Molecular analysis of estrogen induction of preproenkephalin gene expression and its modulation by thyroid hormones

Molecular Brain Research 91 (2001) 23–33 www.elsevier.com / locate / bres

Research report

Molecular analysis of estrogen induction of preproenkephalin gene expression and its modulation by thyroid hormones a,b ,

b

b

b

Yuan-Shan Zhu *, Li-Qun Cai , Xueke You , Yanwen Duan , Julianne Imperato-McGinley b , William W. Chin c , Donald W. Pfaff a b

a Laboratory of Neurobiology and Behavior, The Rockefeller University, New York, NY 10021, USA Department of Medicine /Endocrinology, Weill Medical College of Cornell University, 1300 York Avenue, Box 149, New York, NY 10021, USA c Division of Genetics and Department of Medicine, Brighan and Women’ s Hospital and Harvard Medical School, Boston, MA 02115, USA

Accepted 3 April 2001

Abstract Estrogen receptors (ER) and thyroid hormone receptors (TR) are ligand-dependent nuclear transcription factors. Estrogen-induced preproenkephalin (PPE) gene expression in the hypothalamus is directly related to estrogen-induced lordosis behavior in the rat. In the present study, we showed that the PPE mRNA level in the ventromedial hypothalamus of female rats was significantly decreased by ovariectomy. This decrease was reversed by estrogen replacement in a dose- and time-dependent manner. Using transient transfection and electrophoretic mobility shift assays (EMSA), functional estrogen response elements (ERE) were identified between 2437 and 2145 base pairs (bp) of the rat PPE gene promoter region. Two ERE-like elements are present between 2405 and 2364 of the rat PPE gene promoter, which bind ERa as demonstrated by EMSA. Estrogen produced a dose-dependent increase in CAT activity in cotransfection assays with ERa expression vector and a 437PPE-CAT reporter construct containing 437 bp of the rat PPE gene promoter and the CAT reporter gene. This estrogen-induced PPE promoter activity was inhibited by liganded-TR in transient cotransfection assays. Analysis of DNA–protein interactions by EMSA revealed that both ERa and TR (a1 and b1) could bind to the EREs in the rat PPE gene promoter. Furthermore, estrogen induction of PPE mRNA in the ventromedial hypothalamus of the ovariectomized female rat was significantly attenuated by concomitant administration of triiodothyronine. These results suggest that estrogen regulation of the hypothalamic PPE gene expression is mediated through an estrogen-receptor complex directly interacting with the functional EREs in its promoter region; and that this estrogen effect can be modified by thyroid hormones.  2001 Elsevier Science B.V. All rights reserved. Theme: Cellular and molecular biology Topic: Gene structure and function: general Keywords: Estrogen; Enkephalin; Thyroid hormone; Hypothalamus

1. Introduction Estrogen is a critical factor in the induction of lordosis behavior in quadruped mammals [54]. This behavioral endpoint is dependent on the hypothalamus, especially the ventromedial hypothalamus (VMH), and on de novo RNA and protein biosynthesis. Several genes encoding proteins such as proenkephalin, progesterone receptor, a1-adren-

*Corresponding author. Tel.: 11-212-746-3826; fax: 11-212-7468348. E-mail address: [email protected] (Y.-S. Zhu).

ergic receptor, oxytocin and its receptor that are regulated by estrogen in the hypothalamus have been linked to this estrogenic action on behavior [54]. The preproenkephalin (PPE) gene encodes enkephalin peptides that have been postulated to function as neurotransmitters and neuromodulators in the neural system [3]. Treatment with estrogen in the ovariectomized female rat produces tissue, sex-specific and dose-dependent induction of PPE gene expression in the VMH, which correlates with estrogen-induced lordosis behavior [36,54]. Perturbation of the estrogen-induced PPE gene expression in the VMH of female rats by specific antisense oligonucleotides significantly attenuate estrogen-induced lordosis behavior [46], establishing a cause–effect relationship between estrogen

0169-328X / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0169-328X( 01 )00109-7

24

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

induction of PPE gene expression and lordosis behavior in the female rat. The genomic actions of estrogen are mediated through the binding of estrogen to the estrogen receptors (ER), which then interact with the estrogen DNA responsive element (ERE) to regulate the target gene expression [17]. Two isoforms of ER encoded by two distinctive genes, ERa (the classical ER) [25,26] and ERb [33,43,47,70] have been cloned. They can bind to ERE as either homodimers, or heterodimers, and mediate estrogenic regulation of target gene expression [10,52,62,70,73]. It has been demonstrated that estrogen-induced lordosis behavior is mediated via ERa [8,48], and the predominant isoform expressed in the rat VMH is ERa where the level of ERb is very low [9,15,32,50,64]. Like ER, thyroid hormone receptors (TR) are also members of the nuclear steroid / thyroid receptor superfamily, and are ligand-dependent nuclear transcription factors. There are four TR isoforms, TRa1, a2, b1 and b2, in mammalian systems [37]. TRa2 is different from TRa1 in its carboxyl terminus, and does not bind thyroid hormones. TRb1 and TRb2 have identical DNA and hormone-binding domains, but differ in the N-terminal A / B domain. TRs can bind to thyroid hormone response element (TRE) either as a monomer or a dimer, including both homodimers and heterodimers, to regulate target gene expression [74]. These TR isoforms are differentially expressed in the central nervous system [6,41]. In the adult rat VMH, all TR isoforms have been detected but the level of TRb2 is very low [6,7,38]. Recent studies from our group have shown that ERa and TRa are coexpressed in the same cells of the mouse VMH [31]. Growing evidence indicates that estrogen and thyroid hormones can interact to regulate target gene expression and consequently physiological and behavioral functions. We and others have recently shown that thyroid hormones can inhibit estrogen-induced gene expression [2,11,13,22,24,83], lordosis behavior [12,42], pituitary growth [45,77], and female reproduction [5,30,68]. In the present study, we have analyzed the estrogen regulation of PPE gene expression both in the rat VMH, and in cell culture with transient cotransfection assays. The functional EREs of the rat PPE gene were located between 2437 and 2145 of the promoter region. Furthermore, estrogen induction of PPE gene expression could be modulated by thyroid hormones through TR both in cell cultures and in female rats.

2. Materials and methods

2.1. Animal studies Female Sprague–Dawley rats (175–200 g, Charles River, NY) were maintained on a 12:12-h light / dark cycle. The five intact female rats used in one part of these studies

included two proestrous, two estrous and one diestrous females by vaginal smear analysis. Ovariectomies were performed by the supplier. As previously described, hormone treatments were carried out 2 weeks after surgery [12]. Estradiol benzoate (EB) was dissolved in sesame oil and administered subcutaneously (s.c.). 17b-estradiol (E2) was dissolved in a 50:50 ethanol / saline solution and given intraperitoneally (i.p.). All steroids were obtained from Sigma (St. Louis, MO). For the estrogen replacement study, intact (n55) or ovariectomized (n55) female rats treated with sesame oil, and ovariectomized animals (n55) treated with a single dose (50 mg) of EB for 24 h were used. For time-course and dose–response analyses of estrogen effects, ovariectomized animals treated with either vehicle controls, or a single dose (50 mg) of EB, or a single dose of EB (10 mg) plus E2 (10 mg) were killed at the indicated time points (n53–7). The use of E2 plus EB with different routes of administration is to obtain both a rapid and a long-lasting increase in plasma E2 concentrations [77]. For the analysis of thyroid hormone modulation of estrogen-induced PPE mRNA in the VMH, an experimental design was used as previously described [12]. Ovariectomized animals (n55 / group) were treated with either vehicle controls, or EB (2 mg / day), or triiodothyronine (T3, 500 mg / kg / day), or EB plus T3 for 10 days, and killed 4 h after the last injection. Animals were killed by CO 2 narcosis following rapid decapitation. The ventromedial hypothalamus (VMH) was dissected as previously described [58,81]. Briefly, the hypothalamus was dissected in an ice-chilled Jacobowitz brain slicer (Zivic-Miller) as a 4-mm slice with a rostral border at the level of the optic chiasm, two sagittal cuts outside the fornix to the base of the brain, and a horizontal cut just above the fornix.

2.2. RNA extraction and PPE mRNA determination Total cellular RNA from the VMH was extracted by using TRIzol reagents (Life Technologies, NY) according to the manufacturer’s directions. The concentrations of RNA were determined by ultraviolet absorbance at 260 nm. The levels of PPE mRNA were quantitated by using 3 mg total cellular RNA in slot-blot hybridization with a specific cDNA probe, and densitometrically analyzed in a Zenith soft laser densitometer (Model SLR-2D/ 1D) as previously described [58,82]. An oligo(dT) 15 was endlabeled with [g- 32 P]ATP by T4 polynucleotide kinase, and hybridized to the same slot-blot membrane [58]. The levels of PPE mRNA were normalized to the oligo(dT) 15 signal, reflective of poly(A) RNA, and presented as the percentage of ovariectomized animals treated with vehicle controls, which were expressed as 100%. Northern blot analysis of PPE mRNA was carried out by using 20 mg total cellular RNA, separated on a 1.2%

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

25

agarose gel, and hybridized with a specific rat PPE riboprobe as previously described [28].

activity in the extracts. The CAT activity is presented as fold of vehicle control.

2.3. Plasmid constructs

2.5. Electrophoretic mobility shift assay ( EMSA)

The CAT reporter constructs, 145PPE-CAT and 437PPE-CAT containing the rat PPE gene promoter sequences from 2145 to 153 and from 2437 to 153, respectively, were prepared by ligation of polymerase chain reaction (PCR)-amplified DNA fragments to pPLFCAT, and kindly provided by Dr. Sabol (NIH, MD) [29]. The cap site as described by Rosen et al. [60] is defined as the number 1 position. The 437PPE-CAT construct contains two putative EREs located between 2407 and 2364 of the rat PPE gene promoter as demonstrated by nucleotide sequence analysis [16,60]. Other plasmids used in the transfection studies were previously described [83]. An ERa expression vector containing the wild-type human ERa in pSG5 was kindly provided by Dr. P. Chambon (INSERM, Strasbourg, France). The pSGTRa1 containing a rat wild-type TRa1 in pSG5 [66], pSG-TRa1p containing a P-box mutated rat TRa1 in pSG5 [75], rTRa1, rTRb1, rTRb2 containing a wild-type rat TRa1, b1 and b2, respectively, in the pcDNAI /Amp expression vector were from Drs. Chin and Yen (Harvard Medical School).

EMSA was carried out as previously described [80,81]. Briefly, an oligonucleotide containing a putative ERE (pERE1) from the rat PPE gene promoter (2417 to 2381 from the cap site [60]) was labeled with [ 32 P]dATP by use of a fill-in reaction with Klenow enzyme (Boehringer Mannheim, Indianapolis, IN), and incubated with a baculovirus-expressed ERa (a kind gift from Dr. A. Notides, Rochester, NY) at room temperature. The DNA–protein complexes were separated on a 4% nondenaturing polyacrylamide gel (acrylamide / bis537.5:1) with 5% glycerol by electrophoresis at room temperature. After electrophoresis, the gel was dried and exposed to Kodak X-Omat film with an intensifying screen at 2808C. For competition assays, the cold oligonucleotides were preincubated for 15 min before the addition of a probe. The following oligonucleotides were used: a consensus ERE from vitellogenin A2 gene (AATTCGTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTTG), an AP-1 (CGCTTGATGAGTCAGCCGGAA) and a TRE (TTGACCCCAGCTGAGGTCAAGTTACG) from chicken lysozyme gene, F2 [4].

2.6. Statistics 2.4. Cell culture and transient cotransfection assays CV-1 cells (ATCC, Rockville, MD) were grown in Dulbecco’s modified Eagle’s medium (DMEM, Sigma) supplemented with 10% fetal bovine serum (FBS, Gemini Bio-Products, Calabasas, CA), 2 mM L-glutamine (Sigma), 1 mM sodium pyruvate (Sigma), 13MEM nonessential amino acids (Sigma), 50 units / ml of penicillin and 50 mg / ml of streptomycin (Gemini Bio-Products) [83]. Cells were maintained in a 5% CO 2 –95% air humidified atmosphere at 378C, and cultured in phenol-red free medium with 5% stripped FBS 24 h before experiments. The serum was stripped of steroid hormones and thyroid hormones by use of dextran T-70 coated activated charcoal (Gemini Bio-Products). The cells were plated on 60-mm dishes with 40–50% density, and transiently transfected by the calcium phosphate precipitation method (ProFection, Promega, Madison, WI) with the indicated receptor expression vector, 5 mg reporter construct (145PPE-CAT, or 437PPECAT), 2 mg RSV-b-galactosidase plasmid and pBluescriptSK plasmid to a total of 15 mg DNA per dish as previously described [83]. After 16 h of transfection, the cells were washed and continued to grow in the absence or presence of E2, or T3, or E2 plus T3 for 48 h before harvesting. Cell extracts were prepared by three rapid freeze / thaw cycles and CAT activity was assayed as described before [83] except the incubation was 16 h. The transfection efficiency was normalized by measuring b-galactosidase (b-gal)

The data are presented as mean6S.E.M. One-way analysis of variance (ANOVA) following the post hoc Student–Newman–Keuls test was used to determine the difference among multiple groups. Student’s t-test was used for analyzing difference between two groups. A P value of less than 0.05 was accepted as the level of statistical significance.

3. Results

3.1. Estrogen-induced PPE gene expression in the rat VMH To determine the estrogen-induced PPE gene expression, adult female rats were ovariectomized (OVX) for 2 weeks, and the levels of PPE mRNA in the VMH were determined by slot blot hybridization. As shown in Fig. 1, the level of PPE mRNA in the rat VMH was significantly decreased after ovariectomy to withdraw estrogen compared to intact animals. This decrease was reversed by the administration of a single dose of EB (50 mg, s.c.) for 24 h. The estrogen induction of PPE mRNA in the VMH of OVX female rats was time-dependent (see Fig. 2). The PPE mRNA level in the rat VMH was rapidly elevated within 1 h, reached a peak at 24 h (196% of control), and maintained for at least 72 h after a single dose of EB (50

26

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

Fig. 1. Estrogen-dependent expression of PPE mRNA in the rat VMH. Female rats were ovariectomized (OVX) for 2 weeks and treated with a vehicle control (OVX group), or a single dose of estrogen (EB 50 mg / rat, s.c.). Other animals, intact females, included two proestrous, two estrous and one diestrous females as determined by vaginal smear analysis, were treated with vehicle control (intact group). Twenty-four hours after treatment, the animals were killed and VMH was dissected. Total cellular RNA was extracted from VMH and the levels of PPE mRNA were analyzed by slot blot hybridization. The values are expressed as the percentage of OVX group, and presented as the mean6S.E.M. of five animals per group. *P,0.05 compared to other groups (Student–Newman–Keuls test).

mg) administration. A similar time-course was obtained when animals were given a single administration of EB (10 mg) plus E2 (10 mg). The level of PPE mRNA was significantly higher in animals treated with 50 mg EB than those treated with 10 mg EB plus 10 mg E2 at 24 and 48 h. These results are consistent with previous reports [36,56,58]. Similar changes in PPE mRNA were observed by Northern blot analysis (Fig. 2B) although it was not quantitated. Treatment with estrogen did not alter PPE mRNA size as shown in Fig. 2B.

3.2. Identification of the functional EREs of the rat PPE gene To identify functional EREs in the rat PPE gene promoter, sequence analysis to search for putative EREs in the 2.8 kb region of the rat PPE gene promoter were carried out (GenBank access numbers U03026 and X59136 [16]). Only two putative ERE sequences, referred to as pERE1 (aaagttaTGACTTT) and pERE2 (AGGTCAnnnntgaggt) for the distant and proximal elements, respectively, were identified in the promoter from

Fig. 2. Dose and time-course analyses of estrogen induction of PPE mRNA. (A) Female rats were ovariectomized (OVX) for 2 weeks and treated with a single dose of 50 mg / rat EB, or 10 mg EB plus 10 mg E2 / rat. Animals were killed at different time points as indicated. VMH was dissected and total cellular RNA was extracted. The levels of PPE mRNA were analyzed by slot blot hybridization. The values are mean6S.E.M. of 3–7 individuals. *P,0.05 compared to vehicle control (0) group, and [ P,0.05 compared to animals treated with 10 mg EB plus 10 mg E2 / rat at the same time point (t-test). (B) A representative Northern blot analysis of PPE mRNA in VMH of OVX female rats treated with vehicle control (Ovx) or a single dose of estrogen (EB 10 mg / rat1E2 10 mg / rat). The animals were killed at different time points (h) as indicated on the top of the figure. The numbers on the right side of Northern blot denote the positions of DNA molecular weight size markers (kb).

2407 to 2364 ( 2407]]]]]]] AAAGTtATGACTTTcagatagttg2364 ggcagAGGTCAtctcTGAggT , the cap site [60] is ]]]]]]] defined as number 1 position). Plasmid constructs, 145PPE-CAT and 437PPE-CAT, containing the rat PPE promoter sequences from 2145 to 153, and from –437 to 153, and a CAT reporter gene, respectively, were tran-

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

27

siently cotransfected to CV-1 cells with an ERa expression vector. As shown in Fig. 3, the addition of 17b-estradiol (10 27 M) significantly increased the CAT activity in 437PPE-CAT, but not in 145PPE-CAT, transfected cells. Similar to the estrogen induction of PPE mRNA in the rat VMH, estrogen induction of CAT activity in 437PPE-CAT and ERa cotransfected cells was also dose-dependent at doses from 10 29 M to 10 26 M of 17b-estradiol, and a maximal induction (2.5-fold of control) was reached at 10 27 M of 17b-estradiol (data not shown). Neither ERa cotransfection alone nor E2 treatment alone had any effect on CAT activity in the 437PPE-CAT transfected cells. These results indicate that the functional EREs of the rat PPE gene is located within a 292 bp region (from 2437 to 2145) of the promoter. An insertion of a 129 bp fragment containing sequences from 2444 to 2315, including the two natural EREs, of the rat PPE gene promoter into the upstream of a thymidine kinase minimal promoter controlled CAT construct, pBLCAT2 [40] also conferred an estrogen-dependent change in CAT activity when cotransfected with ERa in CV-1 cells (data not shown). To determine whether the identified EREs can bind to ERa, electrophoretic mobility shift assays were performed. As shown in Fig. 4, purified ERa specifically bound to an

Fig. 3. Identification of functional EREs on the rat PPE gene promoter. Deletion constructs containing various lengths of the rat PPE gene promoter linked to CAT as indicated on the top panel were cotransfected with ERa expression vector into CV-1 cells as described in Section 2. The transfected cells were then treated with either vehicle control or 17bestradiol (E2) at a concentration of 10 27 M for 48 h. Cellular extracts were prepared and b-gal and CAT activities determined. The CAT activity was normalized to b-gal units and presented as fold of vehicle control. The numbers in parentheses denote the sample size. *P,0.05 compared to the corresponding vehicle control (t-test).

Fig. 4. Interaction of purified ERa with PPE gene promoter. A representative EMSA performed as described in Section 2 shows that the purified ERa (a gift from Dr. A.C. Notides) was bound to a putative ERE site from the PPE gene (pERE1). Specific complexes as indicated by the arrowheads in lane c were formed between pERE1 and ERa. The additions of a cold consensus ERE (203 molar excess of pERE probe) in lane a and the cold pERE1 (1003 molar excess) in lane d in the assay decreased or eliminated the formation of specific complexes. In contrast, the addition of a consensus AP-1 oligonucleotide (1003 molar excess) in lane b, or a TRE oligonucleotide (F2, 203 molar excess) in lane e did not affect the formation of the specific pERE1–ERa complexes.

oligonucleotide probe containing one of the putative ERE (pERE1) of the rat PPE gene. This binding could be competed away with the addition of the cold pERE1 (Fig. 4, lane d) as well as a cold consensus ERE oligonucleotide (Fig. 4, lane a), but not nonspecific oligonucleotides, AP1

28

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

and TRE (Fig. 4, lanes b,e, respectively). ERa also bound to an oligonucleotide containing pERE2 sequences ([44]; manuscript submitted), indicating that ERa can directly interact with these natural EREs in the rat PPE gene promoter.

3.3. Modulation of estrogen-induced PPE promoter activity by thyroid hormone Previous studies have shown that thyroid hormones can modulate estrogen-induced gene expression including PPE [11,83], and physiological functions [12,77]. Based on these data, we further analyzed the thyroid hormone modulation of estrogen-induced PPE gene expression. Consistent with our previous report [83], treatment with T3 significantly inhibited estrogen-induced CAT activity in CV-1 cells cotransfected with 437PPE-CAT reporter, ERa expression vector and TR expression vector (Fig. 5). This T3 inhibitory effect was observed in cotransfection of either TRa1, or TRb1, or TRb2 although the potency of each isoform was slightly different. This result is differentiated from previous demonstration that the T3 inhibition of estrogen-induced CAT activity in cotransfection of an ERE-tk-CAT reporter gene (a construct containing a CAT reporter gene directed by a minimal thymidine kinase

Fig. 5. Inhibition of estrogen-induced PPE promoter activity by ligandedTRs. Transient cotransfection of 437PPE-CAT with ERa (1 mg) and 1 or 2 mg of TR isoform expression vector (rTRa1, rTRb1, rTRb2) was carried out in CV-1 cells. The transfected cells were treated with vehicle control, or 17b-estradiol (E, 10 27 M), or T3 (10 26 M), or 17b-estradiol plus T3 for 48 h as described in Section 2. CAT activity was assayed, normalized to b-gal units, and presented as fold of vehicle treated controls. The values are the mean6S.E.M. of 6–8 individual samples. *P,0.05 compared to corresponding control (C), [ P,0.05 compared to corresponding 17b-estradiol treatment (Student–Newman–Keuls test).

promoter and a copy of consensus ERE) was TRa1isoform specific [63,83]. Taken together, these results suggest that liganded-ER and TR interaction on the regulation of gene expression may be gene-specific. Like ERa, both TRa1 and TRb1 can bind to the natural EREs of the rat PPE gene as we previously demonstrated [83]. However, the ability of TR to bind to the PPE gene promoter may be not a major factor in liganded-TR inhibition of estrogen induction of PPE promoter activity. As shown in Fig. 6, in cells cotransfected with a P-box mutated TRa1 (pSG-TRa1p) that is unable to bind to the AGGTCA sequence in the consensus TREs [75], treatment with T3 also significantly inhibited estrogen-induced increase in CAT activity. The significance of estrogen and thyroid hormone interaction on the regulation of PPE gene expression is further illustrated by studying hypothalamic PPE gene expression in intact animals. Treatment with EB (2 mg / rat per day) for 10 days in ovariectomized female rats significantly increased the PPE mRNA level in the ventromedial hypothalamus as demonstrated by slot-blot hybridization (see Fig. 7). This estrogen-induced increase was inhibited by the concomitant administration of T3 (500 mg / kg / day). This result is consistent with our previous demonstration when a different experimental paradigm, or a different detection method was used [11,83], and correlates with thyroid hormone modulation of estrogen-induced lordosis behavior [12,42].

Fig. 6. The effects of mutation of the TRa1 P-box on T3 inhibition of estrogen-induced PPE promoter activity. Transient cotransfection of 437PPE-CAT with ERa and psG-TRa1 or a P-box mutated TRa1 (psG-TRa1p) in CV-1 cells was carried out as described in Section 2. The cells were treated with control vehicle, 17b-estradiol (E, 10 27 M), T3 (10 26 M), or 17b-estradiol plus T3 for 48 h. The values are the mean6S.E.M. of 4–6 samples. *P,0.05 compared to corresponding control (C), [ P,0.05 compared to corresponding 17b-estradiol treatment (Student–Newman–Keuls test).

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

Fig. 7. Inhibition of estrogen-induced PPE mRNA in the VMH of OVX female rats by T3. A high dose T3 (250 mg / kg, i.p., every 12 h) and a low dose of EB (2 mg / rat / day, s.c.) was concomitantly administered to the OVX female rats for 10 days. Total cellular RNA was isolated from the dissected VMH and the levels of PPE mRNA were analyzed by slot blot hybridization as described in Section 2. The values are expressed as percentage of vehicle-treated control (C) and presented as mean6S.E.M. Five animals were used in each group. *P,0.05 compared to all other groups (Student–Newman–Keuls test).

29

transcription. We therefore analyzed the molecular mechanism of estrogen-induced PPE gene expression in the present studies. By analyzing the rat PPE gene promoter sequences [16,60], two putative EREs located in the proximal region of the promoter between 2407 and 2364 were tentatively identified. Although both sequences are imperfect palindromes, they could bind to purified ERa as demonstrated by electrophoretic mobility shift assays. They also displayed specific ERE binding activity with the rat hypothalamic nuclear extracts [81]. Deletion analysis by transient cotransfection assays in cell cultures demonstrated that sequences between 2437 and 2145 of the rat PPE promoter, which include the two putative EREs, were sufficient to confer estrogen inducibility to a homologous promoter in an estrogen dose-dependent manner. Preliminary data also show that these EREs were functional in a heterologous promoter. Thus, these results suggest that these two putative EREs located in the proximal region of the rat PPE gene promoter appear to be functional, and may be two natural EREs of the rat PPE gene. Like estrogen regulation of other estrogen-target genes [17], estrogen induction of PPE gene expression appears to be also mediated through binding to estrogen receptor, and then interacting with these specific functional estrogen DNA response elements located in the PPE gene promoter. These two natural EREs are aligned as a tandem repeat with a 15 bp space between them ( 2407aaagttaTGACTTT]]]]] cagatagttgggcag AGGTCAtctctgaggt 2364 ), which may ]]]]]] have functional significance as previously demonstrated that tandem repeats of hormone response elements had synergistic effects on regulating target gene expression [71]. However, the functional significance of this tandem repeat and each of the two EREs in the estrogen regulation of PPE gene expression remains to be determined.

4. Discussion

4.1. Estrogen regulation of hypothalamic PPE gene expression and the identification of functional EREs on the rat PPE gene promoter It is clearly documented that estrogen can induce PPE gene expression in the ventromedial hypothalamus (VMH) [20,36,56,58,59,83]. In the present study, we further demonstrated that the expression of PPE gene in the rat VMH is regulated by estrogen. The withdrawal of estrogen by ovariectomy in the female rat significantly decreased the levels of PPE mRNA in the VMH, which was restored by the administration of exogenous estrogen (see Fig. 1). The effect of estrogen on PPE gene expression is dose- and time-dependent. These results provide further evidence to support the concept that the expression of PPE gene in the rat VMH is regulated by estrogen. The rapid estrogen induction of PPE mRNA in the rat hypothalamus (see Fig. 2) suggests that estrogen may possess a direct action in the alteration of PPE gene

4.2. Estrogen and thyroid hormone interaction on the regulation of PPE gene expression and its functional significance Growing evidence suggests that thyroid hormones can modulate estrogenic action on the regulation of gene expression in both in vitro and in vivo systems [2,22,24,27,51,57,77,83]. In the present study, we have further studied the estrogen and thyroid hormone interaction on the regulation of PPE gene expression both in cell cultures and in intact animals. In cotransfection assays in cell cultures, thyroid hormone, T3, via its receptors significantly attenuated estrogen-induced PPE promoter activity (see Fig. 5). In the rat VMH, the estrogen-induced increase in PPE mRNA level was inhibited by the concomitant administration of T3 in ovariectomized female rats (see Fig. 7). These results are consistent with previous reports in cell cultures [83], and in intact animals when a different experimental paradigm or a different detection method was used [11,83]. Using in situ hybridization, we

30

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

have observed similar T3 inhibition of estrogen-induced PPE mRNA in the ventromedial nucleus of hypothalamus of ovariectomized female rats [11]. On the other hand, Holland et al. [27] recently reported that thyroid hormones did not alter estrogen induction of PPE mRNA in the ventromedial nucleus of hypothalamus of ovariectomized rats. This discrepancy may be partially due to differences in thyroid hormone preparation. In present study, biologically active form of thyroid hormone, T3, was used rather than thyroxine (T4) used by Holland et al. [27]. In addition, Holland et al. have given much higher dose of T4 (500 mg / kg per day) than the T3 dose (500 mg / kg per day) used in the present study. Finally, the different strains of rats used may also account for the different results.

4.2.1. Molecular mechanisms Mechanisms accounting for the thyroid hormone inhibition of estrogen action are still obscure. The effect of T3 on the inhibition of estrogen-induced PPE promoter activity was TR-dependent since T3 failed to alter estrogen action in the absence of TR cotransfection [83]. We hypothesize that the thyroid hormone modulation of estrogen action occurs intracellularly and is mediated through the hormone–receptor complexes. At the DNA level, liganded-ER and liganded-TR complexes might compete for the same DNA binding elements [1,2]. Several groups including ours have shown that TRs can bind to a consensus ERE as well as natural EREs [2,22,83], suggesting that competition of DNA binding may be a potential mechanism for liganded-ER and TR regulation of PPE gene expression. However, the data that cotransfection of a TRa1 mutant, TRa1p, that does not bind to AGGTCA sequence [75], still inhibited estrogen-induced PPE promoter activity (see Fig. 6) and ERE-tk-CAT activity [83] do not favor DNA competition as the sole mechanism. At the protein level, liganded-ER and liganded-TR could form heterodimers [39], or compete for limited common transcription factors and / or coactivators [23,49,76]. We have shown in the same system that cotransfection of SRC-1, a steroid receptor coactivator restored estrogeninduced CAT activity of ERE-tk-CAT cotransfection [55] [79] as well as 437PPE-CAT cotransfection ([44]; manuscript submitted). These data suggest that competition of limited common transcription factors or coactivators accounts for, at least in part, the liganded-TR modulation of estrogen-induced gene expression. Compared to T3 modulation of estrogen-induced CAT activity in ERE-tk-CAT cotransfection [63,83], the T3 inhibition of estrogen-induced PPE promoter activity was less TR-isoform specific. T3 inhibited estrogen-induced PPE promoter activity in cotransfection of either TRa1, or TRb1, or TRb2 although the potency of each isoform was slightly different (see Fig. 5). Similar gene sequencedependent modulation of estrogen activity by liganded TRs

[63], or AP-1 proteins [61], has been observed between vitellogenin and progesterone receptor EREs in transient cotransfection assays. These results suggest that the outcome of liganded-ER and TR interactions on the regulation of gene expression is highly dependent on the natural ERE sequences of target genes as well as specific TR isoforms. A critical requirement for intracellular TR–ER interaction is that both TR and ER should be localized in the same cells. In the hypothalamus, including VMH, both TR and ER are known to be expressed [6,12,53,65]. Kia et al. have recently shown that ERa and TRa isoforms were co-localized in a high percentage of the hypothalamic cells of female mice by using a double-label in situ hybridization ([31]; manuscript submitted). Co-localization of ER and TR has also reported in the hippocampus neurons [69] and pituitary cells [18,19]. These data provide anatomical evidence that TR and ER can interact at the nuclear level to regulate target-gene expression, and consequently physiological or behavioral functions [12,77].

4.2.2. Functional importance Modulation of estrogen action by thyroid hormones via liganded ER–TR interactions may reflect a physiological mechanism to integrate environmental changes in female reproduction [78]. Environmental conditions can profoundly affect female reproduction and female responses to steroids. One consequence of adverse temperature [67], mild stress [14,34], and inadequate nutrition [21] is altered thyroid hormone status. In both rats and mice, hyperthyroid females had decreased levels of sexual behavior, while hypothyroid females had increased sexual behavior in response to estrogen treatment, which was blocked by thyroid hormone replacement [12,42]. Inhibition of estrogen-induced gene expression and lordosis behavior has also observed at physiological plasma concentration of thyroid hormones [12,13]. Elevation of plasma thyroid hormone levels are known to affect negatively female reproduction in the ewe [30,68,72] and in birds [5]. Alteration of thyroid status can also affect human female reproduction [35]. It is clearly demonstrated that estrogeninduced PPE gene expression is directly related to estrogen-induced lordosis behavior [46,54]. Nicot et al. [46] have recently demonstrated that injection of specific PPE antisense oligonucleotides into the VMH of ovariectomized female rats can specifically block estrogen-induced increase in enkephalin peptide levels, and significantly decrease estrogen-induced lordosis behavior. This study establishes a cause–effect relationship between estrogeninduced PPE gene expression in the rat VMH and estrogen-induced lordosis behavior. Therefore, exploring the mechanisms and functional consequences of the ER–TR interactions provides a model system to study not only hormone interactions but also the neuroendocrine integration of physiological and environmental changes.

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33

Acknowledgements We are grateful to Dr. Sabol for providing the rat PPE constructs, Dr. P. Chambon for an ERa expression vector, Dr. A. Notides for the purified ERa protein, and Drs. O’Malley and Tsai for the SRC-1 expression vector. This study was partly supported by NIH grants HD-05751 (D.W.P.), DK35500 (W.W.C.) and Merck Foundation (J.I.M. / Y-.S.Z.).

[16]

[17] [18]

[19]

References [20] [1] R.A. Adan, J.P. Burbach, Regulation of vasopressin and oxytocin gene expression by estrogen and thyroid hormone, Prog. Brain Res. 92 (1992) 127–136. [2] R.A. Adan, J.J. Cox, T.V. Beischlag, J.P. Burbach, A composite hormone response element mediates the transactivation of the rat oxytocin gene by different classes of nuclear hormone receptors, Mol. Endocrinol. 7 (1993) 47–57. [3] H. Akil, S.J. Watson, E. Young, M.E. Lewis, H. Khachaturian, J.M. Walker, Endogenous opioids: Biology and function, Annu. Rev. Neurosci. 7 (1984) 223–255. [4] A. Baniahmad, C. Steiner, A.C. Kohne, R. Renkawitz, Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site, Cell 61 (1990) 505–514. [5] G.E. Bentley, A.R. Goldsmith, A. Dawson, L.M. Glennie, R.T. Talbot, P.J. Sharp, Photorefractoriness in European starlings (Sturnus vulgaris) is not dependent upon the long-day-induced rise in plasma thyroxine, Gen. Comp. Endocrinol. 107 (1997) 428–438. [6] D.J. Bradley, H.C. Towle, W.S. Young III, Spatial and temporal expression of a and b-thyroid hormone receptor mRNAs, including the b 2 -subtype, in the developing mammalian nervous system, J. Neurosci. 12 (1992) 2288–2302. [7] C.B. Cook, I. Kakucska, R.M. Lechan, R.J. Koenig, Expression of thyroid hormone receptor beta 2 in rat hypothalamus, Endocrinology 130 (1992) 1077–1079. [8] J.F. Couse, K.S. Korach, Estrogen receptor null mice: what have we learned and where will they lead us?, Endocr. Rev. 20 (1999) 358–417. [9] J.F. Couse, J. Lindzey, K. Grandien, J.A. Gustafsson, K.S. Korach, Tissue distribution and quantitative analysis of estrogen receptoralpha (ERalpha) and estrogen receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type and ERalpha-knockout mouse, Endocrinology 138 (1997) 4613–4621. [10] S.M. Cowley, S. Hoare, S. Mosselman, M.G. Parker, Estrogen receptors alpha and beta form heterodimers on DNA, J. Biol. Chem. 272 (1997) 19858–19862. [11] T. Dellovade, K. Kia, Y.S. Zhu, D.W. Pfaff, Thyroid hormone coadministration inhibits the estrogen-stimulated elevation of preproenkaphalin mRNA in female rat hypothalamic neurons, Neuroendocrinology 70 (1999) 168–174. [12] T. Dellovade, Y.S. Zhu, L. Krey, D.W. Pfaff, Thyroid hormone and estrogen interact to regulate behavior, Proc. Natl. Acad. Sci. USA 93 (1996) 12581–12586. [13] T.L. Dellovade, Y.S. Zhu, D.W. Pfaff, Thyroid hormones and estrogen affect oxcytocin gene expression in hypothalamic neurons, J. Neuroendocrinol. 11 (1999) 1–10. [14] K.D. Dohler, K. Gartner, Activation of anterior pituitary, thyroid and adrenal gland in rats after disturbance stress, Acta Endocrinol. 86 (1977) 489–497. [15] H. Dotzlaw, E. Leygue, P.H. Watson, L.C. Murphy, Distribution of

[21]

[22]

[23] [24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

31

estrogen receptor-beta-like immunoreactivity in rat forebrain, Neuroendocrinology 66 (1997) 63–67. R.C. Durkin, G. Weisinger, M.P. Holloway, E.F. La Gamma, Primary sequence of 21436 to 153 bp of the rat preproenkephalin gene putative z-DNA and regulatory motifs, Biochim. Biophys. Acta 1131 (1992) 349–351. R.M. Evans, The steroid and thyroid hormone receptor superfamily, Science 240 (1988) 889–895. N. Fujimoto, B. Roy, H. Watanabe, A. Ito, Increase of estrogen receptor level by thyroxine in estrogen dependent pituitary tumor (MTT / F84) in rats, Biochem. Biophys. Res. Commun. 152 (1988) 44–48. N. Fujimoto, H. Watanabe, A. Ito, Up-regulation of the estrogen receptor by triiodothyronine in rat pituitary cell lines, J. Steroid Biochem. Mol. Biol. 61 (1997) 79–85. T. Funabashi, P.J. Brooks, S.P. Kleopoulos, L. Grandison, C.V. Mobbs, D.W. Pfaff, Changes in preproenkephalin messenger RNA level in the rat ventromedial hypothalamus during the estrous cycle, Mol. Brain Res. 28 (1995) 129–134. A.R. Glass, R. Mellitt, Serum triiodothyronine in undernourished rats: dependence on dietary composition rather than total calorie or protein intake, Endocrinology 102 (1978) 1925–1928. C.K. Glass, J.M. Holloway, O.V. Devary, M.G. Rosenfeld, The thyroid hormone receptor binds with opposite transcriptional effects to a common sequence motif in thyroid hormone and estrogen response elements, Cell 54 (1988) 313–323. C.K. Glass, D.W. Rose, M.G. Rosenfeld, Nuclear receptor coactivators, Curr. Opin. Cell Biol. 9 (1997) 222–232. G. Graupner, X.K. Zhang, M. Tzukerman, K. Wills, T. Hermann, M. Pfahl, Thyroid hormone receptors repress estrogen receptor activation of a TRE, Mol. Endocrinol. 5 (1991) 365–372. S. Green, P. Walter, V. Kumar, A. Krust, J.M. Bornert, P. Argos, P. Chambon, Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-a, Nature 320 (1986) 134–139. G.L. Greene, P. Gilna, M. Waterfield, A. Baker, Y. Hort, J. Shine, Sequence and expression of human estrogen receptor complementary DNA, Science 231 (1986) 1150–1154. K. Holland, A. Norell, P. Micevych, Interaction of thyroxine and estrogen on the expression of estrogen receptor alpha, cholecystokinin, and preproenkephalin messenger ribonucleic acid in the limbic-hypothalamic circuit, Endocrinology 139 (1998) 1221– 1228. C.E. Inturrisi, A.D. Branch, H.D. Robertson, R.D. Howells, S.O. Franklin, J.R. Shapiro, S.E. Calvano, B.C. Yoburn, Glucocorticoid regulation of enkephalins in cultured rat adrenal medulla, Mol. Endocrinol. 2 (1988) 633–640. J. Joshi, S.L. Sabol, Proenkephalin gene expression in C6 rat glioma cells: potentiation of cyclic adenosine 39,59-monophosphate-dependent transcription by glucocorticoids, Mol. Endocrinol. 5 (1991) 1069–1080. F.J. Karsch, G.E. Dahl, T.M. Hachigian, L.A. Thrun, Involvement of thyroid hormones in seasonal reproduction, J. Reprod. Fertil. Suppl. 49 (1995) 409–422. H.K. Kia, C.J. Krebs, N. Koibuchi, W.W. Chin, D.W. Pfaff, Estrogen and thyroid hormone receptor gene expression in mouse brain: a double-label in situ hybridization study, Soc. Neurosci. Abstr. 25 (1999) 614. G.G. Kuiper, B. Carlsson, K. Grandien, E. Enmark, J. Haggblad, S. Nilsson, J.A. Gustafsson, Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta, Endocrinology 138 (1997) 863–870. G.G. Kuiper, E. Enmark, M. Pelto-Huikko, S. Nilsson, J.A. Gustafsson, Cloning of a novel receptor expressed in rat prostate and ovary, Proc. Natl. Acad. Sci. USA 93 (1996) 5925–5930. P. Langer, M. Vigas, Immediate increase of thyroid hormone release

32

[35]

[36]

[37] [38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33 during acute stress in rats: effect of biogenic amines rather than that of TSH?, Acta Endocrinol. 104 (1983) 443–449. P.R. Larsen, T.F. Davies, I.D. Hay, Thyroid gland, in: J.D. Wilson, D.W. Foster, H.M. Kronenberg, P.R. Larsen (Eds.), Williams Textbook of Endocrinology, Saunders, Philadelphia, 1998, pp. 389–515. A.H. Lauber, G.J. Romano, C.V. Mobbs, R.D. Howells, D.W. Pfaff, Estradiol induction of proenkephalin messenger RNA in hypothalamus: dose-response and relation to reproductive behavior in the female rat, Mol. Brain Res. 8 (1990) 47–54. M. Lazar, Thyroid hormone receptors: multiple forms, multiple possibilities, Endocr. Rev. 14 (1993) 184–193. R.M. Lechan, Y. Qi, T.J. Berrodin, K.D. Davis, H.L. Schwartz, K.A. Strait, J.K. Oppenheimer, M.A. Lazar, Immunocytochemical delineation of thyroid hormone receptor b 2 -like immunoreactivity in the rat central nervous system, Endocrinology 132 (1993) 2461– 2469. S.K. Lee, H.S. Choi, M.R. Song, M.O. Lee, J.W. Lee, Estrogen receptor, a common interaction partner for a subset of nuclear receptors, Mol. Endocrinol. 12 (1998) 1184–1192. B. Luckow, G. Schutz, CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements, Nucleic Acids Res. 15 (1987) 5490. ¨ B. Mellstrom, J.R. Naranjo, A. Santos, A.M. Gonzalez, J. Bernal, Independent expression of the alpha and beta c-erbA genes in developing rat brain, Mol. Endocrinol. 5 (1991) 1339–1350. M.A. Morgan, T.L. Dellovade, D.W. Pfaff, Effect of thyroid hormone administration on estrogen-induced sex behavior in female mice, Horm. Behav. 37 (2000) 15–22. S. Mosselman, J. Polman, R. Dijkema, ER beta: identification and characterization of a novel human estrogen receptor, FEBS Lett. 392 (1996) 49–53. V. Nandini, C.J. Krebs, Y.S. Zhu, S. Daniels, N. Koibuichi, W.W. Chin, D.W. Pfaff, Thyroid hormone affects estrogen mediated induction of the rat preproenkephalin gene, Soc. Neurosci. Abstr. 25 (1999) 614. J. Nedvidkova, K. Pacak, J. Nedvidek, D.S. Goldstein, V. Schreiber, Triiodothyronine attenuates estradiol-induced increases in dopamine D-2 receptor number in rat anterior pituitary, Brain Res. 712 (1996) 148–152. A. Nicot, S. Ogawa, Y. Berman, K.D. Carr, D.W. Pfaff, Effects of an intrahypothalamic injection of antisense oligonucleotides for preproenkephalin mRNA in female rats: evidence for opioid involvement in lordosis reflex, Brain Res. 777 (1997) 60–68. S. Ogawa, S. Inoue, T. Watanabe, H. Hiroi, A. Orimo, T. Hosoi, Y. Ouchi, M. Muramatsu, The complete primary structure of human estrogen receptor beta (hER beta) and its heterodimerization with ER alpha in vivo and in vitro, Biochem. Biophys. Res. Commun. 243 (1998) 122–126. S. Ogawa, J.A. Taylor, D.B. Lubahn, K.S. Korach, D.W. Pfaff, Reversal of sex roles in genetic female mice by disruption of estrogen receptor gene, Neuroendocrinology 64 (1996) 467–470. S.A. Onate, S.Y. Tsai, M.-J. Tsai, B.W. O’Malley, Sequence and characterization of a coactivator for the steroid hormone receptor superfamily, Science 270 (1995) 1354–1357. M. Osterlund, G.G.J.M. Kuiper, J.A. Gustafsson, Y.L. Hurd, Differential distribution and regulation of estrogen receptor-alpha and -beta mRNA within the female rat brain, Mol. Brain Res. 54 (1998) 175–180. F. Pernasetti, L. Caccavelli, W.C. Van de, J.A. Martial, M. Muller, Thyroid hormone inhibits the human prolactin gene promoter by interfering with activating protein-1 and estrogen stimulations, Mol. Endocrinol. 11 (1997) 986–996. K. Pettersson, K. Grandien, G.G. Kuiper, J.A. Gustafsson, Mouse estrogen receptor beta forms estrogen response element-binding heterodimers with estrogen receptor alpha, Mol. Endocrinol. 11 (1997) 1486–1496. D.W. Pfaff, M. Keiner, Atlas of estradiol-concentrating cells in the

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67] [68]

[69]

[70]

central nervous system of female rat, J. Comp. Neurol. 151 (1973) 121–158. D.W. Pfaff, S. Schwartz-Giblin, M.M. McCarthy, L.-M. Kow, Cellular and molecular mechanisms of female reproductive behaviors, in: E. Knobil, J.D. Neill (Eds.), The Physiology of Reproduction, Raven, New York, 1994, pp. 107–220. D.W. Pfaff, N. Vasudevan, H.K. Kia, Y.S. Zhu, J. Chan, J. Garey, M.A. Morgan, S. Ogawa, Estrogens, brain and behavior: studies in fundamental neurobiology and observations related to women’s health, J. Steroid Biochem. Mol. Biol. 74 (2000) 365–373. C.A. Priest, C.B. Eckersell, P.E. Micevych, Estrogen regulates preproenkephalin-a mRNA levels in the rat ventromedial nucleus: temporal and cellular aspects, Mol. Brain Res. 28 (1995) 251–262. E.M. Rabelo, J.R. Tata, Thyroid hormone potentiates estrogen activation of vitellogenin genes and autoinduction of estrogen receptor in adult Xenopus hepatocytes, Mol. Cell Endocrinol. 96 (1993) 37–44. G.J. Romano, R.E. Harlan, B.D. Shivers, R.D. Howells, D.W. Pfaff, Estrogen increases proenkephalin messenger ribonucleic acid levels in the ventromedial hypothalamus of the rat, Mol. Endocrinol. 2 (1988) 1320–1328. G.J. Romano, C.V. Mobbs, R.D. Howells, D.W. Pfaff, Estrogen regulation of proenkephalin gene expression in the ventromedial hypothalamus of the rat: temporal qualities and synergism with progesterone, Mol. Brain Res. 5 (1989) 51–58. H. Rosen, J. Douglass, E. Herbert, Isolation and characterization of the rat proenkephalin gene, J. Biol. Chem. 259 (1984) 14309– 14313. J.F. Savouret, M. Rauch, G. Redeuilh, S. Sar, A. Chauchereau, K. Woodruff, M.G. Parker, E. Milgrom, Interplay between estrogens, progestins, retinoic acid and AP-1 on a single regulatory site in the progesterone receptor gene, J. Biol. Chem. 269 (1994) 28955– 28962. J.W.R. Schwabe, L. Chapman, J.T. Finch, D. Rhodes, The crystal structure of the estrogen receptor DNA-binding domain bound to DNA: how receptors discriminate between their response elements, Cell 75 (1993) 567–578. R.E. Scott, X.S. Wu-Peng, P.M. Yen, W.W. Chin, D.W. Pfaff, Interactions of estrogen- and thyroid hormone receptors on a progesterone receptor estrogen response element (ERE) sequence: a comparison with the vitellogenin A2 consensus ERE, Mol. Endocrinol. 11 (1997) 1581–1592. P.J. Shughrue, B. Komm, I. Merchenthaler, The distribution of estrogen receptor-beta mRNA in the rat hypothalamus, Steroids 61 (1996) 678–681. R.B. Simerly, C. Chang, M. Muramatsu, L.W. Swanson, Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: An in situ hybridization study, J. Comp. Neurol. 294 (1990) 76–95. R.A. Spanjaard, D.S. Darling, W.W. Chin, Ligand-binding and heterodimerization activities of a conserved region in the ligandbinding domain of the thyroid hormone receptor, Proc. Natl. Acad. Sci. USA 88 (1991) 8587–8591. K. Sterling, H. Lazarus, The thyroid and its control, Annu. Rev. Physiol. 39 (1977) 349–371. L.A. Thrun, G.E. Dahl, N.P. Evans, F.J. Karsch, A critical period for thyroid hormone action on seasonal changes in reproductive neuroendocrine function in the ewe, Endocrinology 138 (1997) 3402– 3409. H. Tohgi, K. Utsugisawa, M. Yamagata, M. Yoshimura, Effects of age on messenger RNA expression of glucocorticoid, thyroid hormone, androgen, and estrogen receptors in postmortem human hippocampus, Brain Res. 700 (1995) 245–253. G.B. Tremblay, A. Tremblay, N.G. Copeland, D.J. Gilbert, N.A. Jenkins, F. Labrie, V. Giguere, Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor b, Mol. Endocrinol. 11 (1997) 353–365.

Y.-S. Zhu et al. / Molecular Brain Research 91 (2001) 23 – 33 [71] S.Y. Tsai, M.J. Tsai, B.W. O’Malley, Cooperative binding of steroid hormone receptors contributes to transcriptional synergism at target enhancer elements, Cell 57 (1989) 443–448. [72] C. Viguie, D.F. Battaglia, H.B. Krasa, L.A. Thrun, F.J. Karsch, Thyroid hormones act primarily within the brain to promote the seasonal inhibition of luteinizing hormone secretion in the ewe, Endocrinology 140 (1999) 1111–1117. [73] T. Watanabe, S. Inoue, S. Ogawa, Y. Ishii, H. Hiroi, K. Ikeda, A. Orimo, M. Muramatsu, Agonistic effect of tamoxifen is dependent on cell type, ERE-promoter context, and estrogen receptor subtype: functional difference between estrogen receptors alpha and beta, Biochem. Biophys. Res. Commun. 236 (1997) 140–145. [74] P.M. Yen, W.W. Chin, New advances in understanding the molecular mechanisms of thyroid hormone action, Trends Endocrinol. Metab. 5 (1994) 65–72. [75] P.M. Yen, M. Ikeda, E.C. Wilcox, J.H. Brubaker, R.A. Spanjaard, A. Sugawara, W.W. Chin, Half-site arrangement of hybrid glucocorticoid and thyroid hormone response elements specifies thyroid hormone receptor complex binding to DNA and transcriptional activity, J. Biol. Chem. 269 (1994) 12704–12709. [76] X. Zhang, M. Jeyakumar, M.K. Bagchi, Ligand-dependent cross-talk between steroid and thyroid hormone receptors. Evidence for common transcriptional coactivator(s), J. Biol. Chem. 271 (1996) 14825–14833.

33

[77] Y.S. Zhu, T. Dellovade, D.W. Pfaff, Gender-specific induction of pituitary RNA by estrogen and its modification by thyroid hormone, J. Neuroendocrinol. 9 (1997) 395–403. [78] Y.S. Zhu, T.L. Dellovade, D.W. Pfaff, Interactions between hormonal and environmental signals on hypothalamic neurons: molecular mechanisms signalling environmental events, Trends Endocrinol. Metab. 8 (1997) 111–115. [79] Y.S. Zhu, Q. Ling, L.Q. Cai, J. Imperato-McGinley, D.W. Pfaff, Regulation of preproenkephalin (PPE) gene expression by estrogen and its interaction with thyroid hormone, Soc. Neurosci. Abstr. 23 (1997) 798. [80] Y.S. Zhu, D.W. Pfaff, Protein–DNA binding assay for analysis of steroid-sensitive neurons in the mammalian brain, in: E.R. de Kloet, W. Sutanto (Eds.), Neurobiology of Steroids, Vol. 22, Academic Press, Orlando, FL, 1994, pp. 245–264. [81] Y.S. Zhu, D.W. Pfaff, DNA binding of hypothalamic nuclear proteins on estrogen response element and preproenkephalin promoter: modification by estrogen, Neuroendocrinology 62 (1995) 454–466. [82] Y.S. Zhu, D.W. Pfaff, Differential regulation of AP-1 DNA binding activity in rat hypothalamus and pituitary by estrogen, Mol. Brain Res. 55 (1998) 115–125. [83] Y.S. Zhu, P.M. Yen, W.W. Chin, D.W. Pfaff, Estrogen and thyroid hormone interaction on regulation of gene expression, Proc. Natl. Acad. Sci. USA 93 (1996) 12587–12592.