- Email: [email protected]
Mojave rattlesnakes (Crotalus scutulatus scutulatus) lacking the acidic subunit DNA sequence lack Mojave toxin in their venom
Comparitive Biochemistry and Physiology Part B 130 Ž2001. 169᎐179
Mojave rattlesnakes ž Crotalus scutulatus scutulatus/ lacking the acidic subunit DNA sequence lack Mojave toxin in their venom B.J. Wooldridge, G. Pineda, J.J. Banuelas-Ornelas, R.K. Dagda, S.E. Gasanov, E.D. RaelU , C.S. Lieb Department of Biological Sciences, The Uni¨ ersity of Texas at El Paso, 500 West Uni¨ ersity A¨ enue, El Paso, TX 79968-0519, USA Received 2 March 2001; accepted 30 May 2001
Abstract The venom composition of Mojave rattlesnakes Ž Crotalus scutulatus scutulatus. differs in that some individuals have Mojave toxin and others do not. In order to understand the genetic basis for this difference, genomic DNA samples from Mojave rattlesnakes collected in Arizona, New Mexico, and Texas were analyzed for the presence of DNA sequences that relate to the acidic ŽMta. and basic ŽMtb. subunits of this toxin. DNA samples were subjected to PCR to amplify nucleotide sequences from second to fourth exons of the acidic and basic subunits. These nucleotide sequences were cloned and sequenced. The nucleotide sequences generated aligned exactly to previously published nucleotide sequences of Mojave toxin. All DNA samples analyzed generated product using the basic subunit primers, and aligned identically to the Mtb nucleotide sequence. However, only 11 out of the 14 samples generated a product with the acidic subunit primers. These 11 sequences aligned identically to the Mta nucleotide sequence. The venom from the three snakes whose DNA did not amplify with the acidic subunit primers were not recognized by antibodies to Mojave toxin. This suggests that snakes with venom lacking Mojave toxin also lack the productive nucleotide sequence for the acidic subunit in their DNA. 䊚 2001 Elsevier Science Inc. All rights reserved. Keywords: Mojave toxin; Genomic DNA; PCR; Nucleotide sequencing
1. Introduction Mojave toxin is a heterodimeric, presynapticacting neurotoxin in Mojave rattlesnake Ž Crotalus
U
Corresponding author. Tel.: q1-915-7476886; fax: 1-9157475808. E-mail address: [email protected] ŽE.D. Rael..
scutulatus scutulatus. venom. Most snakes of this species have an abundance of this toxin in their venom, whereas some snakes of this species lack the toxin totally ŽGlenn et al., 1983; Glenn and Straight, 1989.. The genetic basis for this difference has not been established. The toxin is composed of acidic and basic subunits, which are non-covalently associated ŽCate and Bieber, 1978; Aird and Kaiser, 1985.. The
1096-4959r01r$ - see front matter 䊚 2001 Elsevier Science Inc. All rights reserved. PII: S 1 0 9 6 - 4 9 5 9 Ž 0 1 . 0 0 4 2 2 - 5
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
170
acidic subunit is non-toxic and is thought to play a role in targeting the neurotoxin to sites of activity. Additionally, the acidic subunit enhances the toxicity of the basic subunit in a manner similar to that of Crotoxin ŽCate and Bieber, 1978; Degn et al., 1991.. The acidic subunit is composed of three disulfide linked polypeptide chains derived from the proteolytic processing of a phospholipase A 2 ŽPLA 2 .-like precursor ŽBieber et al., 1990; Aird et al., 1985; Bouchier et al., 1991.. The basic subunit by itself is weakly toxic and exhibits PLA 2 activity ŽAird et al., 1986.. The amino acid sequences of both acidic and basic subunits are known ŽBieber et al., 1990; Aird et al., 1990., and the genomic sequences encoding the acidic and basic subunits have been determined ŽJohn et al., 1994.. Nucleotide sequence identity between acidic and basic subunits is high: 70% in the exon sequences and greater than 90% in the intron sequences ŽJohn et al., 1994.. The overall gene structure organization for
both acidic and basic subunits is also alike, each having four exons separated by three introns, and the exons inserted in the same relative positions of the gene. This arrangement is similar to that reported for mammalian Group II PLA 2 DNA sequences ŽSeilhamer et al., 1989; Kusunoki et al., 1990.. In this study, we examined genomic DNA from Mojave and other rattlesnakes for the presence of DNA sequences that relate to Mojave toxin. We suggest that the defect in the production of Mojave toxin by some snakes is due to a defect in the acidic subunit gene.
2. Materials and methods 2.1. Study sample Venom and blood was obtained from snakes captured in Arizona, New Mexico and Texas.
Table 1 Locality data, venom recognition by anti-Mojave toxin antibodies ŽCSS12., and amplification of genomic DNA with primers to the acidic and basic subunits of Mojave toxin Snake
Locality
CSS12a
Acidic subunit primers Žnucleotide size.
Basic subunit primers Žnucleotide size.
Css28b Css31 Css36 Css61 Css62 Css64 Css65 Css66 Css67 Css68 Css69 Css71 Css74 Css75 Cdv1 Clk54 Cll55 Clk56 Clk57 Caa24 Caa25 Caa26 Cmm87 Cmm88 Cmm90 Cmm91
El Paso County, Texas Offspring of Css28 Offspring of Css28 Hudspeth County, Texas Hudspeth County, Texas Hidalgo County, New Mexico Cochise County, Arizona Cochise County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Captive, no data Dona Ana County, New Mexico El Paso County, Texas Dona Ana County, New Mexico Dona Ana County, New Mexico Live Oak County, Texas Aransas County, Texas Dona Ana County, New Mexico Pecos County, Texas Gila County, Arizona El Paso County, Texas Pecos County, Texas
q q q q q q q ᎐ ᎐ ᎐ q q q q q ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐
1200 1200 1200 1200 1200 1200 1200 ᎐ ᎐ ᎐ 1200 1200 1200 1200 1200 ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ 1050 1050 1050 1050
1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 ᎐ ᎐ 1175 ᎐ 950 950 950 950 950 950 950
a
Anti-Mojave toxin antibody. Css s C. s. scutulatus; Cdvs C. d. ¨ egrandis; Clk, C. l. klauberi; Cll s C. l. lepidus; Caa s C. atrox; Cmms C. m. molossus.
b
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
Locality information for the snakes is shown in Table 1. 2.2. DNA extraction Blood was withdrawn from the caudal vein with syringe and needle, then transferred into a tube containing sodium citrate. DNA was extracted from whole blood using DNAzol BD, a guanidine-detergent ŽMolecular Research Center, Inc., Cincinnati, OH, USA.. After precipitation with isoproponal and washing with ethanol, the DNA was stored in 0.01 M Tris᎐EDTA ŽTE. buffer. Quantification of DNA was done at OD 260 . 2.3. Oligonucleotides Primers for amplification were designed based on published genomic DNA sequences for Mojave toxin acidic ŽMta. and basic ŽMtb. subunits ŽJohn et al., 1994.. The primer pairs, amplification sites, and corresponding snake base sequences are listed in Table 2. Corresponding sequences for Crotoxin, a Mojave toxin-like toxin was included for comparative purposes. Mojave toxin primers anneal to the second Žsense. and fourth Žanti-sense . exons excluding the flanking regions and the signal peptide-coding exon. The specificity for these sites was verified through BLAST ŽNational Center for Biotechnology Information..
2.4. DNA amplification DNA amplification was done using a PCR kit C ŽInvitrogen, Carlsbad, CA, USA.. DNA Ž1᎐2 g., primers Ž1 M., Taq DNA polymerase Ž2.5 units., dNTP mix Ž1 mM., and MgCl 2 Ž2.5 mM. were mixed in a volume of 50 l. PCR was done in 30 cycles of heat denaturation at 94⬚C for 1 min, annealing for 2 min and extension at 72⬚C for 3 min, and a final extension at 72⬚C for 10 min. The PCR annealing temperatures for Mta and Mtb were 46⬚C and 42⬚C, respectively. Analysis of the amplified products was done by electrophoresis in 1% agarose gels in TAE ŽTris᎐acetic acid᎐EDTA. buffer and visualized with ethidium bromide. A 100-bp ladder ŽAmersham Pharmacia Biotech, Inc.. was used to determine the size of PCR products. 2.5. Cloning Amplified PCR products were purified from agarose gel with a Guantum Prep Gel Slice Kit ŽBio-Rad, Hercules, CA, USA. and ligated into the pCR2.1 plasmid ŽInvitrogen, Carlsbad, CA, USA.. E. coli strain TOP⬘ 10F competent cells were transformed with ligation reactions using the Original TA Cloning kit ŽInvitrogen, Carlsbad, CA, USA.. Cells were grown overnight at 37⬚C on TSB plates containing kanamycin Ž100
Table 2 Primers used for amplifying Mojave toxin subunits genes from Crotalus s. scutulatus genomic DNA Primer
Amplification site
Corresponding sequence
Mojave toxin Ž1669᎐1695. Crotoxinc Ž295᎐321.
GGTATTTCGTACTACAGCTCTTACGGA GGTATTTCGTACTACAGCTCTTACGGA GGTATTTCGTACTACAGCTCTTACGGA
Mojave toxin Ž2925᎐2908. Crotoxin Ž602᎐585.
TGATTCCCCCTGGCAATT TGATTCCCCCTGGCAATT TGATTCCCCCTGGCAATT
Mojave toxin Ž867᎐893. Crotoxin Ž291᎐317.
AACGCTATTCCCTTCTATGCCTTTTAC AACGCTATTCCCTTCTATGCCTTTTAC AACGCTATTCCCTTCTATGCCTTTTAC
Mojave toxin Ž2012᎐1988. Crotoxin Ž515᎐491.
CCTGTCGCACTCACAAATCTGTTCC CCTGTCGCACTCACAAATCTGTTCC CCTGTCGCACTCACAAATCTGTTCC
a
MTXa ŽSense.
MTXa ŽAntisense.
MTXbb ŽSense.
MTXb ŽAntisense.
a
MTXa, Mojave toxin acidic subunit. MTXb, Mojave toxin basic subunit. c Corresponding Crotoxin sequences. b
171
172
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
grml., IPTG Ž0.1 M., and X-Gal Ž25 gr1.25 ml.. White colonies were re-plated and grown overnight to ensure that the colonies were transformants. Positive clones were grown in 10 ml TSB broth at 37⬚C overnight, and the plasmids were isolated from the culture with the Wizard Plus Minipreps DNA Purification kit ŽPromega, Madison, WI.. Plasmids were examined for inserts by EcoRI digestion and by electrophoresis to determine the size of insert. 2.6. Base sequencing Plasmid DNA with inserts were amplified by PCR using M13 Forward Žy29.rIRD700 and M13 ReverserIRD800 dye-labeled primers Ž7.5= 10y8 M each. ŽLI-COR, Lincoln, NE. using the SequiTherm Excel TM II DNA Sequencing Kit-LC for 66-cm gels ŽEpicenter Technologies, Madison, WI.. PCR products were electrophoresed in a 3.6% polyacrylamide gel in TBE buffer on a LI-COR LongReadIR 4200 DNA Sequencer at 2000 V, 25.0 mA, 45.0 W, at 45⬚C. The sequences obtained were analyzed using the Vector NTI TM Suite program ŽInforMax, Inc., North Bethesda, MD, USA. and aligned to known sequences using the BLAST program in the FASTA format. 2.7. Venom analysis by Western blotting Isoelectric focusing and Western blots were done as previously described ŽRael et al., 1993.. The primary antibody in the reaction was CSS12, a mouse monoclonal antibody that recognizes Mojave toxin. Its specificity has been described previously ŽRael et al., 1986; Martinez et al., 1989..
showing that snakes of the two venom types are present in the same region. Additionally, the anti-Mojave toxin antibodies recognized venom from snake C. durissus ¨ egrandis ŽUracoan rattlesnake; Cdv1., a rattlesnake species that has a Crotoxin-like neurotoxin. The anti-Mojave toxin antibodies did not recognize the venom from C. lepidus klauberi ŽBanded rock rattlesnake; Clk54, Clk56, Clk57., C. l. lepidus ŽMottled rock rattlesnake; Cll55., C. atrox ŽWestern diamondback rattlesnake; Caa24, Caa25, Caa26. or C. molossus molossus ŽNorthern blacktailed rattlesnake; Cmm87, Cmm88, Cmm90, Cmm91.. To determine whether the nucleotide base sequences for the acidic and basic subunits of Mojave toxin are present in all of the rattlesnakes in this sampling, DNA from the snakes was amplified by PCR with the Mta and Mtb primer pairs. Electrophoresis of the amplified DNA from selected snakes is shown in Fig. 1. Amplification of Mojave rattlesnake DNA Žsnakes with Mojave toxin. generated a 1200-base fragment with the Mta primers ŽFig. 1, lane a. and an 1100-base fragment with the Mtb primers ŽFig. 1, lane b.. The size of the DNA fragments generated in both amplifications was as expected according to acidic and basic subunit sequences published previously for Mojave toxin ŽJohn et al., 1994.. Mta and Mtb primers also amplified similar size fragments, 1200 and 1100 bp, from C. d. ¨ egrandis DNA ŽFig. 1, lanes c and d.. The size of these fragments correlates exactly with what was expected according to the previously published acidic and basic subunit sequences of Crotoxin ŽBouchier et al., 1991.. The Mtb primers also generated product with
3. Results All of the C. s. scutulatus venoms were recognized by CSS12, the anti-Mojave toxin antibodies, except for venom from snakes Css66, Css67, and Css68 ŽTable 1.. This indicates that all of the venoms, except for venom from these three snakes, had Mojave toxin. The three snakes lacking Mojave toxin were captured in Cochise and Maricopa Counties, Arizona, localities where Mojave rattlesnakes are known not to possess this toxin. Four other snakes, which were captured in Maricopa county, tested positive for the toxin,
Fig. 1. PCR amplification of genomic DNA from C. s. scutulatus Ža, b., C. d. ¨ egrandiss Žc, d., C. atrox Že, f., C. m. molossus Žg, h., and C. l. klauberi Ži, j. with Mta Ža, c, e, g, i. and Mtb Žb, d, f, h, j. primers. Žl. is a 100-bp ladder.
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
both C. atrox and C. m. molossus DNA ŽFig. 1, lanes f and h., generating an Mtb product of 950 bases. The Mta primers, however, amplified C. m.
173
molossus DNA, but not C. atrox DNA, generating a fragment of 1050 ŽFig. 1, lane g.. Both Mta and Mtb primers did not amplify C. l. lepidus DNA.
Fig. 2. Alignment of nucleotide fragments from C. s. scutulatus ŽMojave toxin acidic. and C. m. molossus ŽMTA. genomic DNA samples that were amplified with the Mta primers. Differences between the sequences are indicated ŽU ..
174
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
Fig. 2. Ž Continued..
The Mtb primers, however, amplified DNA from one C. l. klauberi rattlesnake, Clk56, generating a fragment close to 1200 ŽFig. 1, lane j., but did not amplify DNA of other C. l. klauberi rattlesnakes, Clk54 and Clk57 ŽTable 1..
The generated DNA fragments from all the snakes were subsequently sequenced, and then aligned to sequences in the BLAST database. The sequences obtained from all of the C. s. scutulatus and C. d. ¨ egrandis DNA in the study sample
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
175
Fig. 3. Alignment of nucleotide fragments from C. s. scutulatus ŽMojave toxin basic., C. m. molossus ŽMTB., C. atrox ŽMTB., and C. l. klauberi ŽMTB. genomic DNA samples amplified with the Mtb primers.
176
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
Fig. 3. Ž Continued..
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
177
Fig. 3. Ž Continued..
aligned exactly to the corresponding DNA regions of the acidic and basic subunits of Mojave toxin and Crotoxin for both Mta and Mtb fragments. The C. s. scutulatus and C. d. ¨ egrandis sequences also aligned to other venom phospholipases, but with identities of less than 70%. This shows that the fragments generated with the Mta and Mtb primers are specific for the Mojave toxin and Crotoxin subunits. None of the sequences obtained with the C. atrox, C. m. molossus and C. l. klauberi fragments aligned exactly to any nucleotide sequence retrieved from the BLAST database, but aligned to various degrees of identity to DNA and RNA relating to phospholipases of other snakes. The fragment generated from C. m. molossus DNA with the Mta primers aligned with 94% identity from bases 1 to 221 to the published Mojave toxin base sequence 1669 to 1889, but with less than 30% identity to the rest of the acidic subunit generated by the Mta primer pair. The overall sequence identity between the Mta primer-generated C. m. molossus fragment and corresponding Mojave toxin acidic subunit DNA was 43.1% ŽFig. 2.. The sequences generated with the Mtb primers with C. atrox and C. m. molossus DNA were very similar with close to 99% sequence identity ŽFig.
3.. Alignment of the C. atrox and C. m. molossus sequences with the corresponding Mojave toxin basic subunit sequence showed close to 67% identity. The sequence generated with the Mtb primers with C. l. klauberi DNA was significantly different from that of C. atrox and C. m. molossus. This sequence showed 44.5% identity to the corresponding Mojave toxin basic subunit sequence. Thus, from these experiments, one can conclude that the Mta and Mtb primer pairs are specific for the Mojave toxin and Crotoxin subunits in the context of fragment size and base sequences generated. The PCR results obtained for all rattlesnakes are shown in Table 1. It should be noted that the primers for Mtb amplified the genomic DNA of all C. s. scutulatus and C. d. ¨ egrandis samples. The Mta primers, however, amplified all of the same samples except for genomic DNA from Css66, Css67 and Css68. These are the same three snakes whose venom was not recognized by the anti-Mojave toxin antibodies.
4. Discussion Population studies on venom compositional differences have indicated that some C. s. scutula-
178
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
tus in central Arizona lack Mojave toxin and that an inverse relationship exists between Mojave toxin and hemorrhagic toxin Žmetalloproteinase. in venom of these snakes ŽGlenn et al., 1983; Glenn and Straight, 1989.. Subsequent reports have shown that the venom from some Mojave rattlesnakes contains both toxins and that an intergradation of venom properties exists between the two venom types extending outward from central Arizona ŽGlenn and Straight, 1989; Wilkinson et al., 1991.. In one of our studies, using differences in Mojave toxin and hemorrhagic toxin as indicators of venom differences, we demonstrated that venom from some snakes in El Paso County, Texas also differ ŽRael et al., 1993.. In the present study, we examined the venom and genomic DNA of C. s. scutulatus to relate the expression of Mojave toxin in the venom to the Mojave toxin nucleotide base sequences in the snake genome. We found that three of the C. s. scutulatus snakes in the study group lacked Mojave toxin in their venom. These snakes were collected in Cochise and Maricopa Counties in Arizona ŽCss66᎐68., the region where the venom of Mojave rattlesnakes have been shown to lack Mojave toxin. We also found that the venom of four of the snakes from this same region ŽCss69, 71, 74 and 75. had Mojave toxin. This indicates that snakes of both venom types are present in this region, information of importance to clinicians. As expected, there was no Mojave toxin found in venom of C. atrox, C. m. molossus, C. l. klauberi and C. l. lepidus. At the DNA level, we found that the primers for the Mojave toxin basic subunit amplified the DNA of all the snakes in the C. s. scutulatus study group. Furthermore, the amplified DNA of each snake was cloned and sequenced, and all the sequences obtained aligned exactly to the Mojave toxin basic subunit DNA. With the Mojave toxin acidic subunit primers, DNA from 11 of the 14 C. s. scutulatus snakes amplified and were subsequently sequenced. The sequences obtained had 100% identity to the nucleotide sequence of the Mojave toxin acidic subunit. Both acidic and basic subunit primers amplified sequences from C. m. molossus DNA, and the basic subunit primers also amplified C. atrox DNA and DNA of one of the C. l. klauberi rattlesnakes. The amplified PCR samples were cloned and sequenced. Although the sequences obtained were
relevant to snake venom phospholipase genes, none of them aligned exactly to Mojave toxin acidic and basic subunit DNA. These rattlesnakes did not have Mojave toxin genes. The three C. s. scutulatus snakes whose DNA was not amplified with the acidic subunit primers were from the same snakes that did not express Mojave toxin in their venom. We, therefore, suggest that snakes lacking Mojave toxin do not express the toxin because the nucleotide sequence for the acidic subunit is lacking, either completely or partially. Although we think it unlikely, it is possible that a modified acidic subunit sequence is present in these snakes, but which lack the sequence to which our primers anneal. Such a sequence would than code for a modified acidic subunit, probably different from the ‘normal’ acidic subunit. We made no attempt in this study to determine whether either of the Mojave toxin subunits was produced in the venom, other than by detection with anti-Mojave toxin antibodies. These antibodies recognize the complete toxin and are not reactive with the individual subunits. It is, therefore, possible that the two subunits are produced by the three snakes lacking Mojave toxin, but subsequently fail to associate properly post-translationally. Previous research has indicated that association of the two peptides is a requirement for neurotoxicity ŽCate and Bieber, 1978.. We are currently investigating whether either or both acidic and basic subunits are present in the venom of other rattlesnake species ostensibly lacking the complete Mojave toxin.
5. Conclusions An aberration andror lack of the Mojave toxin acidic subunit gene seems to be responsible for absence of expressed Mojave toxin in some Mojave rattlesnake venoms. The Mojave toxin acidic subunit primers that we designed amplify specifically the acidic subunit DNA in C. s. scutulatus samples and can be used to screen rattlesnake DNA samples in population studies.
Acknowledgements This study was supported by NIH grants S06GM08012 and RR08124. The Arizona Depart-
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
ment of Fish and Game, the New Mexico Department of Game and Fish, and the Texas Parks and Wildlife Department issued scientific permits for collection of snakes. References Aird, S.D., Kaiser, I.I., 1985. Comparative studies on three rattlesnake toxins. Toxicon 23, 361᎐374. Aird, S.D., Kaiser, I.I., Lewis, R.V., Kruggel, W.G., 1985. Rattlesnake presynaptic neurotoxins: primary structure and evolutionary origin of the acidic subunit. Biochemistry 24, 7054᎐7058. Aird, S.D., Kaiser, I.I., Lewis, R.V., Kruggel, W.G., 1986. A complete amino acid sequence for the basic subunit of Crotoxin. Arch. Biochem. Biophys. 249, 296᎐300. Aird, S.D., Kruggle, W.G., Kaiser, I.I., 1990. Amino acid sequence of the basic subunit of Mojave toxin from the venom of the Mojave rattlesnake Ž Crotalus scutulatus scutulatus.. Toxicon 28, 669᎐673. Bieber, A.L., Becker, R.R., McParland, R. et al., 1990. The complete sequence of the acidic subunit from Mojave toxin determined by Edman degradation and mass spectrometry. Biochim. Biophys. Acta. 1037, 413᎐421. Bouchier, C., Boulain, J.-C., Bon, C., Menez, A., 1991. Analysis of cDNAs encoding the two subunits of Crotoxin, a phospholipase A 2 neurotoxin from rattlesnake venom: the acidic non enzymatic subunit derives from a phospholipase A 2-like precursor. Biochim. Biophys. Acta 1088, 401᎐408. Cate, R.L., Bieber, A.L., 1978. Purification and characterization of Mojave Ž Crotalus scutulatus scutulatus. toxin and its subunits. Arch. Biochem. Biophys. 189 Ž2., 397᎐408. Degn, L.L., Seebart, C.S., Kaiser, I.I., 1991. Specific binding of Crotoxin to brain synaptosomes and synaptosomal membranes. Toxicon 29, 973᎐988.
179
Glenn, J.L., Straight, R.C., 1989. Integration of two different venom populations of the Mojave rattlesnake Ž Crotalus scutulatus scutulatus. in Arizona. Toxicon 21, 411᎐418. Glenn, J.L., Straight, R.C., Wolfe, M.C., Hardy, D.L., 1983. Geographical variation in Crotalus scutulatus scutulatus ŽMojave rattlesnake . venom properties. Toxicon 21, 119᎐130. John, T.R., Smith, L.A., Kaiser, I.I., 1994. Genomic sequences encoding the acidic and basic subunits of Mojave toxin: unusually high sequence identity of non-coding regions. Gene 139, 229᎐234. Kusunoki, C., Satoh, S., Kobayashi, M., Niwa, M., 1990. Structure of genomic DNA for rat platelet phospholipase A 2 . Biochim. Biophys. Acta 1087, 95᎐97. Martinez, R.A., Huang, S.Y., Rael, E.P., Perez, J.C., 1989. Antigenic relationships of fractionated western diamondback rattlesnake Ž Crotalus atrox . hemorrhagic toxins and other rattlesnake venoms as indicated by monoclonal antibodies. Toxicon 27, 239᎐245. Rael, E.D., Salo, R.J., Zepeda, H., 1986. Monoclonal antibodies to Mojave toxin and use for isolation of cross-reacting proteins in Crotalus venoms. Toxicon 24, 661᎐668. Rael, E.D., Lieb, C.S., Maddux, N., Varela-Ramirez, A., Perez, J., 1993. Hemorrhagic and Mojave toxins in venoms of offspring of two Mojave rattlesnakes Ž Crotalus scutulatus scutulatus.. Comp. Biochem. Physiol. 1106b, 595᎐600. Seilhamer, J.J., Pruzanski, W., Vadas, P. et al., 1989. Cloning and recombinant expression of phospholipase A 2 present in rheumatoid arthritis synovial fluid. J. Biol. Chem. 264, 5335᎐5338. Wilkinson, J.A., Glenn, J.L., Straight, R.C., Sites, J.W., 1991. Distribution and genetic variation in venom A and B populations of Mojave rattlesnakes Ž Crotalus scutulatus scutulatus. in Arizona. Herpetologica 47, 54᎐68.
Mojave rattlesnakes ž Crotalus scutulatus scutulatus/ lacking the acidic subunit DNA sequence lack Mojave toxin in their venom B.J. Wooldridge, G. Pineda, J.J. Banuelas-Ornelas, R.K. Dagda, S.E. Gasanov, E.D. RaelU , C.S. Lieb Department of Biological Sciences, The Uni¨ ersity of Texas at El Paso, 500 West Uni¨ ersity A¨ enue, El Paso, TX 79968-0519, USA Received 2 March 2001; accepted 30 May 2001
Abstract The venom composition of Mojave rattlesnakes Ž Crotalus scutulatus scutulatus. differs in that some individuals have Mojave toxin and others do not. In order to understand the genetic basis for this difference, genomic DNA samples from Mojave rattlesnakes collected in Arizona, New Mexico, and Texas were analyzed for the presence of DNA sequences that relate to the acidic ŽMta. and basic ŽMtb. subunits of this toxin. DNA samples were subjected to PCR to amplify nucleotide sequences from second to fourth exons of the acidic and basic subunits. These nucleotide sequences were cloned and sequenced. The nucleotide sequences generated aligned exactly to previously published nucleotide sequences of Mojave toxin. All DNA samples analyzed generated product using the basic subunit primers, and aligned identically to the Mtb nucleotide sequence. However, only 11 out of the 14 samples generated a product with the acidic subunit primers. These 11 sequences aligned identically to the Mta nucleotide sequence. The venom from the three snakes whose DNA did not amplify with the acidic subunit primers were not recognized by antibodies to Mojave toxin. This suggests that snakes with venom lacking Mojave toxin also lack the productive nucleotide sequence for the acidic subunit in their DNA. 䊚 2001 Elsevier Science Inc. All rights reserved. Keywords: Mojave toxin; Genomic DNA; PCR; Nucleotide sequencing
1. Introduction Mojave toxin is a heterodimeric, presynapticacting neurotoxin in Mojave rattlesnake Ž Crotalus
U
Corresponding author. Tel.: q1-915-7476886; fax: 1-9157475808. E-mail address: [email protected] ŽE.D. Rael..
scutulatus scutulatus. venom. Most snakes of this species have an abundance of this toxin in their venom, whereas some snakes of this species lack the toxin totally ŽGlenn et al., 1983; Glenn and Straight, 1989.. The genetic basis for this difference has not been established. The toxin is composed of acidic and basic subunits, which are non-covalently associated ŽCate and Bieber, 1978; Aird and Kaiser, 1985.. The
1096-4959r01r$ - see front matter 䊚 2001 Elsevier Science Inc. All rights reserved. PII: S 1 0 9 6 - 4 9 5 9 Ž 0 1 . 0 0 4 2 2 - 5
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
170
acidic subunit is non-toxic and is thought to play a role in targeting the neurotoxin to sites of activity. Additionally, the acidic subunit enhances the toxicity of the basic subunit in a manner similar to that of Crotoxin ŽCate and Bieber, 1978; Degn et al., 1991.. The acidic subunit is composed of three disulfide linked polypeptide chains derived from the proteolytic processing of a phospholipase A 2 ŽPLA 2 .-like precursor ŽBieber et al., 1990; Aird et al., 1985; Bouchier et al., 1991.. The basic subunit by itself is weakly toxic and exhibits PLA 2 activity ŽAird et al., 1986.. The amino acid sequences of both acidic and basic subunits are known ŽBieber et al., 1990; Aird et al., 1990., and the genomic sequences encoding the acidic and basic subunits have been determined ŽJohn et al., 1994.. Nucleotide sequence identity between acidic and basic subunits is high: 70% in the exon sequences and greater than 90% in the intron sequences ŽJohn et al., 1994.. The overall gene structure organization for
both acidic and basic subunits is also alike, each having four exons separated by three introns, and the exons inserted in the same relative positions of the gene. This arrangement is similar to that reported for mammalian Group II PLA 2 DNA sequences ŽSeilhamer et al., 1989; Kusunoki et al., 1990.. In this study, we examined genomic DNA from Mojave and other rattlesnakes for the presence of DNA sequences that relate to Mojave toxin. We suggest that the defect in the production of Mojave toxin by some snakes is due to a defect in the acidic subunit gene.
2. Materials and methods 2.1. Study sample Venom and blood was obtained from snakes captured in Arizona, New Mexico and Texas.
Table 1 Locality data, venom recognition by anti-Mojave toxin antibodies ŽCSS12., and amplification of genomic DNA with primers to the acidic and basic subunits of Mojave toxin Snake
Locality
CSS12a
Acidic subunit primers Žnucleotide size.
Basic subunit primers Žnucleotide size.
Css28b Css31 Css36 Css61 Css62 Css64 Css65 Css66 Css67 Css68 Css69 Css71 Css74 Css75 Cdv1 Clk54 Cll55 Clk56 Clk57 Caa24 Caa25 Caa26 Cmm87 Cmm88 Cmm90 Cmm91
El Paso County, Texas Offspring of Css28 Offspring of Css28 Hudspeth County, Texas Hudspeth County, Texas Hidalgo County, New Mexico Cochise County, Arizona Cochise County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Maricopa County, Arizona Captive, no data Dona Ana County, New Mexico El Paso County, Texas Dona Ana County, New Mexico Dona Ana County, New Mexico Live Oak County, Texas Aransas County, Texas Dona Ana County, New Mexico Pecos County, Texas Gila County, Arizona El Paso County, Texas Pecos County, Texas
q q q q q q q ᎐ ᎐ ᎐ q q q q q ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐
1200 1200 1200 1200 1200 1200 1200 ᎐ ᎐ ᎐ 1200 1200 1200 1200 1200 ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ ᎐ 1050 1050 1050 1050
1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 1100 ᎐ ᎐ 1175 ᎐ 950 950 950 950 950 950 950
a
Anti-Mojave toxin antibody. Css s C. s. scutulatus; Cdvs C. d. ¨ egrandis; Clk, C. l. klauberi; Cll s C. l. lepidus; Caa s C. atrox; Cmms C. m. molossus.
b
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
Locality information for the snakes is shown in Table 1. 2.2. DNA extraction Blood was withdrawn from the caudal vein with syringe and needle, then transferred into a tube containing sodium citrate. DNA was extracted from whole blood using DNAzol BD, a guanidine-detergent ŽMolecular Research Center, Inc., Cincinnati, OH, USA.. After precipitation with isoproponal and washing with ethanol, the DNA was stored in 0.01 M Tris᎐EDTA ŽTE. buffer. Quantification of DNA was done at OD 260 . 2.3. Oligonucleotides Primers for amplification were designed based on published genomic DNA sequences for Mojave toxin acidic ŽMta. and basic ŽMtb. subunits ŽJohn et al., 1994.. The primer pairs, amplification sites, and corresponding snake base sequences are listed in Table 2. Corresponding sequences for Crotoxin, a Mojave toxin-like toxin was included for comparative purposes. Mojave toxin primers anneal to the second Žsense. and fourth Žanti-sense . exons excluding the flanking regions and the signal peptide-coding exon. The specificity for these sites was verified through BLAST ŽNational Center for Biotechnology Information..
2.4. DNA amplification DNA amplification was done using a PCR kit C ŽInvitrogen, Carlsbad, CA, USA.. DNA Ž1᎐2 g., primers Ž1 M., Taq DNA polymerase Ž2.5 units., dNTP mix Ž1 mM., and MgCl 2 Ž2.5 mM. were mixed in a volume of 50 l. PCR was done in 30 cycles of heat denaturation at 94⬚C for 1 min, annealing for 2 min and extension at 72⬚C for 3 min, and a final extension at 72⬚C for 10 min. The PCR annealing temperatures for Mta and Mtb were 46⬚C and 42⬚C, respectively. Analysis of the amplified products was done by electrophoresis in 1% agarose gels in TAE ŽTris᎐acetic acid᎐EDTA. buffer and visualized with ethidium bromide. A 100-bp ladder ŽAmersham Pharmacia Biotech, Inc.. was used to determine the size of PCR products. 2.5. Cloning Amplified PCR products were purified from agarose gel with a Guantum Prep Gel Slice Kit ŽBio-Rad, Hercules, CA, USA. and ligated into the pCR2.1 plasmid ŽInvitrogen, Carlsbad, CA, USA.. E. coli strain TOP⬘ 10F competent cells were transformed with ligation reactions using the Original TA Cloning kit ŽInvitrogen, Carlsbad, CA, USA.. Cells were grown overnight at 37⬚C on TSB plates containing kanamycin Ž100
Table 2 Primers used for amplifying Mojave toxin subunits genes from Crotalus s. scutulatus genomic DNA Primer
Amplification site
Corresponding sequence
Mojave toxin Ž1669᎐1695. Crotoxinc Ž295᎐321.
GGTATTTCGTACTACAGCTCTTACGGA GGTATTTCGTACTACAGCTCTTACGGA GGTATTTCGTACTACAGCTCTTACGGA
Mojave toxin Ž2925᎐2908. Crotoxin Ž602᎐585.
TGATTCCCCCTGGCAATT TGATTCCCCCTGGCAATT TGATTCCCCCTGGCAATT
Mojave toxin Ž867᎐893. Crotoxin Ž291᎐317.
AACGCTATTCCCTTCTATGCCTTTTAC AACGCTATTCCCTTCTATGCCTTTTAC AACGCTATTCCCTTCTATGCCTTTTAC
Mojave toxin Ž2012᎐1988. Crotoxin Ž515᎐491.
CCTGTCGCACTCACAAATCTGTTCC CCTGTCGCACTCACAAATCTGTTCC CCTGTCGCACTCACAAATCTGTTCC
a
MTXa ŽSense.
MTXa ŽAntisense.
MTXbb ŽSense.
MTXb ŽAntisense.
a
MTXa, Mojave toxin acidic subunit. MTXb, Mojave toxin basic subunit. c Corresponding Crotoxin sequences. b
171
172
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
grml., IPTG Ž0.1 M., and X-Gal Ž25 gr1.25 ml.. White colonies were re-plated and grown overnight to ensure that the colonies were transformants. Positive clones were grown in 10 ml TSB broth at 37⬚C overnight, and the plasmids were isolated from the culture with the Wizard Plus Minipreps DNA Purification kit ŽPromega, Madison, WI.. Plasmids were examined for inserts by EcoRI digestion and by electrophoresis to determine the size of insert. 2.6. Base sequencing Plasmid DNA with inserts were amplified by PCR using M13 Forward Žy29.rIRD700 and M13 ReverserIRD800 dye-labeled primers Ž7.5= 10y8 M each. ŽLI-COR, Lincoln, NE. using the SequiTherm Excel TM II DNA Sequencing Kit-LC for 66-cm gels ŽEpicenter Technologies, Madison, WI.. PCR products were electrophoresed in a 3.6% polyacrylamide gel in TBE buffer on a LI-COR LongReadIR 4200 DNA Sequencer at 2000 V, 25.0 mA, 45.0 W, at 45⬚C. The sequences obtained were analyzed using the Vector NTI TM Suite program ŽInforMax, Inc., North Bethesda, MD, USA. and aligned to known sequences using the BLAST program in the FASTA format. 2.7. Venom analysis by Western blotting Isoelectric focusing and Western blots were done as previously described ŽRael et al., 1993.. The primary antibody in the reaction was CSS12, a mouse monoclonal antibody that recognizes Mojave toxin. Its specificity has been described previously ŽRael et al., 1986; Martinez et al., 1989..
showing that snakes of the two venom types are present in the same region. Additionally, the anti-Mojave toxin antibodies recognized venom from snake C. durissus ¨ egrandis ŽUracoan rattlesnake; Cdv1., a rattlesnake species that has a Crotoxin-like neurotoxin. The anti-Mojave toxin antibodies did not recognize the venom from C. lepidus klauberi ŽBanded rock rattlesnake; Clk54, Clk56, Clk57., C. l. lepidus ŽMottled rock rattlesnake; Cll55., C. atrox ŽWestern diamondback rattlesnake; Caa24, Caa25, Caa26. or C. molossus molossus ŽNorthern blacktailed rattlesnake; Cmm87, Cmm88, Cmm90, Cmm91.. To determine whether the nucleotide base sequences for the acidic and basic subunits of Mojave toxin are present in all of the rattlesnakes in this sampling, DNA from the snakes was amplified by PCR with the Mta and Mtb primer pairs. Electrophoresis of the amplified DNA from selected snakes is shown in Fig. 1. Amplification of Mojave rattlesnake DNA Žsnakes with Mojave toxin. generated a 1200-base fragment with the Mta primers ŽFig. 1, lane a. and an 1100-base fragment with the Mtb primers ŽFig. 1, lane b.. The size of the DNA fragments generated in both amplifications was as expected according to acidic and basic subunit sequences published previously for Mojave toxin ŽJohn et al., 1994.. Mta and Mtb primers also amplified similar size fragments, 1200 and 1100 bp, from C. d. ¨ egrandis DNA ŽFig. 1, lanes c and d.. The size of these fragments correlates exactly with what was expected according to the previously published acidic and basic subunit sequences of Crotoxin ŽBouchier et al., 1991.. The Mtb primers also generated product with
3. Results All of the C. s. scutulatus venoms were recognized by CSS12, the anti-Mojave toxin antibodies, except for venom from snakes Css66, Css67, and Css68 ŽTable 1.. This indicates that all of the venoms, except for venom from these three snakes, had Mojave toxin. The three snakes lacking Mojave toxin were captured in Cochise and Maricopa Counties, Arizona, localities where Mojave rattlesnakes are known not to possess this toxin. Four other snakes, which were captured in Maricopa county, tested positive for the toxin,
Fig. 1. PCR amplification of genomic DNA from C. s. scutulatus Ža, b., C. d. ¨ egrandiss Žc, d., C. atrox Že, f., C. m. molossus Žg, h., and C. l. klauberi Ži, j. with Mta Ža, c, e, g, i. and Mtb Žb, d, f, h, j. primers. Žl. is a 100-bp ladder.
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
both C. atrox and C. m. molossus DNA ŽFig. 1, lanes f and h., generating an Mtb product of 950 bases. The Mta primers, however, amplified C. m.
173
molossus DNA, but not C. atrox DNA, generating a fragment of 1050 ŽFig. 1, lane g.. Both Mta and Mtb primers did not amplify C. l. lepidus DNA.
Fig. 2. Alignment of nucleotide fragments from C. s. scutulatus ŽMojave toxin acidic. and C. m. molossus ŽMTA. genomic DNA samples that were amplified with the Mta primers. Differences between the sequences are indicated ŽU ..
174
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
Fig. 2. Ž Continued..
The Mtb primers, however, amplified DNA from one C. l. klauberi rattlesnake, Clk56, generating a fragment close to 1200 ŽFig. 1, lane j., but did not amplify DNA of other C. l. klauberi rattlesnakes, Clk54 and Clk57 ŽTable 1..
The generated DNA fragments from all the snakes were subsequently sequenced, and then aligned to sequences in the BLAST database. The sequences obtained from all of the C. s. scutulatus and C. d. ¨ egrandis DNA in the study sample
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
175
Fig. 3. Alignment of nucleotide fragments from C. s. scutulatus ŽMojave toxin basic., C. m. molossus ŽMTB., C. atrox ŽMTB., and C. l. klauberi ŽMTB. genomic DNA samples amplified with the Mtb primers.
176
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
Fig. 3. Ž Continued..
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
177
Fig. 3. Ž Continued..
aligned exactly to the corresponding DNA regions of the acidic and basic subunits of Mojave toxin and Crotoxin for both Mta and Mtb fragments. The C. s. scutulatus and C. d. ¨ egrandis sequences also aligned to other venom phospholipases, but with identities of less than 70%. This shows that the fragments generated with the Mta and Mtb primers are specific for the Mojave toxin and Crotoxin subunits. None of the sequences obtained with the C. atrox, C. m. molossus and C. l. klauberi fragments aligned exactly to any nucleotide sequence retrieved from the BLAST database, but aligned to various degrees of identity to DNA and RNA relating to phospholipases of other snakes. The fragment generated from C. m. molossus DNA with the Mta primers aligned with 94% identity from bases 1 to 221 to the published Mojave toxin base sequence 1669 to 1889, but with less than 30% identity to the rest of the acidic subunit generated by the Mta primer pair. The overall sequence identity between the Mta primer-generated C. m. molossus fragment and corresponding Mojave toxin acidic subunit DNA was 43.1% ŽFig. 2.. The sequences generated with the Mtb primers with C. atrox and C. m. molossus DNA were very similar with close to 99% sequence identity ŽFig.
3.. Alignment of the C. atrox and C. m. molossus sequences with the corresponding Mojave toxin basic subunit sequence showed close to 67% identity. The sequence generated with the Mtb primers with C. l. klauberi DNA was significantly different from that of C. atrox and C. m. molossus. This sequence showed 44.5% identity to the corresponding Mojave toxin basic subunit sequence. Thus, from these experiments, one can conclude that the Mta and Mtb primer pairs are specific for the Mojave toxin and Crotoxin subunits in the context of fragment size and base sequences generated. The PCR results obtained for all rattlesnakes are shown in Table 1. It should be noted that the primers for Mtb amplified the genomic DNA of all C. s. scutulatus and C. d. ¨ egrandis samples. The Mta primers, however, amplified all of the same samples except for genomic DNA from Css66, Css67 and Css68. These are the same three snakes whose venom was not recognized by the anti-Mojave toxin antibodies.
4. Discussion Population studies on venom compositional differences have indicated that some C. s. scutula-
178
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
tus in central Arizona lack Mojave toxin and that an inverse relationship exists between Mojave toxin and hemorrhagic toxin Žmetalloproteinase. in venom of these snakes ŽGlenn et al., 1983; Glenn and Straight, 1989.. Subsequent reports have shown that the venom from some Mojave rattlesnakes contains both toxins and that an intergradation of venom properties exists between the two venom types extending outward from central Arizona ŽGlenn and Straight, 1989; Wilkinson et al., 1991.. In one of our studies, using differences in Mojave toxin and hemorrhagic toxin as indicators of venom differences, we demonstrated that venom from some snakes in El Paso County, Texas also differ ŽRael et al., 1993.. In the present study, we examined the venom and genomic DNA of C. s. scutulatus to relate the expression of Mojave toxin in the venom to the Mojave toxin nucleotide base sequences in the snake genome. We found that three of the C. s. scutulatus snakes in the study group lacked Mojave toxin in their venom. These snakes were collected in Cochise and Maricopa Counties in Arizona ŽCss66᎐68., the region where the venom of Mojave rattlesnakes have been shown to lack Mojave toxin. We also found that the venom of four of the snakes from this same region ŽCss69, 71, 74 and 75. had Mojave toxin. This indicates that snakes of both venom types are present in this region, information of importance to clinicians. As expected, there was no Mojave toxin found in venom of C. atrox, C. m. molossus, C. l. klauberi and C. l. lepidus. At the DNA level, we found that the primers for the Mojave toxin basic subunit amplified the DNA of all the snakes in the C. s. scutulatus study group. Furthermore, the amplified DNA of each snake was cloned and sequenced, and all the sequences obtained aligned exactly to the Mojave toxin basic subunit DNA. With the Mojave toxin acidic subunit primers, DNA from 11 of the 14 C. s. scutulatus snakes amplified and were subsequently sequenced. The sequences obtained had 100% identity to the nucleotide sequence of the Mojave toxin acidic subunit. Both acidic and basic subunit primers amplified sequences from C. m. molossus DNA, and the basic subunit primers also amplified C. atrox DNA and DNA of one of the C. l. klauberi rattlesnakes. The amplified PCR samples were cloned and sequenced. Although the sequences obtained were
relevant to snake venom phospholipase genes, none of them aligned exactly to Mojave toxin acidic and basic subunit DNA. These rattlesnakes did not have Mojave toxin genes. The three C. s. scutulatus snakes whose DNA was not amplified with the acidic subunit primers were from the same snakes that did not express Mojave toxin in their venom. We, therefore, suggest that snakes lacking Mojave toxin do not express the toxin because the nucleotide sequence for the acidic subunit is lacking, either completely or partially. Although we think it unlikely, it is possible that a modified acidic subunit sequence is present in these snakes, but which lack the sequence to which our primers anneal. Such a sequence would than code for a modified acidic subunit, probably different from the ‘normal’ acidic subunit. We made no attempt in this study to determine whether either of the Mojave toxin subunits was produced in the venom, other than by detection with anti-Mojave toxin antibodies. These antibodies recognize the complete toxin and are not reactive with the individual subunits. It is, therefore, possible that the two subunits are produced by the three snakes lacking Mojave toxin, but subsequently fail to associate properly post-translationally. Previous research has indicated that association of the two peptides is a requirement for neurotoxicity ŽCate and Bieber, 1978.. We are currently investigating whether either or both acidic and basic subunits are present in the venom of other rattlesnake species ostensibly lacking the complete Mojave toxin.
5. Conclusions An aberration andror lack of the Mojave toxin acidic subunit gene seems to be responsible for absence of expressed Mojave toxin in some Mojave rattlesnake venoms. The Mojave toxin acidic subunit primers that we designed amplify specifically the acidic subunit DNA in C. s. scutulatus samples and can be used to screen rattlesnake DNA samples in population studies.
Acknowledgements This study was supported by NIH grants S06GM08012 and RR08124. The Arizona Depart-
B.J. Wooldridge et al. r Comparati¨ e Biochemistry and Physiology Part B 130 (2001) 169᎐179
ment of Fish and Game, the New Mexico Department of Game and Fish, and the Texas Parks and Wildlife Department issued scientific permits for collection of snakes. References Aird, S.D., Kaiser, I.I., 1985. Comparative studies on three rattlesnake toxins. Toxicon 23, 361᎐374. Aird, S.D., Kaiser, I.I., Lewis, R.V., Kruggel, W.G., 1985. Rattlesnake presynaptic neurotoxins: primary structure and evolutionary origin of the acidic subunit. Biochemistry 24, 7054᎐7058. Aird, S.D., Kaiser, I.I., Lewis, R.V., Kruggel, W.G., 1986. A complete amino acid sequence for the basic subunit of Crotoxin. Arch. Biochem. Biophys. 249, 296᎐300. Aird, S.D., Kruggle, W.G., Kaiser, I.I., 1990. Amino acid sequence of the basic subunit of Mojave toxin from the venom of the Mojave rattlesnake Ž Crotalus scutulatus scutulatus.. Toxicon 28, 669᎐673. Bieber, A.L., Becker, R.R., McParland, R. et al., 1990. The complete sequence of the acidic subunit from Mojave toxin determined by Edman degradation and mass spectrometry. Biochim. Biophys. Acta. 1037, 413᎐421. Bouchier, C., Boulain, J.-C., Bon, C., Menez, A., 1991. Analysis of cDNAs encoding the two subunits of Crotoxin, a phospholipase A 2 neurotoxin from rattlesnake venom: the acidic non enzymatic subunit derives from a phospholipase A 2-like precursor. Biochim. Biophys. Acta 1088, 401᎐408. Cate, R.L., Bieber, A.L., 1978. Purification and characterization of Mojave Ž Crotalus scutulatus scutulatus. toxin and its subunits. Arch. Biochem. Biophys. 189 Ž2., 397᎐408. Degn, L.L., Seebart, C.S., Kaiser, I.I., 1991. Specific binding of Crotoxin to brain synaptosomes and synaptosomal membranes. Toxicon 29, 973᎐988.
179
Glenn, J.L., Straight, R.C., 1989. Integration of two different venom populations of the Mojave rattlesnake Ž Crotalus scutulatus scutulatus. in Arizona. Toxicon 21, 411᎐418. Glenn, J.L., Straight, R.C., Wolfe, M.C., Hardy, D.L., 1983. Geographical variation in Crotalus scutulatus scutulatus ŽMojave rattlesnake . venom properties. Toxicon 21, 119᎐130. John, T.R., Smith, L.A., Kaiser, I.I., 1994. Genomic sequences encoding the acidic and basic subunits of Mojave toxin: unusually high sequence identity of non-coding regions. Gene 139, 229᎐234. Kusunoki, C., Satoh, S., Kobayashi, M., Niwa, M., 1990. Structure of genomic DNA for rat platelet phospholipase A 2 . Biochim. Biophys. Acta 1087, 95᎐97. Martinez, R.A., Huang, S.Y., Rael, E.P., Perez, J.C., 1989. Antigenic relationships of fractionated western diamondback rattlesnake Ž Crotalus atrox . hemorrhagic toxins and other rattlesnake venoms as indicated by monoclonal antibodies. Toxicon 27, 239᎐245. Rael, E.D., Salo, R.J., Zepeda, H., 1986. Monoclonal antibodies to Mojave toxin and use for isolation of cross-reacting proteins in Crotalus venoms. Toxicon 24, 661᎐668. Rael, E.D., Lieb, C.S., Maddux, N., Varela-Ramirez, A., Perez, J., 1993. Hemorrhagic and Mojave toxins in venoms of offspring of two Mojave rattlesnakes Ž Crotalus scutulatus scutulatus.. Comp. Biochem. Physiol. 1106b, 595᎐600. Seilhamer, J.J., Pruzanski, W., Vadas, P. et al., 1989. Cloning and recombinant expression of phospholipase A 2 present in rheumatoid arthritis synovial fluid. J. Biol. Chem. 264, 5335᎐5338. Wilkinson, J.A., Glenn, J.L., Straight, R.C., Sites, J.W., 1991. Distribution and genetic variation in venom A and B populations of Mojave rattlesnakes Ž Crotalus scutulatus scutulatus. in Arizona. Herpetologica 47, 54᎐68.