- Email: [email protected]
Molecular analysis of a durum wheat ‘stay green’ mutant: Expression pattern of photosynthesis-related genes
Journal of Cereal Science 43 (2006) 160–168 www.elsevier.com/locate/jnlabr/yjcrs
Molecular analysis of a durum wheat ‘stay green’ mutant: Expression pattern of photosynthesis-related genes Patrizia Rampino a, Giuseppe Spano b,c, Stefano Pataleo a, Giovanni Mita d, Johnathan A. Napier e, Natale Di Fonzo c, Peter R. Shewry e, Carla Perrotta a,* a
Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Universita` di Lecce, via prov.le Monteroni, 73100 Lecce, Italy b Dipartimento di Scienze degli Alimenti, Universita` di Foggia, via Napoli 25, 71100 Foggia, Italy c Istituto Sperimentale per la Cerealicoltura, Sez. di Foggia, S.S. 16 Km 675, 71100 Foggia, Italy d ISPA-CNR Lecce, via prov.le Monteroni, 73100 Lecce, Italy e Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK Received 5 April 2005; received in revised form 8 July 2005; accepted 13 July 2005
Abstract Elucidation of molecular mechanisms underlying the ‘stay green’ trait is not only relevant to understanding the senescence phenomenon itself, but also has potential significance for yield improvement. A mutant of durum wheat (Triticum durum Desf.) cultivar Trinakria (designated 504) was characterised by delayed leaf senescence, and analysis of photosynthetic parameters showed that it was functionally ‘stay green’. An in vitro system was established to mimic senescence by incubating wheat leaves in the dark, allowing the expression of genes known to be differentially regulated during senescence to be determined. Moreover, cDNAs found to be differentially expressed in the mutant were cloned and sequenced, showing homologies with photosynthesis-related genes. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) analyses were performed using RNA samples from 504 mutant and parental Trinakria plants, during both natural and artificially induced senescence, confirming the altered expression profiles of these genes in the ‘stay green’ mutant 504. The exploitation of such ‘stay green’ phenotype in breeding of durum and bread wheats has the potential to increase yields by extending the period of active photosynthesis during grain filling, especially under unfavourable environmental conditions. q 2005 Elsevier Ltd. All rights reserved. Keywords: Durum wheat; RT-PCR; Senescence; ‘Stay green’
1. Introduction Annual plants such as durum wheat are characterised by a life cycle in which the plant grows, flowers, ages, and dies during a single year. In such plants, the formation of seeds is related to an irreversible ageing of the whole plant and the mobilisation and translocation of N-rich compounds to the Abbreviations: cab, chlorophyll a/b binding protein gene; DAF, days after flowering; GDC, glycine decarboxylase; rbcS, rubisco small subunit gene; Rht, reduced height; RT-PCR, reverse transcription-polymerase chain reaction; Rubisco, ribulose bisphosphate carboxylase/oxigenase; SAG, senescence associated genes; SDG, senescence down-regulated genes; SEN, senescence enhanced genes; SSS, soluble starch synthase. * Corresponding author. Tel.: C39 832 298688; fax: C39 832 298858. E-mail address: [email protected] (C. Perrotta). 0733-5210/$ - see front matter q 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2005.07.004
seeds. At the end of this process, called senescence, the plant dies (Mohr and Schopfer, 1995). Senescence is a programmed and highly regulated process characterised by a specific sequence of biochemical and physiological events related to the loss of chlorophyll and dismantling of the photosynthetic apparatus. The most dramatic phenotypic feature is the loss of the green colour of leaves. Many cellular and molecular events take place during senescence including mobilisation of nitrogen and other nutrients, degradation of macromolecules (i.e. chlorophyll, lipids, proteins, and nucleic acids), and dismantling of chloroplasts and other organelles (Lin and Wu, 2004). All these events can also be induced by environmental conditions such as nitrogen deficiency, low light intensity, drought and pathogen infection. However, programmed senescence and senescence induced by environmental stresses differ in that the latter can be reversed if the stress conditions
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
are alleviated before the senescence process reaches the ‘nonreturn’ stage. Senescence is an important stage of plant development and when the plant reaches a certain age the process of senescence will be triggered even though the environmental conditions may be favourable for continued growth (Buchanan-Wollaston, 1997; Buchanan-Wollaston et al., 2003; Yoshida, 2003). Although the specific mechanisms by which senescence is regulated are not understood, and many regulators of leaf senescence are not yet identified, there is clear evidence that it is driven by many specific genes which may be either highly expressed (Senescence Associated Genes or SAG) or downregulated (Senescence Down-regulated Genes or SDG) during the senescence process (Gan and Amasino, 1995; Gepstein, 2004; Lim et al., 2003; Nam, 1997; Smart, 1994). Among the SDG are genes coding for the ribulose bisphosphate carboxylase/oxygenase or Rubisco, small subunit (rbcS) and the chlorophyll a/b binding protein (cab). SAG genes may also be called SEN (senescence enhanced) and are divided in two groups. The first of these includes genes that are specifically expressed only during senescence and the second genes whose expression is enhanced during senescence. Elucidation of the molecular basis of senescence is not only of fundamental interest but also relevant to the genetic improvement of crop plants. A powerful tool for the analysis of the senescence process is the molecular characterisation of mutants that are defective in an aspect of senescence, such as the ‘stay green’ mutants. ‘Stay green’ mutants are characterised by the persistence of the green colour of leaves for longer than those of parental genotypes. In particular, some ‘stay green’ mutants can arise from delays in the initiation of senescence and its rate of progress. Consequently such mutants continue to photosynthesise for longer than usual, they are therefore said to be ‘functional stay green’ (Thomas and Howarth, 2000). A strong relationship between the extension of the photosynthetic capacity and grain yield was observed in cereals such as maize and sorghum. In particular, it is important in this respect that the photosynthetic capacities of both the total canopy and specific leaves are maintained throughout the entire life cycle, including the period from flowering to grain maturity (Thomas and Smart, 1993). In agronomic terms, these mutants have higher kernel weights and this observation has been exploited by maize breeders. Although breeders have extensively used such material for yield improvement, little is known about the underlying genetics and molecular biology of the trait(s) even though detailed analyses have been performed in maize and sorghum (Tao et al., 2000; Thomas and Smart, 1993). One approach to determine the molecular basis of the ‘stay green’ phenotype is to identify the differences between mutant and parental plants in their regulation of specific genes during the senescence process. We have therefore compared a previously described (Spano et al., 2003) ‘functional stay green’ mutant of durum wheat (line 504) and its parental line, focusing on three genes identified as differentially expressed in the two lines. Although these three genes differ in their detailed expression patterns the results are consistent with an extension
161
of the period of active photosynthesis indicating that the ‘stay green’ phenotype could be expected to increase crop biomass and yield. 2. Experimental 2.1. Plant material Durum wheat (Triticum durum Desf.) cv. Trinakria and mutant 504 were grown in a glasshouse in 25 cm pots filled with the compost as previously indicated (Spano et al., 2003) under irradiance of ca. 750 mmol mK2 sK1, supplied by 400 W sodium lamps with a 16 h light period, at 18–20 8C under lighting and 14–16 8C during darkness, and 50–70% relative humidity. At various days after flowering (DAF) flag leaves were removed from the plants and frozen in liquid nitrogen before RNA extraction. Plants were also grown in PERLIGRAN (Deutsche Perlite, Dortmund, Germany) for 11 d under a constant light/dark regime with 16 h light and 8 h darkness and watered with tap water. Fully expanded primary foliage leaves were removed, placed in a 50 ml tube filled with tap water and incubated in the dark at 20 8C for induction of senescence. For chlorophyll analysis three discs were taken from different areas of each leaf (i.e. from the apical medial and basal part of the leaf) incubated in the dark at times from 8 to 58 h. Three replicate samples were taken at each time for chlorophyll determination and the leaves were immediately frozen before RNA extraction. 2.2. Chlorophyll assays The three discs (20 mm diameter) excised from different areas of each leaf were pooled and ground in 1 ml of 80% (v/v) aqueous acetone. Extracts were diluted tenfold in 100% acetone and the A646 and A663 were measured. Chlorophyll a and b concentrations were calculated by the equations of Hill (Hill et al., 1985). Mean values were based on independent measurements of at least three leaves. 2.3. Total RNA extraction and northern analysis Total RNA was isolated from leaves of naturally senescent plants or detached leaves that had been kept in the dark, using the ‘SV Total RNA Isolation System’ (Promega, Madison, WI) according to the supplier’s instruction, and was quantified spectrophotometrically. Electrophoresis, blotting and hybridisation of RNA were performed as described previously (Treglia et al., 1999). 2.4. Sequencing of differentially expressed fragments Some clones containing differentially expressed fragments identified by the differential display method (Liang and Pardee, 1992) performed on mRNA from Trinakria and mutant, in a previous work (Spano, 2001), were sequenced using the ‘Big Dye Terminator Sequencing kit’ (Applied Biosystems, Foster
162
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
City, CA). Three sequencing reactions were set up for each plasmid DNA; reaction mix was prepared following the supplier’s instruction and 3.2 pmol of each primer (T7 and SP6) were used for each reaction. Three of them, designated as W3, W4 and W7, where chosen for further analysis. 2.5. Primer design Two sets of primers were designed based on the sequences of genes whose expression is known to be down-regulated by senescence i.e. rbcS from Triticum aestivum (Accession number AB042068) and cab from T. aestivum (Accession number M10144). Primers were also designed based on the sequences of the differentially expressed genes i.e. W3, W4, and W7 and of the a-tubulin gene (Accession number U76558) as an internal control. Primers were selected using ‘Primer 3’ software available at the web site www.basic.nwu.edu/biotools and were prepared commercially (MWG, Ebersberg, Germany). Their sequences are listed in Table 1. 2.6. Semi-quantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR) analysis Synthesis of cDNA was conducted using the ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA) according to the supplier’s instruction using oligo (dT)15 as primer. Subsequently, PCR was performed in a reaction mixture containing 1 ml of cDNA sample in a final reaction mixture (50 ml) containing PCR buffer (10 mM Tris–HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2), 0.1 mM dNTPs, 1 mM of each forward and Table 1 Primers used in RT-PCR analysis.The annealing temperature for each of primer couple and the size of the amplicons are also indicated Primer name
Sequence 5 0 -3 0
Annealing temperature (8C)
Size of PCR product [cDNA (bp)]
TdrbcSF TdrbcSR TdcabF
CTGTGATGGCTTCCTCGG TTAGGCCTTGCCGGACTC GGCCACCACCATGTCTCTT CGCGTTGTTGTTGACAGG AGACTTTTTCGGTGCTCTGC GAGCAGGAGATGTGGTGTGT TACGAGCAGATCTTCCGAATG TGTCAGCTAAGGACAAGACAACA TCTAGGGAGTATGCTGCGTTC GGAGGATACAGGAGAAGGTGG TCGCATACGACACGCTTTAG GCTTGCTTGGTTGCAGTGTA
58
518
56
760
57
321
57
442
59
297
57
589
TdcabR W3F W3R W4F W4R W7F W7R TaTubF TaTubR
reverse primer and 0.5 units of DyNAzyme DNA polymerase (Finnzymes, Espoo, Finland). Amplification was performed in a thermal cycler (MJ PTC-100, MJ research, Sierra Point, CA) using 1 step of 2 min at 94 8C, and then 23–38 cycles each of 30 s at 94 8C, 30 s at 57–59 8C (annealing temperature optimised for the individual genes), and 60 s at 72 8C, followed by a final step of 7 min at 72 8C. The range at which the amount of the PCR products was exponentially increasing was determined for each gene using a fixed quantity of cDNA and serial numbers of cycles, namely 21–40 (Murphy et al., 1990). PCR products were separated in 1% agarose, stained with ethidium bromide, analysed under UV light and a relative estimate of the mRNA amounts was obtained by the 1D Image Analysis software of Kodak EDAS 290 (Eastman Kodak Company, Rochester, NY). The predicted sizes of the amplification products are listed in Table 1. 2.7. Cloning, sequencing and analysis of PCR products PCR products were purified using the ‘Wizard SV gel and PCR clean-up system’ (Promega). They were cloned in ‘PCR II TOPO Vector’ included in the “TA TOPO Cloning kit” (Invitrogen) following the supplier’s instruction. Plasmid DNA was sequenced using the ‘Big Dye Terminator Sequencing Kit’ (Applied Biosystems) as reported in Section 2.6. Thermal cycler conditions, using MJ PTC-100, were as follows: 25 cycles each of 30 s at 96 8C, 15 s at 50 8C and 30 s at 60 8C. Samples were analysed by ABI Prism 310 Genetic Analyser (Applied Biosystems). DNA sequences obtained were compared with public databases using both FASTA and BLAST programs. 3. Results 3.1. Senescence induction and chlorophyll content Dark-induced senescence of plants has been employed as a convenient model system to study leaf senescence (Noode´n, 1988; Oh et al., 1996; Thimann, 1980), giving reproducible material for analysis (Park et al., 1998). Leaves were therefore incubated in the dark up to 58 h. As shown in Fig. 1, the chlorophyll contents of both lines decreased during incubation in the dark but this was significantly delayed in the mutant. In fact, a progressive reduction occurred from the start of the incubation in cv. Trinakria. In contrast in mutant 504 the chlorophyll content remained constant up to 33 h and then decreased, indicating that 504 mutant exhibits a delayed onset, but not a reduced rate of senescence. 3.2. Sequencing of differentially expressed fragments Preliminary analysis of mutant 504 identified many differentially expressed fragments (Spano, 2001). Three of these, called W3, W4 and W7 were selected for this study,
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
163
Fig. 1. Differences in relative chlorophyll contents between 504 mutant and parental Trinakria line. Each value represents the mean of three independent measurements. Data are presented as the meansGSEM.
based on the fact that they gave reproducible results when used for RT-PCR. The cloned fragments were 321, 442, and 297 bp long. Comparison of their nucleotide and deduced amino acid sequences with databases revealed significant similarities to known sequences. The nucleotide sequence of W3 (Accession number AJ35203) shared 91.7% identity with the coding sequence of Rubisco activase A2 (RcaA2) of barley (Hordeum vulgare) (Accession number M55447); the sequence of W4 (Accession number AJ635204) shared 90.3% identity with the soluble starch synthase gene of bread wheat (T. aestivum) (Accession number TA48227) and the sequence of W7 (Accession number AJ635205) was 96.8% identical to the coding sequence of glycine decarboxylase (P-protein) of Tritordeum (Hordeum chilense x T. aestivum) (Accession number AF024589). The high expression levels of these three fragments in the senescing leaves of the mutant line were also confirmed by northern blot analysis of total RNA from leaves at the same stage as those used for differential display (Fig. 2). 3.3. Semi-quantitative RT-PCR analysis The a-tubulin gene has been widely used as a control in studies of gene expression (Kawasaki et al., 2001; Seki et al., 2001) and was therefore used as an internal control for RTPCR analysis. Amplification of the wheat a-tubulin cDNAs confirmed that approximately equal amounts of cDNAs were used for each RT-PCR analysis, with further confirmation being provided by repeated RT-PCR analysis with different RNA samples; preliminary tests were performed for each PCR reaction using different number of cycles, thus ensuring analysis of the product before the plateau was reached (data not shown). The levels of expression of the genes corresponding to all the primers listed in Table 1 were analysed by RT-PCR of RNAs isolated from leaves at different stages of both natural and induced senescence. The results obtained from leaves in which senescence was induced are shown in Fig. 3. Two
Fig. 2. Northern analysis of transcripts corresponding to cDNA probes W3, W4 and W7. RNA was prepared from leaf tissue of naturally senescent plants at 10 DAF; 12 mg of total RNA was applied to each lane. The rRNA was used as loading control. TK, parental line cv. Trinakria; 504, 504 mutant line.
previously defined genes which are down-regulated during senescence (Kleber-Janke and Krupinska, 1997) were included in this present study; these were the small subunit of Rubisco (rbcS) and the chlorophyll a/b binding protein (cab). PCR products amplified by primers based on the T. aestivum rbcS and cab genes were cloned and sequenced to confirm the identity of the T. durum amplicons. The T. durum fragment was 518 bp long and its sequence (Accession number AJ635206) shared 97% identity with the coding sequence of the T. aestivum rbcS (Accession number AB042068). Similarly, the sequence of the T. durum fragment (760 bp long; Accession number AJ635207) corresponding to cab was 98.4% identical to that from T. aestivum (Accession number M10144). The level of rbcS transcripts declined over time in cv. Trinakria, in contrast in the mutant line the amount did not significantly change during the darkness incubation. Transcripts related to the cab gene fell sharply in abundance after 8 h in the dark in both the mutant line and Trinakria, although in the mutant line the relative amount was slightly higher. To verify their identity, the W3, W4 and W7 amplicons were also cloned and sequenced: in all cases their sequences were identical to those of the differentially expressed fragments. The accumulation patterns of transcripts related to the W3, W4 and W7 genes also differed between the two lines. In fact in the cv. Trinakria, the amounts of W3 and W7 transcripts fell to undetectable levels after 8 h while W4 transcripts were still present but at very low levels. In contrast, transcripts related to
164
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
Fig. 3. Expression analysis during dark-induced senescence of rbcS and cab genes, and of W3, W4 and W7 differentially expressed sequences. TK, parental line cv. Trinakria; 504, 504 mutant line; bp, base pairs. Level of mRNA was analysed by RT-PCR using specific primers (reported in Table 1) for target genes and for atubulin, as given in Experimental (Section 2.5). Band intensities (columns) were normalised to a-tubulin band intensity and expressed as relative transcript level (the highest intensity set to 100 for each gene separately). The quantified gels are shown as inserted pictures.
W3 and W7 were still detectable after 8 h in mutant 504 and transcripts related to W4 after 24 h. The induction patterns of the same genes were also determined in leaves undergoing natural senescence (from 7 to 24 DAF). As shown in Fig. 4, the transcripts related to rbcS were not detectable using our RT-PCR conditions at 7 DAF in the cv. Trinakria although they were detectable when performing PCR for a higher number of cycles (data not shown) while in mutant 504 the transcripts were present at very high levels after 7 DAF and then decreased. The levels of these transcripts were reduced to about 25% of their initial level after 24 DAF. Transcripts amplified by the cab primers were undetectable after 7 DAF in cv. Trinakria, but remained at a similar level up to 11 DAF in mutant 504, after which they rapidly declined to undetectable levels. Transcripts of W3, W4 and W7 cDNAs also decreased during the course of senescence in cv. Trinakria. In general,
there were clear decreases after 11 DAF and an even greater reduction after 24 DAF. The most dramatic change was observed for W7 with the transcript levels falling to about 50% by 11 DAF, when its expression is reduced to about 50%. In mutant 504, levels of the transcript related to W3 remained at an almost constant level until 24 DAF. Similarly the levels of transcripts related to W4 and W7 remained almost constant until 11 DAF and then they decreased to about 40 and 55% of their initial expression levels, respectively (Fig. 4). In general, these reported differences in the expression of transcripts related to W3, W4 and W7 were observed in at least three independent experiments. 4. Discussion In this paper we report molecular analyses of a durum wheat mutant characterised by a ‘stay green’ phenotype.
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
165
Fig. 4. Expression analysis during natural senescence of rbcS and cab genes, and of W3, W4 and W7 differentially expressed sequences. DAF, days after flowering; TK, parental line cv. Trinakria; 504, 504 mutant line; bp, base pairs. Level of mRNA was analysed by RT-PCR with specific primers (as indicated in Table 1) for target genes and for a-tubulin, as given in Experimental Section 2.5). Band intensities (columns) were normalised to a-tubulin band intensity and expressed as relative transcript level (the highest intensity set to 100 for each gene separately). The quantified gels are shown as inserted pictures.
Plant senescence can be induced not only by developmental stage and hormone levels, but also by abiotic and biotic stresses, including darkness, and recent analyses of the signalling pathways involved in different stress response have considerable cross-talk with senescence related gene expression (Buchanan-Wollaston et al., 2003). This could indicate some genes that are induced during senescence may also play roles in protection mechanisms activated in response to certain stresses. In fact, Barth and coworkers (2004) have recently described a cDNA that is involved in both abiotic stresses response (such as drought, heat, high light, ABA, etc.) and senescence in barley, and similar cross-talk has been reported in Arabidopsis (Prandl et al., 1995). Many studies of senescence-related genes have been made using leaves induced to senesce in the dark (Becker and Apel, 1993; Fujiki et al., 2001; Lee et al., 2001; Oh et al., 1996). This approach has the advantage of providing
reproducible and homogeneous material. Most of the data obtained by this system confirm that the genes identified as showing enhanced expression during dark-induced senescence of detached leaves show similar behaviour in attached leaves as well as during senescence under field conditions (Kleber-Janke and Krupinska, 1997); moreover data obtained using this treatment show good agreement with agemediated senescence-specific gene expression (Quirino et al., 2000). Other workers have studied leaf senescence in plants grown under controlled environmental conditions (Lohman et al., 1994; Miersch et al., 2000) but most have focused on biochemical and physiological changes (Fischer and Feller, 1994; Lu et al., 2001; Wittenbach, 1979) rather than gene expression (Humbeck et al., 1996; Scharrenberg et al., 2003). Although the loss of chlorophyll and the concomitant yellowing of the leaves are convenient and distinctive
166
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
indicators of leaf senescence, this phenotype can be uncoupled from ‘functional’ leaf senescence (Thomas and Smart, 1993). The ‘stay green’ mutant utilised in this report had already been characterised on the basis of its physiological parameters (Spano et al., 2003) as functional ‘stay green’. These studies showed that the induction of senescence is paralleled by chlorophyll breakdown which is delayed in the leaves of the mutant compared to the control thus can be classified as a type A ‘stay green’ according to Thomas and Smart (1993). The timing of decrease in the chlorophyll content of the flag leaf indicated that the senescence process started at least 1 week earlier in the control plants than in the mutant lines (data not shown). To study these differences at the molecular level we focused on genes whose expression is down-regulated during senescence, including rbcS and cab which were used as markers for the onset of the senescence process (BuchananWollaston and Ainsworth, 1997; Gepstein et al., 2003; KleberJanke and Krupinska, 1997). Our results showed that the expression of these genes in cv. Trinakria decreased during the incubation of leaves in the dark, and confirmed that the induction of senescence was reproducible. Furthermore, differences in the timing of senescence in mutant 504 were consistent with the differences in chlorophyll content. The extended expression of photosynthesis-related genes (rbcS and cab) also confirms that this mutant is a functional ‘stay green’ according to Thomas and Smart (1993). Nevertheless, it should be noted that the leaf senescence is only delayed in the mutant, not eliminated. Among the many differentially expressed fragments isolated (Spano, 2001), we have focused our analysis on W3, W4 and W7 because they gave reproducible results when used for RTPCR. BLAST analysis of three genes (W3, W4, W7) which are differentially expressed in the mutant, revealed that they encode a putative Rubisco activase A2, a soluble starch synthase, and a glycine decarboxylase (P-protein), respectively. It is interesting to note that all these genes code for important components of the photosynthetic system. Rubisco activase normally accumulates in greening or photosynthetic tissues and its primary role is to reactivate Rubisco that has been deactivated by sugar biphosphatases. Degradation of Rubisco is an early event in the senescence-specific dismantling of chloroplasts and the higher expression of Rubisco activase in the mutant may suggest that the extension of the green leaf area in the mutant is sustained by functional photosynthesis. Soluble starch synthase (SSS) is an enzyme of starch synthesis and its extended expression in photosynthesizing flag leaves could be related to extended grain filling and could contribute to the increased seed size and yield already reported for this mutant (Spano et al., 2003). Glycine decarboxylase (GDC), is a key enzyme in the photorespiratory carbon oxidation cycle. Comparison of the expression pattern of the GDC gene with that of rbcS gene suggests common regulation related to light induction
(Vauclare et al., 1996). As for the SSS gene, the GDC gene shows lower expression in the control plants compared with the mutant, indicating that the enzyme is active for longer and suggesting that this aspect also contributes to the ‘stay green’ phenotype. It is probable that none of the three genes identified and analysed in this study are responsible for the ‘stay green’ phenotype but rather they appear to be differentially expressed as a consequence of the mutation. Further analysis of other differentially expressed sequences will be performed in order to elucidate the molecular basis of this phenotype. In recent years, continuing efforts have been made to identify genes responsible for leaf senescence. A picture is emerging of the conditions that initiate leaf senescence and of the promoter elements required for senescence-associated gene expression. However, little is known of the regulatory genes that co-ordinate senescence at the molecular level. Studies of mutants from several species have revealed genes that regulate some aspects of plant senescence. In particular, it has been postulated that Arabidopsis may have multiple pathways which respond to a wide range of factors and form a regulatory network to control leaf senescence. Furthermore, a putative leaf senescence regulatory network in Arabidopsis has been reported (He et al., 2001). However, with few exceptions (Hajouj et al., 2000; Schaller and Bleecker, 1995; Wilkinson et al., 1995; Woo et al., 2001; 2004), the identities of the key genes that regulate the initiation or progression of leaf senescence are not known. Furthermore some genes involved in the chlorophyll catabolism and in its control (i.e. genes for pheophorbide a oxygenase and cysteine proteases) have been identified in grasses and have been demonstrated to be specifically related to senescence (Ho¨rtensteiner and Feller, 2002; Thomas et al., 2002). Our results contribute to this developing picture as well as confirming the functional nature of the ‘stay green’ phenotype in an important agricultural crop, durum wheat. Although conventional plant breeding continues to produce new varieties with increased yield, the magnitude of these increases is falling indicating that a plateau is being reached with the major yield limiting factor being grain number. The exploitation of ‘stay green’ mutations of the type described here has the potential to increase yields above this plateau (in the same way that the Rht series of dwarfing genes revolutionised wheat breeding some 40 years ago (Lenton, 2001)), particularly in water and N-limited environments where post-anthesis photoassimilation is the likely limit to yield. Further studies under field conditions will be required to determine whether the ‘stay green’ phenotype has impacts on seed size, seed number or both of these major yield determinants. Acknowledgements We would like to thank Mrs P. Fasano for her excellent assistance. This work was supported by Italian MIUR funding to C. Perrotta. Istituto Sperimentale per la Cerealicoltura
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
receives grant-aided support from the Italian Ministry of Agriculture (MiPAF), Rothamsted Research receives grantaided support from the Biotechnology and Biological Sciences Research Council (BBSRC) of the UK. References Barth, O., Zschiesche, W., Siersleben, S., Humbeck, K., 2004. Isolation of a novel barley cDNA encoding a nuclear protein involved in stress response and leaf senescence. Physiologia Plantarum 121, 282–293. Becker, W., Apel, K., 1993. Differences in gene expression between natural and artificially induced leaf senescence. Planta 189, 74–79. Buchanan-Wollaston, V., 1997. The molecular biology of leaf senescence. Journal of Experimental Botany 48, 181–199. Buchanan-Wollaston, V., Ainsworth, C., 1997. Leaf senescence in Brassica napus: cloning of senescence related genes by subtractive hybridisation. Plant Molecular Biology 33, 821–834. Buchanan-Wollaston, V., Earl, S., Harrison, E., Mathas, E., Navabpour, S., Page, T., Pink, D., 2003. The molecular analysis of leaf senescence—a genomics approach. Plant Biotechnology Journal 1, 3–22. Fischer, R.A., Feller, U., 1994. Senescence and protein degradation in leaf segments of young winter wheat: influence of leaf age. Journal of Experimental Botany 45, 103–109. Fujiki, Y., Yoshikawa, Y., Sato, T., Inada, N., Ito, M., Nishida, I., Watanabe, A., 2001. Dark-inducible genes from Arabidopsis thaliana are associated with leaf senescence and repressed by sugars. Physiologia Plantarum 11, 345–352. Gan, S., Amasino, R.M., 1995. Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270, 1966–1967. Gepstein, S., 2004. Leaf senescence—not just a ‘wear and tear’ phenomenon. Genome Biology 5, 212. Gepstein, S., Sabehi, G., Carp, M.-J., Hajouj, T., Nesher, M.F.O., Yariv, I., Dor, C., Bassani, M., 2003. Large-scale identification of leaf senescenceassociated genes. Plant Journal 36, 629–642. Hajouj, T., Michelis, R., Gepstein, S., 2000. Cloning and characterisation of a receptor-like protein kinase gene associated with senescence. Plant Physiology 124, 1305–1314. He, Y., Tang, W., Swain, J.D., Green, A.L., Jack, T.P., Gan, S., 2001. Networking senescence-regulating pathways by using Arabidopsis enhancer trap lines. Plant Physiology 126, 707–716. Hill, C.M., Pearson, S.A., Smith, A.J., Rogers, L.J., 1985. Inhibition of chlorophyll synthesis in Hordeum vulgare by 3-amino 2,3-dihydrobenzoic acid (gabaculin). Bioscience Reports 5, 775–781. Ho¨rtensteiner, S., Feller, U., 2002. Nitrogen metabolism and remobilization during senescence. Journal of Experimental Botany 53, 927–937. Humbeck, K., Quast, S., Krupinska, K., 1996. Functional and molecular changes in the photosynthetic apparatus during senescence of flag leaves from field-grown barley plants. Plant, Cell and Environment 19, 337– 344. Kawasaki, K., Borchert, C., Deyholas, M., Wang, H., Brazille, S., Kawai, K., Galbraith, D., Bohnert, H.J., 2001. Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 13, 889–906. Kleber-Janke, T., Krupinska, K., 1997. Isolation of cDNA clones for genes showing enhanced expression in barley leaves during dark-induced senescence as well as during senescence under field conditions. Planta 203, 332–340. Lee, R.-H., Wang, C.-H., Huang, L.-T., Ken, S.-C.G., 2001. Leaf senescence in rice plants: cloning and characterisation of senescence upregulated genes. Journal of Experimental Botany 52, 1117–1121. Lenton, J.R., 2001. Opportunities for the manipulation of development of temperate cereals. In: Shewry, P.R., Lazzeri, P.A., Edwards, K.J. (Eds.), Advances in Botanical Research, vol. 34. Academic Press, London, pp. 127–153. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971.
167
Lim, P.O., Woo, H.R., Nam, H.G., 2003. Molecular genetics of leaf senescence in Arabidopsis. Trends in Plant Science 8, 272–278. Lin, J.F., Wu, S.-H., 2004. Molecular events in senescing Arabidopsis leaves. Plant Journal 39, 612–628. Lohman, K.N., Susheng, G., Manorama, C.J., Amasino, R.M., 1994. Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiologia Plantarum 92, 322–328. Lu, C., Lu, Q., Zang, J., Kuang, T., 2001. Characterisation of photosynthetic pigment composition, photosystem II photochemistry and thermal energy dissipation during leaf senescence of wheat plants grown in the field. Journal of Experimental Botany 52, 1805–1810. Miersch, I., Heise, J., Zelmer, K., Humbeck, K., 2000. Differential degradation of the photosynthetic apparatus during leaf senescence in barley (Hordeum vulgare L.). Plant Biology 2, 618–624. Mohr, H., Schopfer, P., 1995. Plant Physiology. Springer, Berlin. Murphy, L.D., Herzog, C.E., Rudick, J.B., Fojo, A.T., Bates, S.E., 1990. Use of the Polymerase Chain Reaction in the quantitation of mdr-1 gene expression. Biochemistry 29, 10351–10356. Nam, H.G., 1997. The molecular genetic analysis of leaf senescence. Current Opinion in Biotechnology 8, 200–207. Noode´n, L.D., 1988. Abscissic acid, auxin and other regulators of senescence. In: Noode´n, L.D., Leopold, A.C. (Eds.), Senescence and Aging in Plants. Academic Press, San Diego, pp. 330–386. Oh, S.A., Lee, S.Y., Chung, I.K., Lee, C.-H., Nam, H.G., 1996. A senescenceassociated gene of Arabidopsis thaliana is distinctively regulated during natural and artificially induced leaf senescence. Plant Molecular Biology 30, 739–754. Park, J.-H., Oh, S.A., Kim, Y.H., Woo, H.R., Nam, H.G., 1998. Differential expression of senescence-associated mRNAs during leaf senescence induced by different senescence-inducing factors in Arabidopsis. Plant Molecular Biology 37, 445–454. Prandl, P.P., Kloske, E., Shoffl, F., 1995. Developmental regulation and timespecific differences of heat shock gene expression in transgenic tobacco and Arabidopsis. Plant Molecular Biology 28, 73–82. Quirino, B.F., Noh, Y-S., Himelblau, E., Amasino, R.M., 2000. Molecular aspects of leaf senescence. Trends in Plant Science 5, 278–282. Schaller, G.E., Bleecker, A.B., 1995. Ethylene-binding sites generated in yeast expressing Arabidopsis ETR1 gene. Science 270, 1809–1811. Scharrenberg, C., Falk, J., Quast, S., Haussuhl, K., Humberk, K., Krupinska, K., 2003. Isolation of senescence-related cDNAs from flag leaves of field grown barley plants. Physiologia Plantarum 118, 278– 288. Seki, M., Narusaka, M., Abe, H., Kasuga, M., Yamaguchi-Shinozaki, K., Carninci, P., Hayashizaki, Y., Shinozaki, K., 2001. Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full length cDNA microarray. Plant Cell 13, 61–72. Smart, C., 1994. Gene expression during leaf senescence. New Phytologist 126, 419–448. Spano, G., 2001. Physiological and molecular characterisation of ‘stay green’ mutants in durum wheat. PhD Thesis, University of Bristol, Department of Agricultural Science, UK. Spano, G., Di Fonzo, N., Perrotta, C., Ronga, G., Lawlor, D.W., Napier, J.A., Shewry, P.R., 2003. Physiological characterization of ‘stay green’ mutants in durum wheat. Journal of Experimental Botany 54, 1415–1420. Tao, Y.Z., Henzell, R.G., Jordan, D.R., Butler, D.G., Kelly, A.M., McIntyre, C.L., 2000. Identification of genomic regions associated with stay-green in sorghum by testing RILs in multiple environments. Theoretical and Applied Genetics 100, 1225–1232. Thimann, K.V., 1980. The senescence of leaves. In: Thimann, K.V. (Ed.), Senescence in Plants. CRC Press, Boca Raton, FL, pp. 85–115. Thomas, H., Smart, C.M., 1993. Crops that stay green. Annals of Applied Biology 123, 193–203. Thomas, H., Howarth, C.J., 2000. Five ways to stay green. Journal of Experimental Botany 51, 329–337. Thomas, H., Ougham, H., Canter, P., Donnison, I., 2002. What stay-green mutants tell us about nitrogen remobilization in leaf senescence. Journal of Experimental Botany 53, 801–808.
168
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
Treglia, A., Spano, G., Rampino, P., Giangrande, E., Nocco, G., Mita, G., Di Fonzo, N., Perrotta, C., 1999. Identification by in vitro translation and northern blot analysis of heat shock mRNAs isolated from wheat seeds exposed to different temperatures during ripening. Journal of Cereal Science 30, 33–38. Vauclare, P., Diallo, N., Bourguignon, J., Macherel, D., Douce, R., 1996. Regulation of the expression of the glycine decarboxylase complex during pea leaf development. Plant Physiology 112, 1523–1530. Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J., Klee, H.J., 1995. An ethylene inducible component of signal transduction encoded by neverripe. Science 270, 1807–1809.
Wittenbach, V.A., 1979. Ribulose bisphosphate carboxylase and proteolytic activity in wheat leaves from anthesis through senescence. Plant Physiology 64, 84–887. Woo, H.R., Chung, K.M., Park, J.-H., Oh, S.A., Ahn, T., Hong, S.H., Jang, S.K., Nam, H.G., 2001. ORE9, an F-box protein that regulates leaf senescence in Arabidopsis. Plant Cell 13, 1779–1790. Woo, H.R., Kim, J.H., Nam, H.G., Lim, P.O., 2004. The delayed leaf senescence mutants of Arabidopsis, ore1, ore3, and ore9 are tolerant to oxidative stress. Plant Cell Physiology 45, 923–932. Yoshida, S., 2003. Molecular regulation of leaf senescence. Current Opinion in Plant Biology 6, 79–84.
Molecular analysis of a durum wheat ‘stay green’ mutant: Expression pattern of photosynthesis-related genes Patrizia Rampino a, Giuseppe Spano b,c, Stefano Pataleo a, Giovanni Mita d, Johnathan A. Napier e, Natale Di Fonzo c, Peter R. Shewry e, Carla Perrotta a,* a
Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Universita` di Lecce, via prov.le Monteroni, 73100 Lecce, Italy b Dipartimento di Scienze degli Alimenti, Universita` di Foggia, via Napoli 25, 71100 Foggia, Italy c Istituto Sperimentale per la Cerealicoltura, Sez. di Foggia, S.S. 16 Km 675, 71100 Foggia, Italy d ISPA-CNR Lecce, via prov.le Monteroni, 73100 Lecce, Italy e Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK Received 5 April 2005; received in revised form 8 July 2005; accepted 13 July 2005
Abstract Elucidation of molecular mechanisms underlying the ‘stay green’ trait is not only relevant to understanding the senescence phenomenon itself, but also has potential significance for yield improvement. A mutant of durum wheat (Triticum durum Desf.) cultivar Trinakria (designated 504) was characterised by delayed leaf senescence, and analysis of photosynthetic parameters showed that it was functionally ‘stay green’. An in vitro system was established to mimic senescence by incubating wheat leaves in the dark, allowing the expression of genes known to be differentially regulated during senescence to be determined. Moreover, cDNAs found to be differentially expressed in the mutant were cloned and sequenced, showing homologies with photosynthesis-related genes. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) analyses were performed using RNA samples from 504 mutant and parental Trinakria plants, during both natural and artificially induced senescence, confirming the altered expression profiles of these genes in the ‘stay green’ mutant 504. The exploitation of such ‘stay green’ phenotype in breeding of durum and bread wheats has the potential to increase yields by extending the period of active photosynthesis during grain filling, especially under unfavourable environmental conditions. q 2005 Elsevier Ltd. All rights reserved. Keywords: Durum wheat; RT-PCR; Senescence; ‘Stay green’
1. Introduction Annual plants such as durum wheat are characterised by a life cycle in which the plant grows, flowers, ages, and dies during a single year. In such plants, the formation of seeds is related to an irreversible ageing of the whole plant and the mobilisation and translocation of N-rich compounds to the Abbreviations: cab, chlorophyll a/b binding protein gene; DAF, days after flowering; GDC, glycine decarboxylase; rbcS, rubisco small subunit gene; Rht, reduced height; RT-PCR, reverse transcription-polymerase chain reaction; Rubisco, ribulose bisphosphate carboxylase/oxigenase; SAG, senescence associated genes; SDG, senescence down-regulated genes; SEN, senescence enhanced genes; SSS, soluble starch synthase. * Corresponding author. Tel.: C39 832 298688; fax: C39 832 298858. E-mail address: [email protected] (C. Perrotta). 0733-5210/$ - see front matter q 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2005.07.004
seeds. At the end of this process, called senescence, the plant dies (Mohr and Schopfer, 1995). Senescence is a programmed and highly regulated process characterised by a specific sequence of biochemical and physiological events related to the loss of chlorophyll and dismantling of the photosynthetic apparatus. The most dramatic phenotypic feature is the loss of the green colour of leaves. Many cellular and molecular events take place during senescence including mobilisation of nitrogen and other nutrients, degradation of macromolecules (i.e. chlorophyll, lipids, proteins, and nucleic acids), and dismantling of chloroplasts and other organelles (Lin and Wu, 2004). All these events can also be induced by environmental conditions such as nitrogen deficiency, low light intensity, drought and pathogen infection. However, programmed senescence and senescence induced by environmental stresses differ in that the latter can be reversed if the stress conditions
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
are alleviated before the senescence process reaches the ‘nonreturn’ stage. Senescence is an important stage of plant development and when the plant reaches a certain age the process of senescence will be triggered even though the environmental conditions may be favourable for continued growth (Buchanan-Wollaston, 1997; Buchanan-Wollaston et al., 2003; Yoshida, 2003). Although the specific mechanisms by which senescence is regulated are not understood, and many regulators of leaf senescence are not yet identified, there is clear evidence that it is driven by many specific genes which may be either highly expressed (Senescence Associated Genes or SAG) or downregulated (Senescence Down-regulated Genes or SDG) during the senescence process (Gan and Amasino, 1995; Gepstein, 2004; Lim et al., 2003; Nam, 1997; Smart, 1994). Among the SDG are genes coding for the ribulose bisphosphate carboxylase/oxygenase or Rubisco, small subunit (rbcS) and the chlorophyll a/b binding protein (cab). SAG genes may also be called SEN (senescence enhanced) and are divided in two groups. The first of these includes genes that are specifically expressed only during senescence and the second genes whose expression is enhanced during senescence. Elucidation of the molecular basis of senescence is not only of fundamental interest but also relevant to the genetic improvement of crop plants. A powerful tool for the analysis of the senescence process is the molecular characterisation of mutants that are defective in an aspect of senescence, such as the ‘stay green’ mutants. ‘Stay green’ mutants are characterised by the persistence of the green colour of leaves for longer than those of parental genotypes. In particular, some ‘stay green’ mutants can arise from delays in the initiation of senescence and its rate of progress. Consequently such mutants continue to photosynthesise for longer than usual, they are therefore said to be ‘functional stay green’ (Thomas and Howarth, 2000). A strong relationship between the extension of the photosynthetic capacity and grain yield was observed in cereals such as maize and sorghum. In particular, it is important in this respect that the photosynthetic capacities of both the total canopy and specific leaves are maintained throughout the entire life cycle, including the period from flowering to grain maturity (Thomas and Smart, 1993). In agronomic terms, these mutants have higher kernel weights and this observation has been exploited by maize breeders. Although breeders have extensively used such material for yield improvement, little is known about the underlying genetics and molecular biology of the trait(s) even though detailed analyses have been performed in maize and sorghum (Tao et al., 2000; Thomas and Smart, 1993). One approach to determine the molecular basis of the ‘stay green’ phenotype is to identify the differences between mutant and parental plants in their regulation of specific genes during the senescence process. We have therefore compared a previously described (Spano et al., 2003) ‘functional stay green’ mutant of durum wheat (line 504) and its parental line, focusing on three genes identified as differentially expressed in the two lines. Although these three genes differ in their detailed expression patterns the results are consistent with an extension
161
of the period of active photosynthesis indicating that the ‘stay green’ phenotype could be expected to increase crop biomass and yield. 2. Experimental 2.1. Plant material Durum wheat (Triticum durum Desf.) cv. Trinakria and mutant 504 were grown in a glasshouse in 25 cm pots filled with the compost as previously indicated (Spano et al., 2003) under irradiance of ca. 750 mmol mK2 sK1, supplied by 400 W sodium lamps with a 16 h light period, at 18–20 8C under lighting and 14–16 8C during darkness, and 50–70% relative humidity. At various days after flowering (DAF) flag leaves were removed from the plants and frozen in liquid nitrogen before RNA extraction. Plants were also grown in PERLIGRAN (Deutsche Perlite, Dortmund, Germany) for 11 d under a constant light/dark regime with 16 h light and 8 h darkness and watered with tap water. Fully expanded primary foliage leaves were removed, placed in a 50 ml tube filled with tap water and incubated in the dark at 20 8C for induction of senescence. For chlorophyll analysis three discs were taken from different areas of each leaf (i.e. from the apical medial and basal part of the leaf) incubated in the dark at times from 8 to 58 h. Three replicate samples were taken at each time for chlorophyll determination and the leaves were immediately frozen before RNA extraction. 2.2. Chlorophyll assays The three discs (20 mm diameter) excised from different areas of each leaf were pooled and ground in 1 ml of 80% (v/v) aqueous acetone. Extracts were diluted tenfold in 100% acetone and the A646 and A663 were measured. Chlorophyll a and b concentrations were calculated by the equations of Hill (Hill et al., 1985). Mean values were based on independent measurements of at least three leaves. 2.3. Total RNA extraction and northern analysis Total RNA was isolated from leaves of naturally senescent plants or detached leaves that had been kept in the dark, using the ‘SV Total RNA Isolation System’ (Promega, Madison, WI) according to the supplier’s instruction, and was quantified spectrophotometrically. Electrophoresis, blotting and hybridisation of RNA were performed as described previously (Treglia et al., 1999). 2.4. Sequencing of differentially expressed fragments Some clones containing differentially expressed fragments identified by the differential display method (Liang and Pardee, 1992) performed on mRNA from Trinakria and mutant, in a previous work (Spano, 2001), were sequenced using the ‘Big Dye Terminator Sequencing kit’ (Applied Biosystems, Foster
162
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
City, CA). Three sequencing reactions were set up for each plasmid DNA; reaction mix was prepared following the supplier’s instruction and 3.2 pmol of each primer (T7 and SP6) were used for each reaction. Three of them, designated as W3, W4 and W7, where chosen for further analysis. 2.5. Primer design Two sets of primers were designed based on the sequences of genes whose expression is known to be down-regulated by senescence i.e. rbcS from Triticum aestivum (Accession number AB042068) and cab from T. aestivum (Accession number M10144). Primers were also designed based on the sequences of the differentially expressed genes i.e. W3, W4, and W7 and of the a-tubulin gene (Accession number U76558) as an internal control. Primers were selected using ‘Primer 3’ software available at the web site www.basic.nwu.edu/biotools and were prepared commercially (MWG, Ebersberg, Germany). Their sequences are listed in Table 1. 2.6. Semi-quantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR) analysis Synthesis of cDNA was conducted using the ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA) according to the supplier’s instruction using oligo (dT)15 as primer. Subsequently, PCR was performed in a reaction mixture containing 1 ml of cDNA sample in a final reaction mixture (50 ml) containing PCR buffer (10 mM Tris–HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2), 0.1 mM dNTPs, 1 mM of each forward and Table 1 Primers used in RT-PCR analysis.The annealing temperature for each of primer couple and the size of the amplicons are also indicated Primer name
Sequence 5 0 -3 0
Annealing temperature (8C)
Size of PCR product [cDNA (bp)]
TdrbcSF TdrbcSR TdcabF
CTGTGATGGCTTCCTCGG TTAGGCCTTGCCGGACTC GGCCACCACCATGTCTCTT CGCGTTGTTGTTGACAGG AGACTTTTTCGGTGCTCTGC GAGCAGGAGATGTGGTGTGT TACGAGCAGATCTTCCGAATG TGTCAGCTAAGGACAAGACAACA TCTAGGGAGTATGCTGCGTTC GGAGGATACAGGAGAAGGTGG TCGCATACGACACGCTTTAG GCTTGCTTGGTTGCAGTGTA
58
518
56
760
57
321
57
442
59
297
57
589
TdcabR W3F W3R W4F W4R W7F W7R TaTubF TaTubR
reverse primer and 0.5 units of DyNAzyme DNA polymerase (Finnzymes, Espoo, Finland). Amplification was performed in a thermal cycler (MJ PTC-100, MJ research, Sierra Point, CA) using 1 step of 2 min at 94 8C, and then 23–38 cycles each of 30 s at 94 8C, 30 s at 57–59 8C (annealing temperature optimised for the individual genes), and 60 s at 72 8C, followed by a final step of 7 min at 72 8C. The range at which the amount of the PCR products was exponentially increasing was determined for each gene using a fixed quantity of cDNA and serial numbers of cycles, namely 21–40 (Murphy et al., 1990). PCR products were separated in 1% agarose, stained with ethidium bromide, analysed under UV light and a relative estimate of the mRNA amounts was obtained by the 1D Image Analysis software of Kodak EDAS 290 (Eastman Kodak Company, Rochester, NY). The predicted sizes of the amplification products are listed in Table 1. 2.7. Cloning, sequencing and analysis of PCR products PCR products were purified using the ‘Wizard SV gel and PCR clean-up system’ (Promega). They were cloned in ‘PCR II TOPO Vector’ included in the “TA TOPO Cloning kit” (Invitrogen) following the supplier’s instruction. Plasmid DNA was sequenced using the ‘Big Dye Terminator Sequencing Kit’ (Applied Biosystems) as reported in Section 2.6. Thermal cycler conditions, using MJ PTC-100, were as follows: 25 cycles each of 30 s at 96 8C, 15 s at 50 8C and 30 s at 60 8C. Samples were analysed by ABI Prism 310 Genetic Analyser (Applied Biosystems). DNA sequences obtained were compared with public databases using both FASTA and BLAST programs. 3. Results 3.1. Senescence induction and chlorophyll content Dark-induced senescence of plants has been employed as a convenient model system to study leaf senescence (Noode´n, 1988; Oh et al., 1996; Thimann, 1980), giving reproducible material for analysis (Park et al., 1998). Leaves were therefore incubated in the dark up to 58 h. As shown in Fig. 1, the chlorophyll contents of both lines decreased during incubation in the dark but this was significantly delayed in the mutant. In fact, a progressive reduction occurred from the start of the incubation in cv. Trinakria. In contrast in mutant 504 the chlorophyll content remained constant up to 33 h and then decreased, indicating that 504 mutant exhibits a delayed onset, but not a reduced rate of senescence. 3.2. Sequencing of differentially expressed fragments Preliminary analysis of mutant 504 identified many differentially expressed fragments (Spano, 2001). Three of these, called W3, W4 and W7 were selected for this study,
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
163
Fig. 1. Differences in relative chlorophyll contents between 504 mutant and parental Trinakria line. Each value represents the mean of three independent measurements. Data are presented as the meansGSEM.
based on the fact that they gave reproducible results when used for RT-PCR. The cloned fragments were 321, 442, and 297 bp long. Comparison of their nucleotide and deduced amino acid sequences with databases revealed significant similarities to known sequences. The nucleotide sequence of W3 (Accession number AJ35203) shared 91.7% identity with the coding sequence of Rubisco activase A2 (RcaA2) of barley (Hordeum vulgare) (Accession number M55447); the sequence of W4 (Accession number AJ635204) shared 90.3% identity with the soluble starch synthase gene of bread wheat (T. aestivum) (Accession number TA48227) and the sequence of W7 (Accession number AJ635205) was 96.8% identical to the coding sequence of glycine decarboxylase (P-protein) of Tritordeum (Hordeum chilense x T. aestivum) (Accession number AF024589). The high expression levels of these three fragments in the senescing leaves of the mutant line were also confirmed by northern blot analysis of total RNA from leaves at the same stage as those used for differential display (Fig. 2). 3.3. Semi-quantitative RT-PCR analysis The a-tubulin gene has been widely used as a control in studies of gene expression (Kawasaki et al., 2001; Seki et al., 2001) and was therefore used as an internal control for RTPCR analysis. Amplification of the wheat a-tubulin cDNAs confirmed that approximately equal amounts of cDNAs were used for each RT-PCR analysis, with further confirmation being provided by repeated RT-PCR analysis with different RNA samples; preliminary tests were performed for each PCR reaction using different number of cycles, thus ensuring analysis of the product before the plateau was reached (data not shown). The levels of expression of the genes corresponding to all the primers listed in Table 1 were analysed by RT-PCR of RNAs isolated from leaves at different stages of both natural and induced senescence. The results obtained from leaves in which senescence was induced are shown in Fig. 3. Two
Fig. 2. Northern analysis of transcripts corresponding to cDNA probes W3, W4 and W7. RNA was prepared from leaf tissue of naturally senescent plants at 10 DAF; 12 mg of total RNA was applied to each lane. The rRNA was used as loading control. TK, parental line cv. Trinakria; 504, 504 mutant line.
previously defined genes which are down-regulated during senescence (Kleber-Janke and Krupinska, 1997) were included in this present study; these were the small subunit of Rubisco (rbcS) and the chlorophyll a/b binding protein (cab). PCR products amplified by primers based on the T. aestivum rbcS and cab genes were cloned and sequenced to confirm the identity of the T. durum amplicons. The T. durum fragment was 518 bp long and its sequence (Accession number AJ635206) shared 97% identity with the coding sequence of the T. aestivum rbcS (Accession number AB042068). Similarly, the sequence of the T. durum fragment (760 bp long; Accession number AJ635207) corresponding to cab was 98.4% identical to that from T. aestivum (Accession number M10144). The level of rbcS transcripts declined over time in cv. Trinakria, in contrast in the mutant line the amount did not significantly change during the darkness incubation. Transcripts related to the cab gene fell sharply in abundance after 8 h in the dark in both the mutant line and Trinakria, although in the mutant line the relative amount was slightly higher. To verify their identity, the W3, W4 and W7 amplicons were also cloned and sequenced: in all cases their sequences were identical to those of the differentially expressed fragments. The accumulation patterns of transcripts related to the W3, W4 and W7 genes also differed between the two lines. In fact in the cv. Trinakria, the amounts of W3 and W7 transcripts fell to undetectable levels after 8 h while W4 transcripts were still present but at very low levels. In contrast, transcripts related to
164
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
Fig. 3. Expression analysis during dark-induced senescence of rbcS and cab genes, and of W3, W4 and W7 differentially expressed sequences. TK, parental line cv. Trinakria; 504, 504 mutant line; bp, base pairs. Level of mRNA was analysed by RT-PCR using specific primers (reported in Table 1) for target genes and for atubulin, as given in Experimental (Section 2.5). Band intensities (columns) were normalised to a-tubulin band intensity and expressed as relative transcript level (the highest intensity set to 100 for each gene separately). The quantified gels are shown as inserted pictures.
W3 and W7 were still detectable after 8 h in mutant 504 and transcripts related to W4 after 24 h. The induction patterns of the same genes were also determined in leaves undergoing natural senescence (from 7 to 24 DAF). As shown in Fig. 4, the transcripts related to rbcS were not detectable using our RT-PCR conditions at 7 DAF in the cv. Trinakria although they were detectable when performing PCR for a higher number of cycles (data not shown) while in mutant 504 the transcripts were present at very high levels after 7 DAF and then decreased. The levels of these transcripts were reduced to about 25% of their initial level after 24 DAF. Transcripts amplified by the cab primers were undetectable after 7 DAF in cv. Trinakria, but remained at a similar level up to 11 DAF in mutant 504, after which they rapidly declined to undetectable levels. Transcripts of W3, W4 and W7 cDNAs also decreased during the course of senescence in cv. Trinakria. In general,
there were clear decreases after 11 DAF and an even greater reduction after 24 DAF. The most dramatic change was observed for W7 with the transcript levels falling to about 50% by 11 DAF, when its expression is reduced to about 50%. In mutant 504, levels of the transcript related to W3 remained at an almost constant level until 24 DAF. Similarly the levels of transcripts related to W4 and W7 remained almost constant until 11 DAF and then they decreased to about 40 and 55% of their initial expression levels, respectively (Fig. 4). In general, these reported differences in the expression of transcripts related to W3, W4 and W7 were observed in at least three independent experiments. 4. Discussion In this paper we report molecular analyses of a durum wheat mutant characterised by a ‘stay green’ phenotype.
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
165
Fig. 4. Expression analysis during natural senescence of rbcS and cab genes, and of W3, W4 and W7 differentially expressed sequences. DAF, days after flowering; TK, parental line cv. Trinakria; 504, 504 mutant line; bp, base pairs. Level of mRNA was analysed by RT-PCR with specific primers (as indicated in Table 1) for target genes and for a-tubulin, as given in Experimental Section 2.5). Band intensities (columns) were normalised to a-tubulin band intensity and expressed as relative transcript level (the highest intensity set to 100 for each gene separately). The quantified gels are shown as inserted pictures.
Plant senescence can be induced not only by developmental stage and hormone levels, but also by abiotic and biotic stresses, including darkness, and recent analyses of the signalling pathways involved in different stress response have considerable cross-talk with senescence related gene expression (Buchanan-Wollaston et al., 2003). This could indicate some genes that are induced during senescence may also play roles in protection mechanisms activated in response to certain stresses. In fact, Barth and coworkers (2004) have recently described a cDNA that is involved in both abiotic stresses response (such as drought, heat, high light, ABA, etc.) and senescence in barley, and similar cross-talk has been reported in Arabidopsis (Prandl et al., 1995). Many studies of senescence-related genes have been made using leaves induced to senesce in the dark (Becker and Apel, 1993; Fujiki et al., 2001; Lee et al., 2001; Oh et al., 1996). This approach has the advantage of providing
reproducible and homogeneous material. Most of the data obtained by this system confirm that the genes identified as showing enhanced expression during dark-induced senescence of detached leaves show similar behaviour in attached leaves as well as during senescence under field conditions (Kleber-Janke and Krupinska, 1997); moreover data obtained using this treatment show good agreement with agemediated senescence-specific gene expression (Quirino et al., 2000). Other workers have studied leaf senescence in plants grown under controlled environmental conditions (Lohman et al., 1994; Miersch et al., 2000) but most have focused on biochemical and physiological changes (Fischer and Feller, 1994; Lu et al., 2001; Wittenbach, 1979) rather than gene expression (Humbeck et al., 1996; Scharrenberg et al., 2003). Although the loss of chlorophyll and the concomitant yellowing of the leaves are convenient and distinctive
166
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
indicators of leaf senescence, this phenotype can be uncoupled from ‘functional’ leaf senescence (Thomas and Smart, 1993). The ‘stay green’ mutant utilised in this report had already been characterised on the basis of its physiological parameters (Spano et al., 2003) as functional ‘stay green’. These studies showed that the induction of senescence is paralleled by chlorophyll breakdown which is delayed in the leaves of the mutant compared to the control thus can be classified as a type A ‘stay green’ according to Thomas and Smart (1993). The timing of decrease in the chlorophyll content of the flag leaf indicated that the senescence process started at least 1 week earlier in the control plants than in the mutant lines (data not shown). To study these differences at the molecular level we focused on genes whose expression is down-regulated during senescence, including rbcS and cab which were used as markers for the onset of the senescence process (BuchananWollaston and Ainsworth, 1997; Gepstein et al., 2003; KleberJanke and Krupinska, 1997). Our results showed that the expression of these genes in cv. Trinakria decreased during the incubation of leaves in the dark, and confirmed that the induction of senescence was reproducible. Furthermore, differences in the timing of senescence in mutant 504 were consistent with the differences in chlorophyll content. The extended expression of photosynthesis-related genes (rbcS and cab) also confirms that this mutant is a functional ‘stay green’ according to Thomas and Smart (1993). Nevertheless, it should be noted that the leaf senescence is only delayed in the mutant, not eliminated. Among the many differentially expressed fragments isolated (Spano, 2001), we have focused our analysis on W3, W4 and W7 because they gave reproducible results when used for RTPCR. BLAST analysis of three genes (W3, W4, W7) which are differentially expressed in the mutant, revealed that they encode a putative Rubisco activase A2, a soluble starch synthase, and a glycine decarboxylase (P-protein), respectively. It is interesting to note that all these genes code for important components of the photosynthetic system. Rubisco activase normally accumulates in greening or photosynthetic tissues and its primary role is to reactivate Rubisco that has been deactivated by sugar biphosphatases. Degradation of Rubisco is an early event in the senescence-specific dismantling of chloroplasts and the higher expression of Rubisco activase in the mutant may suggest that the extension of the green leaf area in the mutant is sustained by functional photosynthesis. Soluble starch synthase (SSS) is an enzyme of starch synthesis and its extended expression in photosynthesizing flag leaves could be related to extended grain filling and could contribute to the increased seed size and yield already reported for this mutant (Spano et al., 2003). Glycine decarboxylase (GDC), is a key enzyme in the photorespiratory carbon oxidation cycle. Comparison of the expression pattern of the GDC gene with that of rbcS gene suggests common regulation related to light induction
(Vauclare et al., 1996). As for the SSS gene, the GDC gene shows lower expression in the control plants compared with the mutant, indicating that the enzyme is active for longer and suggesting that this aspect also contributes to the ‘stay green’ phenotype. It is probable that none of the three genes identified and analysed in this study are responsible for the ‘stay green’ phenotype but rather they appear to be differentially expressed as a consequence of the mutation. Further analysis of other differentially expressed sequences will be performed in order to elucidate the molecular basis of this phenotype. In recent years, continuing efforts have been made to identify genes responsible for leaf senescence. A picture is emerging of the conditions that initiate leaf senescence and of the promoter elements required for senescence-associated gene expression. However, little is known of the regulatory genes that co-ordinate senescence at the molecular level. Studies of mutants from several species have revealed genes that regulate some aspects of plant senescence. In particular, it has been postulated that Arabidopsis may have multiple pathways which respond to a wide range of factors and form a regulatory network to control leaf senescence. Furthermore, a putative leaf senescence regulatory network in Arabidopsis has been reported (He et al., 2001). However, with few exceptions (Hajouj et al., 2000; Schaller and Bleecker, 1995; Wilkinson et al., 1995; Woo et al., 2001; 2004), the identities of the key genes that regulate the initiation or progression of leaf senescence are not known. Furthermore some genes involved in the chlorophyll catabolism and in its control (i.e. genes for pheophorbide a oxygenase and cysteine proteases) have been identified in grasses and have been demonstrated to be specifically related to senescence (Ho¨rtensteiner and Feller, 2002; Thomas et al., 2002). Our results contribute to this developing picture as well as confirming the functional nature of the ‘stay green’ phenotype in an important agricultural crop, durum wheat. Although conventional plant breeding continues to produce new varieties with increased yield, the magnitude of these increases is falling indicating that a plateau is being reached with the major yield limiting factor being grain number. The exploitation of ‘stay green’ mutations of the type described here has the potential to increase yields above this plateau (in the same way that the Rht series of dwarfing genes revolutionised wheat breeding some 40 years ago (Lenton, 2001)), particularly in water and N-limited environments where post-anthesis photoassimilation is the likely limit to yield. Further studies under field conditions will be required to determine whether the ‘stay green’ phenotype has impacts on seed size, seed number or both of these major yield determinants. Acknowledgements We would like to thank Mrs P. Fasano for her excellent assistance. This work was supported by Italian MIUR funding to C. Perrotta. Istituto Sperimentale per la Cerealicoltura
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
receives grant-aided support from the Italian Ministry of Agriculture (MiPAF), Rothamsted Research receives grantaided support from the Biotechnology and Biological Sciences Research Council (BBSRC) of the UK. References Barth, O., Zschiesche, W., Siersleben, S., Humbeck, K., 2004. Isolation of a novel barley cDNA encoding a nuclear protein involved in stress response and leaf senescence. Physiologia Plantarum 121, 282–293. Becker, W., Apel, K., 1993. Differences in gene expression between natural and artificially induced leaf senescence. Planta 189, 74–79. Buchanan-Wollaston, V., 1997. The molecular biology of leaf senescence. Journal of Experimental Botany 48, 181–199. Buchanan-Wollaston, V., Ainsworth, C., 1997. Leaf senescence in Brassica napus: cloning of senescence related genes by subtractive hybridisation. Plant Molecular Biology 33, 821–834. Buchanan-Wollaston, V., Earl, S., Harrison, E., Mathas, E., Navabpour, S., Page, T., Pink, D., 2003. The molecular analysis of leaf senescence—a genomics approach. Plant Biotechnology Journal 1, 3–22. Fischer, R.A., Feller, U., 1994. Senescence and protein degradation in leaf segments of young winter wheat: influence of leaf age. Journal of Experimental Botany 45, 103–109. Fujiki, Y., Yoshikawa, Y., Sato, T., Inada, N., Ito, M., Nishida, I., Watanabe, A., 2001. Dark-inducible genes from Arabidopsis thaliana are associated with leaf senescence and repressed by sugars. Physiologia Plantarum 11, 345–352. Gan, S., Amasino, R.M., 1995. Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270, 1966–1967. Gepstein, S., 2004. Leaf senescence—not just a ‘wear and tear’ phenomenon. Genome Biology 5, 212. Gepstein, S., Sabehi, G., Carp, M.-J., Hajouj, T., Nesher, M.F.O., Yariv, I., Dor, C., Bassani, M., 2003. Large-scale identification of leaf senescenceassociated genes. Plant Journal 36, 629–642. Hajouj, T., Michelis, R., Gepstein, S., 2000. Cloning and characterisation of a receptor-like protein kinase gene associated with senescence. Plant Physiology 124, 1305–1314. He, Y., Tang, W., Swain, J.D., Green, A.L., Jack, T.P., Gan, S., 2001. Networking senescence-regulating pathways by using Arabidopsis enhancer trap lines. Plant Physiology 126, 707–716. Hill, C.M., Pearson, S.A., Smith, A.J., Rogers, L.J., 1985. Inhibition of chlorophyll synthesis in Hordeum vulgare by 3-amino 2,3-dihydrobenzoic acid (gabaculin). Bioscience Reports 5, 775–781. Ho¨rtensteiner, S., Feller, U., 2002. Nitrogen metabolism and remobilization during senescence. Journal of Experimental Botany 53, 927–937. Humbeck, K., Quast, S., Krupinska, K., 1996. Functional and molecular changes in the photosynthetic apparatus during senescence of flag leaves from field-grown barley plants. Plant, Cell and Environment 19, 337– 344. Kawasaki, K., Borchert, C., Deyholas, M., Wang, H., Brazille, S., Kawai, K., Galbraith, D., Bohnert, H.J., 2001. Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 13, 889–906. Kleber-Janke, T., Krupinska, K., 1997. Isolation of cDNA clones for genes showing enhanced expression in barley leaves during dark-induced senescence as well as during senescence under field conditions. Planta 203, 332–340. Lee, R.-H., Wang, C.-H., Huang, L.-T., Ken, S.-C.G., 2001. Leaf senescence in rice plants: cloning and characterisation of senescence upregulated genes. Journal of Experimental Botany 52, 1117–1121. Lenton, J.R., 2001. Opportunities for the manipulation of development of temperate cereals. In: Shewry, P.R., Lazzeri, P.A., Edwards, K.J. (Eds.), Advances in Botanical Research, vol. 34. Academic Press, London, pp. 127–153. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971.
167
Lim, P.O., Woo, H.R., Nam, H.G., 2003. Molecular genetics of leaf senescence in Arabidopsis. Trends in Plant Science 8, 272–278. Lin, J.F., Wu, S.-H., 2004. Molecular events in senescing Arabidopsis leaves. Plant Journal 39, 612–628. Lohman, K.N., Susheng, G., Manorama, C.J., Amasino, R.M., 1994. Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiologia Plantarum 92, 322–328. Lu, C., Lu, Q., Zang, J., Kuang, T., 2001. Characterisation of photosynthetic pigment composition, photosystem II photochemistry and thermal energy dissipation during leaf senescence of wheat plants grown in the field. Journal of Experimental Botany 52, 1805–1810. Miersch, I., Heise, J., Zelmer, K., Humbeck, K., 2000. Differential degradation of the photosynthetic apparatus during leaf senescence in barley (Hordeum vulgare L.). Plant Biology 2, 618–624. Mohr, H., Schopfer, P., 1995. Plant Physiology. Springer, Berlin. Murphy, L.D., Herzog, C.E., Rudick, J.B., Fojo, A.T., Bates, S.E., 1990. Use of the Polymerase Chain Reaction in the quantitation of mdr-1 gene expression. Biochemistry 29, 10351–10356. Nam, H.G., 1997. The molecular genetic analysis of leaf senescence. Current Opinion in Biotechnology 8, 200–207. Noode´n, L.D., 1988. Abscissic acid, auxin and other regulators of senescence. In: Noode´n, L.D., Leopold, A.C. (Eds.), Senescence and Aging in Plants. Academic Press, San Diego, pp. 330–386. Oh, S.A., Lee, S.Y., Chung, I.K., Lee, C.-H., Nam, H.G., 1996. A senescenceassociated gene of Arabidopsis thaliana is distinctively regulated during natural and artificially induced leaf senescence. Plant Molecular Biology 30, 739–754. Park, J.-H., Oh, S.A., Kim, Y.H., Woo, H.R., Nam, H.G., 1998. Differential expression of senescence-associated mRNAs during leaf senescence induced by different senescence-inducing factors in Arabidopsis. Plant Molecular Biology 37, 445–454. Prandl, P.P., Kloske, E., Shoffl, F., 1995. Developmental regulation and timespecific differences of heat shock gene expression in transgenic tobacco and Arabidopsis. Plant Molecular Biology 28, 73–82. Quirino, B.F., Noh, Y-S., Himelblau, E., Amasino, R.M., 2000. Molecular aspects of leaf senescence. Trends in Plant Science 5, 278–282. Schaller, G.E., Bleecker, A.B., 1995. Ethylene-binding sites generated in yeast expressing Arabidopsis ETR1 gene. Science 270, 1809–1811. Scharrenberg, C., Falk, J., Quast, S., Haussuhl, K., Humberk, K., Krupinska, K., 2003. Isolation of senescence-related cDNAs from flag leaves of field grown barley plants. Physiologia Plantarum 118, 278– 288. Seki, M., Narusaka, M., Abe, H., Kasuga, M., Yamaguchi-Shinozaki, K., Carninci, P., Hayashizaki, Y., Shinozaki, K., 2001. Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full length cDNA microarray. Plant Cell 13, 61–72. Smart, C., 1994. Gene expression during leaf senescence. New Phytologist 126, 419–448. Spano, G., 2001. Physiological and molecular characterisation of ‘stay green’ mutants in durum wheat. PhD Thesis, University of Bristol, Department of Agricultural Science, UK. Spano, G., Di Fonzo, N., Perrotta, C., Ronga, G., Lawlor, D.W., Napier, J.A., Shewry, P.R., 2003. Physiological characterization of ‘stay green’ mutants in durum wheat. Journal of Experimental Botany 54, 1415–1420. Tao, Y.Z., Henzell, R.G., Jordan, D.R., Butler, D.G., Kelly, A.M., McIntyre, C.L., 2000. Identification of genomic regions associated with stay-green in sorghum by testing RILs in multiple environments. Theoretical and Applied Genetics 100, 1225–1232. Thimann, K.V., 1980. The senescence of leaves. In: Thimann, K.V. (Ed.), Senescence in Plants. CRC Press, Boca Raton, FL, pp. 85–115. Thomas, H., Smart, C.M., 1993. Crops that stay green. Annals of Applied Biology 123, 193–203. Thomas, H., Howarth, C.J., 2000. Five ways to stay green. Journal of Experimental Botany 51, 329–337. Thomas, H., Ougham, H., Canter, P., Donnison, I., 2002. What stay-green mutants tell us about nitrogen remobilization in leaf senescence. Journal of Experimental Botany 53, 801–808.
168
P. Rampino et al. / Journal of Cereal Science 43 (2006) 160–168
Treglia, A., Spano, G., Rampino, P., Giangrande, E., Nocco, G., Mita, G., Di Fonzo, N., Perrotta, C., 1999. Identification by in vitro translation and northern blot analysis of heat shock mRNAs isolated from wheat seeds exposed to different temperatures during ripening. Journal of Cereal Science 30, 33–38. Vauclare, P., Diallo, N., Bourguignon, J., Macherel, D., Douce, R., 1996. Regulation of the expression of the glycine decarboxylase complex during pea leaf development. Plant Physiology 112, 1523–1530. Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J., Klee, H.J., 1995. An ethylene inducible component of signal transduction encoded by neverripe. Science 270, 1807–1809.
Wittenbach, V.A., 1979. Ribulose bisphosphate carboxylase and proteolytic activity in wheat leaves from anthesis through senescence. Plant Physiology 64, 84–887. Woo, H.R., Chung, K.M., Park, J.-H., Oh, S.A., Ahn, T., Hong, S.H., Jang, S.K., Nam, H.G., 2001. ORE9, an F-box protein that regulates leaf senescence in Arabidopsis. Plant Cell 13, 1779–1790. Woo, H.R., Kim, J.H., Nam, H.G., Lim, P.O., 2004. The delayed leaf senescence mutants of Arabidopsis, ore1, ore3, and ore9 are tolerant to oxidative stress. Plant Cell Physiology 45, 923–932. Yoshida, S., 2003. Molecular regulation of leaf senescence. Current Opinion in Plant Biology 6, 79–84.