Modulo is a target of Myc selectively required for growth of proliferative cells in Drosophila

Mechanisms of Development 120 (2003) 645–655 www.elsevier.com/locate/modo

Modulo is a target of Myc selectively required for growth of proliferative cells in Drosophila Laurent Perrina,b,*, Corinne Benassayagc, Dominique Morelloc, Jacques Pradelb, Jacques Montagned a

Institut de Ge´ne´tique Humaine, 141 rue de la Cardonille, 34396 Montpellier Cedex 5, France Laboratoire de Ge´ne´tique et de Physiologie du De´veloppement, Institut de Biologie du De´veloppement de Marseille, CNRS-INSERM-Universite´ de la Me´diterrane´e, Case 907, Parc Scientifique de Luminy, 13288 Marseille Cedex 09, France c Centre de Biologie du De´veloppement CNRS, UMR5547, IFR 109, 118 route de Narbonne, Baˆtiment 4R3, 31062 Toulouse Cedex, France d Friedrich Miescher-Institut, P.O. Box 2543, Maulbeerstrasse 66, CH-4002 Basel, Switzerland b

Received 6 February 2003; received in revised form 10 April 2003; accepted 10 April 2003

Abstract In Drosophila, the homologue of the proto-oncogene Myc is a key regulator of both cell size and cell growth. The identities and roles of dMyc target genes in these processes, however, remain largely unexplored. Here, we investigate the function of the modulo (mod) gene, which encodes a nucleolus localized protein. In gain of function or loss of function experiments, we demonstrate that mod is directly controlled by dMyc. Strikingly, in proliferative imaginal cells, mod loss-of-function impairs both cell growth and cell size, whereas larval endoreplicative tissues grow normally. In contrast to dMyc, over-expressing Mod in wing imaginal discs is not sufficient to induce cell growth. Taken together, our results indicate that mod does not possess the full spectrum of dMyc activities, but is required selectively in proliferative cells to sustain their growth and to maintain their specific size. q 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Cell growth; Proliferative/endoreplicative tissues; Nucleolus; Ribosome biogenesis; Myc

1. Introduction During development, the program of growth has to coordinate the increase in cell mass (i.e. cell growth) with cell proliferation, to give rise to an adult organism whose final size depends on cell size and cell number (reviewed in Conlon and Raff (1999)). Drosophila is an attractive system to study growth that occurs essentially during larval life. In late embryogenesis, cells dedicated to form the larval tissues stop dividing and, after hatching, support multiple rounds of endocycles (Pearson, 1974; Smith and Orr-Weaver, 1991) to sustain their growth (Follette et al., 1998; Weiss et al., 1998). The adult structures differentiate from the imaginal discs that individualize as groups of cells invaginating from * Corresponding author. Address: Laboratoire de Ge´ne´tique et de Physiologie du De´veloppement, Institut de Biologie du De´veloppement de Marseille, CNRS-INSERM-Universite´ de la Me´diterrane´e, Case 907, Parc Scientifique de Luminy, 13288 Marseille Cedex 09, France. Tel.: þ 33-4-91-26-96-11; fax: þ 33-4-91-82-06-82. E-mail address: [email protected] (L. Perrin).

the ectoderm during mid-embryogenesis, then grow and proliferate during larval life and early metamorphosis (Cohen, 1993). Imaginal discs are subdivided into compartments (Garcia-Bellido et al., 1973), so that cells from one compartment neither mix nor compete with cells in an adjacent compartment (Simpson, 1976). Growth and size in discs are controlled in a compartment-specific manner, as in the organs of mammals (Conlon and Raff, 1999; Day and Lawrence, 2000), and many genes involved in growth control are conserved throughout evolution (Neufeld and Edgar, 1998; Weinkove and Leevers, 2000). Newly-hatched larvae must feed to reinitiate both proliferation of imaginal cells and endoreplication of larval tissues. If larvae are then transferred to amino acid-deprived media, endoreplication stops, while proliferation and growth of imaginal cells only slow down (Britton and Edgar, 1998). Mutations for the Drosophila TOR homologue (dTOR) also affect more growth of endoreplicative tissues than imaginal discs (Oldham et al., 2000; Zhang et al., 2000), suggesting that, congruent with studies in yeast

0925-4773/03/$ - see front matter q 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0925-4773(03)00049-2

646

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

and mammals (Dennis et al., 1999), dTOR acts as a nutrient sensor to orchestrate growth. In mammals, mTOR is assumed to act in the PI3K signaling pathway (Gingras et al., 1998) and to activate S6 Kinase (S6K), which results in enhanced translation of mRNAs that encode components of the protein synthesis machinery (Jefferies et al., 1997). In Drosophila, mutations in intermediates of the PI3K signaling pathway typically lead to a severe developmental delay and an autonomous reduction in cell size, cell growth, and proliferation without affecting cell identity specification (Bohni et al., 1999; Verdu et al., 1999; Weinkove et al., 1999). Drosophila mutations for S6K (dS6K) also reduce cell size and cell growth (Montagne et al., 1999). However, it has recently been shown that dS6K is independent of the PI3K pathway, although it does require functional dTOR (Radimerski et al., 2002a). Quiescent cells, when stimulated to proliferate, grow until they reach a size threshold required for the G1/S transition (Gao and Raff, 1997; Killander and Zetterberg, 1965; Nurse et al., 1976). In mammals, mitogenic stimulation induces the transient early expression of the Ras and c-Myc proto-oncogenes (Eisenman and Cooper, 1995). However, ectopic expression of c-Myc in mouse liver does not activate cell proliferation, but rather leads to cell hypertrophy accompanied by the induction of ribosomal and nucleolar protein gene expression (Kim et al., 2000). This suggests that in proliferative cells, c-Myc does not trigger cell cycle progression per se, but rather directs cell growth and hence allows cells to reach the critical size required for G1/S progression. In Drosophila, over expressing the c-Myc homologue (dMyc) increases the rate of cell growth but not that of cell division. The G1/S transition is accelerated as a consequence of an effect on Cyclin E, but cells accumulate in G2 (Johnston et al., 1999). Ectopic expression of Drosophila Ras (dRas) induces a comparable effect on cell growth that is, at least in part, a consequence of increased amount of dMyc protein (Prober and Edgar, 2000). Thus, the dMyc-dependent mechanism that triggers Cyclin E expression at the G1/S transition is likely to be the size sensor that links cell growth with cell cycle progression (Stocker and Hafen, 2000). Hence, dMyc and dRas, as well as the dTOR/dS6K cassette and components of the PI3K pathway, participate in independent pathways that converge to regulate both cell size and cell growth. Conversely, a homologue for the tumor suppressor PTEN (Di Cristofano and Pandolfi, 2000) has been identified in Drosophila as a negative regulator of growth that antagonizes the PI3K pathway (Goberdhan et al., 1999; Stocker et al., 2002). Two additional tumor suppressor genes, which together constitute the tuberous sclerosis complex (TSC) (Young and Povey, 1998) have been underscored in Drosophila (dTsc1 and dTsc2), as mutation of either one of them increases both cell size and growth (Potter et al., 2001; Tapon et al., 2001). In addition, nucleolar size is strongly increased in dTSC1 mutant cells (Gao and Pan, 2001). More recently, it has been reported

that TSC is able to downregulate S6Kinase activity both in mammalian cells and in Drosophila (Gao et al., 2002; Goncharova et al., 2002; Inoki et al., 2002; Manning et al., 2002; Radimerski et al., 2002b; Tee et al., 2002). The relationship of these regulators to the nucleolus and to translational capacity strongly supports the notion that ribosome biogenesis is a limiting step for growth. In favor of this, a screen for growth defective mutants led to the identification of new genes whose products are required for protein synthesis (Galloni and Edgar, 1999). Since the mechanisms through which these regulators control cell growth remains largely elusive, identification of their target genes constitutes a critical step to elucidate how independent signals can be integrated to achieve the process of growth. The modulo (mod; Garzino et al., 1992) gene product has been previously shown to localize at the nucleolus in proliferative cells (Perrin et al., 1998). Consistent with this location at the site of ribosome biogenesis (Shaw and Jordan, 1995), Mod displays a modular organization, which is often found in non ribosomal nucleolar proteins, including an acidic stretch, two basic regions located at both ends of the molecule and four reiterated RRMs (for RNA Recognition Motifs) in the remaining core of the protein. We previously demonstrated that RRMs provides a sequence-specific RNA binding activity and that nucleolar Mod is highly phosphorylated and part of a ribunucleoprotein complex (Perrin et al., 1999). Whereas no vertebrate homologues have been identified to date, Mod appears to be structurally related to Nucleolin, an abundant protein of proliferating vertebrate’s cells that has recently been shown to be transcriptionnally activated by c-myc (Kim et al., 2000). We show here that mod is required for growth and size control of proliferative cells, but not of endoreplicative cells. Furthermore, in agreement with its cellular growth phenotypes and its expression pattern similar to that of dmyc, we show that mod is a transcriptional target of dMyc.

2. Results 2.1. Loss-of mod function induces a developmental delay but does not affect growth of endoreplicative tissues Modulo protein accumulates at the nucleolus (Perrin et al., 1998). This observation prompted us to analyze the function of mod in growth and proliferation processes. The previously characterized A4-4L8 deletion (Garzino et al., 1992) disrupts the divergently transcribed kurtz (krz) and mod genes situated at the right tip of the third chromosome (Roman et al., 2000). krz is an essential cell nonautonomous neural gene, whose mutant phenotype can be rescued by selective expression of a krz cDNA in the CNS (Roman et al., 2000). Previous rescue experiments demonstrated that lack of mod results in an extended larval third instar and in a cell-autonomous Minute-like phenotype

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

647

(Perrin et al., 1998; Roman et al., 2000). The A4-4L8 deletion complemented with a krz rescue transgene (see Section 4, Experimental procedures), hereafter referred to as mod L8, has been used in this study to determine the function of mod in controlling growth. Homozygous mod L8 larvae reached the third larval stage with a 6-hour delay (data not shown) and did not exhibit significant size differences relative to wild type (Fig. 1A and B). In agreement with the study of Roman et al. (2000), mod L8 larvae enter pupariation with a 3-day delay (Fig. 1B). Most die as pharate adult. The few escapers were reduced in body weight (26%) and total wing area (6%). Remarkably, the wing cell area was strongly reduced by 22% (Fig. 1C). Although these defects are consistent with mod being required for growth and cell size regulation, overall larval growth was not impaired in 5 day-old larvae (Fig. 1A). To gain insight into this striking phenotype, larval tissues were analyzed during the third instar. Interestingly, larval tissues in mod L8 animals were normal, as depicted for the midgut, which was comparable to wild type at 3 –5 days AEL (Fig. 1D – G). The endoreplicative cells of the larval gut were of normal size in mod L8 mutants (Fig. 1H and I). The results indicate that mod function is not required for growth of endoreplicative cells. The larval midgut also contains diploid intestinal adult precursor cells (apc) that proliferate during larval stages to form groups of approximately 4 –8 cells prior to pupariation in wild type (5 days AEL, Fig. 1H). In contrast, at the same age, the mod L8 midgut had fewer isolated intestinal apc, usually as doublets, or occasionally as groups of 3 –4 cells (Fig. 1I). In addition, mutant apc appeared smaller than wild type (data not shown). Proliferation was, however, not arrested, since apc eventually formed groups of 4– 8 cells in 7 days AEL mutant larvae (data not shown). Taken together, these observations suggest that mod is selectively required in diploid cells to sustain growth. 2.2. Mod is autonomously required for growth and size control of imaginal cells Imaginal discs are composed mainly of proliferative cells. To better understand mod L8 related growth defects, imaginal discs were analyzed during larval development. As shown in Fig. 2A and B, mod L8 wing imaginal discs were severely delayed in growth. However, at the extended third instar (7 – 8 days AEL), the mutant discs attained a size comparable to prepupal wild type discs (Fig. 2A and B), suggesting that mod is required for growth of imaginal tissues. The reduced growth rate was not due to an enhancement of cell death, as no increase of apoptotic cells was observed in mod L8 mutant imaginal discs stained with acridine orange (data not shown). Somatic mod L8 clones exhibit a growth-related phenotype characterized by short slender bristles and reduced cell number (Perrin et al., 1998). Within third instar discs, mod L8 clones contained very few cells when induced in a wild type background (data

Fig. 1. Recessive phenotypes of mod loss-of-function. The age in days after egg laying (AEL), of wild type (A) and mod L8 mutant (B), is indicated underneath. Note that regarding growth, wild type and mod L8 five day-old larvae look similar; mod L8 mutant display an extended third instar larval period and develop to pharate. (C) Growth defects of mod L8 escapers: reduction in male weight (mg), wing area (mm2) and cell area (mm2) are plotted (n ¼ 12 and error bars indicate standard deviations). (D– G) Hoechst DNA staining of wild type (left) and mutant (right) anterior midguts (same magnification) dissected at 3 (D-E) and 5 days (F–G) AEL. Note that mod loss-of-function does not modify the growth of this larval tissue. (H –I) A higher magnification of wild type and mod L8 anterior midguts at 5 days AEL shows that in the mutant the number of intestinal adult precursor cells (apc) is much lower (arrow), while size of endoreplicative larval cells seem unaffected.

648

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

To address the question of a potential effect during cell cycle progression, dissociated cells from mod L8 prepupal wing discs were analyzed with a fluorescence-activated cell sorter (FACS). Cell cycle profile analysis did not reveal any significant difference in mutant versus wild type cells (Fig. 2D). However, the mod mutation is associated with a reduction in size of both G1 and G2 cells (Fig. 2D). This observation suggests that Mod also acts on cell size control as reported for other growth regulators (Montagne, 2000). 2.3. Mod over-expression does not alter compartment size

Fig. 2. mod loss-of-function affects growth of imaginal tissues. (A– B) Hoechst DNA staining of wild type (A) and mod L8 (B) third instar wing discs (same magnification) dissected at various days AEL (indicated at the bottom right of each panel). Note that growth of mutant imaginal discs is severely impaired but still continues during the extended larval period, which allows the disc to eventually reach a size comparable to that of wild type. (C) mod L8 homozygous somatic clones observed in yw, HS-Flp/P{b5.8T12}; FRT82B, HS-pmyc, M(3)96C/ FRT82B, mod L8 larvae were induced during first larval stage. As surrounding Minute cells have a growth disadvantage, large mod 2/2 mutant clones are recovered. Imaginal discs were double stained with Mod specific antibody (green) and with propidium iodine (red). (D) FACS analysis of dissociated cells from either mod L8 (black) or wild type (red) wing imaginal discs. Cell cycle profiles (left), as estimated by DNA content, are unchanged in the mutant, whereas both G1 (top right) and G2 (bottom right) cells have a reduced size in the mod L8 mutant, as measured by forward scatter (FSC).

not shown), confirming the cell autonomous nature of mod function. In contrast, clones were larger and comprised many more cells when induced in a Minute background (Fig. 2C). As Minute cells are known to be at a growth and proliferative disadvantage (Morata and Ripoll, 1975), these results indicate that mod L8 cells grow and proliferate at a lower rate than wild type cells.

Loss-of-function experiments showed that Mod is necessary for cell growth. We then tested whether overexpression suffices to stimulate cell growth. Using the UAS/Gal4 system, Mod was overproduced together with GFP in the entire posterior compartment of wing imaginal discs. This over-expression did not significantly increase posterior compartment size (Fig. 3A and B). Using GFP as a landmark, the determination of the posterior/anterior area ratio showed that compartment size was not affected (Fig. 3E). To examine a possible effect on apoptosis, wing discs over-expressing Mod in their posterior compartments were stained with Acridine Orange. Clearly, apoptotic cells were more abundant in the posterior than in the anterior compartment (Fig. 3C), indicating that an excess of Mod results in increased cell death. Interestingly, although co-expression of P35 with Mod efficiently suppresses apoptosis, this did not modify the posterior/anterior ratio (Fig. 3D – E). Taken together, these results show that Mod-induced apoptosis does not influence compartment size. Nevertheless, the fact that over-expressed Mod is not able to overcome the limit on compartment size could mask specific effects on individual cells. Therefore, imaginal disc cells either over-expressing GFP alone or Mod þ GFP marker within their posterior compartment, were dissociated and analyzed by FACS. mod gain-of-function within the whole posterior compartment left the cell cycle profile unaltered (Fig. 3F). However, both these G1 and G2 cells were slightly bigger (Fig. 3F), whereas cells from the anterior compartment (GFP minus) were similar in size (data not shown). This observation suggests that overexpression of Mod can trigger a cell size increase but not compartment growth. 2.4. Clonal over-expression of Mod To further investigate the function of Mod in the context of cell competition, the ‘flip out’ technique was used to generate clones over-expressing Mod. Over-expression of Mod was accompanied by GFP as marker, and P35 to inhibit Mod-induced apoptosis (Fig. 3 and data not shown). In control clones, proliferation and growth rates were identical (Fig. 4A and B; Mass Doubling Time (MDT) ¼ Cell Doubling Time (CDT) ¼ 11.9 h), congruent with the

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

Fig. 3. Over-expression of Mod within posterior compartment of wing discs, does not affect growth but increases cell size. The enGal4 driver has been used to induce GFP alone (A) or in combination with Mod (B, C) or with Mod and P35 (D) in the posterior compartment of wing imaginal discs. (A, B) Detection of GFP fluorescence. (C) Acridine Orange staining indicates that Mod over-expression induces apoptosis. (D) P35 expression prevents Mod-induced apoptosis. (E) The relative area of the anterior and posterior compartments were calculated by measuring the number of pixels with Adobe Photoshop (see Section 4, Experimental procedures), and used to determine the mean value of the posterior/anterior area ratio for each genotype from the indicated number ðnÞ of discs analysed. Bars indicate standard variations. (F) FACS analysis of dissociated cells from wing imaginal discs over-expressing either GFP alone (grey) or in combination with Mod (black) in the posterior compartment. Mod over-expression does not affect the cell cycle profile (as estimated by DNA content, left), but induces a size increase of both G1 (top right) and G2 (bottom right) cells, as measured by forward scatter (FSC).

expected coupling of cell growth and proliferation in wild type imaginal discs (Neufeld et al., 1998). Unexpectedly, clonal over-expression of Mod did not modify the growth rate (MDT ¼ 12.0 h), but was associated with significantly slower proliferation (CDT ¼ 13.6 h). While these observations show that Mod is not sufficient to trigger cell growth, they also implicate Mod over-expression in increased cell size. To verify the apparent cell size increase, dissociated cells from discs containing GFP clones were analyzed by FACS. Consistent with the delay in cell

649

Fig. 4. Clones over-expressing Mod display an increased cell size. (A) Cell doubling time (CDT) of clones over-expressing various combinations of GFP, Mod P35 and Stg, as indicated. Clones were generated by inducing ectopic Act . Gal4 at 72 h AEL, and analysed at 120 h AEL. Clones have been classified with respect to the number of cells they contain. The number of clones in each class is plotted as a percentage of the total number ðnÞ of clones analysed for each genotype. Median CDT are indicated in each panel. (B) The mean value of clone area (plotted in pixels) has been calculated with Adobe Photoshop (see Section 4, Experimental procedures) from the given number of clone ðnÞ and used to calculate the mass doubling time (MDT); the statistically significance was estimated by T-test (P [StgþMod/wt] ¼ 1.6 £ 10 210 ; P [StgþMod/Mod] ¼ 4.9 £ 10 211 ; P [StgþMod/Stg] ¼ 2.6 £ 10218; P values are considered highly significant when less than 0.01). (C) FACS analysis of dissociated cells from wing imaginal discs. Cells over-expressing GFP in combination with Mod (black) have been compared to the surrounding GFP minus cells from the same disc (grey). Clones were generated as described above (A). Mod over-expression in clones induces a decrease in G1 cell number accompanied by an accumulation of G2 cells (left), but also a size increase of both G1 (top right) and G2 (bottom right) cells, as measured by forward scatter (FSC).

650

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

doubling, Modþ cells were indeed slightly larger than wild type, although the effect was more pronounced in G2 than in G1 cells (Fig. 4C). Moreover, analysis of the cell cycle profile revealed that the population of over-expressing cells was reduced in G1 relative to G2 (Fig. 4C). In contrast, the cell cycle profile was not changed upon mod mis-expression within the entire compartment, either in loss-of-function mutants (Fig. 2D) or in compartment over-expression (Fig. 3F). A similar discrepancy has been reported in loss-of-function mutants for Drosophila TOR: in mosaic wing discs, mutant cells accumulate in G1 (Zhang et al., 2000), whereas the cell cycle profile is unchanged when the entire wing disc is mutant (Oldham et al., 2000). The molecular mechanism underlying cell competition might be responsible for this discrepancy, creating interference with cell cycle progression in heterogeneous cell populations. In Modþ clones, the cell size increase along with the G2 accumulation raised the possibility that Mod may slow down cell division by delaying G2/M transition. To address this question, String (the rate limiting phosphatase for G2/M; Neufeld et al., 1998) was expressed alone or in combination with Mod using the ‘flip out’ technique. Cell division was slightly faster in Stringþ cells as compare to wild type (CDT ¼ 10.9 and 11.9 h, respectively; Fig. 4A), and further accelerated upon co-expressing Mod and String together (CDT ¼ 10 h; Fig. 4A). If Mod functions as a brake of G2/M transition, co-expression of String might counteract this effect. However, expressing Mod and String together accelerates cell division rate more than String alone does. Hence, this cooperative effect rather excludes that Mod could antagonize String at G2/M transition. Strikingly, String over-expression promoted growth of Modþ cells (MDT ¼ 10.5 h for Mod and String together, as compared to 12 and 13 h for either Mod or String, respectively, Fig. 4B). No evident hypothesis can be proposed to explain how is accomplished the overgrowth induced by Mod and String co-expression. However, this observation indicates that Mod, while insufficient to direct growth alone, can nonetheless cooperate with Stg to promote growth. 2.5. Mod is a dMyc target During embryogenesis, the pattern of mod expression (Graba et al., 1994) closely resembles that of dmyc (Gallant et al., 1996). As shown in Fig. 5D, in stage 10 embryos mod transcripts are visible in the mesoderm, the anterior and posterior midgut precursors, the salivary gland precursors in parasegment 2 and the anal plate. This pattern is indistinguishable from that of pitchoune ( pit), a potential dMyc target (Zaffran et al., 1998). In ovaries, transcripts of dmyc, pit and mod, are likewise identically detected throughout egg chamber development, except at stage 2 (Gallant et al., 1996; Zaffran et al., 1998 and our unpublished observations). To determine whether mod

Fig. 5. Transcriptional regulation of mod by dMyc. (A) Suppression of mod transcripts in dmycPL35 loss-of function mutant in third instar wing imaginal discs as compared to wild type. (B) Similar suppression of mod mRNA and dMyc mRNA level in dmycPL35 mutant is observed by semi-quantitative RT-PCR; note that the transcript level of the internal control croquemort (croq) is not affected in dmycPL35 mutant. (C) In situ detection of mod transcripts in third instar larval wing imaginal discs, either UASdmyc (left) or dppGAL4-UASdmyc (right); note the strong ectopic expression of mod transcripts at the A/P compartment boundary in response to dmyc overexpression. (D) In situ detection of mod transcripts in early stage 11 embryos, either enGAL4 (left), or enGAL4-UASdmyc (right); note the strong ectopic expression of mod transcripts in the posterior cells of each parasegment upon dmyc induction.

expression is transcriptionally controlled by dMyc, mod mRNA level was measured in loss-of function dmyc mutants. No change in mod expression was observed (data not shown) for the viable hypomorphic allele dmyc P0 (Johnston et al., 1999). In contrast, both in situ hybridization and quantitative RT-PCR on third instar larval imaginal discs, showed that mod transcription was severely impaired in the pupal lethal dmyc PL35 mutants (Bourbon et al., 2002; Fig. 5A, B). Thus sufficient diminishing of dmyc þ function reveals dMyc requirement for mod expression. The effect of dMyc on mod transcription was also analyzed in gain-of-function experiments, using the UAS/Gal4 system. In third instar wing imaginal discs, dMyc overexpression directed by dpp regulatory sequences led to a marked increase in mod transcription (Fig. 5C). Also, in engrailed(en)-Gal4/UASdmyc embryos, mod transcription was strongly induced in the posterior cells of each

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

651

parasegment where dMyc was over-expressed (Fig. 5D). Taken together, these results show that dMyc is required for mod expression. 2.6. mod transcriptional activation by dMyc depends on an E box sequence element E-boxes constitute functional Myc binding sites that typically reside downstream of the transcriptional start sites of target genes (Grandori and Eisenman, 1997). The action of Myc in regulating transcription has been described as involving binding of Myc homo-or heterodimers to an ‘E-box’ sequence based on a ‘CACGTG’ motif. A 1 kb DNA fragment located upstream of mod coding sequences has previously been shown capable of directing reporter gene expression that mimics the mod embryonic expression pattern (Alexandre et al., 1996 and Fig. 6A). This fragment harbors a canonical CACGTG E-box between the mod initiator ATG and a transcriptional start site assigned by primer extension (data not shown and Fig. 6B). A 365 bp fragment (P1) encompassing both the transcription start site and the E-box (Fig. 6A and B) was fused to a Lac-Z reporter gene. Trangenic flies containing this P1-LacZ chimeric gene expressed b-Gal in a pattern similar to endogenous mod. Further, on expressing dMyc in embryos (enGAL4, UASdMyc), mod expression and P1-LacZ expression were augmented in the posterior compartments (compare Fig. 6C with Fig. 5D). To ask whether the responsiveness of P1 to dMyc is E-box dependant, the canonical CACGTG E-box was mutated (CAGGTG) to abolish a potential dMyc-DNA interaction, according to Myc binding specificity (Grandori and Eisenman, 1997 and Fig. 6B). When fused to a Lac-Z reporter gene, this mutated P1 fragment was no longer able to mimic the mod transcription pattern, either in wild type or en-Gal4/UASdmyc embryos (Fig. 6, compare D with C). Taken together, these results strongly support the notion that mod transcription is controlled by dMyc, and favor the possibility that dMyc binds directly to the canonical E-box residing in mod regulatory sequences.

3. Discussion Recent studies have underscored a role for dMyc both in cell growth and cell size regulation. In contrast, little is yet known concerning target genes regulated by dMyc in vivo and their functions. We have shown here that mod is a downstream target of dMyc and is likely to be directly regulated. We previously demonstrated that Mod is a dual chromatin/RNA binding protein mainly located at the nucleolus (Perrin et al., 1999). In the same vein, diminished mod activity leads to a Minute-like phenotype (Perrin et al., 1998; Roman et al., 2000), thus suggesting a role for Mod in ribosome biogenesis. Here we have carried out a detailed analysis of mod growth-related phenotypes and have shown that it acts on growth and size of proliferative cells.

Fig. 6. mod transcriptional activation by dMyc depends on an E box sequence within its promoter. (A) A BamH1-Mlu1 DNA fragment (B and M, respectively) encompassing the mod transcription start site (arrow), has been previously shown to direct the embryonic expression of a reporter gene in a pattern identical to that of mod (Alexandre et al., 1996). Location of the Mod ATG (p) and of the P1 DNA fragment (dotted line) are indicated. (B) Putative regulatory region in the vicinity of the mod transcription start site (þ1) determined by primer extension analysis (the primer-matching sequence is underlined). The Mlu1 restriction site is indicated, the ATG is doubly underlined and the putative Myc binding site CACGTG is boxed. The P1 fragment expends from 2136 to þ 229 nucleotide positions. (C) The P1-LacZ transgene directs bGal expression (left) in a pattern identical to that of mod (compare with Fig. 5A). Note the staining in the mesoderm, the anterior and posterior midgut, the salivary gland precursors and the anal plate. In P1-LacZ embryos, dMyc ectopic expression driven by enGAL4 induces bGal expression in the posterior cells of each parasegment (right). (D) Left: Mutation of the E box sequence within the P1 fragment leads to dramatic suppression of bGal expression. Faint bGal staining is observed in anterior and posterior midgut while mesoderm, salivary gland precursors and anal plate no longer express bGal. Right: Ectopic induction of dMyc has no effect on P1 mut-LacZ expression.

652

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

3.1. mod functions downstream of dMyc selectively in proliferative cells mod loss-of-function selectively affects imaginal diploid cells but not endoreplicative tissues. In addition, Mod overexpression affects diploid cells but not endoreplicative tissues. For instance, salivary glands cells were bigger in cell and nucleus size upon ectopic expression of dMyc, but looked normal following Mod over-expression (L.P., unpublished results). Since amino acids directly control growth of endoreplicative tissues (Britton and Edgar, 1998), it is unlikely that Mod is related to nutrient availability. Indeed, in agreement with the phenotype specific for proliferative cells, we show here that mod transcription is controlled by dMyc, whose mammalian homologue is a proto-oncogene deregulated in various tumors (Pelengaris et al., 2000). Furthermore, we identified in the 50 UTR of mod an E-box DNA element that confers dMyc responsiveness to the mod transcription unit, suggesting that mod is a direct target of dMyc. In contrast, this transcriptional promoter element is not responsive to Drosophila PI3K (L.P., unpublished results). This indicates that mod expression is not simply controlled by cell growth and cell size increase, but constitutes a specific dMyc target in the mitogenic response. Nevertheless, mod is certainly not involved in all the various cellular processes controlled by dMyc, as in dmyc PL35 mutant, imaginal and endoreplicative tissues are equally affected (L.P., unpublished results). 3.2. Mod functions in the nucleolus We previously reported Mod to be a sequence-specific RNA binding protein, which localizes mainly to the nucleolus in a highly phosphorylated ribonucleoprotein complex (Perrin et al., 1999). In addition, Mod is detected throughout the entire nucleolus of proliferative imaginal cells, but is present only at the nucleolar periphery in larval cells (Perrin et al., 1998). In light of our observation that mod selectively affects growth and size of proliferative imaginal cells, it is likely that Mod is functionally required within the nucleolus. Hence, regarding its RNA-binding properties as well as its requirement for cell growth, Mod might affect ribosome biogenesis. Mod phosphorylation is stimulated by serum in cell culture (Perrin et al., 1999), suggesting that Mod may act as an integrator of dMyc transcriptional activity and of kinase cascades such as the PI3K signaling pathway. Drosophila PI3K is a dimer of Dp110 catalytic and P60 regulatory subunits, and acts as a growth promoter (Weinkove et al., 1999). It is, however, unlikely that this kinase activity affects the nucleolar localization of Mod, since ubiquitous expression of dominant negative or constitutively active Dp110 derivatives do not perturb Mod sub-nucleolar localization in either imaginal cells or endoreplicative tissues (L.P., unpublished results).

Mod shares structural similarities with Nucleolin, the most abundant nucleolar protein in mammalian cells (Ginisty et al., 1999). Strikingly, Nucleolin relocalizes at the periphery of the nucleolus upon actinomycin treatment (Caizergues-Ferrer et al., 1987) and is upregulated in hypertrophic mouse liver cells induced by c-Myc over-expression (Kim et al., 2000). Furthermore, the human RNA-helicase MrDb and its Drosophila counterpart Pit are also targets for c-Myc and dMyc, respectively (Grandori et al., 1996; Zaffran et al., 1998). This suggests that Myc function as well as that Myc target genes may have been conserved throughout evolution, although functional homology between Mod and Nucleolin remains to be demonstrated. 3.3. Mod effects on cell size, growth and proliferation Consistent with mod being a dMyc target, our experiments revealed that Mod is required for growth of imaginal cells. However, in contrast to dMyc, over-expression of Mod does not trigger cell growth on its own, indicating that additional target genes are required to mediate the growth enhancement induced by dMyc. Also, that loss-of mod function only affects proliferative cells reveals that different target genes are recruited to accomplish the dMycdependent growth in endoreplicative tissues. Over-expression of Mod alone does not increase cell growth but leads to a slight increase in cell size. In Modþ clones, the cell size increase is accompanied by an increase in G2 cells, which might be due to a block at G2/M transition leading to a subsequent slow down of cell division rate. Since dMyc over-expression does not affect G2/M transition it is, therefore, unlikely that Mod, a dMyc-target, could repress G2/M transition. We also have ruled out such a Mod-induced negative effect on cell cycle progression, as over-expressing Mod and String together accelerates cell division more than String alone does. This unambiguously excludes a Mod negative effect on cell cycle regulators, but somewhat suggests an acceleration of G1/S transition in Modþ clones. Since the decrease of the G1/G2 ratio does not occur when Mod is over-expressed within the entire compartment, it is, however, unlikely that Mod acts directly on cell cycle progression. In contrast, the fact that in adult wings of mod L8 escapers cell size was more reduced (22%) than overall wing area (6%), suggests that Mod could directly act on cell size through a not yet characterized mechanism. This hypothesis is further supported by the observation that change in Mod dosage always induces cell size variations, which can be observed in absence of cellular growth effect. In conclusion, we provide the first in depth analysis of the in vivo effects of a dMyc target, mod. Loss-of mod function results in a slow down of growth that is restricted to proliferative cells, whereas Mod over-expression is not sufficient to accelerate cell growth rate. However, when co-expressed with String, Mod is able to increase cell growth, validating the concept that cell growth achievement

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

integrates various independent molecular events. Therefore, future work dedicated to the identification of other dMyctarget should shed light on the molecular mechanisms that control cell size and cell growth downstream of dMyc in the mitogenic response.

4. Experimental procedures 4.1. Fly strains UASmod and P1-LacZ lines were generated by P-element mediated transformation. In the P{b5.8T12}; mod L8/TM6B strain (Roman et al., 2000), the mod L8 deletion removes the last three genes at the Tip of 3R. These are, from centromere to telomere, kurtz, mod and MAP 205. It has been shown that MAP205 is a non-essential gene (Pereira et al., 1992). Indeed terminal deletions of 3R, which only delete MAP205, are viable and do not display any growth defect. Since the P{b5.8T12} insertion mediates a selective krz rescue (Roman et al., 2000), the P{b5.8T12}; mod L8/TM6B selectively allowed the determination of mod loss of function phenotypes. The following fly strains have already been described: UASP35 (Hay et al., 1994); FRT82B, mod L8/TM6B (Perrin et al., 1998); Actin5C . CD2 . Gal4, UAS-GFP and enGal4, UASGFP (Neufeld et al., 1998); UASdmyc (Zaffran et al., 1998). The FRT82B, HS-pmyc, M(3)96C strain was generated by recombination of the FRT82B, HS-pmyc chromosome (Xu and Rubin, 1993) with the Minute mutation M(3)96C. To analyse somatic clones in a context rescued for krz, the krz rescue transgene (P{b5.8T12}) and the FRT82B, mod L8 chromosome were brought in the same line (P{b5.8T12}; FRT82B mod L8/ TM6B). The dmyc PL35 mutant (Bourbon et al., 2002) specifically affects dmyc function, as lethality can be rescued by ectopic dMyc expression (C.B. and D. Cribbs unpublished result).

653

identified by Acridine Orange staining as described (Neufeld et al., 1998). Mod immunodetection on third larval imaginal discs was performed as previously described, (Perrin et al., 1998) then discs were treated with RNAse A (15 mg/ml) in PBT, washed and incubated in a 5 mg/ml propidium iodine solution for 3 minutes. After several washes in PBT, discs were mounted in Permafluor for observation. In situ hybridisation was performed using a digoxigenin labelled probe according to Graba et al. (1994) and b-Galactosidase staining was performed as described in Alexandre et al. (1996). 4.4. RNA extraction and RT-PCR Total RNAs were extracted from embryos with the Trizol procedure following manufacturer’s instructions (Gibco BRL). One mg of total RNA was reverse transcribed using Superscript II RNase H2 reverse transcriptase (Gibco BRL) and oligodT primer in a final reaction volume of 20 ml. Semi quantitative PCR was performed using 2 ml of reverse transcript sample per reaction, 200 nM of each primer and 2U of Taq polymerase (Promega). The thermal cycling conditions included an initial denaturation step (95 8C for 5 min) and 20, 23, 26 and 29 cycles (94 8C for 30 s; 58 8C for 30 s and 728 for 1 min). Experiments were performed in duplicate. The sequences of the different primers used are the following: crq F: GCTGGCTGGAGGCACCTATCC30 , crqR: GCGGGAACATGTCGCCCGTGG30 ; dmycF: 50 CCGACGACCGGCTCTGATAG30 , dmycR: 50 GGCACGAGGGATTTGTGGGTA30 ; modF: 50 CGTGGAGGCGGTGA CTATATC30 , modR: 50 CACTTTCCGCAGGTCGGCTTC30 . 4.5. Size measurement in adults Twelve flies, either wild type or mod L8 escapers grown in optimal feeding conditions, were weighed 2 days after hatching. Analysis of wing area and cell density was performed as previously described (Montagne et al., 1999).

4.2. Generation of somatic clones

4.6. Flow cytometry

mod somatic clones were generated as previously described (Perrin et al., 1998). For the generation of somatic clones in a Minute background, a chromosome bearing both the FRT82B insertion and the Minute mutation M(3)96C was constructed.

Six hours egg collections from wild type or mod l8/þ adults were grown in optimal feeding conditions. 20 larvae of each genotype were collected just prior to pupariation during the short window of time (less than 3 h) when larvae immobilize and are no longer reactive, preceding anterior spiracle eversion and hardening of the external tissues (Bainbridge and Bownes, 1981). FACS analyses were performed according to Neufeld et al. (1998). Experiments were reproduced at least three times.

4.3. Immunohistochemistry, histology and in situ hybridisation Dissected larval tissues and imaginal discs were fixed in 4% paraformaldehyde/PBT (PBS, 0.1% Triton X100) for 15 min at room temperature, washed in PBT and incubated 5 min in Hoechst solution (5 mg/ml) for DNA detection. Tissues were extensively washed in PBT, and then mounted in Permafluor (Immunotech, France). Apoptotic cells were

4.7. Proliferation and growth rate measurements Clones expressing Gal4 were induced and identified using the flip out technique in HS-Flp; Act . CD2 . Gal4, UASGFP as described (Neufeld et al., 1998). GFP positive

654

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655

cells were counted using a Zeiss AxioPhot microscope. Cell doubling times (CDT) were obtained from the formula tðln 2=ln NÞ; where N is the mean cell number per clone and t the age (hours) of the clone. To measure clone and compartment size, discs were imaged using a Zeiss AxioPhot microscope and the areas of GFP-positive clones determined using the histogram function of Adobe Photoshop. Clonal over-expression was undertaken so that each discs did not contain more than five clones to avoid overlap between them. Each experiment was repeated at least twice on more than 80 clones for each condition leading to reproducible results. Mass doubling times (MDT) were calculated as MDT ¼ t{ln 2/ln(final clone area/area of one cell)} where t is the age (hours) of the clone. 4.8. P-element mediated transformation UASmod was constructed by ligation of the mod cDNA into a P(UAST) vector (Brand and Perrimon, 1993). Wild type or mutant P1 fragments containing mod regulatory sequences were generated by PCR amplification (primers available upon request) and subcloned in p(CasperAUGbGal). P-element transformation used standard methods (Rubin and Spradling, 1982). Several independent transformants were tested and gave similar results for each construct.

Acknowledgements We thank G. Roman and R.L. Davis for P{b5.8T12}; mod L8/TM6B flies, the Bloomington Stock Centre for providing the strains used for the somatic and germ line clonal analyses and Pierre Le´opold for UAS stocks. We also would like to thank Tracy Hayden for help with the FACS analysis and Michel Se´me´riva for fruitful discussions throughout this work. We also thank D. Cribbs for critical comments on the manuscript. This work was supported by the CNRS and by grants from l’ARC, LNCC and ACI to J.P., by a CEFIPRA postdoctoral fellowship to L.P. (Grant No. 1603-1) and by the Swiss Cancer League to J.M.

References Alexandre, E., Graba, Y., Fasano, L., Gallet, A., Perrin, L., De Zulueta, P., et al., 1996. The Drosophila teashirt homeotic protein is a DNA-binding protein and modulo, a HOM-C regulated modifier of variegation, is a likely candidate for being a direct target gene. Mech. Dev. 59, 191–204. Bainbridge, S.P., Bownes, M., 1981. Staging the metamorphosis of Drosophila melanogaster. J. Embryol. Exp. Morphol. 66, 57–80. Bohni, R., Riesgo-Escovar, J., Oldham, S., Brogiolo, W., Stocker, H., Andruss, B.F., et al., 1999. Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1-4. Cell 97, 865– 875. Bourbon, H.M., Gonzy-Treboul, G., Peronnet, F., Alin, M.F., Ardourel, C., Benassayag, C., et al., 2002. A P-insertion screen identifying novel X-linked essential genes in Drosophila. Mech. Dev. 110, 71 –83.

Brand, A.H., Perrimon, N., 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415. Britton, J.S., Edgar, B.A., 1998. Environmental control of the cell cycle in Drosophila: nutrition activates mitotic and endoreplicative cells by distinct mechanisms. Development 125, 2149– 2158. Caizergues-Ferrer, M., Belenguer, P., Lapeyre, B., Amalric, F., Wallace, M.O., Olson, M.O., 1987. Phosphorylation of nucleolin by a nucleolar type NII protein kinase. Biochemistry 26, 7876– 7883. Cohen, S.M., 1993. Imaginal Disc Development, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Conlon, I., Raff, M., 1999. Size control in animal development. Cell 96, 235 –244. Day, S.J., Lawrence, P.A., 2000. Measuring dimensions: the regulation of size and shape. Development 127, 2977–2987. Dennis, P.B., Fumagalli, S., Thomas, G., 1999. Target of rapamycin (TOR): balancing the opposing forces of protein synthesis and degradation. Curr. Opin. Genet. Dev. 9, 49 –54. Di Cristofano, A., Pandolfi, P.P., 2000. The multiple roles of PTEN in tumor suppression. Cell 100, 387–390. Eisenman, R.N., Cooper, J.A., 1995. Signal transduction. Beating a path to Myc. Nature 378, 438–439. Follette, P.J., Duronio, R.J., O’Farrell, P.H., 1998. Fluctuations in cyclin E levels are required for multiple rounds of endocycle S phase in Drosophila. Curr. Biol. 8, 235 –238. Gallant, P., Shiio, Y., Cheng, P.F., Parkhurst, S.M., Eisenman, R.N., 1996. Myc and Max homologs in Drosophila. Science 274, 1523–1527. Galloni, M., Edgar, B.A., 1999. Cell-autonomous and non-autonomous growth-defective mutants of Drosophila melanogaster. Development 126, 2365–2375. Gao, F.B., Raff, M., 1997. Cell size control and a cell-intrinsic maturation program in proliferating oligodendrocyte precursor cells. J. Cell. Biol. 138, 1367–1377. Gao, X., Pan, D., 2001. TSC1 and TSC2 tumor suppressors antagonize insulin signaling in cell growth. Genes Dev. 15, 1383–1392. Gao, X., Zhang, Y., Arrazola, P., Hino, O., Kobayashi, T., Yeung, R.S., et al., 2002. Tsc tumour suppressor proteins antagonize amino-acid– TOR signalling. Nat. Cell. Biol. 4, 699 –704. Garcia-Bellido, A., Ripoll, P., Morata, G., 1973. Developmental compartmentalisation of the wing disk of Drosophila. Nat. New Biol. 245, 251 –253. Garzino, V., Pereira, A., Laurenti, P., Graba, Y., Levis, R.W., Le Parco, Y., et al., 1992. Cell lineage-specific expression of modulo, a dosedependent modifier of variegation in Drosophila. Embo. J. 11, 4471–4479. Gingras, A.C., Kennedy, S.G., O’Leary, M.A., Sonenberg, N., Hay, N., 1998. 4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt(PKB) signaling pathway. Genes Dev. 12, 502 –513. Ginisty, H., Sicard, H., Roger, B., Bouvet, P., 1999. Structure and functions of nucleolin. J. Cell. Sci. 112, 761–772. Goberdhan, D.C., Paricio, N., Goodman, E.C., Mlodzik, M., Wilson, C., 1999. Drosophila tumor suppressor PTEN controls cell size and number by antagonizing the Chico/PI3-kinase signaling pathway. Genes Dev. 13, 3244–3258. Goncharova, E.A., Goncharov, D.A., Eszterhas, A., Hunter, D.S., Glassberg, M.K., Yeung, R.S., et al., 2002. Tuberin regulates p70 S6 kinase activation and ribosomal protein S6 phosphorylation. A role for the TSC2 tumor suppressor gene in pulmonary lymphangioleiomyomatosis (LAM). J. Biol. Chem. 277, 30958– 30967. Graba, Y., Laurenti, P., Perrin, L., Aragnol, D., Pradel, J., 1994. The modifier of variegation modulo gene acts downstream of dorsoventral and HOM-C genes and is required for morphogenesis in Drosophila. Dev. Biol. 166, 704 –715. Grandori, C., Eisenman, R.N., 1997. Myc target genes. Trends Biochem. Sci. 22, 177–181. Grandori, C., Mac, J., Siebelt, F., Ayer, D.E., Eisenman, R.N., 1996.

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655 Myc-Max heterodimers activate a DEAD box gene and interact with multiple E box-related sites in vivo. Embo. J. 15, 4344– 4357. Hay, B.A., Wolff, T., Rubin, G.M., 1994. Expression of baculovirus P35 prevents cell death in Drosophila. Development 120, 2121– 2129. Inoki, K., Li, Y., Zhu, T., Wu, J., Guan, K.L., 2002. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell. Biol. 4, 648 –657. Jefferies, H.B., Fumagalli, S., Dennis, P.B., Reinhard, C., Pearson, R.B., Thomas, G., 1997. Rapamycin suppresses 5’TOP mRNA translation through inhibition of p70s6k. Embo. J. 16, 3693–3704. Johnston, L.A., Prober, D.A., Edgar, B.A., Eisenman, R.N., Gallant, P., 1999. Drosophila myc regulates cellular growth during development. Cell 98, 779–790. Killander, D., Zetterberg, A., 1965. A quantitative cytochemical investigation of the relationship between cell mass and initiation of DNA synthesis in mouse fibroblasts in vitro. Exp. Cell. Res. 40, 12–20. Kim, S., Li, Q., Dang, C.V., Lee, L.A., 2000. Induction of ribosomal genes and hepatocyte hypertrophy by adenovirus-mediated expression of c-Myc in vivo. Proc. Natl Acad. Sci. USA 97, 11198– 11202. Manning, B.D., Tee, A.R., Logsdon, M.N., Blenis, J., Cantley, L.C., 2002. Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol. Cell. 10, 151–162. Montagne, J., 2000. Genetic and molecular mechanisms of cell size control. Mol. Cell. Biol. Res. Commun. 4, 195 –202. Montagne, J., Stewart, M.J., Stocker, H., Hafen, E., Kozma, S.C., Thomas, G., 1999. Drosophila S6 kinase: a regulator of cell size. Science 285, 2126–2129. Morata, G., Ripoll, P., 1975. Minutes: mutants of drosophila autonomously affecting cell division rate. Dev. Biol. 42, 211–221. Neufeld, P.N., Edgar, B.A., 1998. Connections between growth and the cell cycle. Curr. Opin. Cell. Biol. 10, 784– 790. Neufeld, T.P., de la Cruz, A.F., Johnston, L.A., Edgar, B.A., 1998. Coordination of growth and cell division in the Drosophila wing. Cell 93, 1183–1193. Nurse, P., Thuriaux, P., Nasmyth, K., 1976. Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146, 167 –178. Oldham, S., Montagne, J., Radimerski, T., Thomas, G., Hafen, E., 2000. Genetic and biochemical characterization of dTOR, the drosophila homolog of the target of rapamycin. Genes Dev. 14, 2689–2694. Pearson, M.J., 1974. Polyteny and the functional significance of the polytene cell cycle. J. Cell. Sci. 15, 457 –479. Pelengaris, S., Rudolph, B., Littlewood, T., 2000. Action of Myc in vivoproliferation and apoptosis. Curr. Opin. Genet. Dev. 10, 100 –105. Pereira, A., Doshen, J., Tanaka, E., Goldstein, L.S., 1992. Genetic analysis of a Drosophila microtubule-associated protein. J. Cell. Biol. 116 (2), 377–383. Perrin, L., Demakova, O., Fanti, L., Kallenbach, S., Saingery, S., Mal’ceva, N.I., et al., 1998. Dynamics of the sub-nuclear distribution of Modulo and the regulation of position-effect variegation by nucleolus in Drosophila. J. Cell. Sci. 111, 2753–2761. Perrin, L., Romby, P., Laurenti, P., Berenger, H., Kallenbach, S., Bourbon, H.M., et al., 1999. The Drosophila modifier of variegation modulo gene product binds specific RNA sequences at the nucleolus and interacts with DNA and chromatin in a phosphorylation-dependent manner. J. Biol. Chem. 274, 6315–6323. Potter, C.J., Huang, H., Xu, T., 2001. Drosophila Tsc1 functions with Tsc2 to antagonize insulin signaling in regulating cell growth, cell proliferation, and organ size. Cell 105, 357– 368.

655

Prober, D.A., Edgar, B.A., 2000. Ras1 promotes cellular growth in the Drosophila wing. Cell 100, 435– 446. Radimerski, T., Montagne, J., Rintelen, F., Stocker, H., Van der Kaay, J., Downes, C.P., Hafen, E., Thomas, G., 2002a. dSbK-regulated cell growth is dPKB/dPI(3)K-independent, but requires dPDK1Nat. Cell Biol. 4, 251– 255. Radimerski, T., Montagne, J., Hemmings-Mieszczak, M., Thomas, G., 2002b. Lethality of Drosophila lacking TSC tumor suppressor function rescued by reducing dS6K signaling. Genes Dev. 16, 2627–2632. Roman, G., He, J., Davis, R.L., 2000. kurtz, a novel nonvisual arrestin, is an essential neural gene in Drosophila. Genetics 155, 1281–1295. Rubin, G.M., Spradling, A.C., 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218, 348 –353. Shaw, P.J., Jordan, E.G., 1995. The nucleolus. Ann. Rev. Cell. Dev. Biol. 11, 93–121. Simpson, P., 1976. Analysis of the compartments of the wing of Drosophila melanogaster mosaic for a temperature-sensitive mutation that reduces mitotic rate. Dev. Biol. 54, 100 –115. Smith, A.V., Orr-Weaver, T.L., 1991. The regulation of the cell cycle during Drosophila embryogenesis: the transition to polyteny. Development 112, 997–1008. Stocker, H., Andjelkovic, M., Oldham, S., Laffargue, M., Wymann, M.P., Hemmings, B.A., et al., 2002. Living with lethal PIP3 levels: viability of flies lacking PTEN restored by a PH domain mutation in Akt/PKB. Science 295, 2088–2091. Stocker, H., Hafen, E., 2000. Genetic control of cell size. Curr. Opin. Genet. Dev. 10, 529 –535. Tapon, N., Ito, N., Dickson, B.J., Treisman, J.E., Hariharan, I.K., 2001. The Drosophila tuberous sclerosis complex gene homologs restrict cell growth and cell proliferation. Cell 105, 345– 355. Tee, A.R., Fingar, D.C., Manning, B.D., Kwiatkowski, D.J., Cantley, L.C., Blenis, J., 2002. Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin (mTOR)mediated downstream signaling. Proc. Natl Acad. Sci. USA 99, 13571–13576. Verdu, J., Buratovich, M.A., Wilder, E.L., Birnbaum, M.J., 1999. Cellautonomous regulation of cell and organ growth in Drosophila by Akt/PKB. Nat. Cell. Biol. 1, 500– 506. Weinkove, D., Leevers, S.J., 2000. The genetic control of organ growth: insights from Drosophila. Curr. Opin. Genet. Dev. 10, 75–80. Weinkove, D., Neufeld, T.P., Twardzik, T., Waterfield, M.D., Leevers, S.J., 1999. Regulation of imaginal disc cell size, cell number and organ size by Drosophila class I(A) phosphoinositide 3-kinase and its adaptor. Curr. Biol. 9, 1019–1029. Weiss, A., Herzig, A., Jacobs, H., Lehner, C.F., 1998. Continuous Cyclin E expression inhibits progression through endoreduplication cycles in Drosophila. Curr. Biol. 8, 239–242. Xu, T., Rubin, G., 1993. Analysis of genetic mosaics in developing and adult Drosophila tissues. Dev. Suppl. 117, 1223–1237. Young, J., Povey, S., 1998. The genetic basis of tuberous sclerosis. Mol. Med. Today 4, 313– 319. Zaffran, S., Chartier, A., Gallant, P., Astier, M., Arquier, N., Doherty, D., et al., 1998. A Drosophila RNA helicase gene, pitchoune, is required for cell growth and proliferation and is a potential target of d-Myc. Development 125, 3571–3584. Zhang, H., Stallock, J.P., Ng, J.C., Reinhard, C., Neufeld, T.P., 2000. Regulation of cellular growth by the drosophila target of rapamycin dTOR. Genes Dev. 14, 2712–2724.