- Email: [email protected]
Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg
Journal of Bioscience and Bioengineering VOL. xxx No. xxx, xxx, xxxx www.elsevier.com/locate/jbiosc
Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg Yaqi Meng,1 Can Chen,1 Ning Qiu,1, * and Russell Keast2 Key Laboratory of Environment Correlative Dietology, Ministry of Education, National Research and Development Center for Egg Processing, College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China1 and Centre for Advanced Sensory Science, School of Exercise and Nutrition Sciences, Deakin University, Burwood, Victoria 3125, Australia2 Received 25 November 2019; accepted 23 February 2020 Available online xxx
Pidan, as the preserved duck egg, is a traditional alkaline-pickled food in China. Previous studies have suggested preserved egg white has an anti-inflammatory effect, though the mechanism of action was unclear. In this work, the difference of peptides distribution in the digestive products was identified from those of duck egg. The effects of preserved egg diet on the modulation of gut microbiota as well as the alteration in fecal metabolites were further investigated. Minor variations of gut microbiota in phylum level were observed between preserved and fresh duck egg diet groups, even though, preserved egg diet intake attributed to increases in the relative abundance of Prevotella and Phascolarctobacterium (p < 0.05), while Ruminococcaceae and Allobaculum were quantitatively decreased (p < 0.05). In terms of metabolites, the contents of acetic acid (p < 0.01) and propionic acid (p < 0.05) were significantly increased in the preserved egg diet group. It was speculated that the preserved egg diet might alter the proportion of short-chain fatty acids (SCFAs) in the gut of rats by modulating specific intestinal bacteria, and subsequently play an active role in anti-inflammatory effects. Compared to the fresh egg group, the bacterial produced SCFAs of preserved egg group were increased in abundance (p < 0.05), which may have potential anti-obesity and anti-inflammatory effects. The results provide a novel insight into the relationship between preserved egg intake, gut microbiota and potential positive effects on host health. Ó 2020, The Society for Biotechnology, Japan. All rights reserved. [Key words: Preserved egg; Gut microbiota; Short-chain fatty acids; High-throughput sequencing; Gas chromatography-mass spectrometry]
Preserved egg is a traditional Chinese duck egg product, produced by pickling for 4e5 weeks at 20 C in a mixture of sodium hydroxide, salt, black tea, and metal ions (1). During the pickling process, sodium hydroxide penetrates into the egg through the eggshell, leading to physical and chemical changes in both egg white and yolk (2). The egg white and yolk gradually harden under the influence of sodium hydroxide, while the proteins are mostly decomposed into polypeptides and free amino acids, leading to a significant change in the free amino acid composition and an increase in the proportion of essential amino acids (3). Meanwhile, fat is broken down to free fatty acids, while the ratio of saturated, polyunsaturated and monounsaturated fatty acids changes significantly (4). In recent years, bacteria in the colon and caecum have been considered as essential participants in the interaction between food and host (5). Food components are digested in stomach and further absorbed in the small intestine, but a significant amount of food may enter the gut and modulate the diversity of gut microbiota (6). Numerous studies have shown that the gut micro-ecology may change due to different dietary structures, which in turn regulate human health (7,8). For example, the excessive intake of red meat compared with white meat significantly increases the level of
* Corresponding author. Tel./fax: þ86 27 87283177. E-mail address: [email protected] (N. Qiu).
beneficial genus Lactobacillus, and reduces the inflammatory response in the host (9). High fat diet can reduce the abundance of Bacteroidetes and Bifidobacterium in the feces of rats while elevates the relative abundance of Firmicutes and Proteobacteria (10). Therefore, it is crucial for human health that the intestine, as the most important digestive, absorptive and immune organ of body, maintains its proper micro-ecological structure. Moreover, changes in nutritional composition during food processing may affect the gut microbiota. For instance, compared to whole-grain barley, processed malt increases the abundance of butyrate-producing bacteria in the intestine of rats, leading to higher butyrate levels (11). In addition, different processing methods such as frying and boiling can alter food components that influence the structure of gut microbiota (12). Therefore, it is important to analyze the effects of food components alterations derived from various processing methods on the regulation of gut microbiota, which will contribute to exploring the effect of processing on the nutritional value and safety of foods from an intestinal micro-ecology perspective. Studies in the intestinal micro-ecology have shown that there are significant differences in the gut microbiota formed by various sources of dietary protein and lipid (13,14). The nitrogen of gut microbiota mainly originates from residual dietary proteins, and the amino acid composition in the diet is one of the key factors to alter the gut microbiota (13). The percentage of nine amino acids in preserved duck egg is higher than that of fresh duck eggs (15). Similarly, many studies have confirmed that dietary fatty acids can
1389-1723/$ e see front matter Ó 2020, The Society for Biotechnology, Japan. All rights reserved. https://doi.org/10.1016/j.jbiosc.2020.02.015
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
2
MENG ET AL.
J. BIOSCI. BIOENG.,
directly or indirectly affect the intestinal micro-ecology and change the proportion and composition of gut microbiota in the body. Polyunsaturated fatty acids (PUFAs), especially omega-3 PUFAs, can regulate the gut microbiota, affecting the physiological properties of intestinal epithelial cells (16). Also, a diet rich in saturated fatty acid resulted in a significant reduction in the abundance of Bacteroidetes (17). During processing into preserved eggs, unsaturated fatty acids decreased, while saturated fatty acids (SFAs) increased (4). Changes of these dietary components will influence the function and structure of gut microbiota, thereby altering the host’s metabolic status and metabolites accumulation (18e20). As a relatively rare alkaline-pickling food, the formation of specific components after processing into preserved eggs may cause changes in the intestinal micro-ecology that have not yet been revealed. It has been confirmed that preserved egg white digestion products can down-regulate TNF-a-induced expression, including TNF-a, IL-6, IL-1b and interferon gamma involved in inflammation, and up-regulate the anti-inflammatory cytokines, such as IL-10 (3,21). The results prove that these digestion products have an inhibitory effect on DSS-induced colitis in mice. In addition, preserved eggs have a positive influence on lipid-lowering and anticancer (22), but the mechanism has not yet been fully clarified. In the current study, matrix-assisted laser desorption ionizationtime-of-flight/ time-of-flight (MALDI-TOF/TOF) was used to identify the differences of peptides in preserved duck egg (PE) and fresh duck egg (DE) digestion products, high throughput sequencing technology together with Gas Chromatography-Mass Spectrometry were used to investigate the effect of preserved egg intake on gut microbiota and its metabolites, in order to provide new insight for elucidating the nutritional value and safety of pickled preserved eggs.
MATERIALS AND METHODS In vitro digestion assay The methods were based on our previous protocol with modifications (23). Fresh and preserved duck eggs were obtained from the Shendi Agriculture Branch Trade (Hubei, China) and then freeze-dried and stored at 20 C until used. The nutritive composition of the fresh and preserved egg is indicated in Table S1. PE (1 g) and DE (1 g) powder were weighed separately, and 20 mL of PBS (50 mM, pH 7.2) was added to prepare a 5% suspension. The pH of the suspension was adjusted to 2.0 with 1 mol/L HCl, then 0.4 g pepsin from porcine gastric mucosa (enzyme:substrate ratio ¼ 0.4, P7125) was added, and the reaction was shaken at 37 C for 2 h. Then, the suspension was adjusted to pH 7.5 with 1 mol/L NaOH, 0.5 g pancreatin from porcine pancreas (enzyme:substrate ratio ¼ 0.5, P1750) was added, and the reaction was shaken at 37 C for 2 h. The enzyme digestion reaction was terminated by heating in a 95 C water bath for 5 min. The digestion product was centrifuged at 8000 rpm for 10 min at 4 C, and the supernatant was separated. Peptide mass fingerprinting of in vitro digested products The supernatant of the in vitro digestion product was analyzed using MALDI-TOF/TOF to obtain the peptide mass fingerprint under the following conditions: 355 nm of UV wavelength, 20,000 V of accelerating voltage, 1500 Da of optimal mass resolution, and 200 HZ of repetition rate. Scanning mass-to-charge ratio (m/z) ranges from 59 to 8000. Animals and diets All the experimental protocols were performed in accordance with the National Guidelines for Experimental Animal Welfare and were approved by the Ethical Committee of Experimental Animal Center of Huazhong Agricultural University. Twenty-four male SpragueeDawley rats (110e130 g) were housed in specific pathogen-free quarters in Animal Center of Huazhong Agricultural University (HZAURA-2018-006). The rats were kept in a controlled environment (room temperature 22e24 C, room humidity 40%e60%; 12 h lightedark cycle), free access to food and water. After 1-week acclimatization, all rats were assigned randomly to one of two groups and fed one of the two formulated diets with 1/fresh or 2/preserved duck eggs. Rats were housed in plastic cages in-group of four rats. Fresh and preserved duck eggs were obtained from the Jiu Feng Shan farm (Hubei, China). The eggs were cleaned and cooked in boiling water for 15 min. Fresh and preserved eggs were stripped of shell and membranes, egg whites and yolks were crushed, and then evenly mixed. Animal diets were prepared to content the
TABLE 1. The primers of the certain bacterium for qPCR. Primer sequence (50 ->30 )
Bacterium Prevotella species Ruminococcaceae bacterium
Lactobacillus species Allobaculum species
F: CACCAAGGCGACGATCA R: GGATAACGCCCGGACCT F: CAGCGAATTTGCAAGAGATTGCGAAGTG R: CTGCAATCTGAACTGAGATCGC TTTTGGG F: TTCGCAAGAATGAAACTCAAAG R: AAGGAAAGATCCGGTTAAGGATC F: TTAAGGCAGGGTCTAGGGAATC R: CTAAACGGGTGCGTGACTTATT
nutritional needs of growing rats. Fresh and preserved eggs were added on the basis of AIN-93, with 15 g duck eggs or preserved eggs per 100 g feed. The rat diet composition is indicated in Table S2. Animal treatments lasted for 8 weeks. When collecting fecal samples at the 8week period, the rats were caged individually in the metabolic cages. Fecal samples collected from 20 rats (10 rats per group) were placed separately in cryo tubes and stored at 80 C. 16S rRNA gene-based analysis The method was based on Zhu et al. (9) with modifications. Microbial DNA was extracted by QIAamp DNA Stool Mini Kit (Qiagen, Doncaster, Australia) from rat fecal samples. After genomic DNA extraction, the extracted genomic DNA was detected by 1% agarose gel electrophoresis. Amplification of V3eV4 hypervariable region of bacterial 16S rRNA gene using universal primers 338F (50 -ACTCCTACGGGAGGCAGCAG-30 ) and 806R (50 GGACTACHVGGGTWTCTAAT-30 ). PCR reaction conditions were as follows: denaturation at 95 C for 3.5 min, annealing at 55 C for 30 s, extended at 72 C for 45 s, a total 27 cycles, and finally extended at 72 C for 10 min. The PCR reaction system has a total of 20 mL, including mixture containing 4 mL of 5 FastPfu Buffer, 0.8 mL primers (5 mM), 2 mL of 2.5 mM dNTPs, 0.4 mL of FastPfu Polymerase, 0.2 mL of BSA and 10 ng of template DNA for three replications. PCR products were detected by 2% agarose gel electrophoresis, and recovered using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). Referring to the preliminary quantitative results of electrophoresis, the PCR products were quantified by QuantiFluor-ST (Promega, Madison, WI, USA), and then mixed according to the sequencing amount of each sample. According to Major Bio-Pharm Technology Co. Ltd. (Shanghai, China) standard protocols, the purified amplicons were combined on an Illumina Miseq platform (Illumina, San Diego, CA, USA) with equimolar ratios for sequencing (2 300). Real-time quantitative PCR In view of the above results of the 16S rRNA gene sequence, gene primers were designed for further study (Table 1). quantitative PCR (qPCR) was performed with QuantStudio 6 Flex (Applied Biosystems, Foster City, CA, USA). Each PCR was performed in a final volume of 10 mL comprising SYBR Green master mixture, primers, and template DNA. The following thermal cycling parameters were used to amplify the DNA: reacting at 95 C for 10 min, then initial denaturation at 95 C for 30 s and 30 s of annealing at 60 C for 40 cycles. Quantitative analysis was performed by using a standard curve prepared from plasmid DNA of known concentration including corresponding amplification for each primer. qPCR was run in triplicate for each sample. Detection of SCFAs by gas chromatography-mass spectrometry Quantitative analysis of SCFAs was performed using an Agilent 6890N gas chromatography in conjunction with an Agilent 5975B mass spectrometric detector (Agilent Technologies, Santa Clara, CA, USA) (23). Briefly, w0.1 g of fecal sample was added in a screw capped tube with 100 mL isohexanoic acid and 400 mL ether. The mixture was centrifuged at 12,000 g at 4 C for 10 min. The concentrations of the SCFAs were performed with HP-INNOWAX capillary column (30 m 0.25 mm i.d., 0.25 mm film thickness, Agilent). The front inlet temperature, ion source temperature, transfer line temperature, and quadrupole temperature were set as 250, 230, 250 and 150 C, respectively. The programmed temperature was 90 C, then ramped to 120 C at 10 C/min, then ramped to 150 C at 5 C/min, finally ramped to 250 C at 25 C/min and held for 2 min. The carrier gas was helium and the carrier gas flow rate were 1 mL/min. Statistical analysis All values are presented as the mean standard error of mean. Statistical significances between groups were evaluated by one-way ANOVA using SPSS 16.0 (SPSS Inc., Chicago, IL, USA). Correlations between parameters assessed by Pearson correlation test. P < 0.05 was defined as a significant difference.
RESULTS Peptide profiling of PE and DE digested products The composition of the peptides in DE and PE digested products were analyzed by MALDI-TOF/TOF (Fig. 1). Most of the DE and PE digested peptides were distributed in the region of 59 < m/z <
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx
PRESERVED EGG ALTERS GUT MICROBIOTA
3
FIG. 1. Peptide mass fingerprinting of digestive products of PE and DE. (A) PE; (B) DE.
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
4
MENG ET AL.
J. BIOSCI. BIOENG.,
FIG. 2. Overall structural changes of gut microbiota in response to DE and PE. (A) Comparison of alpha diversity accessed by Shannon and Simpson indexes; (B) principal component analysis of gut microbiota based on OTU relative abundance. Each point represents one animal.
3228.6. The major variation of the distribution of peptides in the range of m/z < 1663.8 indicated that the number of small molecule peptides in digested products for PE was less than that of DE group. Overall structural changes of gut microbiota in response to preserved egg diet compared to that of duck egg diet Using 16S rRNA sequencing, 838,729 valid raw reads were obtained from the 20 fecal samples. The vast majority of the sequence lengths in the samples were scattered in 421w460 bp. Operational taxonomic units (OTUs) were delineated at a 97% similarity level. The total number of OTU was 15,646, with an average of 782 88 per sample. Changes of gut microbial community diversity after DE and PE treatment were assessed
using Shannon and Simpson indices. In this study, a decrease in Simpson index and increase in Shannon index were observed in the PE group, suggesting higher microbiota diversity (Fig. 2A). At the OTU level, beta-diversity analyses were carried out to compare the community composition of the gut microbiota. Principal component analysis (PCA) reflected intra- and intergroup differences of gut microbiota (Fig. 2B). PC1, which expressed 30.97% of total variance, indicated that the gut microbial community structure was modified by PE diet. The gut microbiota of the rats fed with DE showed a higher intra-group variation than those fed with PE, suggesting a dietary modulation of gut microflora with variations in food components caused by the pickling process.
FIG. 3. Effect of experimental diets on relative abundance of microbiota at the phylum level. (A), relative abundance of fecal microbiota on the phylum in response to DE and PE; (B), the relative abundances of Firmicutes, Bacteroidetes, and the ratio of Firmicutes to Bacteroidetes.
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx
PRESERVED EGG ALTERS GUT MICROBIOTA
5
FIG. 4. Effect of experimental diets on relative abundance of microbiota at the genus level. (A), bacterial taxonomic profiling at the genus level. Each column represents one animal; (B), comparative analysis of 10 significant different and most abundant bacteria at the genus level. *p < 0.05, **p < 0.01, ***p < 0.001.
Gut microbiota in phylum and genus levels The most abundant phylum found in the feces of rats was Firmicutes (54.78%), followed by Bacteroidetes (41.07%) and Proteobacteria (2.47%). No significant difference was found between DE and PE fed group at the phylum level. The total relative abundance of Firmicutes and Bacteroidetes accounted for more than 95% in both groups (Fig. 3A). Even so, a higher Bacteroidetes abundance, as well as a lower Firmicutes abundance, were found in the feces of PE-fed rats compared with those of DE-fed rats, which caused a decrease in the ratio of Firmicutes to Bacteroidetes in PE group (Fig. 3B). At the genus level, the abundance of gut bacteria is shown in Fig. 4A. Bacteroidales S24-7 group (26.06%), Ruminococcaceae UCG005 (12.57%), Allobaculum (5.78%), Prevotella (5.20%) and Lactobacillus (4.20%) were the five most abundant bacteria in the DE group, while Bacteroidales S24-7 group (28.00%), Prevotella (9.73%), Lachnospiraceae NK4A136 group (5.03%), Ruminococcaceae UCG005 (4.87%) and Ruminococcus (4.05%) were the five most abundant in the PE group. After supplementation with PE, a significant decrease in relative abundances of Ruminococcaceae UCG-005, Allobaculum, Christensenellaceae R-7 group, and unclassified Clostridiales, as well as a significant increase in relative abundances of Eubacterium ruminantium group, Eubacterium xylanophilum
group, Ruminococcaceae UCG-009, Eubacterium ventriosum group, and Tyzzerella were detected compared with the DE group (Fig. 4B). Furthermore, the major different bacteria between DE and PE samples were quantitatively analyzed by qPCR. The quantity of Prevotella in PE group was over 100-fold higher when compared with DE group (p < 0.05) (Fig. 5). Consistent with our sequencing results, PE group demonstrated a significant decrease in the quantity of Ruminococcaceae compared with DE group as control (p < 0.05). Meanwhile, no statistical difference (p > 0.05) of Allobaculum and Lactobacillus was detected between PE and DE groups.
Shared and unique gut microbial populations A Venn diagram was used for demonstrating the shared and unique OTUs between PE and DE group (Fig. 6A). With the threshold of 97% identity, a total of 902 OTUs were detected in all samples, more than 85% OTUs shared between DE and PE groups. The number of unique OTUs was higher in the PE group (63 OTUs) than the DE group (46 OTUs). As for genus level, Lactococcus, no rank VadinBE97, no rank Flavobacteriaceae, Anaerostipes and Eubacterium hallii group were only in DE group, while Veillonella, Phascolarcto bacterium, Alpinimonas, Coprococcus 3, Coprococcus 2,
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
6
MENG ET AL.
J. BIOSCI. BIOENG.,
FIG. 5. Quantity of different phylotypes in PE and DE rats measured by qPCR. PE group displayed a higher abundance of Prevotella while Ruminococcaceae, Allobaculum and Lactobacillus were decreased in PE group compared with DE control. *p < 0.05.
Gelria and unclassified Methylocystaceae were only found in PE group (Fig. 6B). SCFAs in fecal contents Seven major SCFAs, including acetic acid, propionic acid, isobutyric acid, butyrate acid, isovaleric acid, valeric acid, and caproic acid were detected quantitatively for further comparison between DE and PE groups. Acetic acid, as one of the major energy substances produced by gut bacteria, had higher abundance (p < 0.01) in PE group than the DE group (Fig. 7). The contents of total SCFAs and propionic acid were also significantly higher in PE group (p < 0.05). Nevertheless, only a small amount of isobutyric acid, butyrate acid, isovaleric acid, valeric acid, and caproic acid was detected and no significant variation (p > 0.05) was found between DE and PE groups (data not shown). DISCUSSION Preserved egg is a delicacy used in many dishes and even as traditional a remedy, but its nutritional value and safety are still controversial. Preserved eggs have previously been shown to have
anti-inflammatory activity (3). The current research was designed to assess the impact of a preserved duck egg diet on gut bacteria in rats, using fresh duck egg diet as control. To the best of our knowledge, a high-throughput sequencing technique has rarely been used to reveal the effects of processed foods on gut microbiota. The exposed internal hydrophobic groups of the partially unfolded proteins are more readily digestible as the pepsin cleavage sites are mainly hydrophobic amino acids (24). In the current study, lower numbers of small peptides were found in the PE digested products. This may due to the damage of the exposed internal hydrophobic groups by high concentrations of OH- during the alkali treatment (25), which made the hydrophobic amino acids difficult to be recognized and degraded by pepsin. Accordingly, it might lead to more undigested high-molecular-weight polypeptides (m/z > 1663.8) in PE group. The small peptides consisting of 2e6 amino acids could be absorbed by the small intestine (26), while the undigested polypeptides with large molecular weight could be further utilized in the large intestine. The small peptides which were absorbed in the intestine may improve the metabolism and inflammation directly (27), without the gut mediated
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx
PRESERVED EGG ALTERS GUT MICROBIOTA
7
FIG. 6. Venn diagram displays number of unique and shared OTUs (A) and genus (B) among two groups of rats after 8 weeks. Size of each list shows the number of all OTUs and genus in each group.
metabolic regulation. Thus, the difference of the peptides distribution in digested products might lead to one of the major variations of the colonic substrate between DE and PE diet. It has been reported that undigested proteins and amino acids in the colon could serve, in addition to nondigestible carbohydrate, as an additional substrate for SCFA production (28), which explains the increase in fecal SCFA levels in the PE diet group. Lower gut microbiota diversity has been suggested to be involved with various metabolic and immune disorders (29). For instance, the alpha diversity analysis showed that the gut microbiota diversity was negatively related to obesity (30). In this study, a higher diversity in gut microbiota composition was revealed in PE group based on PCA analysis, suggesting a potential preventive effect of PE on metabolic disorders by regulating gut microbiota community. A decrease in Firmicutes and an increase in Bacteroidetes in the PE group resulted in a lower ratio of F/B, which was usually represented in lean individuals (31,32). Extensive research has proved that the F/B ratio is closely related to obesity (33,34). Furthermore, higher ratio of F/B can enhance energy harvest, which is considered to be correlated with obesity (35). In this study, the data showed a limited decrease of F/B ratio in PE group. This may
FIG. 7. Effect of dietary DE and PE on fecal SCFA concentrations of rats after 8 weeks. Each bar was composed of the means and the standard deviations. *p < 0.05, **p < 0.01.
have two possibilities: dietary intervention may need a longer period of time, and/or the decisive peptides (or amino acids) and fatty acids content which could influence the F/B ratio were relatively similar between PE and DE (1,3). This may indicate that the variation derived from food processing, specifically pickling in this study, may have a limited effect on gut bacteria. The modulation of gut bacteria is more likely to be affected by the different sources of proteins and lipids. Prevotella is as a producer of succinate, which acts as a substrate for intestinal gluconeogenesis and improves glucose metabolism (36). Prevotella is believed to prevent the Bacteroidesinduced glucose tolerance by promoting increased liver glycogen storage (36), which might have potential use in diabetes therapies (37). Moreover, the presence of Prevotella was negatively associated with obesity (38). In this study, the relative abundance of Prevotella was significantly higher in PE group (p < 0.05), which indicates a possible positive health effect brought about by PE diet. In contrast, intestinal types rich in Prevotella may be positively correlated with a high risk of irritable bowel syndrome with diarrhea (IBS-D). Prevotella in feces of IBS-D patients was more abundant than in healthy controls (39). Meanwhile, Prevotella has been associated with proinflammatory function. Prevotella contains enzymes that promote the mucin degradation, which may result in the increased intestinal permeability (40). The effect of dietary modulation of gut microbiota depends on a synergy among gut bacteria. Apart from the potential proinflammatory function induced by Prevotella, secreted succinate may be utilized as the sole carbon source of Phascolarctobacterium (41), which has been identified as an anti-inflammatory butyrate producer (42). In addition, the predominance of Phascolarctobacterium, which was specifically found in PE group, might also be induced by the increase of intestinal pH caused by the undigested PE components (43). PE diet also lead to a significantly lower population of Ruminococcaceae compared with DE diet (p < 0.01). The Ruminococcaceae family is one of the major mucosa-associated microbiota (44). Numerous studies pointed out that such strains were present at reduced levels in patients with inflammatory bowel disease (45e47). A trace amount of heavy metals, such as Cu, which was incorporated during PE processing (2), might be responsible for the
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
8
MENG ET AL.
decrease of the Ruminococcaceae ratio. Another down-modulated bacteria in PE group was Allobaculum, which was also proposed to be inhibited by Cu (48). SCFAs were suggested to be involved in regulating certain physiological responses, including intestinal permeability, lipid metabolism, and immune system function (11,49,50). In the present study, the amount of acetic (p < 0.01) and propionic acid (p < 0.05) increased significantly in the PE group. Acetate was identified as the net fermentation product of most intestinal anaerobic bacteria and generally ranked highest in percentage among all SCFAs in the intestinal lumen (51). Acetate was shown to be effective in inducing the secretion of glucagon-like peptide-1, which is a gut-derived metabolite that reduces food intake (52) and prevents dietinduced obesity (53,54). Propionate was also recommended for its potential health benefits including anti-obesity, anti-inflammation and anti-cancer effects (55,56). As propionate was produced primarily through the pathway of aspartate acid, threonine, alanine and methionine (57e59), the increase of fecal propionate in PE group might be due to the relatively higher abundance of free amino acids in PE digested products (3). Based on the analysis of the characteristics for altered intestinal microbiota in PE group, it could be speculated that the increase of fecal SCFAs levels was associated with the upregulation of certain SCFAs producers. For example, Prevotella and Coprococcus were producers of acetate and propionate, respectively (60,61). Coprococcus was only detected in PE group, from which Prevotella also significantly increased. Moreover, Vanegas et al. (62) confirmed that Lachnospira was positively correlated with fecal acetate and butyrate. The formation of propionic acid and propanol from deoxysugar rhamnose and fucose respectively through the propylene glycol pathway has been confirmed in the dominant intestinal symbiotic bacteria belonging to the Lachnospiraceae (63,64). From our results, Lachnospira and Lachnospiraceae were also more abundant in the PE group. Other than energy sources, SCFAs also act as anti-inflammatory mediators against human gastrointestinal and inflammatory disorders (49). According to the results from similar studies (11,56), it could be hypothesized that the higher SCFAs level in PE group might contribute to its anti-inflammatory effect. In conclusion, this work has provided novel information regarding the modulation of gut microbiota influenced by preserved duck egg diet. Due to the alteration of egg components induced by alkaline processing, certain fecal bacteria and the corresponding SCFAs levels increased quantitatively, indicating potential anti-obesity and anti-inflammatory effects. Some specific SCFA-producers were identified with a significant increase in PE group (p < 0.05), even though no significant difference was found in the phylum level of gut microbiota between PE and DE group, which may be the bioactive peptides in PE group were already absorbed in small intestine and causing improvements in inflammation. These results provided new insight into the relationship between preserved egg diet and host health from the perspective of gut microbiota modulations. In addition to the potential nutritional and functional benefits, there may be disadvantages to consuming preserved eggs. For example, the decline of specific bacteria resulting in potential intestinal-related diseases might be affected by the residual heavy metals in PE, more research is required on this issue. Still, more efforts need to be paid in revealing the beneficial PE components with anti-inflammatory effect through modulating the gut microbiota. Supplementary data to this article can be found online at https://doi.org/10.1016/j.jbiosc.2020.02.015.
J. BIOSCI. BIOENG., ACKNOWLEDGMENTS This work was financially supported by the Chinese National Natural Science Foundation of China (Grant No. 31772043), Fundamental Research Funds for the Central Universities (Program No. 2662018JC021 & Project No. 2019BC008). The authors declare that there are no conflicts of interest.
References 1. Zhao, Y., Tu, Y., Xu, M., Li, J., and Du, H.: Physicochemical and nutritional characteristics of preserved duck egg white, Poult. Sci., 93, 3130e3137 (2014). 2. Tu, Y. G., Zhao, Y., Xu, M. S., Li, X., and Du, H. Y.: Simultaneous determination of 20 inorganic elements in preserved egg prepared with different metal ions by ICP-AES, Food Anal. Method, 6, 667e676 (2013). 3. Zhao, Y., Yao, Y., Xu, M., Wang, S., Wang, X., and Tu, Y.: Simulated gastrointestinal digest from preserved egg white exerts anti-inflammatory effects on Caco-2 cells and a mouse model of DSS-induced colitis, J. Funct. Food, 35, 655e665 (2017). 4. Zhao, Y., Tu, Y. G., Deng, W. H., and Li, J. K.: Changes of fatty acids during the processing of preserved eggs, Food Sci. (N.Y.), 35, 69e72 (2014). 5. Turnbaugh, P. J., Ley, R. E., Hamady, M., Fraser-Liggett, C. M., Knight, R., and Gordon, J. I.: The human microbiome project, Nature, 449, 804e810 (2007). 6. Rist, V. T. S., Weiss, E., Eklund, M., and Mosenthin, R.: Impact of dietary protein on microbiota composition and activity in the gastrointestinal tract of piglets in relation to gut health: a review, Animal, 7, 1067e1078 (2013). 7. Requena, T., Martinez-Cuesta, M. C., and Pelaez, C.: Diet and microbiota linked in health and disease, Food Funct, 9, 688e704 (2018). 8. Smits, S. A., Leach, J., Sonnenburg, E. D., Gonzalez, C. G., Lichtman, J. S., Reid, G., Knight, R., Manjurano, A., Changalucha, J., Elias, J. E., DominguezBello, M. G., and Sonnenburg, J. L.: Seasonal cycling in the gut microbiome of the Hadza hunter-gatherers of Tanzania, Science, 357, 802e806 (2017). 9. Zhu, Y., Lin, X., Zhao, F., Shi, X., Li, H., Li, Y., Zhu, W., Xu, X., Li, C., and Zhou, G.: Meat, dairy and plant proteins alter bacterial composition of rat gut bacteria, Sci. Rep., 5, 15220e15233 (2015). 10. Zhang, C. H., Zhang, M. H., Pang, X. Y., Zhao, Y. F., Wang, L. H., and Zhao, L. P.: Structural resilience of the gut microbiota in adult mice under high-fat dietary perturbations, ISME J., 6, 1848e1857 (2012). 11. Zhong, Y. D., Nyman, M., and Fak, F.: Modulation of gut microbiota in rats fed high-fat diets by processing whole-grain barley to barley malt, Mol. Nutr. Food Res., 59, 2066e2076 (2015). 12. Shen, Q., Chen, Y. A., and Tuohy, K. M.: A comparative in vitro investigation into the effects of cooked meats on the human faecal microbiota, Anaerobe, 16, 572e577 (2010). 13. Zhu, Y., Shi, X., Lin, X., Ye, K., Xu, X., Li, C., and Zhou, G.: Beef, chicken, and soy proteins in diets induce different gut microbiota and metabolites in rats, Front. Microbiol., 8, 1395e1406 (2017). 14. Tuohy, K. M., Hinton, D. J. S., Davies, S. J., Crabbe, M. J. C., Gibson, G. R., and Ames, J. M.: Metabolism of maillard reaction products by the human gut microbiota e implications for health, Mol. Nutr. Food Res., 50, 847e857 (2006). 15. Zhang, R. Z., Liu, S. T., Lin, X. H., Gao, W. H., and Rao, P. F.: Study on protein changes during processing of preserved eggs, Fujian Agric. Sci.Technol., S1, 69e70 (1998). 16. Li, H., Zhu, Y., Zhao, F., Song, S., Li, Y., Xu, X., Zhou, G., and Li, C.: Fish oil, lard and soybean oil differentially shape gut microbiota of middle-aged rats, Sci. Rep., 7, 826e837 (2017). 17. Liu, T. Y., Hougen, H., Vollmer, A. C., and Hiebert, S. M.: Gut bacteria profiles of Mus musculus at the phylum and family levels are influenced by saturation of dietary fatty acids, Anaerobe, 18, 331e337 (2012). 18. Xie, H. L., Guo, R. J., Zhong, H. Z., Feng, Q., Lan, Z., Qin, B. C., Ward, K. J., Jackson, M. A., Xia, Y., Chen, X., and other 15 authors: Shotgun metagenomics of 250 adult twins reveals genetic and environmental impacts on the gut microbiome, Cell Syst., 3, 572e584 (2016). 19. Goodrich, J. K., Davenport, E. R., Waters, J. L., Clark, A. G., and Ley, R. E.: Cross-species comparisons of host genetic associations with the microbiome, Science, 352, 532e535 (2016). 20. Carmody, R. N., Gerber, G. K., Luevano, J. M., Gatti, D. M., Somes, L., Svenson, K. L., and Turnbaugh, P. J.: Diet dominates host genotype in shaping the murine gut microbiota, Cell Host Microbe, 17, 72e84 (2015). 21. Zhang, M., Zhao, Y., Wu, N., Yao, Y., Xu, M., Du, H., and Tu, Y.: The antiinflammatory activity of peptides from simulated gastrointestinal digestion of preserved egg white in DSS-induced mouse colitis, Food Funct., 13, 6444e6454 (2018).
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx 22. Mao, C. Y., Yu, Z. H., Li, C. L., Jin, Y. G., and Ma, M. H.: The functional properties of preserved eggs: from anti-cancer and anti-inflammatory aspects, Korean J. Food Sci. Anim. Resour., 38, 615e628 (2018). 23. Wang, X. F., Qiu, N., and Liu, Y. P.: Effect of different heat treatments on in vitro digestion of egg white proteins and identification of bioactive peptides in digested products, J. Food Sci., 4, 1140e1148 (2018). 24. Keil, B.: Essential substrate residues for action of endopeptidases. Springer, Berlin, Heidelberg (1992). 25. Zhao, Y., Chen, Z., Li, J., Xu, M., Shao, Y., and Tu, Y.: Changes of microstructure characteristics and intermolecular interactions of preserved egg white gel during pickling, Food Chem., 203, 323e330 (2016). 26. Grimble, G. K. and Silk, D. B. A.: Peptides in human nutrition, Nutr. Res. Rev., 2, 87e108 (1989). 27. Requena, T., Miguel, M., Garcés-Rimón, M., Martínez-Cuesta, M. C., and Peláez, C.: Pepsin egg white hydrolysate modulates gut microbiota in Zucker obese rats, Food Funct., 8, 437e443 (2017). 28. Nordgaard, I., Mortensen, P. B., and Langkilde, A. M.: Small intestinal malabsorption and colonic fermentation of resistant starch and resistant peptides to short-chain fatty acids, Nutrition, 11, 129e137 (1995). 29. Dore, J. and Blottiere, H.: The influence of diet on the gut microbiota and its consequences for health, Curr. Opin. Biotechnol., 32, 195e199 (2015). 30. Beaumont, M., Goodrich, J. K., Jackson, M. A., Yet, I., Davenport, E. R., VieiraSilva, S., Debelius, J., Pallister, T., Mangino, M., Raes, J., and other 5 authors: Heritable components of the human fecal microbiome are associated with visceral fat, Genome Biol., 17, 189 (2016). 31. Ley, R. E., Turnbaugh, P. J., Klein, S., and Gordon, J. I.: Microbial ecology human gut microbes associated with obesity, Nature, 444, 1022e1023 (2006). 32. Ley, R. E., Backhed, F., Turnbaugh, P., Lozupone, C. A., Knight, R. D., and Gordon, J. I.: Obesity alters gut microbial ecology, Proc. Natl. Acad. Sci. USA, 102, 11070e11075 (2005). 33. Jumpertz, R., Le, D. S., Turnbaugh, P. J., Trinidad, C., Bogardus, C., Gordon, J. I., and Krakoff, J.: Energy-balance studies reveal associations between gut microbes, caloric load, and nutrient absorption in humans, Am. J. Clin. Nutr., 94, 58e65 (2011). 34. Chang, C. J., Lin, C. S., Lu, C. C., Martel, J., Ko, Y. F., Ojcius, D. M., Tseng, S. F., Wu, T. R., Chen, Y. Y. M., Young, J. D., and Lai, H. C.: Ganoderma lucidum reduces obesity in mice by modulating the composition of the gut microbiota, Nat. Commun., 6, 7489e7505 (2015). 35. Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L., Duncan, A., Ley, R. E., Sogin, M. L., Jones, W. J., Roe, B. A., Affourtit, J. P., and other 5 authors: A core gut microbiome in obese and lean twins, Nature, 457, 480e487 (2009). 36. Kovatcheva-Datchary, P., Nilsson, A., Akrami, R., Lee, Y. S., De Vadder, F., Arora, T., Hallen, A., Martens, E., Bjorck, I., and Backhed, F.: Dietary fiberinduced improvement in glucose metabolism is associated with increased abundance of Prevotella, Cell Metabol., 22, 971e982 (2015). 37. De Vadder, F., Kovatcheva-Datchary, P., Zitoun, C., Duchampt, A., Backhed, F., and Mithieux, G.: Microbiota-produced succinate improves glucose homeostasis via intestinal gluconeogenesis, Cell Metabol., 24, 151e157 (2016). 38. Santacruz, A., Collado, M. C., Garcia-Valdes, L., Segura, M. T., MartinLagos, J. A., Anjos, T., Marti-Romero, M., Lopez, R. M., Florido, J., Campoy, C., and Sanz, Y.: Gut microbiota composition is associated with body weight, weight gain and biochemical parameters in pregnant women, Br. J. Nutr., 104, 83e92 (2010). 39. Su, T. T., Liu, R. B., Lee, A., Long, Y. Q., Du, L. J., Lai, S. C., Chen, X. Q., Wang, L., Si, J. M., Owyang, C., and Chen, S. J.: Altered intestinal microbiota with increased abundance of prevotella is associated with high risk of diarrheapredominant irritable bowel syndrome, Gastroenterol. Res. Pract., 6961783 (2018). 40. Staudacher, H. M., Irving, P. M., Lomer, M. C. E., and Whelan, K.: Mechanisms and efficacy of dietary FODMAP restriction in IBS, Nat. Rev. Gastroenterol. Hepatol., 11, 256e266 (2014). 41. Zhang, J., Zheng, Y., Guo, Z., Qiao, J., Gesudu, Q., Sun, Z., Huo, D., Huang, W., Hou, Q., Kwok, L., and Zhang, H.: The diversity of intestinal microbiota of Mongolians living in Inner Mongolia, China, Benefit Mirbobes, 4, 319e328 (2013). 42. Louis, P. and Flint, H. J.: Diversity, metabolism and microbial ecology of butyrate-producing bacteria from the human large intestine, FEMS Microbiol. Lett., 294, 1e8 (2009). 43. Zhao, Y. G., Li, X. W., Wang, J. C., Bai, J., and Tian, W. J.: Performance of a sulfidogenic bioreactor and bacterial community shifts under different alkalinity levels, Bioresour. Technol., 101, 9190e9196 (2010). 44. Nava, G. M. and Stappenbeck, T. S.: Diversity of the autochthonous colonic microbiota, Gut Microbes, 2, 99e104 (2011).
PRESERVED EGG ALTERS GUT MICROBIOTA
9
45. Willing, B. P., Dicksved, J., Halfvarson, J., Andersson, A. F., Lucio, M., Zheng, Z., Jarnerot, G., Tysk, C., Jansson, J. K., and Engstrand, L.: A pyrosequencing study in twins shows that gastrointestinal microbial profiles vary with inflammatory bowel disease phenotypes, Gastroenterology, 139, 1844e1854 (2010). 46. Schubert, A. M., Sinani, H., and Schloss, P. D.: Antibiotic-induced alterations of the murine gut microbiota and subsequent effects on colonization resistance against clostridium difficile, mBio, 6, e00974 (2015). 47. Jiang, W. W., Wu, N., Wang, X. M., Chi, Y. J., Zhang, Y. Y., Qiu, X. Y., Hu, Y., Li, J., and Liu, Y. L.: Dysbiosis gut microbiota associated with inflammation and impaired mucosal immune function in intestine of humans with non-alcoholic fatty liver disease, Sci. Rep., 5, 8096e8102 (2015). 48. Munyaka, P. M., Rabbi, M. F., Khafipour, E., and Ghia, J. E.: Acute dextran sulfate sodium (DSS)-induced colitis promotes gut microbial dysbiosis in mice, J. Basic Microbiol., 56, 986e998 (2016). 49. Fukuda, S., Toh, H., Hase, K., Oshima, K., Nakanishi, Y., Yoshimura, K., Tobe, T., Clarke, J. M., Topping, D. L., Suzuki, T., and other 6 authors: Bifidobacteria can protect from enteropathogenic infection through production of acetate, Nature, 469, 543e547 (2011). 50. Gao, B., Chi, L., Mahbub, R., Bian, X. M., Tu, P. C., Ru, H. Y., and Lu, K.: Multiomits reveals that lead exposure disturbs gut microbiome development, key metabolites, and metabolic pathways, Chem. Res. Toxicol., 30, 996e1005 (2017). 51. Younesi, H., Najafpour, G., and Mohamed, A. R.: Ethanol and acetate production from synthesis gas via fermentation processes using anaerobic bacterium, Clostridium ljungdahlii, Biochem. Eng. J., 27, 110e119 (2005). 52. Frost, G., Sleeth, M. L., Sahuri-Arisoylu, M., Lizarbe, B., Cerdan, S., Brody, L., Anastasovska, J., Ghourab, S., Hankir, M., Zhang, S., and other 7 authors: The short-chain fatty acid acetate reduces appetite via a central homeostatic mechanism, Nat. Commun., 5, 3611e3621 (2014). 53. Lin, H. V., Frassetto, A., Kowalik, E. J., Nawrocki, A. R., Lu, M. F. M., Kosinski, J. R., Hubert, J. A., Szeto, D., Yao, X. R., Forrest, G., and Marsh, D. J.: Butyrate and propionate protect against diet-induced obesity and regulate gut hormones via free fatty acid receptor 3-independent mechanisms, PloS One, 7, e35240 (2012). 54. den Besten, G., Bleeker, A., Gerding, A., van Eunen, K., Havinga, R., van Dijk, T. H., Oosterveer, M. H., Jonker, J. W., Groen, A. K., Reijngoud, D. J., and Bakker, B. M.: Short-chain fatty acids protect against high-fat diet-induced obesity via a PPAR-dependent switch from lipogenesis to fat oxidation, Diabetes, 64, 2398e2408 (2015). 55. Hosseini, E., Grootaert, C., Verstraete, W., and Van de Wiele, T.: Propionate as a health-promoting microbial metabolite in the human gut, Nutr. Rev., 69, 245e258 (2011). 56. Vinolo, M. A. R., Rodrigues, H. G., Nachbar, R. T., and Curi, R.: Regulation of inflammation by short chain fatty acids, Nutrients, 3, 858e876 (2011). 57. Potrykus, J., White, R. L., and Bearne, S. L.: Proteomic investigation of amino acid catabolism in the indigenous gut anaerobe Fusobacterium varium, Proteomics, 8, 2691e2703 (2008). 58. Carbonero, F., Benefiel, A. C., Alizadeh-Ghamsari, A. H., and Gaskins, H. R.: Microbial pathways in colonic sulfur metabolism and links with health and disease, Front. Physiol., 3, 448e458 (2012). 59. Buckel, W.: Unusual enzymes involved in five pathways of glutamate fermentation, Appl. Microbiol. Biotechnol., 57, 263e273 (2001). 60. Xia, X. J., Li, G. N., Ding, Y. B., Ren, T. Y., Zheng, J., and Kan, J. Q.: Effect of whole grain qingke (Tibetan Hordeum vulgare L. Zangqing 320) on the serum lipid levels and intestinal microbiota of rats under high-fat diet, J. Agric. Food Chem., 65, 2686e2693 (2017). 61. Shang, W. T., Si, X., Zhou, Z. K., Li, Y., Strappe, P., and Blanchard, C.: Characterization of fecal fat composition and gut derived fecal microbiota in highfat diet fed rats following intervention with chito-oligosaccharide and resistant starch complexes, Food Funct., 8, 4374e4383 (2017). 62. Vanegas, S. M., Meydani, M., Barnett, J. B., Kane, A., Goldin, B., Wu, D. Y., Karl, J. P., Brown, C., Vangay, P., Knights, D., and other 5 authors: Effect of a diet rich in whole grains on gut microbiota, and immune and inflammatory markers of healthy adults, FASEB J., 30, 635e650 (2016). 63. Scott, K. P., Martin, J. C., Campbell, G., Mayer, C. D., and Flint, H. J.: Wholegenome transcription profiling reveals genes up-regulated by growth on fucose in the human gut bacterium "Roseburia inulinivorans", J. Bacteriol., 188, 4340e4349 (2006). 64. Reichardt, N., Duncan, S. H., Young, P., Belenguer, A., Leitch, C. M., Scott, K. P., Flint, H. J., and Louis, P.: Phylogenetic distribution of three pathways for propionate production within the human gut microbiota, ISME J., 8, 1323e1335 (2014).
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg Yaqi Meng,1 Can Chen,1 Ning Qiu,1, * and Russell Keast2 Key Laboratory of Environment Correlative Dietology, Ministry of Education, National Research and Development Center for Egg Processing, College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China1 and Centre for Advanced Sensory Science, School of Exercise and Nutrition Sciences, Deakin University, Burwood, Victoria 3125, Australia2 Received 25 November 2019; accepted 23 February 2020 Available online xxx
Pidan, as the preserved duck egg, is a traditional alkaline-pickled food in China. Previous studies have suggested preserved egg white has an anti-inflammatory effect, though the mechanism of action was unclear. In this work, the difference of peptides distribution in the digestive products was identified from those of duck egg. The effects of preserved egg diet on the modulation of gut microbiota as well as the alteration in fecal metabolites were further investigated. Minor variations of gut microbiota in phylum level were observed between preserved and fresh duck egg diet groups, even though, preserved egg diet intake attributed to increases in the relative abundance of Prevotella and Phascolarctobacterium (p < 0.05), while Ruminococcaceae and Allobaculum were quantitatively decreased (p < 0.05). In terms of metabolites, the contents of acetic acid (p < 0.01) and propionic acid (p < 0.05) were significantly increased in the preserved egg diet group. It was speculated that the preserved egg diet might alter the proportion of short-chain fatty acids (SCFAs) in the gut of rats by modulating specific intestinal bacteria, and subsequently play an active role in anti-inflammatory effects. Compared to the fresh egg group, the bacterial produced SCFAs of preserved egg group were increased in abundance (p < 0.05), which may have potential anti-obesity and anti-inflammatory effects. The results provide a novel insight into the relationship between preserved egg intake, gut microbiota and potential positive effects on host health. Ó 2020, The Society for Biotechnology, Japan. All rights reserved. [Key words: Preserved egg; Gut microbiota; Short-chain fatty acids; High-throughput sequencing; Gas chromatography-mass spectrometry]
Preserved egg is a traditional Chinese duck egg product, produced by pickling for 4e5 weeks at 20 C in a mixture of sodium hydroxide, salt, black tea, and metal ions (1). During the pickling process, sodium hydroxide penetrates into the egg through the eggshell, leading to physical and chemical changes in both egg white and yolk (2). The egg white and yolk gradually harden under the influence of sodium hydroxide, while the proteins are mostly decomposed into polypeptides and free amino acids, leading to a significant change in the free amino acid composition and an increase in the proportion of essential amino acids (3). Meanwhile, fat is broken down to free fatty acids, while the ratio of saturated, polyunsaturated and monounsaturated fatty acids changes significantly (4). In recent years, bacteria in the colon and caecum have been considered as essential participants in the interaction between food and host (5). Food components are digested in stomach and further absorbed in the small intestine, but a significant amount of food may enter the gut and modulate the diversity of gut microbiota (6). Numerous studies have shown that the gut micro-ecology may change due to different dietary structures, which in turn regulate human health (7,8). For example, the excessive intake of red meat compared with white meat significantly increases the level of
* Corresponding author. Tel./fax: þ86 27 87283177. E-mail address: [email protected] (N. Qiu).
beneficial genus Lactobacillus, and reduces the inflammatory response in the host (9). High fat diet can reduce the abundance of Bacteroidetes and Bifidobacterium in the feces of rats while elevates the relative abundance of Firmicutes and Proteobacteria (10). Therefore, it is crucial for human health that the intestine, as the most important digestive, absorptive and immune organ of body, maintains its proper micro-ecological structure. Moreover, changes in nutritional composition during food processing may affect the gut microbiota. For instance, compared to whole-grain barley, processed malt increases the abundance of butyrate-producing bacteria in the intestine of rats, leading to higher butyrate levels (11). In addition, different processing methods such as frying and boiling can alter food components that influence the structure of gut microbiota (12). Therefore, it is important to analyze the effects of food components alterations derived from various processing methods on the regulation of gut microbiota, which will contribute to exploring the effect of processing on the nutritional value and safety of foods from an intestinal micro-ecology perspective. Studies in the intestinal micro-ecology have shown that there are significant differences in the gut microbiota formed by various sources of dietary protein and lipid (13,14). The nitrogen of gut microbiota mainly originates from residual dietary proteins, and the amino acid composition in the diet is one of the key factors to alter the gut microbiota (13). The percentage of nine amino acids in preserved duck egg is higher than that of fresh duck eggs (15). Similarly, many studies have confirmed that dietary fatty acids can
1389-1723/$ e see front matter Ó 2020, The Society for Biotechnology, Japan. All rights reserved. https://doi.org/10.1016/j.jbiosc.2020.02.015
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
2
MENG ET AL.
J. BIOSCI. BIOENG.,
directly or indirectly affect the intestinal micro-ecology and change the proportion and composition of gut microbiota in the body. Polyunsaturated fatty acids (PUFAs), especially omega-3 PUFAs, can regulate the gut microbiota, affecting the physiological properties of intestinal epithelial cells (16). Also, a diet rich in saturated fatty acid resulted in a significant reduction in the abundance of Bacteroidetes (17). During processing into preserved eggs, unsaturated fatty acids decreased, while saturated fatty acids (SFAs) increased (4). Changes of these dietary components will influence the function and structure of gut microbiota, thereby altering the host’s metabolic status and metabolites accumulation (18e20). As a relatively rare alkaline-pickling food, the formation of specific components after processing into preserved eggs may cause changes in the intestinal micro-ecology that have not yet been revealed. It has been confirmed that preserved egg white digestion products can down-regulate TNF-a-induced expression, including TNF-a, IL-6, IL-1b and interferon gamma involved in inflammation, and up-regulate the anti-inflammatory cytokines, such as IL-10 (3,21). The results prove that these digestion products have an inhibitory effect on DSS-induced colitis in mice. In addition, preserved eggs have a positive influence on lipid-lowering and anticancer (22), but the mechanism has not yet been fully clarified. In the current study, matrix-assisted laser desorption ionizationtime-of-flight/ time-of-flight (MALDI-TOF/TOF) was used to identify the differences of peptides in preserved duck egg (PE) and fresh duck egg (DE) digestion products, high throughput sequencing technology together with Gas Chromatography-Mass Spectrometry were used to investigate the effect of preserved egg intake on gut microbiota and its metabolites, in order to provide new insight for elucidating the nutritional value and safety of pickled preserved eggs.
MATERIALS AND METHODS In vitro digestion assay The methods were based on our previous protocol with modifications (23). Fresh and preserved duck eggs were obtained from the Shendi Agriculture Branch Trade (Hubei, China) and then freeze-dried and stored at 20 C until used. The nutritive composition of the fresh and preserved egg is indicated in Table S1. PE (1 g) and DE (1 g) powder were weighed separately, and 20 mL of PBS (50 mM, pH 7.2) was added to prepare a 5% suspension. The pH of the suspension was adjusted to 2.0 with 1 mol/L HCl, then 0.4 g pepsin from porcine gastric mucosa (enzyme:substrate ratio ¼ 0.4, P7125) was added, and the reaction was shaken at 37 C for 2 h. Then, the suspension was adjusted to pH 7.5 with 1 mol/L NaOH, 0.5 g pancreatin from porcine pancreas (enzyme:substrate ratio ¼ 0.5, P1750) was added, and the reaction was shaken at 37 C for 2 h. The enzyme digestion reaction was terminated by heating in a 95 C water bath for 5 min. The digestion product was centrifuged at 8000 rpm for 10 min at 4 C, and the supernatant was separated. Peptide mass fingerprinting of in vitro digested products The supernatant of the in vitro digestion product was analyzed using MALDI-TOF/TOF to obtain the peptide mass fingerprint under the following conditions: 355 nm of UV wavelength, 20,000 V of accelerating voltage, 1500 Da of optimal mass resolution, and 200 HZ of repetition rate. Scanning mass-to-charge ratio (m/z) ranges from 59 to 8000. Animals and diets All the experimental protocols were performed in accordance with the National Guidelines for Experimental Animal Welfare and were approved by the Ethical Committee of Experimental Animal Center of Huazhong Agricultural University. Twenty-four male SpragueeDawley rats (110e130 g) were housed in specific pathogen-free quarters in Animal Center of Huazhong Agricultural University (HZAURA-2018-006). The rats were kept in a controlled environment (room temperature 22e24 C, room humidity 40%e60%; 12 h lightedark cycle), free access to food and water. After 1-week acclimatization, all rats were assigned randomly to one of two groups and fed one of the two formulated diets with 1/fresh or 2/preserved duck eggs. Rats were housed in plastic cages in-group of four rats. Fresh and preserved duck eggs were obtained from the Jiu Feng Shan farm (Hubei, China). The eggs were cleaned and cooked in boiling water for 15 min. Fresh and preserved eggs were stripped of shell and membranes, egg whites and yolks were crushed, and then evenly mixed. Animal diets were prepared to content the
TABLE 1. The primers of the certain bacterium for qPCR. Primer sequence (50 ->30 )
Bacterium Prevotella species Ruminococcaceae bacterium
Lactobacillus species Allobaculum species
F: CACCAAGGCGACGATCA R: GGATAACGCCCGGACCT F: CAGCGAATTTGCAAGAGATTGCGAAGTG R: CTGCAATCTGAACTGAGATCGC TTTTGGG F: TTCGCAAGAATGAAACTCAAAG R: AAGGAAAGATCCGGTTAAGGATC F: TTAAGGCAGGGTCTAGGGAATC R: CTAAACGGGTGCGTGACTTATT
nutritional needs of growing rats. Fresh and preserved eggs were added on the basis of AIN-93, with 15 g duck eggs or preserved eggs per 100 g feed. The rat diet composition is indicated in Table S2. Animal treatments lasted for 8 weeks. When collecting fecal samples at the 8week period, the rats were caged individually in the metabolic cages. Fecal samples collected from 20 rats (10 rats per group) were placed separately in cryo tubes and stored at 80 C. 16S rRNA gene-based analysis The method was based on Zhu et al. (9) with modifications. Microbial DNA was extracted by QIAamp DNA Stool Mini Kit (Qiagen, Doncaster, Australia) from rat fecal samples. After genomic DNA extraction, the extracted genomic DNA was detected by 1% agarose gel electrophoresis. Amplification of V3eV4 hypervariable region of bacterial 16S rRNA gene using universal primers 338F (50 -ACTCCTACGGGAGGCAGCAG-30 ) and 806R (50 GGACTACHVGGGTWTCTAAT-30 ). PCR reaction conditions were as follows: denaturation at 95 C for 3.5 min, annealing at 55 C for 30 s, extended at 72 C for 45 s, a total 27 cycles, and finally extended at 72 C for 10 min. The PCR reaction system has a total of 20 mL, including mixture containing 4 mL of 5 FastPfu Buffer, 0.8 mL primers (5 mM), 2 mL of 2.5 mM dNTPs, 0.4 mL of FastPfu Polymerase, 0.2 mL of BSA and 10 ng of template DNA for three replications. PCR products were detected by 2% agarose gel electrophoresis, and recovered using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). Referring to the preliminary quantitative results of electrophoresis, the PCR products were quantified by QuantiFluor-ST (Promega, Madison, WI, USA), and then mixed according to the sequencing amount of each sample. According to Major Bio-Pharm Technology Co. Ltd. (Shanghai, China) standard protocols, the purified amplicons were combined on an Illumina Miseq platform (Illumina, San Diego, CA, USA) with equimolar ratios for sequencing (2 300). Real-time quantitative PCR In view of the above results of the 16S rRNA gene sequence, gene primers were designed for further study (Table 1). quantitative PCR (qPCR) was performed with QuantStudio 6 Flex (Applied Biosystems, Foster City, CA, USA). Each PCR was performed in a final volume of 10 mL comprising SYBR Green master mixture, primers, and template DNA. The following thermal cycling parameters were used to amplify the DNA: reacting at 95 C for 10 min, then initial denaturation at 95 C for 30 s and 30 s of annealing at 60 C for 40 cycles. Quantitative analysis was performed by using a standard curve prepared from plasmid DNA of known concentration including corresponding amplification for each primer. qPCR was run in triplicate for each sample. Detection of SCFAs by gas chromatography-mass spectrometry Quantitative analysis of SCFAs was performed using an Agilent 6890N gas chromatography in conjunction with an Agilent 5975B mass spectrometric detector (Agilent Technologies, Santa Clara, CA, USA) (23). Briefly, w0.1 g of fecal sample was added in a screw capped tube with 100 mL isohexanoic acid and 400 mL ether. The mixture was centrifuged at 12,000 g at 4 C for 10 min. The concentrations of the SCFAs were performed with HP-INNOWAX capillary column (30 m 0.25 mm i.d., 0.25 mm film thickness, Agilent). The front inlet temperature, ion source temperature, transfer line temperature, and quadrupole temperature were set as 250, 230, 250 and 150 C, respectively. The programmed temperature was 90 C, then ramped to 120 C at 10 C/min, then ramped to 150 C at 5 C/min, finally ramped to 250 C at 25 C/min and held for 2 min. The carrier gas was helium and the carrier gas flow rate were 1 mL/min. Statistical analysis All values are presented as the mean standard error of mean. Statistical significances between groups were evaluated by one-way ANOVA using SPSS 16.0 (SPSS Inc., Chicago, IL, USA). Correlations between parameters assessed by Pearson correlation test. P < 0.05 was defined as a significant difference.
RESULTS Peptide profiling of PE and DE digested products The composition of the peptides in DE and PE digested products were analyzed by MALDI-TOF/TOF (Fig. 1). Most of the DE and PE digested peptides were distributed in the region of 59 < m/z <
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx
PRESERVED EGG ALTERS GUT MICROBIOTA
3
FIG. 1. Peptide mass fingerprinting of digestive products of PE and DE. (A) PE; (B) DE.
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
4
MENG ET AL.
J. BIOSCI. BIOENG.,
FIG. 2. Overall structural changes of gut microbiota in response to DE and PE. (A) Comparison of alpha diversity accessed by Shannon and Simpson indexes; (B) principal component analysis of gut microbiota based on OTU relative abundance. Each point represents one animal.
3228.6. The major variation of the distribution of peptides in the range of m/z < 1663.8 indicated that the number of small molecule peptides in digested products for PE was less than that of DE group. Overall structural changes of gut microbiota in response to preserved egg diet compared to that of duck egg diet Using 16S rRNA sequencing, 838,729 valid raw reads were obtained from the 20 fecal samples. The vast majority of the sequence lengths in the samples were scattered in 421w460 bp. Operational taxonomic units (OTUs) were delineated at a 97% similarity level. The total number of OTU was 15,646, with an average of 782 88 per sample. Changes of gut microbial community diversity after DE and PE treatment were assessed
using Shannon and Simpson indices. In this study, a decrease in Simpson index and increase in Shannon index were observed in the PE group, suggesting higher microbiota diversity (Fig. 2A). At the OTU level, beta-diversity analyses were carried out to compare the community composition of the gut microbiota. Principal component analysis (PCA) reflected intra- and intergroup differences of gut microbiota (Fig. 2B). PC1, which expressed 30.97% of total variance, indicated that the gut microbial community structure was modified by PE diet. The gut microbiota of the rats fed with DE showed a higher intra-group variation than those fed with PE, suggesting a dietary modulation of gut microflora with variations in food components caused by the pickling process.
FIG. 3. Effect of experimental diets on relative abundance of microbiota at the phylum level. (A), relative abundance of fecal microbiota on the phylum in response to DE and PE; (B), the relative abundances of Firmicutes, Bacteroidetes, and the ratio of Firmicutes to Bacteroidetes.
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx
PRESERVED EGG ALTERS GUT MICROBIOTA
5
FIG. 4. Effect of experimental diets on relative abundance of microbiota at the genus level. (A), bacterial taxonomic profiling at the genus level. Each column represents one animal; (B), comparative analysis of 10 significant different and most abundant bacteria at the genus level. *p < 0.05, **p < 0.01, ***p < 0.001.
Gut microbiota in phylum and genus levels The most abundant phylum found in the feces of rats was Firmicutes (54.78%), followed by Bacteroidetes (41.07%) and Proteobacteria (2.47%). No significant difference was found between DE and PE fed group at the phylum level. The total relative abundance of Firmicutes and Bacteroidetes accounted for more than 95% in both groups (Fig. 3A). Even so, a higher Bacteroidetes abundance, as well as a lower Firmicutes abundance, were found in the feces of PE-fed rats compared with those of DE-fed rats, which caused a decrease in the ratio of Firmicutes to Bacteroidetes in PE group (Fig. 3B). At the genus level, the abundance of gut bacteria is shown in Fig. 4A. Bacteroidales S24-7 group (26.06%), Ruminococcaceae UCG005 (12.57%), Allobaculum (5.78%), Prevotella (5.20%) and Lactobacillus (4.20%) were the five most abundant bacteria in the DE group, while Bacteroidales S24-7 group (28.00%), Prevotella (9.73%), Lachnospiraceae NK4A136 group (5.03%), Ruminococcaceae UCG005 (4.87%) and Ruminococcus (4.05%) were the five most abundant in the PE group. After supplementation with PE, a significant decrease in relative abundances of Ruminococcaceae UCG-005, Allobaculum, Christensenellaceae R-7 group, and unclassified Clostridiales, as well as a significant increase in relative abundances of Eubacterium ruminantium group, Eubacterium xylanophilum
group, Ruminococcaceae UCG-009, Eubacterium ventriosum group, and Tyzzerella were detected compared with the DE group (Fig. 4B). Furthermore, the major different bacteria between DE and PE samples were quantitatively analyzed by qPCR. The quantity of Prevotella in PE group was over 100-fold higher when compared with DE group (p < 0.05) (Fig. 5). Consistent with our sequencing results, PE group demonstrated a significant decrease in the quantity of Ruminococcaceae compared with DE group as control (p < 0.05). Meanwhile, no statistical difference (p > 0.05) of Allobaculum and Lactobacillus was detected between PE and DE groups.
Shared and unique gut microbial populations A Venn diagram was used for demonstrating the shared and unique OTUs between PE and DE group (Fig. 6A). With the threshold of 97% identity, a total of 902 OTUs were detected in all samples, more than 85% OTUs shared between DE and PE groups. The number of unique OTUs was higher in the PE group (63 OTUs) than the DE group (46 OTUs). As for genus level, Lactococcus, no rank VadinBE97, no rank Flavobacteriaceae, Anaerostipes and Eubacterium hallii group were only in DE group, while Veillonella, Phascolarcto bacterium, Alpinimonas, Coprococcus 3, Coprococcus 2,
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
6
MENG ET AL.
J. BIOSCI. BIOENG.,
FIG. 5. Quantity of different phylotypes in PE and DE rats measured by qPCR. PE group displayed a higher abundance of Prevotella while Ruminococcaceae, Allobaculum and Lactobacillus were decreased in PE group compared with DE control. *p < 0.05.
Gelria and unclassified Methylocystaceae were only found in PE group (Fig. 6B). SCFAs in fecal contents Seven major SCFAs, including acetic acid, propionic acid, isobutyric acid, butyrate acid, isovaleric acid, valeric acid, and caproic acid were detected quantitatively for further comparison between DE and PE groups. Acetic acid, as one of the major energy substances produced by gut bacteria, had higher abundance (p < 0.01) in PE group than the DE group (Fig. 7). The contents of total SCFAs and propionic acid were also significantly higher in PE group (p < 0.05). Nevertheless, only a small amount of isobutyric acid, butyrate acid, isovaleric acid, valeric acid, and caproic acid was detected and no significant variation (p > 0.05) was found between DE and PE groups (data not shown). DISCUSSION Preserved egg is a delicacy used in many dishes and even as traditional a remedy, but its nutritional value and safety are still controversial. Preserved eggs have previously been shown to have
anti-inflammatory activity (3). The current research was designed to assess the impact of a preserved duck egg diet on gut bacteria in rats, using fresh duck egg diet as control. To the best of our knowledge, a high-throughput sequencing technique has rarely been used to reveal the effects of processed foods on gut microbiota. The exposed internal hydrophobic groups of the partially unfolded proteins are more readily digestible as the pepsin cleavage sites are mainly hydrophobic amino acids (24). In the current study, lower numbers of small peptides were found in the PE digested products. This may due to the damage of the exposed internal hydrophobic groups by high concentrations of OH- during the alkali treatment (25), which made the hydrophobic amino acids difficult to be recognized and degraded by pepsin. Accordingly, it might lead to more undigested high-molecular-weight polypeptides (m/z > 1663.8) in PE group. The small peptides consisting of 2e6 amino acids could be absorbed by the small intestine (26), while the undigested polypeptides with large molecular weight could be further utilized in the large intestine. The small peptides which were absorbed in the intestine may improve the metabolism and inflammation directly (27), without the gut mediated
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx
PRESERVED EGG ALTERS GUT MICROBIOTA
7
FIG. 6. Venn diagram displays number of unique and shared OTUs (A) and genus (B) among two groups of rats after 8 weeks. Size of each list shows the number of all OTUs and genus in each group.
metabolic regulation. Thus, the difference of the peptides distribution in digested products might lead to one of the major variations of the colonic substrate between DE and PE diet. It has been reported that undigested proteins and amino acids in the colon could serve, in addition to nondigestible carbohydrate, as an additional substrate for SCFA production (28), which explains the increase in fecal SCFA levels in the PE diet group. Lower gut microbiota diversity has been suggested to be involved with various metabolic and immune disorders (29). For instance, the alpha diversity analysis showed that the gut microbiota diversity was negatively related to obesity (30). In this study, a higher diversity in gut microbiota composition was revealed in PE group based on PCA analysis, suggesting a potential preventive effect of PE on metabolic disorders by regulating gut microbiota community. A decrease in Firmicutes and an increase in Bacteroidetes in the PE group resulted in a lower ratio of F/B, which was usually represented in lean individuals (31,32). Extensive research has proved that the F/B ratio is closely related to obesity (33,34). Furthermore, higher ratio of F/B can enhance energy harvest, which is considered to be correlated with obesity (35). In this study, the data showed a limited decrease of F/B ratio in PE group. This may
FIG. 7. Effect of dietary DE and PE on fecal SCFA concentrations of rats after 8 weeks. Each bar was composed of the means and the standard deviations. *p < 0.05, **p < 0.01.
have two possibilities: dietary intervention may need a longer period of time, and/or the decisive peptides (or amino acids) and fatty acids content which could influence the F/B ratio were relatively similar between PE and DE (1,3). This may indicate that the variation derived from food processing, specifically pickling in this study, may have a limited effect on gut bacteria. The modulation of gut bacteria is more likely to be affected by the different sources of proteins and lipids. Prevotella is as a producer of succinate, which acts as a substrate for intestinal gluconeogenesis and improves glucose metabolism (36). Prevotella is believed to prevent the Bacteroidesinduced glucose tolerance by promoting increased liver glycogen storage (36), which might have potential use in diabetes therapies (37). Moreover, the presence of Prevotella was negatively associated with obesity (38). In this study, the relative abundance of Prevotella was significantly higher in PE group (p < 0.05), which indicates a possible positive health effect brought about by PE diet. In contrast, intestinal types rich in Prevotella may be positively correlated with a high risk of irritable bowel syndrome with diarrhea (IBS-D). Prevotella in feces of IBS-D patients was more abundant than in healthy controls (39). Meanwhile, Prevotella has been associated with proinflammatory function. Prevotella contains enzymes that promote the mucin degradation, which may result in the increased intestinal permeability (40). The effect of dietary modulation of gut microbiota depends on a synergy among gut bacteria. Apart from the potential proinflammatory function induced by Prevotella, secreted succinate may be utilized as the sole carbon source of Phascolarctobacterium (41), which has been identified as an anti-inflammatory butyrate producer (42). In addition, the predominance of Phascolarctobacterium, which was specifically found in PE group, might also be induced by the increase of intestinal pH caused by the undigested PE components (43). PE diet also lead to a significantly lower population of Ruminococcaceae compared with DE diet (p < 0.01). The Ruminococcaceae family is one of the major mucosa-associated microbiota (44). Numerous studies pointed out that such strains were present at reduced levels in patients with inflammatory bowel disease (45e47). A trace amount of heavy metals, such as Cu, which was incorporated during PE processing (2), might be responsible for the
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
8
MENG ET AL.
decrease of the Ruminococcaceae ratio. Another down-modulated bacteria in PE group was Allobaculum, which was also proposed to be inhibited by Cu (48). SCFAs were suggested to be involved in regulating certain physiological responses, including intestinal permeability, lipid metabolism, and immune system function (11,49,50). In the present study, the amount of acetic (p < 0.01) and propionic acid (p < 0.05) increased significantly in the PE group. Acetate was identified as the net fermentation product of most intestinal anaerobic bacteria and generally ranked highest in percentage among all SCFAs in the intestinal lumen (51). Acetate was shown to be effective in inducing the secretion of glucagon-like peptide-1, which is a gut-derived metabolite that reduces food intake (52) and prevents dietinduced obesity (53,54). Propionate was also recommended for its potential health benefits including anti-obesity, anti-inflammation and anti-cancer effects (55,56). As propionate was produced primarily through the pathway of aspartate acid, threonine, alanine and methionine (57e59), the increase of fecal propionate in PE group might be due to the relatively higher abundance of free amino acids in PE digested products (3). Based on the analysis of the characteristics for altered intestinal microbiota in PE group, it could be speculated that the increase of fecal SCFAs levels was associated with the upregulation of certain SCFAs producers. For example, Prevotella and Coprococcus were producers of acetate and propionate, respectively (60,61). Coprococcus was only detected in PE group, from which Prevotella also significantly increased. Moreover, Vanegas et al. (62) confirmed that Lachnospira was positively correlated with fecal acetate and butyrate. The formation of propionic acid and propanol from deoxysugar rhamnose and fucose respectively through the propylene glycol pathway has been confirmed in the dominant intestinal symbiotic bacteria belonging to the Lachnospiraceae (63,64). From our results, Lachnospira and Lachnospiraceae were also more abundant in the PE group. Other than energy sources, SCFAs also act as anti-inflammatory mediators against human gastrointestinal and inflammatory disorders (49). According to the results from similar studies (11,56), it could be hypothesized that the higher SCFAs level in PE group might contribute to its anti-inflammatory effect. In conclusion, this work has provided novel information regarding the modulation of gut microbiota influenced by preserved duck egg diet. Due to the alteration of egg components induced by alkaline processing, certain fecal bacteria and the corresponding SCFAs levels increased quantitatively, indicating potential anti-obesity and anti-inflammatory effects. Some specific SCFA-producers were identified with a significant increase in PE group (p < 0.05), even though no significant difference was found in the phylum level of gut microbiota between PE and DE group, which may be the bioactive peptides in PE group were already absorbed in small intestine and causing improvements in inflammation. These results provided new insight into the relationship between preserved egg diet and host health from the perspective of gut microbiota modulations. In addition to the potential nutritional and functional benefits, there may be disadvantages to consuming preserved eggs. For example, the decline of specific bacteria resulting in potential intestinal-related diseases might be affected by the residual heavy metals in PE, more research is required on this issue. Still, more efforts need to be paid in revealing the beneficial PE components with anti-inflammatory effect through modulating the gut microbiota. Supplementary data to this article can be found online at https://doi.org/10.1016/j.jbiosc.2020.02.015.
J. BIOSCI. BIOENG., ACKNOWLEDGMENTS This work was financially supported by the Chinese National Natural Science Foundation of China (Grant No. 31772043), Fundamental Research Funds for the Central Universities (Program No. 2662018JC021 & Project No. 2019BC008). The authors declare that there are no conflicts of interest.
References 1. Zhao, Y., Tu, Y., Xu, M., Li, J., and Du, H.: Physicochemical and nutritional characteristics of preserved duck egg white, Poult. Sci., 93, 3130e3137 (2014). 2. Tu, Y. G., Zhao, Y., Xu, M. S., Li, X., and Du, H. Y.: Simultaneous determination of 20 inorganic elements in preserved egg prepared with different metal ions by ICP-AES, Food Anal. Method, 6, 667e676 (2013). 3. Zhao, Y., Yao, Y., Xu, M., Wang, S., Wang, X., and Tu, Y.: Simulated gastrointestinal digest from preserved egg white exerts anti-inflammatory effects on Caco-2 cells and a mouse model of DSS-induced colitis, J. Funct. Food, 35, 655e665 (2017). 4. Zhao, Y., Tu, Y. G., Deng, W. H., and Li, J. K.: Changes of fatty acids during the processing of preserved eggs, Food Sci. (N.Y.), 35, 69e72 (2014). 5. Turnbaugh, P. J., Ley, R. E., Hamady, M., Fraser-Liggett, C. M., Knight, R., and Gordon, J. I.: The human microbiome project, Nature, 449, 804e810 (2007). 6. Rist, V. T. S., Weiss, E., Eklund, M., and Mosenthin, R.: Impact of dietary protein on microbiota composition and activity in the gastrointestinal tract of piglets in relation to gut health: a review, Animal, 7, 1067e1078 (2013). 7. Requena, T., Martinez-Cuesta, M. C., and Pelaez, C.: Diet and microbiota linked in health and disease, Food Funct, 9, 688e704 (2018). 8. Smits, S. A., Leach, J., Sonnenburg, E. D., Gonzalez, C. G., Lichtman, J. S., Reid, G., Knight, R., Manjurano, A., Changalucha, J., Elias, J. E., DominguezBello, M. G., and Sonnenburg, J. L.: Seasonal cycling in the gut microbiome of the Hadza hunter-gatherers of Tanzania, Science, 357, 802e806 (2017). 9. Zhu, Y., Lin, X., Zhao, F., Shi, X., Li, H., Li, Y., Zhu, W., Xu, X., Li, C., and Zhou, G.: Meat, dairy and plant proteins alter bacterial composition of rat gut bacteria, Sci. Rep., 5, 15220e15233 (2015). 10. Zhang, C. H., Zhang, M. H., Pang, X. Y., Zhao, Y. F., Wang, L. H., and Zhao, L. P.: Structural resilience of the gut microbiota in adult mice under high-fat dietary perturbations, ISME J., 6, 1848e1857 (2012). 11. Zhong, Y. D., Nyman, M., and Fak, F.: Modulation of gut microbiota in rats fed high-fat diets by processing whole-grain barley to barley malt, Mol. Nutr. Food Res., 59, 2066e2076 (2015). 12. Shen, Q., Chen, Y. A., and Tuohy, K. M.: A comparative in vitro investigation into the effects of cooked meats on the human faecal microbiota, Anaerobe, 16, 572e577 (2010). 13. Zhu, Y., Shi, X., Lin, X., Ye, K., Xu, X., Li, C., and Zhou, G.: Beef, chicken, and soy proteins in diets induce different gut microbiota and metabolites in rats, Front. Microbiol., 8, 1395e1406 (2017). 14. Tuohy, K. M., Hinton, D. J. S., Davies, S. J., Crabbe, M. J. C., Gibson, G. R., and Ames, J. M.: Metabolism of maillard reaction products by the human gut microbiota e implications for health, Mol. Nutr. Food Res., 50, 847e857 (2006). 15. Zhang, R. Z., Liu, S. T., Lin, X. H., Gao, W. H., and Rao, P. F.: Study on protein changes during processing of preserved eggs, Fujian Agric. Sci.Technol., S1, 69e70 (1998). 16. Li, H., Zhu, Y., Zhao, F., Song, S., Li, Y., Xu, X., Zhou, G., and Li, C.: Fish oil, lard and soybean oil differentially shape gut microbiota of middle-aged rats, Sci. Rep., 7, 826e837 (2017). 17. Liu, T. Y., Hougen, H., Vollmer, A. C., and Hiebert, S. M.: Gut bacteria profiles of Mus musculus at the phylum and family levels are influenced by saturation of dietary fatty acids, Anaerobe, 18, 331e337 (2012). 18. Xie, H. L., Guo, R. J., Zhong, H. Z., Feng, Q., Lan, Z., Qin, B. C., Ward, K. J., Jackson, M. A., Xia, Y., Chen, X., and other 15 authors: Shotgun metagenomics of 250 adult twins reveals genetic and environmental impacts on the gut microbiome, Cell Syst., 3, 572e584 (2016). 19. Goodrich, J. K., Davenport, E. R., Waters, J. L., Clark, A. G., and Ley, R. E.: Cross-species comparisons of host genetic associations with the microbiome, Science, 352, 532e535 (2016). 20. Carmody, R. N., Gerber, G. K., Luevano, J. M., Gatti, D. M., Somes, L., Svenson, K. L., and Turnbaugh, P. J.: Diet dominates host genotype in shaping the murine gut microbiota, Cell Host Microbe, 17, 72e84 (2015). 21. Zhang, M., Zhao, Y., Wu, N., Yao, Y., Xu, M., Du, H., and Tu, Y.: The antiinflammatory activity of peptides from simulated gastrointestinal digestion of preserved egg white in DSS-induced mouse colitis, Food Funct., 13, 6444e6454 (2018).
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015
VOL. xxx, xxxx 22. Mao, C. Y., Yu, Z. H., Li, C. L., Jin, Y. G., and Ma, M. H.: The functional properties of preserved eggs: from anti-cancer and anti-inflammatory aspects, Korean J. Food Sci. Anim. Resour., 38, 615e628 (2018). 23. Wang, X. F., Qiu, N., and Liu, Y. P.: Effect of different heat treatments on in vitro digestion of egg white proteins and identification of bioactive peptides in digested products, J. Food Sci., 4, 1140e1148 (2018). 24. Keil, B.: Essential substrate residues for action of endopeptidases. Springer, Berlin, Heidelberg (1992). 25. Zhao, Y., Chen, Z., Li, J., Xu, M., Shao, Y., and Tu, Y.: Changes of microstructure characteristics and intermolecular interactions of preserved egg white gel during pickling, Food Chem., 203, 323e330 (2016). 26. Grimble, G. K. and Silk, D. B. A.: Peptides in human nutrition, Nutr. Res. Rev., 2, 87e108 (1989). 27. Requena, T., Miguel, M., Garcés-Rimón, M., Martínez-Cuesta, M. C., and Peláez, C.: Pepsin egg white hydrolysate modulates gut microbiota in Zucker obese rats, Food Funct., 8, 437e443 (2017). 28. Nordgaard, I., Mortensen, P. B., and Langkilde, A. M.: Small intestinal malabsorption and colonic fermentation of resistant starch and resistant peptides to short-chain fatty acids, Nutrition, 11, 129e137 (1995). 29. Dore, J. and Blottiere, H.: The influence of diet on the gut microbiota and its consequences for health, Curr. Opin. Biotechnol., 32, 195e199 (2015). 30. Beaumont, M., Goodrich, J. K., Jackson, M. A., Yet, I., Davenport, E. R., VieiraSilva, S., Debelius, J., Pallister, T., Mangino, M., Raes, J., and other 5 authors: Heritable components of the human fecal microbiome are associated with visceral fat, Genome Biol., 17, 189 (2016). 31. Ley, R. E., Turnbaugh, P. J., Klein, S., and Gordon, J. I.: Microbial ecology human gut microbes associated with obesity, Nature, 444, 1022e1023 (2006). 32. Ley, R. E., Backhed, F., Turnbaugh, P., Lozupone, C. A., Knight, R. D., and Gordon, J. I.: Obesity alters gut microbial ecology, Proc. Natl. Acad. Sci. USA, 102, 11070e11075 (2005). 33. Jumpertz, R., Le, D. S., Turnbaugh, P. J., Trinidad, C., Bogardus, C., Gordon, J. I., and Krakoff, J.: Energy-balance studies reveal associations between gut microbes, caloric load, and nutrient absorption in humans, Am. J. Clin. Nutr., 94, 58e65 (2011). 34. Chang, C. J., Lin, C. S., Lu, C. C., Martel, J., Ko, Y. F., Ojcius, D. M., Tseng, S. F., Wu, T. R., Chen, Y. Y. M., Young, J. D., and Lai, H. C.: Ganoderma lucidum reduces obesity in mice by modulating the composition of the gut microbiota, Nat. Commun., 6, 7489e7505 (2015). 35. Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L., Duncan, A., Ley, R. E., Sogin, M. L., Jones, W. J., Roe, B. A., Affourtit, J. P., and other 5 authors: A core gut microbiome in obese and lean twins, Nature, 457, 480e487 (2009). 36. Kovatcheva-Datchary, P., Nilsson, A., Akrami, R., Lee, Y. S., De Vadder, F., Arora, T., Hallen, A., Martens, E., Bjorck, I., and Backhed, F.: Dietary fiberinduced improvement in glucose metabolism is associated with increased abundance of Prevotella, Cell Metabol., 22, 971e982 (2015). 37. De Vadder, F., Kovatcheva-Datchary, P., Zitoun, C., Duchampt, A., Backhed, F., and Mithieux, G.: Microbiota-produced succinate improves glucose homeostasis via intestinal gluconeogenesis, Cell Metabol., 24, 151e157 (2016). 38. Santacruz, A., Collado, M. C., Garcia-Valdes, L., Segura, M. T., MartinLagos, J. A., Anjos, T., Marti-Romero, M., Lopez, R. M., Florido, J., Campoy, C., and Sanz, Y.: Gut microbiota composition is associated with body weight, weight gain and biochemical parameters in pregnant women, Br. J. Nutr., 104, 83e92 (2010). 39. Su, T. T., Liu, R. B., Lee, A., Long, Y. Q., Du, L. J., Lai, S. C., Chen, X. Q., Wang, L., Si, J. M., Owyang, C., and Chen, S. J.: Altered intestinal microbiota with increased abundance of prevotella is associated with high risk of diarrheapredominant irritable bowel syndrome, Gastroenterol. Res. Pract., 6961783 (2018). 40. Staudacher, H. M., Irving, P. M., Lomer, M. C. E., and Whelan, K.: Mechanisms and efficacy of dietary FODMAP restriction in IBS, Nat. Rev. Gastroenterol. Hepatol., 11, 256e266 (2014). 41. Zhang, J., Zheng, Y., Guo, Z., Qiao, J., Gesudu, Q., Sun, Z., Huo, D., Huang, W., Hou, Q., Kwok, L., and Zhang, H.: The diversity of intestinal microbiota of Mongolians living in Inner Mongolia, China, Benefit Mirbobes, 4, 319e328 (2013). 42. Louis, P. and Flint, H. J.: Diversity, metabolism and microbial ecology of butyrate-producing bacteria from the human large intestine, FEMS Microbiol. Lett., 294, 1e8 (2009). 43. Zhao, Y. G., Li, X. W., Wang, J. C., Bai, J., and Tian, W. J.: Performance of a sulfidogenic bioreactor and bacterial community shifts under different alkalinity levels, Bioresour. Technol., 101, 9190e9196 (2010). 44. Nava, G. M. and Stappenbeck, T. S.: Diversity of the autochthonous colonic microbiota, Gut Microbes, 2, 99e104 (2011).
PRESERVED EGG ALTERS GUT MICROBIOTA
9
45. Willing, B. P., Dicksved, J., Halfvarson, J., Andersson, A. F., Lucio, M., Zheng, Z., Jarnerot, G., Tysk, C., Jansson, J. K., and Engstrand, L.: A pyrosequencing study in twins shows that gastrointestinal microbial profiles vary with inflammatory bowel disease phenotypes, Gastroenterology, 139, 1844e1854 (2010). 46. Schubert, A. M., Sinani, H., and Schloss, P. D.: Antibiotic-induced alterations of the murine gut microbiota and subsequent effects on colonization resistance against clostridium difficile, mBio, 6, e00974 (2015). 47. Jiang, W. W., Wu, N., Wang, X. M., Chi, Y. J., Zhang, Y. Y., Qiu, X. Y., Hu, Y., Li, J., and Liu, Y. L.: Dysbiosis gut microbiota associated with inflammation and impaired mucosal immune function in intestine of humans with non-alcoholic fatty liver disease, Sci. Rep., 5, 8096e8102 (2015). 48. Munyaka, P. M., Rabbi, M. F., Khafipour, E., and Ghia, J. E.: Acute dextran sulfate sodium (DSS)-induced colitis promotes gut microbial dysbiosis in mice, J. Basic Microbiol., 56, 986e998 (2016). 49. Fukuda, S., Toh, H., Hase, K., Oshima, K., Nakanishi, Y., Yoshimura, K., Tobe, T., Clarke, J. M., Topping, D. L., Suzuki, T., and other 6 authors: Bifidobacteria can protect from enteropathogenic infection through production of acetate, Nature, 469, 543e547 (2011). 50. Gao, B., Chi, L., Mahbub, R., Bian, X. M., Tu, P. C., Ru, H. Y., and Lu, K.: Multiomits reveals that lead exposure disturbs gut microbiome development, key metabolites, and metabolic pathways, Chem. Res. Toxicol., 30, 996e1005 (2017). 51. Younesi, H., Najafpour, G., and Mohamed, A. R.: Ethanol and acetate production from synthesis gas via fermentation processes using anaerobic bacterium, Clostridium ljungdahlii, Biochem. Eng. J., 27, 110e119 (2005). 52. Frost, G., Sleeth, M. L., Sahuri-Arisoylu, M., Lizarbe, B., Cerdan, S., Brody, L., Anastasovska, J., Ghourab, S., Hankir, M., Zhang, S., and other 7 authors: The short-chain fatty acid acetate reduces appetite via a central homeostatic mechanism, Nat. Commun., 5, 3611e3621 (2014). 53. Lin, H. V., Frassetto, A., Kowalik, E. J., Nawrocki, A. R., Lu, M. F. M., Kosinski, J. R., Hubert, J. A., Szeto, D., Yao, X. R., Forrest, G., and Marsh, D. J.: Butyrate and propionate protect against diet-induced obesity and regulate gut hormones via free fatty acid receptor 3-independent mechanisms, PloS One, 7, e35240 (2012). 54. den Besten, G., Bleeker, A., Gerding, A., van Eunen, K., Havinga, R., van Dijk, T. H., Oosterveer, M. H., Jonker, J. W., Groen, A. K., Reijngoud, D. J., and Bakker, B. M.: Short-chain fatty acids protect against high-fat diet-induced obesity via a PPAR-dependent switch from lipogenesis to fat oxidation, Diabetes, 64, 2398e2408 (2015). 55. Hosseini, E., Grootaert, C., Verstraete, W., and Van de Wiele, T.: Propionate as a health-promoting microbial metabolite in the human gut, Nutr. Rev., 69, 245e258 (2011). 56. Vinolo, M. A. R., Rodrigues, H. G., Nachbar, R. T., and Curi, R.: Regulation of inflammation by short chain fatty acids, Nutrients, 3, 858e876 (2011). 57. Potrykus, J., White, R. L., and Bearne, S. L.: Proteomic investigation of amino acid catabolism in the indigenous gut anaerobe Fusobacterium varium, Proteomics, 8, 2691e2703 (2008). 58. Carbonero, F., Benefiel, A. C., Alizadeh-Ghamsari, A. H., and Gaskins, H. R.: Microbial pathways in colonic sulfur metabolism and links with health and disease, Front. Physiol., 3, 448e458 (2012). 59. Buckel, W.: Unusual enzymes involved in five pathways of glutamate fermentation, Appl. Microbiol. Biotechnol., 57, 263e273 (2001). 60. Xia, X. J., Li, G. N., Ding, Y. B., Ren, T. Y., Zheng, J., and Kan, J. Q.: Effect of whole grain qingke (Tibetan Hordeum vulgare L. Zangqing 320) on the serum lipid levels and intestinal microbiota of rats under high-fat diet, J. Agric. Food Chem., 65, 2686e2693 (2017). 61. Shang, W. T., Si, X., Zhou, Z. K., Li, Y., Strappe, P., and Blanchard, C.: Characterization of fecal fat composition and gut derived fecal microbiota in highfat diet fed rats following intervention with chito-oligosaccharide and resistant starch complexes, Food Funct., 8, 4374e4383 (2017). 62. Vanegas, S. M., Meydani, M., Barnett, J. B., Kane, A., Goldin, B., Wu, D. Y., Karl, J. P., Brown, C., Vangay, P., Knights, D., and other 5 authors: Effect of a diet rich in whole grains on gut microbiota, and immune and inflammatory markers of healthy adults, FASEB J., 30, 635e650 (2016). 63. Scott, K. P., Martin, J. C., Campbell, G., Mayer, C. D., and Flint, H. J.: Wholegenome transcription profiling reveals genes up-regulated by growth on fucose in the human gut bacterium "Roseburia inulinivorans", J. Bacteriol., 188, 4340e4349 (2006). 64. Reichardt, N., Duncan, S. H., Young, P., Belenguer, A., Leitch, C. M., Scott, K. P., Flint, H. J., and Louis, P.: Phylogenetic distribution of three pathways for propionate production within the human gut microbiota, ISME J., 8, 1323e1335 (2014).
Please cite this article as: Meng, Y et al., Modulation of gut microbiota in rats fed whole egg diets by processing duck egg to preserved egg, J. Biosci. Bioeng., https://doi.org/10.1016/j.jbiosc.2020.02.015