that proper coupling of PSD-95 to AMPA receptors is important for rapid translation of signals from activated D1 receptors.

776

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

PSD-95 can also modulate synapse morphology by regulating the recruitment of neuroligin (NLG) to the PSD (Prange and El-Husseini; unpublished observations). Moreover, PSD-95 may regulate glutamate receptor function by: (a) enhancing receptor phosphorylation by protein kinases (Esteban et al., 2003) or by (b) modulating receptor internalization by endocytosis or retention to regulate the number of receptors available at the synapse (Sheng and Kim, 2002). The coupling of PSD-95 to AKAP79/150 may serve to properly anchor the PKA in close proximity to AMPA receptors (Colledge et al., 2000; Scott, 2003). Indeed, our novel results show that a non-targeting form of AKAP79/ 150 blocks dopamine mediated effects on AMPA receptor phosphorylation and surface expression. These effects are highly significant since AMPA receptor phosphorylation by protein kinase A (PKA) controls synaptic trafficking underlying plasticity (Esteban et al., 2003). In this context, the present finding that brainstimulation reward induced by electrical stimulation of dopaminergic neurons in the VTA can facilitate GluR1 phosphorylation in the NAc, implies that dopaminemediated reward processes are linked to D1-mediated GluR1 phosphorylation and surface expression through a mechanism that involves the recruitment of both AKAP79/150 and PSD-95. Chronic administration of addictive drugs including amphetamine and cocaine, can modulate the activity of dopamine receptors. In drug addiction models, chronic changes in dopamine receptor function is thought to trigger long lasting changes in glutamate receptor activity associated with neuroadaptation to chronic administration of addictive drugs (Hyman and Malenka, 2001). The NAc, a central brain region for addiction, receives both glutamatergic and dopaminergic inputs (Fibiger and Phillips, 1988; Wise and Bozarth, 1981). Given the convergence of the dopaminergic and glutamatergic signaling pathways, neurons in this region are excellent candidates for drug-induced adaptation in glutamate transmission. Yao et al. (2004) showed recently that PSD-95 expression is downregulated in mouse models of psychostimulant sensitization or dopamine supersensitivity. Specifically, these authors suggest that chronic exposure to psychostimulant drugs may serve as a functional equivalent to down-regulation of PSD-95 at glutamatergic synapses, a process that is thought to disrupt drug-induced sensitization (Robinson and Berridge, 1993). These findings indicate that down-regulation of PSD-95 expression may result in uncoupling of the dopamine and glutamate signaling pathways, thereby altering processes related to synaptic plasticity associated with addiction. Rapid activation of AMPA receptors induces rapid dephosphorylation of AMPA receptors at Ser845 (Snyder et al., 2003). However, long-term potentiation (LTP) induces insertion of AMPA receptors into den-

dritic spines (Hayashi et al., 2000). Importantly, both LTP and LTD involve recruitment and removal of AMPA receptor at the synapse (Bredt and Nicoll, 2003; Luscher et al., 2000; Malinow and Malenka, 2002). Moreover, GluR1 phosphorylation at the PKA site is thought to be a major contributor for modulating long lasting changes in AMPA receptor insertion and removal at synaptic sites (Malinow and Malenka, 2002). During LTP, GluR1 containing receptors are delivered to synaptic sites. In contrast, LTD results in enhanced internalization of GluR1 containing AMPA receptors. Indeed, our findings demonstrate for the first time that stimulation of dopamine release in the mesolimbic system in vivo results in rapid phosphorylation of AMPA receptors. These changes further support the notion that endogenous dopamine receptor activity results in a rapid phosphorylation and membrane insertion of AMPA receptors. Several lines of evidence indicate that stimulation of D1 rather D2 receptors are involved in the rapid phosphorylation of GluR1 by dopamine in a PKA-dependent pathway. First, the phosphorylation of GluR1 was triggered by a selective D1 but not a D2 agonist. Second, the effects observed on the phosphorylation of Ser845 of GluR1 were blocked by a D1 antagonist and the PKA inhibitor, Rp-cAMPS. Taken together, these results suggest that D1 rather D2 is mediating the dopamine effects on AMPA receptors phosphorylation in our culture systems. In the future, it will be important to determine whether specific D1 antagonists block D1-mediated effects on AMPA receptors in vivo. The PFC is another brain region with high density of dopamine receptors that modulate working memory (Phillips et al., 2004). PFC is involved in the control of emotion and cognition and functional changes in the brain region have been linked to schizophrenia (Harrison, 1999). Moreover, disruption of glutamate receptor signaling in the PFC is thought to occur in schizophrenia (Tamminga, 1998; Ulas and Cotman, 1993). For instance, treatment with phencyclidine (PCP), a noncompetitive blocker of the NMDA-subtype of glutamate receptors, triggers schizophrenoform psychosis with symptoms similar to those manifested in schizophrenia (Javitt and Zukin, 1991). Other findings indicate that glutamatergic hypofunction is involved in the manifestation of schizophrenia. Evidence for this includes an apparent decrease in the density/function of NMDA and AMPA subtypes of glutamate receptors (Bressan and Pilowsky, 2000). Because schizophrenialike symptoms results from disruption of function of both dopamine and glutamate receptors, this suggests that schizophrenia is likely to be a heterogeneous group of disorders that result in a dysfunction in signals between the glutamatergic and dopaminergic systems (Bressan and Pilowsky, 2000). Future work should examine whether chronic treatment with

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

psychoactive drugs such as amphetamine and PCP can modulate glutamate receptor phosphorylation and trafficking through changes in PSD-95/AKAP79/150 recruitment to synapses.

Acknowledgements We thank Dr. Mark Dell’Acqua (University of Colorado, Denver, Colorado) for kindly providing us with wild type and mutant forms of AKAP79/150 cDNAs, and Dr. Yvonne Lai (ICOS) for generously giving us AKAP79/150 antibodies. We are grateful for the excellent technical assistance provided by Fred Lepaine and Dr. Karen Brebner in connection with ICSS experiments. We also thank Dr. Tim Murphy for valuable suggestions and discussions. This work was supported by a grant for A.E.-H. from the National Alliance for Schizophrenia Research and Depression (NARSAD), the Michael Smith foundation for Health Research (MSFHR) and grants from the Canadian Institutes for Health Research (CIHR) (A.E.-H., 20R90479; A.G.P., 20R90644) and CIHR NET-54013. A.E.-H. is a CIHR new investigator and an MSFHR scholar. R.D.S. is supported by the Heart and Stroke Foundation, CIHR, Canadian Stroke Network, AstraZeneca Canada Inc, and MSFHR studentship.

References Berke, J.D., Hyman, S.E., 2000. Addiction, dopamine, and the molecular mechanisms of memory. Neuron 25, 515–532. Bredt, D.S., Nicoll, R.A., 2003. AMPA receptor trafficking at excitatory synapses. Neuron 40, 361–379. Bressan, R.A., Pilowsky, L.S., 2000. Imaging the glutamatergic system in vivo—relevance to schizophrenia. Eur. J. Nucl. Med. 27, 1723–1731. Brewer, G.J., Torricelli, J.R., Evege, E.K., Price, P.J., 1993. Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J. Neurosci. Res. 83, 567–576. Chao, S.Z., Ariano, M.A., Peterson, D.A., Wolf, M.E., 2002. D1 dopamine receptor stimulation increases GluR1 surface expression in nucleus accumbens neurons. J. Neurochem. 83, 704–712. Chen, L., Chetkovich, D.M., Petralia, R.S., Sweeney, N.T., Kawasaki, Y., Wenthold, R.J., Bredt, D.S., Nicoll, R.A., 2000. Stargazing regulates synaptic targeting of AMPA receptors by two distinct mechanisms. Nature 408, 936–943. Chen, L., El-Husseini, A., Tomita, S., Bredt, D.S., Nicoll, R.A., 2003. Stargazin differentially controls the trafficking of {alpha}amino-3-hydroxyl-5-methyl-4-isoxazolepropionate and kainate receptors. Mol. Pharmacol. 64, 703–706. Chen, G., Greengard, P., Yan, Z., 2004. Potentiation of NMDA receptor currents by dopamine D1 receptors in prefrontal cortex. Proc. Natl. Acad. Sci. USA 101, 2596–2600. Colledge, M., Dean, R.A., Scott, G.K., Langeberg, L.K., Huganir, R.L., Scott, J.D., 2000. Targeting of PKA to glutamate receptors through a MAGUK–AKAP complex. Neuron 27, 107–119.

777

Creese, I., 1987. Biochemical properties of CNS dopamine receptors. In: Meltzer, H.Y. (Ed.), Psychopharmacology: The Third Generation of Progress. Raven Press, New York, pp. 257–264. Dell’Acqua, M.L., Faux, M.C., Thorburn, J., Thorburn, A., Scott, J.D., 1998. Membrane-targeting sequences on AKAP79 bind phosphatidylinositol-4,5-bisphosphate. EMBO J. 17, 2246–2260. Dudman, J.T., Eaton, M.E., Rajadhyaksha, A., Macias, W., Taher, M., Barczak, A., Kameyama, K., Huganir, R., Konradi, C., 2003. Dopamine D1 receptors mediate CREB phosphorylation via phosphorylation of the NMDA receptor at Ser897-NR1. J. Neurochem. 87, 922–934. Ehrlich, I., Malinow, R., 2004. Postsynaptic density 95 controls AMPA receptor incorporation during long-term potentiation and experience-driven synaptic plasticity. J. Neurosci. 24, 916–927. El-Husseini, A.E., Bredt, D.S., 2002. Protein palmitoylation: a regulator of neuronal development and function. Nat. Rev. Neurosci. 3, 791–802. El-Husseini, A.E., Schnell, E., Chetkovich, D.M., Nicoll, R.A., Bredt, D.S., 2000. PSD-95 involvement in maturation of excitatory synapses. Science 290, 1364–1368. El-Husseini, A.E., Schnell, E., Dakoji, S., Sweeney, N., Zhou, Q., Prange, O., Gauthier-Campbell, C., Aguilera-Moreno, A., Nicoll, R.A., Bredt, D.S., 2002. Synaptic strength regulated by palmitate cycling on PSD-95. Cell 108, 849–863. Esteban, J.A., Shi, S.H., Wilson, C., Nuriya, M., Huganir, R.L., Malinow, R., 2003. PKA phosphorylation of AMPA receptor subunits controls synaptic trafficking underlying plasticity. Nat. Neurosci. 6, 136–143. Fibiger, H.C., Phillips, A.G., 1988. Mesocorticolimbic dopamine systems and reward. Ann. N. Y. Acad. Sci. 537, 206–215. Fiorino, D.F., Coury, A., Fibiger, H.C., Philips, A.G., 1993. Electrical stimulation of reward sites in the ventral tegmetnal area increases dopamine transmission in the nucleus accumbens of the rat. Behav. Brain Res. 55, 131–141. Gomez, L.L., Alam, S., Smith, K.E., Horne, E., Dell’Acqua, M.L., 2002. Regulation of A-kinase anchoring protein 79/150-cAMPdependent protein kinase postsynaptic targeting by NMDA receptor activation of calcineurin and remodeling of dendritic actin. J. Neurosci. 22, 7027–7044. Gurden, H., Takita, M., Jay, T.M., 2000. Essential role of D1 but not D2 receptors in the NMDA receptor-dependent long-term potentiation at hippocampal-prefrontal cortex synapses in vivo. J. Neurosci. 20, RC1061–RC1065. Harrison, P.J., 1999. The neuropathology of schizophrenia. A critical review of the data and their interpretation. Brain 122 (Pt. 4), 593–624. Hayashi, Y., Shi, S.H., Esteban, J.A., Piccini, A., Poncer, J.C., Malinow, R., 2000. Driving AMPA receptors into synapses by LTP and CaMKII: requirement for GluR1 and PDZ domain interaction. Science 287, 2262–2267. Hyman, S.E., Malenka, R.C., 2001. Addiction and the brain: the neurobiology of compulsion and its persistence. Nat. Rev. Neurosci. 2, 695–703. Javitt, D.C., Zukin, S.R., 1991. Recent advances in the phencyclidine model of schizophrenia. Am. J. Psychiatry 148, 1301–1308. Laakso, A., Mohn, A.R., Gainetdinov, R.R., Caron, M.G., 2002. Experimental genetic approaches to addiction. Neuron 36, 213–228. Lee, S.H., Sheng, M., 2000. Development of neuron–neuron synapses. Curr. Opin. Neurobiol. 10, 125–131. Luscher, C., Nicoll, R.A., Malenka, R.C., Muller, D., 2000. Synaptic plasticity and dynamic modulation of the postsynaptic membrane. Nat. Neurosci. 3, 545–550. Malinow, R., Malenka, R.C., 2002. AMPA receptor trafficking and synaptic plasticity. Annu. Rev. Neurosci. 25, 103–126. Mangiavacchi, S., Wolf, M.E., 2004. D1 dopamine receptor stimulation increases the rate of AMPA receptor insertion onto the sur-

778

R.D. Swayze et al. / Neuropharmacology 47 (2004) 764–778

face of cultured nucleus accumbens neurons through a pathway dependent on protein kinase A. J. Neurochem. 88, 1261–1271. Phillips, A.G., Ahn, S., Floresco, S.B., 2004. Magnitude of dopamine release in medial prefrontal cortex predicts accuracy of memory on a delayed response task. J. Neurosci. 24, 547–553. Price, C.J., Kim, P., Raymond, L.A., 1999. D1 dopamine receptorinduced cyclic AMP-dependent protein kinase phosphorylation and potentiation of striatal glutamate receptors. J. Neurochem. 73, 2441–2446. Robinson, T.E., Berridge, K.C., 1993. The neural basis of drug craving: an incentive-sensitization theory of addiction. Brain Res. Brain Res. Rev. 18, 247–291. Rosenmund, C., Carr, D.W., Bergeson, S.E., Nilaver, G., Scott, J.D., Westbrook, G.L., 1994. Anchoring of protein kinase A is required for modulation of AMPA/kainate receptors on hippocampal neurons. Nature 368, 853–856. Schnell, E., Sizemore, M., Karimzadegan, S., Chen, L., Bredt, D.S., Nicoll, R.A., 2002. Direct interactions between PSD-95 and stargazin control synaptic AMPA receptor number. Proc. Natl. Acad. Sci. USA 99, 13902–13907. Scott, J.D., 2003. A-kinase-anchoring proteins and cytoskeletal signalling events. Biochem. Soc. Trans. 31, 87–89. Sheng, M., Kim, M.J., 2002. Postsynaptic signaling and plasticity mechanisms. Science 298, 776–780.

Snyder, G.L., Galdi, S., Fienberg, A.A., Allen, P., Nairn, A.C., Greengard, P., 2003. Regulation of AMPA receptor dephosphorylation by glutamate receptor agonists. Neuropharmacology 45, 703–713. Stein, V., House, D.R., Bredt, D.S., Nicoll, R.A., 2003. Postsynaptic density-95 mimics and occludes hippocampal long-term potentiation and enhances long-term depression. J. Neurosci. 23, 5503– 5506. Tamminga, C.A., 1998. Schizophrenia and glutamatergic transmission. Crit. Rev. Neurobiol. 12, 21–36. Ulas, J., Cotman, C.W., 1993. Excitatory amino acid receptors in schizophrenia. Schizophr. Bull. 19, 105–117. Wise, R.A., 2002. Brain reward circuitry: insights from unsensed incentives. Neuron 36, 229–240. Wise, R.A., Bozarth, M.A., 1981. Brain substrates for reinforcement and drug self-administration. Prog. Neuropsychopharmacol. 5, 467–474. Wolf, M.E., Mangiavacchi, S., Sun, X., 2003. Mechanisms by which dopamine receptors may influence synaptic plasticity. Ann. N. Y. Acad. Sci. 1003, 241–249. Yao, W.D., Gainetdinov, R.R., Arbuckle, M.I., Sotnikova, T.D., Cyr, M., Beaulieu, J.M., Torres, G.E., Grant, S.G., Caron, M.G., 2004. Identification of PSD-95 as a regulator of dopaminemediated synaptic and behavioral plasticity. Neuron 41, 625–638.