Modulation of haemocyte phagocytic and antibacterial activity by alpha-adrenergic receptor in scallop Chlamys farreri

Fish & Shellfish Immunology 35 (2013) 825e832

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Modulation of haemocyte phagocytic and antibacterial activity by alpha-adrenergic receptor in scallop Chlamys farreri Zhi Zhou a, Qiufeng Jiang a, b, Mengqiang Wang a, Feng Yue a, b, Lingling Wang a, *, Leilei Wang a, b, Fengmei Li a, Rui Liu a, Linsheng Song a, * a b

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 January 2013 Received in revised form 14 June 2013 Accepted 14 June 2013 Available online 25 June 2013

The adrenergic receptors are a class of G protein-coupled receptors, through which norepinephrine and epinephrine trigger the second messenger to modulate the immune response in immunocytes of vertebrate. In the present study, a gene coding the homologue of a-adrenergic receptor was identified from scallop Chlamys farreri (designated CfaAR). Its deduced protein comprised 318 amino acids, and contained a conserved 7tm_1 domain. After CfaAR protein was expressed in the HEK293 cells, the stimulation of octopamine, tyramine, epinephrine and isoprenaline (b-adrenergic receptor agonist) did not change significantly the intracellular cAMP concentration, whereas the stimulation of norepinephrine and phenylephrine (a-adrenergic receptor agonist) lowered significantly the cAMP level to 0.52 and 0.84 pmol ml
1 (P < 0.05), respectively. The CfaAR transcripts were ubiquitously detected in the tested tissues including haemocytes, adductor muscle, kidney, hepatopancreas, gill, gonad and mantle, with the highest expression in the gill. The expression level of CfaAR mRNA decreased significantly (0.21-fold, P < 0.05) at 3 h after the challenge of bacteria Vibrio anguillarum. Then, it began to increase (4.74-fold, P < 0.05) at 12 h, and reached the highest level (4.92-fold, P < 0.05) at 24 h after bacteria challenge. The addition of a-adrenergic receptor agonist to the primary scallop haemocytes repressed significantly the increase of phagocytic and antibacterial activity induced by LPS stimulation, while the induction was reverted by the addition of a-adrenergic receptor antagonist. These results collectively suggested that aadrenergic receptor could be regulated dynamically in the transcriptional level during the immune response, and it could modulate the haemocyte phagocytic and antibacterial function through the second messenger cAMP, which might be requisite for pathogen elimination and the homeostasis maintenance in scallop. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: a-Adrenergic receptor Immunomodulation cAMP Haemocyte Scallop

1. Introduction Catecholaminergic neuroendocrine system is one of the most important neuroendocrine system in chordate, which innervates various of physiological functions such as stress response and homeostasis maintenance [1]. The recent available reports evidence that mollusc has also evolved the catecholaminergic neuroendocrine system. For example, catecholamines, pivotal catecholamine metabolism-related enzymes and catecholamine receptors all have been identified in mollusc [2e5], and their constructed

* Corresponding authors. Tel.: þ86 532 82898843, þ86 532 82898552; fax: þ86 532 82898578. E-mail addresses: [email protected] (L. Wang), lshsong@ ms.qdio.ac.cn (L. Song). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.06.020

catecholaminergic neuroendocrine system can be activated by environmental stress and immune response to release catecholamines into the haemolymph [6,7]. Catecholaminergic neuroendocrine system can interact with immune system to modulate immune response and maintain immune homeostasis in chordate [8e11]. When the host suffers from the infection of pathogens, the catecholaminergic neuroendocrine system will be activated by immune cytokines such as TNF-a to release catecholamines into the serum [12,13], and these released catecholamines bind to catecholamine receptor on the surface of immunocytes to modulate the immune response [14,15]. The similar interaction is also adopted as the important immunomodulation strategy in mollusc [16]. For example, the catecholaminergic neuroendocrine system in scallop could be activated by immune response [6], and catecholamines could modulate the cellular and humoral immune response in scallop and oyster

826

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

[17,18]. Furthermore, catecholamine receptor as the mediator is also essential for the immunomodulation of catecholamines, because their regulatory effect could be repressed by the antagonist of corresponding receptors [18,19]. Adrenergic receptor, as a kind of catecholamine receptor, mediates the immunomodulation of norepinephrine and epinephrine in chordate. Adrenergic receptor is the member of G-protein coupled receptors family 1 [20], and is divided into two main groups including a and b. The binding of norepinephrine/ epinephrine to a and b-adrenergic receptors can trigger different intracellular second messengers including Ca2þ and cAMP [21]. It is known that a1 adrenergic receptor couples to Gq protein, resulting in the increase of intracellular Ca2þ level, and a2 adrenergic receptor couples to Gi protein, causing the decrease of intracellular cAMP level. For b adrenergic receptors, it couples to Gs to increase intracellular cAMP level. The adrenergic receptor on the surface of immunocytes can be activated by the binding of norepinephrine or epinephrine, and transmit the regulatory signal into intracellular downstream pathway to achieve immunomodulation in chordate [14]. Moreover, the activation of different adrenergic receptors will result in diverse modulation effect on immune response. The activation of b-adrenergic receptors on the surface of immunocytes usually hampers the immune responses [22,23], whereas the activation of a-adrenergic receptors contributes to the trigger of immune responses [24]. The adrenergic receptor has also been observed to mediate the immunomodulation of norepinephrine in mollusc. For example, norepinephrine has been demonstrated to modulate haemocyte ROS level and phagocytosis via b-adrenergic receptor in oyster Crassostrea gigas [18,19]. Because few genes of adrenergic receptor have been so far identified and characterized, the molecular mechanism of adrenergic immunomodulation are still not well understood in mollusc. The scallop Chlamys farreri is a dioecious bivalve native to the coast of China, Korea and Japan, and contributes weightily to the aquaculture industry of northern China. In recent years, the outbreak of disease has resulted in severe mortality of scallops and threatened the development of scallop industry [25,26]. Investigations of a-adrenergic immunomodulation in the scallop C. farreri will pave a new way to further understand the immune modulation mechanism of mollusc and offer enlightenment to disease control. The purposes of this study were to (1) identify the homologue of a-adrenergic receptor from scallop C. farreri (designated as CfaAR), (2) survey the possible ligand of CfaAR and the possible change of second messenger after the activation of CfaAR, (3) investigate tissue distribution of CfaAR mRNA transcripts, and the temporal expression level of CfaAR mRNA in haemocytes after the challenge of bacteria Vibrio anguillarum, (4) examine the change of haemocyte phagocytic and antibacterial activity after the activation of a-adrenergic receptor to understand of a-adrenergic immunomodulation in scallop. 2. Materials and methods 2.1. Scallops Adult scallops (about 1.5-year old, average shell length 58 mm) were collected from a local farm in Qingdao, Shandong Province, China, and maintained in the aerated seawater at 15  C for two weeks before processing. 2.2. Tissue collection and bacteria challenge Six tissues including hepatopancreas, adductor muscle, kidney, gonad, gill and mantle from six scallops were collected as parallel samples. Haemolymph from these six scallops was also collected

from the adductor muscle and then immediately centrifuged at 800 g, 4  C for 10 min to harvest the haemocytes. All these samples were stored at
80  C after addition of 1 ml TRIzol reagent (Invitrogen) for subsequent RNA extraction. Two hundred and eighty scallops were employed for the bacteria challenge experiment, and divided into control group, challenge group and blank group. One hundred and twenty scallops received an injection of 50 mL phosphate buffered saline (PBS, 0.14 mol L
1 sodium chloride, 3 mmol L
1 potassium chloride, 8 mmol L
1 disodium hydrogen phosphate dodecahydrate, 1.5 mmol L
1 potassium phosphate monobasic, pH 7.4) were employed as control group, while other one hundred and twenty scallops received an injection of 50 mL alive V. anguillarum strain M3 (kindly provided by Prof. Zhaolan Mo, Institute of Oceanology, Chinese Academy of Sciences) suspended in PBS (8  106 CFU ml
1) were employed as challenge group. These treated scallops were returned to water tanks after injection, and fifteen individuals were randomly sampled at 3, 6, 12, 24, 48 and 96 h post-injection. The rest forty untreated scallops were employed as blank group, and fifteen individuals were randomly sampled at 0 h. Haemolymph collected from three individuals were pooled into one sample. There were five replicates for each time points. Then the haemocytes were harvested and stored as described above. 2.3. RNA isolation and cDNA synthesis Total RNA was isolated from the scallop tissues using Trizol reagent (Invitrogen) according to its protocol. The first-strand synthesis was carried out based on Promega M-MLV RT Usage information using the DNase I (Promega)-treated total RNA as template and oligo(dT)-adaptor as primer. The synthesis reaction was performed at 42  C for 1 h, terminated by heating at 95  C for 5 min. The cDNA mix was diluted to 1:100 and stored at
80  C for subsequent SYBR Green fluorescent quantitative real-time PCR. 2.4. Gene cloning and sequence analysis A cDNA library was constructed with the whole body of a scallop challenged by V. anguillarum, and random sequencing of the library using T3 primer yielded 6935 successful sequencing reactions [27]. BLAST analysis of all the EST sequences revealed that one EST (no. DT716202) was homologous to the a-adrenergic receptor identified previously in other animals. The full-length cDNA of CfaAR was cloned from the cDNA library using specific primers (Table 1) and rapid amplification of cDNA ends approach (RACE) [2]. The homology searches of the cDNA sequence and protein sequence of CfaAR were conducted with BLAST algorithm at the National Center for Biotechnology Information (http://www.ncbi. nlm.gov/blast). The deduced amino acid sequence was analyzed with the Expert Protein Analysis System (http://www.expasy.org). The protein domain was predicted with the simple modular architecture research tool (SMART) version 5.1 (http://www.smart. emblheidelberg.de/). Multiple alignment of the CfaAR and other Table 1 Sequence of the primers used in the experiment. Primer

Sequence (50 -30 )

Sequence information

P1 P2 P3 P4 P5 P6 P7 P8

GCTTCGTCATCGAGATCTTCAGCAG CGTTACATTGCCATTGTCAGACCTC AGACTGAACTGTCACGGATGTGTCC CTGCTGAAGATCTCGATGACGAAGC GCCAGAAAGCACATCCGA AATAGCCCACCAATATACTGACTG CAAACAGCAGCCTCCTCGTCAT CTGGGCACCTGAACCTTTCGTT

30 RACE primer 30 RACE primer 50 RACE primer 50 RACE primer Real-time CfaAR primer Real-time CfaAR primer Real-time actin primer Real-time actin primer

(forward) (forward) (reverse) (reverse) (forward) (reverse) (forward) (reverse)

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

a-adrenergic receptor was performed with the ClustalW multiple alignment program (http://www.ebi.ac.uk/clustalw/) and multiple alignment show program (http://www.biosoft.net/sms/index. html). 2.5. Quantitative real-time PCR analysis of CfaAR mRNA expression The quantitative real-time PCR was carried out in a total volume of 25.0 mL, containing 12.5 mL of 2 SYBR Green Master Mix (Applied Biosystems), 2.0 mL of the 100 times diluted cDNA, 0.5 mL of each primers (10 mmol L
1), and 9.5 mL of DEPC-water. A fragment of 118 bp was amplified using two sequence-specific primers (Table 1), and the PCR products were sequenced to verify the PCR specificity. Two b-actin primers (Table 1) were used to amplify a 94 bp fragment as an internal control to verify the successful reverse transcription and calibrate the cDNA template. The SYBR Green real-time PCR assay was carried out in an ABI PRISM 7300 Sequence Detection System (Applied Biosystems) as described by Zhang et al. [28]. All data was given in terms of relative mRNA OOCt method. expression using the 2
2.6. Cell culture, transfection, stimulation and cAMP assay HEK-293 cells were grown in Dulbecco’s modified Eagle’s medium (D-MEM; Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS; Gibco BRL) at 37  C and 5% CO2. The CfaAR gene was inserted into the expression vector pcDNA3.1 (Invitrogen), and the constructed pcDNA3.1-CfaAR plasmid was transfected into HEK-293 cells with Lipofectamine 2000 (Invitrogen). After 48 h, CfaAR-HEK293 cells with transient expression were prepared. For stimulation assay, various biogenic amines (octopamine, tyramine, norepinephrine and epinephrine, 1 mmol L
1), a-adrenergic receptor agonist (phenylephrine, 1 mmol L
1) or b-adrenergic receptor agonist (isoprenaline, 1 mmol L
1) was added into the wells containing CfaAR-HEK293 cells. After the incubation for 20 min, four parallel samples were used in each drug stimulation for subsequently cAMP assay. The HEK293 cells without transfection and CfaAR-HEK293 cells without drug stimulation were employed as the blank and control group, respectively. The concentration of cAMP was measured following the instruction of cAMP Direct Immunoassay Kit (ab65355, Abcam, Cambridge, UK). The cultured CfaAR-HEK293 cells were scraped and lysed completely, following by centrifuging 14,000 g for 10 min. The supernatant was collected as the testing sample. To be ready for quantification, cAMP standards and samples were neutralized and acetylated using the neutralizing buffer and acetylating reagent supplied in the Kit, respectively. During the quantification, 50 mL standard cAMP and testing samples were added to the Protein G coated 96-well plate. After blended with 10 mL cAMP antibody, the suspension incubated for 1 h at room temperature with gentle agitation and for another hour with the adding of 10 mL cAMP-HRP. Then the plate was washed for five times, following by incubation with 100 mL HRP developer for 1 h. The reaction was stopped by 100 mL of 1 mol L
1 HCl and the absorbance was detected by a microtiter plate reader (BioTek, USA) at 600 nm. The molar concentration of cAMP in primary cells was determined from standard curves generated using standard preparation.

827

tetraacetic acid (EDTA) and 22.5 g L
1 NaCl, pH 7.0 and 1000 mOsm) with the ratio of 1:1. After the centrifugation for 10 min at 800 g, the haemocytes were resuspended in modified Leibovitz L-15 medium (supplemented with 20.2 g L
1 NaCl, 0.54 g L
1 KCl, 0.6 g L
1 CaCl2, 1 g L
1 MgSO4, 3.9 g L
1 MgCl2, 20.8 g L
1 glucose, 10% FCS, 100 mg ml
1 penicillin G, 100 mg ml
1 streptomycin, 40 mg ml
1 gentamicin and 0.1 mg ml
1 amphotericin B at pH 7.0 and 1000 mOsm) [30]. The resuspended haemocytes were counted and diluted to a concentration of 8  105 cells ml
1, and then planted into the 24-well plate (500 mL each well). After the culture was kept at 18  C for three days, the adhesive haemocytes were used in the subsequent stimulation experiment. In the stimulation experiment, all haemocytes were divided into four groups. Firstly, the first and latter three groups were added with the same volume of L-15 medium and L-15 medium containing LPS (final concentration of 5.0 mg ml
1), respectively. The first and second groups were employed as the control and LPS group, respectively. After 6 h for LPS stimulation, the third group was added with phenylephrine (Phe, a-adrenergic receptor agonist, the final concentration of 10.0 mmol L
1) as the LPS þ Phe group, while the fourth group was added with prazosin (Phe, a-adrenergic receptor antagonist, the final concentration of 10.0 mmol L
1) for 30 min before the addition of phenylephrine, which was employed as the LPS þ Pra þ Phe group. Haemocytes were then incubated for 20 min, and sampled for the phagocytic and antibacterial assays, in which four and six reduplicate samples were prepared respectively. 2.8. Haemocytes phagocytic assay The determination of phagocytic activity was performed as described by Ciacci and Wootton with slight modification [31,32]. Briefly, 20 mL of neutral red stain (Beyotime) was added into the each well containing haemocytes. After the incubation for 2 h, the supernate containing neutral red stain was pipetted out. Then, the haemocytes were washed twice with PBS, and lysed by 200 mL of cell lysis solution (Beyotime) for 20 min with shaking. Finally, the absorbance of haemocyte lysate was measured at 600 nm. The value of absorbance was used to indicate the phagocytic ability of scallop haemocytes. 2.9. Haemocytes antibacterial assay For the antibacterial assay, the adhesive haemocytes were eluted in each well, and centrifuged at 800 g for 10 min and resuspended into 200 mL PBS. After the lysis by sonication, the haemocyte lysate was centrifuged at 10,000 g, 4  C for 20 min. Then, 50 mL haemocyte lysate and 10 mL of alive V. anguillarum were pipetted into each well of a sterile, flat bottom 96 wells plate and incubated at 18  C for 3 h with shaking, following by the addition of 200 mL of 2216E medium. The plate was incubated at 28  C for 23 h on a plate reader, and the absorbance at 600 nm was measured at intervals of 30 min. 2.10. Statistical analysis All data was given as means  S.D. The data was subjected to one-way analysis of variance (one-way ANOVA) followed by a multiple comparison. Differences were considered significant at P < 0.05.

2.7. Haemocyte culture and stimulation experiment

3. Result

Haemocytes were prepared as described previously by Hughes et al. [29]. Briefly, haemolymph was aspirated by a syringe from the adductor muscle of scallop in ALS (Alseve) buffer (20.8 g L
1 glucose, 8 g L
1 sodium citrate, 3.36 g L
1 ethylene diamine-

3.1. Molecular characteristics of CfaAR gene A 1579 bp nucleotide sequence representing the complete cDNA sequence of CfaAR was obtained by overlapping EST DT716202

828

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

with the amplified fragments. The sequence was deposited in GenBank under accession no. GU002540. The CfaAR cDNA contained a 50 untranslated region (UTR) of 209 bp, a 30 UTR of 413 bp with a poly(A) tail, and an open reading frame (ORF) of 957 bp. The ORF encoded a polypeptide of 318 amino acids with the predicted molecular weight of 35.8 kDa. SMART program analysis revealed that CfaAR contained a 7tm_1 domain (7 transmembrane receptor, from Gly35 to Tyr292, E-value of 6.50e37). The amino acid sequence similarity of CfaAR with vertebrate adrenergic receptors and invertebrate octopamine receptors was analyzed by BLAST algorithm. CfaAR shared 22.3e28.6% similarity with that of a-adrenergic receptors from vertebrate, 25.1e30.6% similarity with that of b-adrenergic receptors from vertebrate, and 19.2e30.8% similarity with that of octopamine receptors from invertebrate. The amino acid sequence of CfaAR protein and other a-adrenergic receptor were aligned, which revealed five conserved cysteine residues (Fig. 1). Among them, PROSITE predicted that conserved Cys95 and Cys175 were able to form an important disulfide bond. 3.2. The change of cAMP concentration after the stimulation of biogenic amides and adrenergic receptor agonist The cAMP concentration in CfaAR-HEK293 cells was determined after the stimulation of biogenic amines or adrenergic receptor agonist. The intracellular cAMP concentration decreased significantly to 0.52 and 0.84 pmol mL
1 (P < 0.05) after the stimulation of norepinephrine and phenylephrine (a-adrenergic receptor agonist) (Fig. 2). However, there was no significant change of the cAMP concentration after the stimulation of octopamine, tyramine, epinephrine and isoprenaline (b-adrenergic receptor agonist), in comparison with that in the blank and control group. 3.3. The tissue distribution of CfaAR transcripts Quantitative real-time PCR was employed to investigate the distribution of CfaAR mRNA transcripts in different tissues with b-

Fig. 2. The change of intracellular cAMP level in the CfaAR-transfected HEK293 cells after the stimulation of biogenic amines or adrenergic receptor agonists. For biogenic amines, Tyr, Oct, NE and E indicate tyrosine, octopamine, norepinephrine and epinephrine, respectively. Phe and Iso indicated phenylephrine (the agonist of a-adrenergic receptor) and isoprenaline (the agonist of b-adrenergic receptor), respectively. Each values were shown as mean  SD (N ¼ 4), and bars with different letters were significantly different (P < 0.05).

actin as internal control. For CfaAR and b-actin genes, there was only one peak at the corresponding melting temperature in the dissociation curve analysis, indicating that the PCR was specifically amplified (data not shown). The CfaAR transcripts were ubiquitously detected in all the tested tissues including haemocytes, adductor muscle, kidney, hepatopancreas, gill, gonad and mantle. The higher CfaAR expression was observed in gill and kidney, which was 11.96-fold (P < 0.05) and 8.29-fold (P < 0.05) of that in haemocytes, respectively. The expression level of CfaAR mRNA in the hepatopancreas, muscle, mantle and gonad was 2.83, 1.63, 0.99 and 0.39-fold (P > 0.05) of that in haemocytes, respectively (Fig. 3).

Fig. 1. Multiple alignment of the amino acid sequence fragment of CfaAR with that of other vertebrate a-adrenergic receptor deposited in GenBank. The black shadow region indicated positions where all sequences shared the same amino acid residue. Similar amino acids were shaded in grey. Gaps were indicated by dashes to improve the alignment. The asterisks indicated five conserved cysteine residues. The species and the GenBank accession numbers are as follows: Homo sapiens (NP_000673) and Danio rerio (NP_997520).

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

829

3.5. The effect of a-adrenergic receptor agonist on the haemocyte phagocytic and antibacterial activity

Fig. 3. Tissue distribution of the CfaAR transcript detected by SYBR Green real-time PCR. CfaAR relative mRNA expression level in adductor muscle, kidney, hepatopancreas, gill, gonad and mantle of six adult scallops was normalized to that of haemocyte. Each values were shown as mean  SD (N ¼ 6), and bars with different letters were significantly different (P < 0.05).

3.4. The temporal expression of CfaAR mRNA in haemocytes after bacteria challenge The expression of CfaAR mRNA in haemocytes was quantified by quantitative real-time PCR after bacteria challenge. In the bacteria challenge group, the expression level of CfaAR mRNA decreased firstly at 3 h (0.21-fold, P < 0.05), and then increased significantly compared to that in the blank and control group. After the transitory fall during 3e6 h, CfaAR transcripts began to increase at 12 h (4.74-fold, P < 0.05), and reached the highest level at 24 h (4.92fold, P < 0.05). Subsequently, it restored to the initial level again during 24e48 h post challenge. There was no significant difference in the expression level of CfaAR mRNA between the control and blank group (Fig. 4).

Fig. 4. Temporal expression of CfaAR mRNA detected by SYBR Green real-time PCR in scallop haemocytes after bacteria challenge for 0, 3, 6, 12, 24, 48 and 96 h b-actin gene was used as an internal control to calibrate the cDNA template for all the samples. Each values were shown as mean  SD (N ¼ 5), and bars with different letters were significantly different (P < 0.05).

Phagocytic and antibacterial activity of haemocytes was determined after the addition of a-adrenergic receptor agonist and antagonist. The addition of a-adrenergic receptor agonist decreased significantly the phagocytic and antibacterial activity of haemocytes. Haemocyte phagocytic activity in LPS and LPS þ Pra þ Phe group increased significantly by 47% and 74% (P < 0.05) respectively, in comparison with that in the control group. No significant difference was observed in the phagocytic activity of haemocytes between the LPS þ Phe and control group (Fig.5). Haemocyte lysate in LPS and LPS þ Pra þ Phe group exhibited higher antibacterial activity than that in the LPS þ Phe and control group (Fig.6A). The difference of bacteria concentration after the treatment with haemocyte lysates maximized at 20.5 h (P < 0.05) in the control and LPS group. Meanwhile, the bacteria concentration in the LPS group was significantly lower (P < 0.05) than that in the LPS þ Phe group, and shared the same level (P > 0.05) with that in the LPS þ Pra þ Phe group (Fig.6B). 4. Discussion The communication and interaction between neuroendocrine and immune system is an important regulatory mechanism for the maintenance of immune homeostasis in vertebrate, and the interaction also plays important role in the mollusc immunomodulation [8,16,33]. For example, scallop catecholaminergic neuroendocrine system can be activated by immune response to release catecholamines into haemolymph, and then catecholamines can modulate conversely the immune response through corresponding receptors [6]. The adrenergic receptor is a class of G protein-coupled receptors, which are targets of the catecholamines, especially norepinephrine and epinephrine. In the present study, the cDNA of an a-adrenergic receptor (CfaAR) was identified from scallop C. farreri. Its full-length cDNA was of 1579 bp, containing a 50 UTR of 209 bp, a 30 UTR of 413 bp with a poly(A) tail, and an ORF of 957 bp encoding a polypeptide of 318 amino acids. There was a 7tm_1

Fig. 5. The effect of a-adrenergic receptor agonist on the phagocytic activity in the primary cultured haemocytes of scallop. Phe indicated phenylephrine (the agonist of aadrenergic receptor), and Pra indicated prazosin (the antagonist of a-adrenergic receptor). Each values were shown as mean  SD (N ¼ 4), and bars with different letters were significantly different (P < 0.05).

830

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

Fig. 6. The effect of a-adrenergic receptor agonist on the antibacterial activity in the primary cultured haemocytes of scallop. (A) The growth curves for bacteria Vibrio anguillarum exposed to scallop haemocyte lysate from the control, LPS, LPS þ Phe and LPS þ Pra þ Phe group. Bacterial growth was recorded as absorbance at 600 nm (B) the absorbance of bacteria from the control, LPS, LPS þ Phe and LPS þ Pra þ Phe group at 20.5 h, when the absorbance different between the control and LPS group reach the maximum. Phe indicated phenylephrine (the agonist of a-adrenergic receptor), and Pra indicated prazosin (the antagonist of a-adrenergic receptor). Each values were shown as mean  SD (N ¼ 6), and bars with different letters were significantly different (P < 0.05).

domain in the deduced CfaAR protein, together with two conserved cysteine residues which form a disulfide bond, similar to previously identified G-protein coupled receptors family 1 members [34]. The deduced amino acid sequence of CfaAR shared 22.3e28.6% similarity with that of vertebrate a-adrenergic receptors, 25.1e30.6% similarity with that of vertebrate b-adrenergic receptors, and 19.2e 30.8% similarity with that of invertebrate octopamine receptors. The above results indicated that CfaAR was one member of Gprotein coupled receptors family 1, but it was difficult to ascertain the type of CfaAR according its sequence character. After the activation of different adrenergic receptors, the level of different intercellular second messengers would change correspondingly to relay the upstream signals into downstream pathway [35]. For instance, the activation of a1-adrenergic receptor can improve the intracellular Ca2þ level in vertebrate, while the activation of b- and a1-adrenergic receptor can increase and decline the level of intracellular cAMP, respectively. To further ascertain the type of CfaAR, the cAMP concentration in CfaAR-HEK293 cells was determined after the stimulations of biogenic amines or adrenergic receptor agonists. The treatments of octopamine, tyramine, epinephrine and b-adrenergic receptor agonist did not alter significantly the cAMP concentration, while norepinephrine and aadrenergic receptor agonist induced the significant decline of cAMP concentration to 0.52 and 0.84 pmol ml
1 (P < 0.05). The significant change of cAMP level after the stimulation of norepinephrine demonstrated that the CfaAR was activated by the binding of norepinephrine to decrease the intracellular cAMP level, and CfaAR could be categorized as an a-adrenergic receptor in scallop. The significant effect of a-adrenergic receptor agonist, instead of badrenergic receptor agonist, on the cAMP level further ensured that CfaAR was a member of a-adrenergic receptor family. The adrenergic receptors from vertebrates have the capability to bind both norepinephrine and epinephrine. Epinephrine has been verified to exist in mollusc, and its concentration in haemolymph can be induced by environmental stress, immune challenge and cytokine stimulation [6,7,36]. But in the present study, it was notable that the stimulation of epinephrine did not change significantly the level of intracellular cAMP. The higher affinity of CfaAR for norepinephrine rather than epinephrine could not be explained reasonably by the available information, and the detailed mechanism needed further investigation. The stimulation of octopamine and tyramine did not result in significant effect on the intracellular cAMP level, indicating CfaAR could not pertain to octopamine/tyramine receptor family

[37,38]. Therefore, these results confirmed that CfaAR was one of aadrenergic receptor in scallop, whose signal transduction depended on the involvement of cAMP. The distribution of CfaAR mRNA in different tissues was investigated to gain more clues for its potential function. The CfaAR transcripts were ubiquitously detectable in all seven tested tissues, including haemocytes, adductor muscle, kidney, hepatopancreas, gill, gonad and mantle, indicating that a-adrenergic modulation could be essential for most physiological functions in scallop. The highest expression level was detected in gill, which was consistent with the observation from sea scallop oyster Placopecten magellanicus [39], indicating that a-adrenergic modulation might be important for scallop respiration. For as much haemocytes and hepatopancreas were considered to be the main immune tissue of scallops [40,41], the mRNA expression of CfaAR in these two tissues indicated that a-adrenergic receptor could be implicated in the immune response of scallops. Circulating haemocytes are main immunocytes responsible for the immune defense responses in mollusc, including recognition and elimination of pathogens mainly by phagocytosis, encapsulation and nodulation, and oxidative killing [42e44]. To understand the involvement of CfaAR in the scallop immune response, its temporal expression was determined in haemocytes after bacteria challenge. The expression level of CfaAR mRNA decreased at 3 h (0.21-fold, P < 0.05) after bacteria challenge, and then began to increase at 12 h (4.74-fold, P < 0.05) and reached the peak at 24 h (4.92-fold, P < 0.05). The result demonstrated that the expression of CfaAR declined during the early stage, and then rose during the later stage of scallop immune response. It was possible that the expression manner of CfaAR mRNA was related to the effect of its ligand norepinephrine on the mollusc immune response. Norepinephrine could suppress not only the haemocyte phagocytic and ROS level, but also the activity of immune-related enzymes in haemolymph of mollusc [17e19,45]. Because the inhibitory effect of norepinephrine seemed detrimental to the elimination of invasive pathogens during the early stage of immune response [6], the decreased expression level of a-adrenergic receptor might be a beneficial way to avoid the negative factor. In addition, too high immunocompetence was able to kill normal cell and threaten other physiological function in host during the later stage, and it was necessary to down-regulate the immune response after the elimination of pathogens [8,9]. Therefore, the dynamic expression of aadrenergic receptor could mediate the inhibitory modulation of

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

norepinephrine in scallop, which was in agreement with the observation that norepinephrine concentration in scallop haemolymph increased significantly during the later stage of immune response. These results collectively suggested that CfaAR could be involved in the immune response of scallop, and its transcriptional level could be regulated dynamically during the immune response. As important catecholamines, norepinephrine and epinephrine achieve their immunomodulation function through the adrenergic receptor on the surface of immunocytes. To further understand the immunomodulation mechanism mediated by a-adrenergic receptor in scallop, the haemocyte phagocytic and antibacterial activity was determined after the activation of a-adrenergic receptor. The phagocytic and antibacterial activity of haemocytes was induced significantly at 6 h after LPS stimulation, but the induction was repressed significantly by the activation of a-adrenergic receptor. Moreover, the addition of a-adrenergic receptor antagonist significantly increased the induction of the haemocyte phagocytic and antibacterial activity. These results revealed that the activation of aadrenergic receptor could down-regulate the immune activity of haemocytes during the immune response in scallop. It seemed inconsistent with the previous report in which norepinephrine had inhibitory effect on haemocyte phagocytosis and reactive oxygen species production through b not a-adrenergic receptor in the nonimmune state oyster C. gigas [18,19]. The divergence might owe to the difference of haemocyte status between the immune and nonimmune situation, because adrenergic receptor can be desensitized with ligands through phosphorylation under certain physiology condition [46,47]. The present results indicated that the a-adrenergic receptor on the surface of scallop haemocytes was of ligand-binding activity during the immune response, and could transmit signals elicited by ligand stimulation to repress the increase of haemocyte phagocytic and antibacterial activity. Besides, the activation of aadrenergic receptor on mollusc haemocytes also modulated the transcriptional express of immune-related genes and the activity of immune-related enzymes in haemolymph [6,48]. These results suggested that there was a-adrenergic immunomodulation in haemocytes of scallop C. farreri, and it might be requisite for the elimination of pathogens and the maintenance of immune homeostasis in scallop. Acknowledgements The authors were grateful to all the laboratory members for continuous technical advice and helpful discussion. This research was supported by 973 National Key Fundamental Research Program (No. 2010CB126404), National High Technology Research and Development Program (863 Program, No. 2012AA10A401) from the Chinese Ministry of Science and Technology, grants from NSFC (No. 31072192 to L.W, 30925028 to L.S.), and Shandong Provincial Natural Science Foundation (No.JQ201110 to L.W.). References [1] Kvetnansky R, Sabban EL, Palkovits M. Catecholaminergic systems in stress: structural and molecular genetic approaches. Physiol Rev 2009;89:535e606. [2] Zhou Z, Yang J, Wang L, Zhang H, Gao Y, Shi X, et al. A dopa decarboxylase modulating the immune response of scallop Chlamys farreri. PLoS One 2011;6: e18596. [3] Zhou Z, Wang L, Yang J, Zhang H, Kong P, Wang M, et al. A dopamine beta hydroxylase from Chlamys farreri and its induced mRNA expression in the haemocytes after LPS stimulation. Fish Shellfish Immunol 2011;30:154e62. [4] Zhou Z, Wang L, Gao Y, Wang M, Zhang H, Wang L, et al. A monoamine oxidase from scallop Chlamys farreri serving as an immunomodulator in response against bacterial challenge. Dev Comp Immunol 2011;35:799e807. [5] Yang B, Qin J, Shi B, Han G, Chen J, Huang H, et al. Molecular characterization and functional analysis of adrenergic like receptor during larval metamorphosis in Crassostrea angulata. Aquaculture 2012;366e367:54e61. [6] Zhou Z, Wang L, Shi X, Zhang H, Gao Y, Wang M, et al. The modulation of catecholamines to the immune response against bacteria Vibrio anguillarum challenge in scallop Chlamys farreri. Fish Shellfish Immunol 2011;31:1065e71.

831

[7] Chen M, Yang H, Xu B, Wang F, Liu B. Catecholaminergic responses to environmental stress in the hemolymph of Zhikong scallop Chlamys farreri. J Exp Zool A Ecol Genet Physiol 2008;309:289e96. [8] Sternberg EM. Neural regulation of innate immunity: a coordinated nonspecific host response to pathogens. Nat Rev Immunol 2006;6:318e28. [9] Steinman L. Elaborate interactions between the immune and nervous systems. Nat Immunol 2004;5:575e81. [10] Webster JI, Tonelli L, Sternberg EM. Neuroendocrine regulation of immunity. Annu Rev Immunol 2002;20:125e63. [11] Demas GE, Adamo SA, French SS. Neuroendocrine-immune crosstalk in vertebrates and invertebrates: implications for host defence. Funct Ecol 2011;25: 29e39. [12] Webster Marketon JI, Glaser R. Stress hormones and immune function. Cell Immunol 2008;252:16e26. [13] Camacho-Arroyo I, Lopez-Griego L, Morales-Montor J. The role of cytokines in the regulation of neurotransmission. Neuroimmunomodulation 2009;16: 1e12. [14] Sanders VM, Straub RH. Norepinephrine, the beta-adrenergic receptor, and immunity. Brain Behav Immun 2002;16:290e332. [15] Sarkar C, Basu B, Chakroborty D, Dasgupta PS, Basu S. The immunoregulatory role of dopamine: an update. Brain Behav Immun 2010;24:525e8. [16] Wang L, Qiu L, Zhou Z, Song L. Research progress on the mollusc immunity in China. Dev Comp Immunol 2013;39:2e10. [17] Aladaileh S, Nair SV, Raftos DA. Effects of noradrenaline on immunological activity in Sydney rock oysters. Dev Comp Immunol 2008;32:627e36. [18] Lacoste A, Malham SK, Cueff A, Poulet SA. Noradrenaline modulates oyster hemocyte phagocytosis via a beta-adrenergic receptor-cAMP signaling pathway. Gen Comp Endocrinol 2001;122:252e9. [19] Lacoste A, Malham SK, Cueff A, Poulet SA. Noradrenaline modulates hemocyte reactive oxygen species production via beta-adrenergic receptors in the oyster Crassostrea gigas. Dev Comp Immunol 2001;25:285e9. [20] Rosenbaum DM, Rasmussen SG, Kobilka BK. The structure and function of Gprotein-coupled receptors. Nature 2009;459:356e63. [21] Ziolkowski N, Grover AK. Functional linkage as a direction for studies in oxidative stress: alpha-adrenergic receptors. Can J Physiol Pharmacol 2010;88:220e32. [22] Sanders VM, Straub RH. Norepinephrine, the b-adrenergic receptor, and immunity. Brain Behav Immun 2002;16:290e332. [23] Maestroni GJM, Mazzola P. Langerhans cells b2-adrenoceptors: role in migration, cytokine production, Th priming and contact hypersensitivity. J Neuroimmunology 2003;144:91e9. [24] Madden KS, Sanders VM, Felten DL. Catecholamine influences and sympathetic neural modulation of immune responsiveness. Annu Rev Pharmacol Toxicol 1995;35:417e48. [25] Xiao J, Ford SE, Yang H, Zhang G, Zhang F, Guo X. Studies on mass summer mortality of cultured zhikong scallops (Chlamys farreri Jones et Preston) in China. Aquaculture 2005;250:602e15. [26] Zhang F, Yang H. Analysis of the causes of mass mortality of farming Chlamys farreri in summer in coastal areas of Shandong, China. Mar Sci 1999;1:44e7. [27] Wang L, Song L, Zhao J, Qiu L, Zhang H, Xu W, et al. Expressed sequence tags from the zhikong scallop (Chlamys farreri): discovery and annotation of hostdefense genes. Fish Shellfish Immunol 2009;26:744e50. [28] Zhang H, Song L, Li C, Zhao J, Wang H, Qiu L, et al. A novel C1q-domaincontaining protein from Zhikong scallop Chlamys farreri with lipopolysaccharide binding activity. Fish Shellfish Immunol 2008;25:281e9. [29] Hughes Jr TK, Smith EM, Chin R, Cadet P, Sinisterra J, Leung MK, et al. Interaction of immunoactive monokines (interleukin 1 and tumor necrosis factor) in the bivalve mollusc Mytilus edulis. Proc Natl Acad Sci 1990;87:4426e9. [30] Cao A, Mercado L, Ramos-Martinez JI, Barcia R. Primary cultures of hemocytes from Mytilus galloprovincialis Lmk.: expression of IL-2R alpha subunit. Aquaculture 2003;216:1e8. [31] Ciacci C, Canonico B, Bilanicova D, Fabbri R, Cortese K, Gallo G, et al. Immunomodulation by different types of N-oxides in the hemocytes of the marine bivalve Mytilus galloprovincialis. PLoS One 2012;7:e36937. [32] Wootton EC, Pipe RK. Structural and functional characterisation of the blood cells of the bivalve mollusc, Scrobicularia plana. Fish Shellfish Immunol 2003;15:249e62. [33] Adamo SA. The effects of the stress response on immune function in invertebrates: an evolutionary perspective on an ancient connection. Horm Behav 2012;62:324e30. [34] Ribeiro P, Geary TG. Neuronal signaling in schistosomes: current status and prospects for postgenomics. Can J Zool-rev Can Zool 2010;88:1e22. [35] Fabbri E, Capuzzo A. Cyclic AMP signaling in bivalve molluscs: an overview. J Exp Zool Part A, Ecol Genet Physiol 2010;313:179e200. [36] Ottaviani E, Caselgrandi E, Kletsas D. Effect of PDGF and TGF-beta on the release of biogenic amines from invertebrate immunocytes and their possible role in the stress response. FEBS Lett 1997;403:236e8. [37] Blais V, Bounif N, Dube F. Characterization of a novel octopamine receptor expressed in the surf clam Spisula solidissima. Gen Comp Endocrinol 2010;167:215e27. [38] Rotte C, Krach C, Balfanz S, Baumann A, Walz B, Blenau W. Molecular characterization and localization of the first tyramine receptor of the American cockroach (Periplaneta americana). Neuroscience 2009;162:1120e33. [39] Smith SA, Nason J, Croll RP. Distribution of catecholamines in the sea scallop, Placopecten magellanicus. Can J Zool 1998;76:1254e62.

832

Z. Zhou et al. / Fish & Shellfish Immunology 35 (2013) 825e832

[40] Wootton EC, Dyrynda EA, Ratcliffe NA. Bivalve immunity: comparisons between the marine mussel (Mytilus edulis), the edible cockle (Cerastoderma edule) and the razor-shell (Ensis siliqua). Fish Shellfish Immunol 2003;15: 195e210. [41] Zhao J, Song L, Li C, Zou H, Ni D, Wang W, et al. Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein. Mol Immunol 2007;44: 1198e208. [42] Costa MM, Prado-Alvarez M, Gestal C, Li H, Roch P, Novoa B, et al. Functional and molecular immune response of Mediterranean mussel (Mytilus galloprovincialis) haemocytes against pathogen-associated molecular patterns and bacteria. Fish Shellfish Immunol 2009;26:515e23. [43] Travers MA, Mirella da Silva P, Le Goic N, Marie D, Donval A, Huchette S, et al. Morphologic, cytometric and functional characterisation of abalone (Haliotis tuberculata) haemocytes. Fish Shellfish Immunol 2008;24:400e11.

[44] Cao A, Ramos-Martinez JI, Barcia R. In hemocytes from Mytilus galloprovincialis Lmk., treatment with corticotropin or growth factors conditions catecholamine release. Int Immunopharmacol 2007;7:1395e402. [45] Aladaileh S, Mohammad MG, Ferrari B, Nair SV, Raftos DA. In vitro effects of noradrenaline on Sydney rock oyster (Saccostrea glomerata) hemocytes. Comp Biochem Physiol A Mol Integr Physiol 2008;151:691e7. [46] Violin JD, DiPilato LM, Yildirim N, Elston TC, Zhang J, Lefkowitz RJ. b2Adrenergic receptor signaling and desensitization elucidated by quantitative modeling of real time cAMP dynamics. J Biol Chem 2008;283:2949e61. [47] Suzuki E, Tsujimoto G, Hashimoto K. Different desensitization mechanisms of two alpha 1-adrenoceptor subtypes in the contraction of rabbit aorta. Br J Clin Pharmacol 1990;30:121Se4S. [48] Lacoste A, De Cian MC, Cueff A, Poulet SA. Noradrenaline and alpha-adrenergic signaling induce the hsp70 gene promoter in mollusc immune cells. J Cell Sci 2001;114:3557e64.