Molecular analysis of intraspousal transmission of hepatitis C virus

Journal of Hepatology 1995;22: 431439 Printed in Denmark . AN rights reserved

Journal of Hepatology ISSN 0168-8278

Molecular analysis of intraspousal transmission of hepatitis C virus* Kazuaki

Chayama ‘p2, Mariko ‘Depariment

Kobayashi3, Akihito Tsubota’, Isao Koida’, Yasuji Arase’, Satoshi Saitoh’, Kenji Ikeda’ and Hiromitsu Kumada’

of Gastroenterology, Toranomon Hospital, -?Okinaka Memorial Institute for Medical Research and ‘Liver Research Laboratory, Toranomon Hospital, Tokyo, Japan

Although intraspousal transBackground/Aims: mission of hepatitis C virus (HCV) has been speculated, there is no direct evidence. Methods: To investigate whether transmission of HCV occurs by this route, 295 spouses of persons diagnosed with HCV were studied. Of these, 25 (8.8%) tested positive for anti-HCX Next, the HCV genotype was determined by polymerase chain reaction using a mixed primer set, and cDNA was obtained in 17 of the 25 couples for comparison of the genotypes. Results: Of these 17, 14 (82.4%) spouses were shown to be infected with HCV of the same genotype. Analysis of the nucleotide sequences of putative El gene of eight couples having the same HCV genotype revealed that five couples had remarkably high nucleotide sequence homologies (>97%), whereas samples ob-

tained from the remaining three couples showed relatively low homology (91-92%). Nucleotide sequence homologies were significantly higher between spouses than between non-spouse pairs of isolates. Phylogenetic analysis using the neighbor-joining method suggests that infection in these five couples probably occurred after marriage. Furthermore, none of the five couples had shared other possible transmission routes such as intravenous drug use, dental treatment or acupuncture. Conclusion: These data strongly suggest the occurrence of intraspousal transmission of HCX

S

munity-acquired non-A, non-B hepatitis patients have been shown to have HCV infection (9). Transmission through parenteral use of blood products should be reduced effectively by screening such products by antibody testing. Transmission is also known to occur through needle-sharing among intravenous drug users, needlestick accidents among health care workers, and tattooing (lO-12), but the route of transmission for most sporadic cases remains unknown. Whether or not sexual/household transmission is one such route is highly controversial. Kumada et al. (13) reported that the incidence of chronic liver disease among the spouses of patients with chronic hepatitis C was high in Japan (22 of 183 (12.0%)), 70% of whom were shown to have chronic hepatitis C by liver biopsy. While some researchers have reported the likelihood of sexual transmission (1421) others have reported a low risk (22-25) and the absence of HCV RNA in body fluids does not support this hypothesis (26,27). The aim of this study was to evaluate the feasibility

THE cloning and sequencing of hepatitis C virus (HCV) (1) by first-generation serological assays for the detection of anti-HCV antibody (antiHCV) (2), more than 60% of the cases of so-called chronic non-A, non-B hepatitis have now been reclassified as chronic hepatitis C (3-5). Recently, more sensitive and specific second-generation antibody assays have been developed (6,7). More than 90% of posttransfusion hepatitis patients (8) and 82% of comINCE

Received 2 June 1994

Correspondence: Kazuaki Chayama, MD, Department of Gastroenterology, Toranomon Hospital, 2-2-2 Toranomon, Minatoku, Tokyo, Japan * The nucleotide sequence data reported in this paper will appear in the GSDB, DDBJ, EMBL and NCBI nucleotide sequence databases with the following accession numbers; D28918-D28933 for El gene of the hepatitis C virus isolated from eight couples and D14829-D14831 for a control patient.

Key words: El gene; Nucleotide sequence; Phylogenetic analysis. 0 Journal of Hepatology.

431

K. Chayama et al.

of HCV transmission by the intraspousal route by determining the nucleotide sequences of the El gene in couples who were both positive for HCV

Patients and Methods Serum samples From 1987 to 1992, we collected serum samples from 295 adult patients with chronic hepatitis C and their spouses, and tested them for routine liver function. The unused sera were stored at - 80°C until further analysis for HCV markers. The study protocol was approved by the institutional review board in our hospital, and informed consent was obtained from all patients and spouses examined, after the nature of the study had been explained to them. All of the couples were given a detailed questionnaire to rule out parenteral sources of infection. Of the 295 patients enrolled in the study, there were 25 married couples in which both partners were positive for anti-HCV by enzyme-linked immunosorbent assay (ELISA). Next, we determined the HCV genotype by polymerase chain reaction (PCR)-based genotypic subtyping in samples obtained from these 25 couples. Genotypes for one or both partners could not be determined in eight couples, probably due to low virus titer or mismatch of the primers. Of the 17 couples in whom HCV genotypes for both husband and wife could be determined (28), 14 (82.4%) were found to have the same genotype. Since having the same genotype does not prove intraspousal transmission, we compared the nucleotide sequence homology of the putative viral El region, which shows more than 85% homology among isolates of genotype lb and is suitable for sequence comparisons. Of these 17 couples, 7 were excluded in which one partner or both had a history of transfusion. Since the transfused strain may mask the pre-existing, intraspousally transmitted strain, we determined the El sequences in the remaining 10 couples. As the El gene could not be amplified by our primers in two couples, the sequences from only eight couples were used in the final analysis. Although two of these eight couples had a history of acupuncture/tattooing, they showed very high nucleotide sequence homology essentially ruling out these routes of transmission. With hindsight, if these couples had shown less homology, we would have had to consider these other routes and perhaps eliminate the couples from the final analysis. As is, we feel that it is appropriate to include them in the analysis. Detection of anti-HCV and HCV RNA Detection of anti-HCV was done using a second-generation ELISA (Ortho HCV ELISA test system, Ortho

432

Diagnostics Japan, Tokyo, Japan) according to the manufacturer’s instructions. HCV RNA was detected by reverse transcription (RT)-PCR and nested PCR as described elsewhere (29). Briefly, HCV RNA was extracted from serum samples by the acid-guanidine phenol chloroform method and cDNA was synthesized using random hexamers (Takara Biochemicals, Tokyo, Japan) and MMLV reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, MD, USA) according to the manufacturer’s instructions. Nested PCR was performed using the above cDNA as a template and two primer pairs were derived from the highly conserved 5’ non-coding region. The nucleotide sequences of the primers were: 5’-CCTGTGAGGAACTACTGTC-3’ (nucleotides (nt) 32-50) and 5’-CAACACTACTCGGCTAGCAGTC-3’ (nt 124145) as the outer primer pair and 5’-TTCACGCAGAAAGCGTCTAG-3’ (nt 5 17 1) and 5’-TTTATCCAAGAAAGGACCC-3’ (nt 176194) as the inner primer pair. All nucleotide number designations correspond to those of Kato et al. (30). To avoid false-positive results, the procedures developed by Kwok & Higuchi to avoid contamination (31) were strictly applied. PCR was always done along with negative serum (healthy control) and water as negative controls. No contamination was observed in this study. Samples which tested positive for anti-HCV but negative for HCV RNA were analyzed by recombinant immunoblot assay (RIBA) and all of these samples were tested positive for RIBA.

Genotypic subtyping for HCV HCV isolates were amplified by PCR, as described previously (28), and classified genotypically into five subtypes: I (Pt), II (Kl), III (K2a), IV (K2b), and Tr. Briefly, cDNA (equivalent to 25 ~1 of serum) was amplified by PCR using a mixed primer set deduced from the nucleotide sequences of the NS5 region of the five HCV genotypes. As these primers were situated in different regions of the NS5 region, each genotype could be determined by simply comparing the sizes of amplified DNA fragments after gel electrophoresis. The specificities of each primer and results of confirmatory tests have been described elsewhere (28). In this paper, we used the classification proposed by Simmonds et al. (32), that is, I (Pt) corresponds to genotype la in Simmonds classification, II (Kl) to lb, III (K2a) to 2a, IV (K2b) to 2b and Tr to 3b.

Sequencing of El gene HCV cDNA sequences coding for the putative El gene were amplified by PCR, cloned and sequenced. The

Intraspousaltransmissionof HCV primers used to amplify this region were 5’CTCGAATTCGGCTTCGCCGATCTCATGG-3’ nucleotide (nt) 705-732 (nt designations correspond to those of Kato etal. (30)) as the sense primer and 5’GCTTGTGGGATCCGGAGTA-3’ (nt 1339-l 357) as the antisense primer. Primers were designed to contain EcoRI (sense primer) or BamHI (antisense primer) sites for directional cloning. PCR was performed in a total volume of 50 ,.~lusing Taq DNA polymerase (Promega Corp., Madison, WI) with MgC& at a concentration of 1.5 mM and dNTP (N=A,T,C,G) at 200 ,uM. Thirty-five cycles of PCR were performed after the first denaturation at 94°C for 4 min as follows: denaturation at 94°C for 1 min, annealing of primers at 50°C for 2 min, and primer extension at 72°C for 3 min. Final extension was performed at 72°C for 7 min. PCR products were double-digested with both EcoRI and BamHI (Takara Biochemicals, Tokyo) and then electrophoresed in 3% agarose gels. DNA fragments were extracted from the gel and the DNA was then cloned into both M13mp18 and M13mp19 phage vectors. Nucleotide sequencing was performed by the dideoxy termination method (33) in both directions. To avoid sequencing errors due to misincorporation by Taq DNA polymerase, at least three clones for each individual were cloned and sequenced. Phylogenetic analysis of the El gene The total numbers of synonymous and nonsynonymous substitutions among nucleotide sequences were estimated by the method of Gojobori et al. (34). Using this number, a phylogenetic tree was constructed by the neighbor-joining method (35). The results were further confirmed using unweighted pair grouping (36) using the numbers of synonymous and nonsynonymous substitutions as well as the numbers of nucleotide substitutions at each position of a codon separately. These analyses were performed using the “Bioresearch” software (Fujitsu, Ltd., Tokyo, Japan). Mutation rate of HCV type lb genome By analyzing nucleotide sequence changes in one patient with type lb whom we followed up over 15 years, we were able to calculate evolutionary rates of HCV nucleotide change and, keeping in mind that the rate determined in this individual is not necessarily representative of all type lb mutation rates, we used this rate to estimate the time when intraspousal transmission occurred. Statistical analysis The Mann-Whitney U-test was used to analyze differences between married couples and other pair-wise

comparisons of non-spouse pairs of isolates and phylogenetic distance.

Results Incidence of HCV infection and related liver disease in spouses of patients with chronic hepatitis Among the 295 spouses examined, 25 (8.8%) were positive for anti-HCV antibody. Further analysis by RT nested PCR showed that 23 of these 25 spouses were positive for HCV RNA. The two HCV RNA negative spouses also showed normal alanine aminotransferase (ALT) levels. Of the remaining 23, 16 had biopsyproven chronic hepatitis, and five of the remaining seven showed abnormal liver function tests. Thus, 21 of 295 spouses (7.1%) were suggested to have an HCVrelated liver disease. The clinical backgrounds of the 25 couples are shown in Table 1. HCV genotypes in viremic couples Thirty-nine of 46 (84.5%) HCV RNA-positive individuals were evaluated for HCV genotypes, but the genotypes could only be determined in 17 couples. The eight couples who were not evaluated probably showed negative results in genotyping due to a low virus titer and/or mismatches of the genotyping primers. The genotypes were the same in 14 (82.4%) couples (13 couples were identical for type lb and one for type 2b), and non-identical in three (one couple had types lb and 2a and two had types lb and 2b). Thus, in at least 3 of 17 (17.6%) couples, infection seems to have come from a different source. Comparison of nucleotide sequences of the El gene We further investigated 16 samples obtained from eight couples (nos. l-8 in Table 1) and analyzed the nucleotide sequence of the 606 bases in the putative El gene. These eight couples were selected because none had a history of blood transfusion (newly transfused virus may mask the pre-existing strain) and all were positive for the El gene by PCR amplification using the above primers (of the remaining unanalyzed couples, one or both of the partners showed negative results; see Materials and Methods). Of these eight couples analyzed, five showed a very high degree of sequence similarity (Fig. 1 and Table 2). Two couples (nos. 1 and 2) had almost identical HCV El nucleotide sequences (99.8% and 99.4%, respectively). This suggests that infection in these two couples occurred recently. It should be noted that we were able to detect the occurrence of infection in couple no. 1 by prospectively following them (Fig. 2). The husband developed acute hepatitislike symptoms (nausea and anorexia) about 9 months after his wife was diagnosed (November 1991) as 433

K. Chayama et al. TABLE

1

Clinical

background

of couples No.

lh wt 2h wt 3 ht 41 wt

W

5

61 wt 7 ht 8Wht 9Wht dlt llwh wt 12 ht 13whi 14Wht 151 wt 16 ht 17Wht 18Q 191, 20wht 21Wht 22Wht 23Wht 24Wht 25Wht W

both positive for anti-HCV

antibody

Age

ALT*

HCV RNA

Transfusion

Acupuncture/ tattooing

64 62 40 28 IO 58 50 45 50 44 65 53 59 55 70 64 12 63 55 57 48 45 60 58 60 56 56 50 51 45 36 35 53 46 40 38 58 58 54 50 60 56 53 47 56 56 58 56 53 40

114 34 202 60 431 210 82 10 244 115 133 211 29 140 165 139 144 139 70 64 18 60 53 45 185 46 256 211 58 12 255 161 101 175 130 56 82 29 94 22 145 8 144 139 143 10 32 45 87 8

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + _ + + + +

_ _ _ _ _ _ _ _ _ + _ _ + + _ + _ + _ _ _ _ + + _ _ _ _ _ _ + + _ + + _ -

+ _ _ _ _ + _ _ _ _ _ + + _ _ _ _ _ _ _ _ _ _ _ _ + _ _ _ -

Histolog**

Genotype

CH CH LC CH LC+HCC ND CH CH LC ND LC LC LC+HCC CH CH LC HCC LC CH CH CH LC LC CH HCC ND LC CH LC LC CH CH CH CH CH ND CH ND CH ND LC ND CH CH CH ND LC LC CH ND

lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb lb 2b 2b 2a lb 2b lb lb 2b 2a lb _ lb _ lb _ lb _ _ _ _ _

* Alanine aminotransferase value at the first sampling. ** CH: chronic hepatitis. LC: cirrhosis. ND: not done. t Index case.

having chronic hepatitis by liver biopsy. He tested negative for anti-HCV at that time, but tested positive when he was admitted to our hospital. To compare this nucleotide sequence similarity with others, we obtained the nucleotide sequences of the El gene from previously published papers (37-52). Se434

quences obtained were analyzed phylogenetically using the neighbor-joining method (35) (Fig. 3). A phylogenetic tree constructed by the unweighted pairing method (36) showed similar results (data not shown). There are five major genotypes in the phylogenetic tree, as previously shown by analyzing nucleotide sequences of the

Intraspousal transmission of HCV 835 TGCTCTTTCTCTATCTTCCTCTTAGCCTTGCTGTCTTGCT lh Iw TTTGCCCGGT _..._..._._._...__.....__...-.--.--...--__....__.. .__... _ ___G__TC_ __...C_.T. 2h ...._..... _. . . . . . zr

__.._.__._

3h

__________

_. . _ _._. _. . _. . _. . .._

3n ....__.-.- _. . _ 4h _C____T___ _. _. dn _C____T___ 5h __________ _. - . ljn....._.._. 6h CC........ _... 6n ...._..... .__.. 7h _C.._..... . . _. . Tn ___....... . . _. . 6h C________. . . _. & C__A______ __C__

-T-

. _. . _.

..._ ._._

_

___G__TC_

. _ _ _ _ _ _ _ _ _

_____C____ TC-G--TC- T____C____ TC-G--TC..._.._._ .._._C_.TC ._.__._.. _____C_.TC ._.G__TC_ _____C__T_ ___G__TC_ _____C__T_ ______TC_ ________T_ _._G___C__________TC ___G__T________C__T_ ___G__TC_______C__T_ _C_G__T_______.C____ ___G__T___._.._._._.

___._C_.T.

ALT Mu/I)

600

HCV-Ab(+) Biopsy

wife

CAH

WV-Ab(-)

HCV-Ab(+)

husband

600;t.h 2h .& 3h

885

a; 41 5h 51

TGACCATCCC . _ . . . AGCTTCCGCT . . _ . _ . . . - TACGAAGTGC -. - . . . _ _ _ . GCAACGTGTC . . _ _ . . . _ _ . CGGGGTGTAC __ . . . _ . . . . ______C_____T____..__.T_____________________A_A___ ______C_____T________.T_____________________A_A___ _________....._._.._..T.____________________._A... ____________T_______________________A___ ::::::::::_____._.._..T_____________..._____A_____ _______......_......._T_____________________A_____ ____T________C____.______G__________C________C____ ____T_____._.C......._.__G__________C______..C_.._

&,

__________

T_________

__T__..__.

_

‘jn

__________

__T_______

__TA_G____

_

._..._. _._...____ . _. . ___

7,,

__________

_________.

C.T_..AC__

_

._.....

7,,

__________

___C______

__T_______

_

____A__

___._._._T

8h

____TG____

__________

_____G____

_

._.._._

_._._._...

gu

. . .._..._.

. . . . . . . . . .

c_________

______c___

______A___ .._..._...

Nucleotide

homologies

No.

Nucleotide sequence homoloav (%)

Marriage duration (years)

Estimated time of infection (years earlier)

Possibility of intraspousal transmission

99.8 99.4 98.4 98.0 91.3 92.4 91.6 91.4

35 4 30 20 35 15 31 45

1.3 3.3 10 13 19 53 60 70

+ + + + + _

between married

couples

Nucleotide homologies between married couples, marriage duration and estimated time of infection between spouses. Estimated time of infection was calculated using a phylogenetic tree analysis (see legend to Fig. 3). If the elapsed time between the estimated time of infection and this study was longer than marriage duration, the possibility of intraspousal transmission was ruled out.

NS5

c1990 "1991

'

1992

' 1993

Fig. 2. Time course of couple (couple no. I in Table 1) both infected with hepatitis C virus.

duration of marriage for comparison (Table 2). Intraspousal transmission was likely in five couples (nos. l5) who were found to have HCV with high nucleotide sequence homology (~97%). Mutation

TABLE2

1 2 3 4 5 6 7 8

2ocb

._...-....

Fig. 1. Nucleotide sequences of the putative El region of hepatitis C virus obtained from eight husbands (h) and wives (w). Dashes indicate identity with sequence of I h (top line). Nucleotide number corresponds to that described for the lb genotype sequence by Kato et al. (30).

Couple Couple Couple Couple Couple Couple Couple Couple

400.

region by Simmonds et al. (32). Among them, five couples with a high degree of nucleotide sequence similarity were positioned adjacent to each other on the phylogenetic tree. We also determined, for comparison, nucleotide sequences of the putative El region of HCV using samples obtained from a patient with chronic hepatitis C (infected by lb type. HCV) in 1976, 1986 and 1991 (Control 76, 86 and 91), respectively The estimated elapsed time after infection between spouses, using these data (Fig. 3), is shown together with the

rate of HCV

type lb genome

(El

gene)

Based on the calculations of the mutation rate of a single individual who was followed up for 15 years, the mutation rate used to estimate the time when intraspousal transmission occurred was 1.39 X 10e3/sites/ year using the six-parameter method (34). Comparison gene between

of nucleotide

sequence

couples and non-couple

homologies

of El

pairs

To determine whether the degree of nucleotide homology of couples is higher than the homology seen in the general population, we performed pair-wise comparisons of nucleotide sequence homology and phylogenetic distance estimated by the six-parameter method (34) using the nucleotide sequences of the El gene which appeared to be type lb HCV (Fig. 3). As some papers report sequences apparently obtained from one infected individual, we obtained one sequence from each paper. In total, pair-wise comparisons of 22 nucleotide sequences (17 from this study (16 from eight couples), one from a control patient and five from references) were performed. As shown in Fig. 4, nucleotide sequence homologies ranged from 87.5% to 99.8%; the evolutionary distance using the six-parameter method (34) ranged from 0.001 to 0.136, as has been shown by Simmonds et al. (32). Both homologies and distances of five couples were distributed apart from the main peak. Both homologies and distances of eight couples were significantly more similar than those of 435

K. Chayama et al.

n 60

homology

Dkl l(37) +

HC-J8(39)

Couple Couple

1h lw

87

88

89

9C

9'2 93 94 95 96 97 98 99 (%)

n evolutionary distance

605040-

3020-

10-

13

12

11

ia

IL I

6

5

4

3

2

1 (x10-‘)

Fig. 4. Comparison of nucleotide sequence homologies and phylogenetic distances of El gene of hepatitis C virus among couples and non-couple pairs. Shaded boxes represent the homologies and distances obtained from the comparisons of the eight couples.

Fig. 3. Phylogenetic tree of hepatitis C virus (HCV) constructed by the neighbor-joining method analyzing nucleotide sequences of putative El region. Couples 1 to 8 represent husbands (h) and wives (w) studied. CONTROL 76, 86 and 91 in dark open boxes were clones obtained at 1976, 1986, 1991, respectively, from one patient. Using the phylogenetic distance of two isolates, CONTROL 76 and 91 (15 years), as shown by the bold line, we could estimate when transmission between spouses occurred; that is, because the lengths of the horizontal lines in the phylogenetic tree constructed by the neighbor-joining method are proportional to the evolutionary distance (time), we were able to calculate the time span using the above bold line as a measure. The published sequences of HCV in this figure were obtained from the sources indicated in parentheses.

non-couple comparisons (Mann-Whitney p
U-test;

Discussion While the question of whether HCV is transmitted sexually is still unsettled, some investigators have obtained epidemiological data suggesting that sexual/household transmission does in fact occur (13-21), although the rate is far lower than with the hepatitis B virus or human immunodeficiency virus (5354). Others have reported that HCV is not efficiently transmitted by the sexual route (22-25,55,56). Analysis of body fluids other than plasma by the very sensitive PCR failed to detect HCV RNA (26,27). Thus, it seems that sexual transmission of HCV is relatively infrequent. Nevertheless, except for the known parenteral routes (transfusion of blood products (4,5), needle-sharing among intravenous drug users, needlestick accidents, and tattooing (l&12)), the transmission route which is responsible for sporadic cases remains unknown, and thus sexual/household transmission cannot be ruled out. Recently, Kao et al. (17) reported results similar to

Intraspousal

ours in their analysis of HCV nucleotide sequences in the putative non-structural region 3 where they found 100% nucleotide homology in three of four couples analyzed. This finding is particularly noteworthy because this region is relatively poorly conserved and evolutionary rates of the HCV genome are high; therefore, in the absence of sexual transmission, the chance of a 100% match in three of four couples is nil. Nevertheless, as the rate of positivity for anti-HCV in the spouses of the index patients they analyzed was much higher (antiHCV positivity rates were 38% among husbands whose wives were the index patients and 12% among wives whose husbands were the index patients) than ours, it is possible that the spouses of the index patients in their study were infected just before analysis. Unfortunately, the durations of marriage for the couples they analyzed were not specified in their paper. It seems certain, however, that based on our and their results (17), sexual/ household transmission does in fact occur, but at a low rate. Recently, Honda et al. (57) also reported infection of HCV through household contact in one couple (homology 98.1%) by analyzing the core region and part of the envelope region of the HCV genome. We have shown here that the incidence of anti-HCV positivity in spouses of patients with chronic hepatitis C was 8.8%. As 14 of 17 couples (82.4%) had same genotype and the nucleotide sequence similarity was very high in five of eight spouses (62.5%), we could estimate roughly that at least 4.5% (8.8x0.824x0.625) of these spouses were infected intraspousally. One young couple was apparently infected soon after marriage (couple no. 2) but in others transmission occurred much later in marriage. It is unknown exactly when and how transmission occurred because we were unable to determine which spouse was infected first and when the infection occurred. Furthermore, it should be noted that the intrinsic evolutionary rates of HCV change may differ from strain to strain, individual to individual, or even within a given individual (42,58). Such differences may grossly alter the results. The low frequency, and hence low efficiency of sexual/household transmission of HCV, as shown in this study, and the absence of any other obvious transmission route (except for parenteral exposure) makes the understanding of HCV transmission more difficult. However, it is possible that living in close contact, as married couples do, involves occasional injuries to the skin and mucosa through which HCV gain entry over long periods of time. A prospective study of spouses of patients with chronic hepatitis C, as was done in this study (Fig. 2) may address this issue and suggest strategies to prevent the spread of this agent.

transmission of HCV

Acknowledgements The authors thank Dr Kunio Okuda, Professor Emeritus, Chiba University, Japan, for his suggestions and critical review of the manuscript, Mr Katsura Okamoto, MS Masumi Kanda, MS Miche Hashimoto, and MS Satomi Iwasaki for their excellent technical assistance and MS Miho Satoh for her secretarial work.

References 1. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a bloodborne non-A, non-B viral hepatitis genome. Science 1989; 244: 35962. 2. Kuo G, Choo QL, Alter HJ, Gitnick L, Redeker G, Purcell RH, et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989; 244: 362-4. 3. Esteban JI, Esteban R, Viladomiu L, Lopez-Alavera JC, Gonzalez A, Hernandez JM, et al. Hepatitis C virus antibodies among risk groups in Spain. Lancet 1990; 335: 294 7. 4. Van der Poe1 CL, Reesink HW, Lelie PN, Leentcaar-Kuypers A, Choo QL, Kuo G, et al. Antihepatitis C antibodies and non-A, non-B post-transfusion hepatitis in The Netherlands. Lancet 1990; 335: 297-8. 5. Alter HJ, Purcell RH, Shin JW, Melpolder JC, Houghton M, Choo QL, et al. Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis. N Engl J Med 1989; 321: 1494-500. 6. Aach RD, Stevens CE, Hollinger FB, Mosley Jw, Peterson DA, Taylor PE, et al. Hepatitis C virus infection in posttransfusion hepatitis; an analysis with first and second-generation assays. N Engl J Med 1991; 325: 1325-9. I. Lin R, Yatuhashi H, Yano M, Farrell GC. Hepatitis C as the cause of chronic non-A, non-B hepatitis: high sensitivity of simultaneous measurement of core and non-structural antibodies. J Gastroenterol Hepatol 1992; 7: 459-62. 8. Morris JA Jr, Wilcox TR, Reed GW, Hunter EB, Wallas CH, Steane EA, et al. Safety of the blood supply. Surrogate testing and transmission of hepatitis C in patients after massive transfusion. Ann Surg 1994; 219: 517-25. 9. Alter MJ, Margolis HS, Krawczynski K, Judson FN, Mares A, Alexander WJ, et al. The natural history of communityacquired hepatitis C in the United States. N Engl J Med 1992; 327: 1949-50. 10. Kiyosawa K, Sodeyama T, Tanaka E, Nakano Y, Furuta S, Nishioka K, et al. hepatitis C in hospital employees with needlestick injuries. Ann Intern Med 1991; 115: 367-9. 11. Mitsui T, Iwano K, Masuko K, Yamazaki C, Okamoto H, Tsuda F, et al. Hepatitis C virus infection in medical personnel after needlestick accident. Hepatology 1992; 16: 1109-14. 12. Ko YC, Ho MS, Chiang TA, Chang SJ, Chang PY. Tattooing as a risk of hepatitis C virus infection. J Med Virol 1992; 38: 288-9 1. 13. Kumada H, Arase Y, Ikeda K, Chayama K, Saitoh S, Sakai Y, et al. Detection of hepatitis C virus antibody in spouses of patients with chronic hepatitis type C. Acta Hepatol Jpn (in Japanese) 1990; 31: 357-8. 14. Alter MJ, Hadler SC, Judson FN, Mares A, Alexander WJ, Hu PY, et al. Risk factors for acute non-A, non-B hepatitis

437

K. Chayama et al. in the United States and association with hepatitis C virus infection. JAMA 1990; 264: 2231-5. 15. Everhart JE, Di Bisceglie AM, Murray LM, Alter HJ, Melpolder JC, Kuo G. Risk for non-A, non-B (type C) hepatitis through sexual or household contact with chronic carriers. Ann Intern Med 1990; 112: 544-5. 16. Akahane Y, Aikawa T, Tsuda F, Okamoto H, Mishiro S. Transmission of HCV between spouses. Lancet 1992; 339: 1059-60. 17. Kao JH, Chen PJ, Yang PM, Lai MY, Sheu JC, Wang TH, Chen DS. Intrafamilial transmission of hepatitis C virus: the important role of infection between spouses. J Infect Dis 1992; 166: 900-3. 18. Napoli N, Fiore G, Vella F, Fera G, Schiraldi 0. Prevalence of antibodies to hepatitis C virus among family members of patients with chronic hepatitis C. Eur J Epidemiol 1993; 9: 629-32. 19. McKenna JG, Evans G, Lyttle PH, Cluper A. Hepatitis C virus seroprevalence in patients attending a sexual health centre. NZ Med J 1994; 107: 810. 20. Oshita M, Hayashi N, Kasahara A, Yuki N, Takehara T, Hagiwara H, et al. Prevalence of hepatitis C virus in family members of patients with hepatitis C. J Med Virol 1993; 41: 251-5. 21. Wu JC, Lin HC, Jeng FS, Ma GY, Lee SD, Sheng WY. Prevalence, infectivity, and risk factor analysis of hepatitis C virus infection in prostitutes. J Med Virol 1993; 39: 312-7. 22. Hallam NF, Fletcher ML, Read SJ, Majid AM, Kurts JB, Rizza CR. Low risk of sexual transmission of hepatitis C virus. J Med Virol 1993; 40: 251-3. 23. Bresters D, Mauser-Bunschoten EP, Reesink HW, Roosendaal G, van der Poe1 CL, Chamuleau RA, et al. Sexual transmission of hepatitis C virus. Lancet 1993; 342: 210-l. 24 Brackmann SA, Gerritzen A, Oldenburg J, Brackmann HH, Schneweis KE. Search for intrafamilial transmission of hepatitis C virus in hemophilia patients. Blood 1993; 81: 107782. 25 Weinstock HS, Bolan G, Reingold AL, Polish LB. Hepatitis C virus infection among patients attending a clinic for sexually transmitted diseases. JAMA 1993; 269: 3924. 26. Fried MW, Shindo M, Fong TL, Fox PC, Hoofnagle JH, DiBisceglie AM. Absence of hepatitis C viral RNA from saliva and semen of patients with chronic hepatitis C. Gastroenterology 1992; 102: 14269. 27. Hsu HH, Wright TL, Luba D, Martin M, Feinstone SM, Garcia G, Greenberg HB. Failure to detect hepatitis C virus genome in human secretions with the polymerase chain reaction. Hepatology 1991; 14: 763-7. 28. Chayama K, Tsubota A, Arase Y, Saitoh S, Koida I, Ikeda K, et al. Genotypic subtyping of hepatitis C virus. J Gastroenter01 Hepatol 1993; 8: 15&6. 29. Chayama K, Saitoh S, Arase Y, Ikeda K, Matsumoto T, Sakai Y, et al. Effect of interferon administration on serum hepatitis C virus RNA in patients with chronic hepatitis C. Hepatology 1991; 13: 1040-3. 30. Kato N, Hijikata M, Ootsuyama Y, Nakagawa M, Ohkoshi S, Sugimura T, Shimotohno K. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc Nat1 Acad Sci USA 1990; 87: 95248. 31 Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989; 339: 237-8. 32 Simmonds P, Holmes C, Cha T, Chan SW, McOmish F, Irvine

438

33.

34.

35.

36. 37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

N, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS5 region. J Gen Virol 1993; 73: 2391-9. Sanger F Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Nat1 Acad Sci USA 1977; 74: 5463-7. Gojobori T, Ishii K, Nei M. Estimation of average number of nucleotide substitutions when the rate of substitution varies with nucleotide. J Mol Evol 1982; 18: 414-23. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987; 24: 189-204. Nei M. Molecular Population Genetics and Evolution. Amsterdam: North Holland, 1975. Bukh J, Purcell RH, Miller RH. At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative El gene of isolates collected worldwide. Proc Nat1 Acad Sci USA 1993; 90: 8234-8. Okamoto H, Kurai K, Okada SI, Yamamoto K, Lizuka H, Tanaka T, et al. Full-length sequence of a hepatitis C virus genome having poor homology to reported isolates: comparative study of four distinct genotypes. Virology 1992; 188: 33141. Okamoto H, Okada S, Sugiyama Y, Kurai K, Lizuka H, Machida A, et al. Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions. J Gen Virol 1991; 72: 2697-704. Choo QL, Richman K, Han JH, Berger K, Lee C, Dong C, et al. Genetic organization and diversity of the hepatitis C virus. Proc Nat1 Acad Sci USA 1991; 88: 2451-5. Okamoto H, Kanai N, Mishiro S. Full length nucleotide sequence of a Japanese hepatitis C virus isolate (HCJl) with high homology to USA isolates. Nucleic Acids Res 1992; 20: 6410. Weiner A, Brauer MJ, Rosenblatt J, Richman KH, Tung F, Crawford K, et al. Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NSl proteins and the pestivirus envelope glycoproteins. Virology 1991; 180: 842-8. Ogata N, Alter HJ, Miller RH, Purcell RH. Nucleotide sequence and mutation rate of the H strain of hepatitis C virus. Proc Nat1 Acad Sci USA 1991; 88: 339226. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H. The 5’-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med 1991; 60: 167-77. Inchauspe G, Zebedee SL, Lee DHH, Sugitani M, Nasoff MS, Prince AM. Genomic structure of the human prototype strain H hepatitis C virus: comparison with American and Japanese isolates. Proc Nat1 Acad Sci USA 1991; 88. 102926. Takamizawa A, Mori C, Manabe S, Murakami S, Fujita J, Onishi E, et al. The structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 1991; 65: 1105-13. Kato N, Hijikata M, Ootsuyama Y, Nakagawa M, Ohkoshi S, Sugiyama T, Shimotohno K. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc Nat1 Acad Sci USA 1991; 87: 9524-8. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Ohkoshi S, Shimotohno K. Hypervariable regions in the putative glycoprotein of hepatitis C virus. Biochem Biophys Res Commun 1991; 175: 220-8.

Intraspousal

49. Chen PJ, Lin MH, Tai KF, Liu PC, Lin CJ, Chen DS. The Taiwanese hepatitis C virus genome: sequence determination RNA. Virology 1992; 188: 102-13. 50. Takeuchi K, Boomnar S, Kubo Y, Katayama T, Harada H, Ohbayashi A, et al. Hepatitis C viral cDNA clones isolated from a healthy carrier donor implicated in post-transfusion non-A, non-B, hepatitis. Gene 1990; 91: 287-91. 51. Tanaka T, Kato N, Nakagawa M, Ootsuyama Y, Cho MJ, Nakagawa T, et al. Molecular cloning of hepatitis C virus genome from a single Japanese carrier: sequence variation within the same individual and among infected individuals. Virus Res 1992; 23: 39-53. 52. Chayama K, Tsubota A, Koida I, Arase Y, Saitoh S, Ikeda K, et al. Nucleotide sequence of hepatitis C virus (Type 3b) isolated from a Japanese patient with chronic hepatitis C. J Gen Virol; in press. 53. Toe J, Libre JM, Calbonell M, Muga R, Ribera A, Soriano V, et al. Sexual transmission of hepatitis C virus and its relation with hepatitis B virus and HIV Br Med J 1990; 301: 210.

transmission of HCV

54. Eyster

55.

56.

57.

58.

ME, Alter HJ, Aledort LM, Quan S, Matzakis A, Goedert JJ. Heterosexual cotransmission of hepatitis C virus (HCV) and human immunodeficiency virus (HIV). Ann Intern Med 1991; 115: 764. Hess G, Massing A, Ross01 S, Schutt H, Clemens R, Meyer Zum Buschenfelde KH. Hepatitis C virus and sexual transmission. Lancet 1989; ii: 987. Melbye M, Biggar RJ, Wantzin P, Krogsgaard K, Ebbesen P Becker NG. Sexual transmission of hepatitis C virus: cohort study (1982-90) among European heterosexual men. Br Med J 1990; 301: 210. Honda M, Kaneko S, Unoura M, Kobayashi K, Murakami S. Risk of hepatitis C virus infections through household contact with chronic carriers: analysis of nucleotide sequences. Hepatology 1993; 17: 9716. Okamoto H, Kojima M, Okada S, Yoshizawa H, Lizuka H, Tanaka T, et al. Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: variability and stability. Virology 1992; 190: 8949.

439