- Email: [email protected]
Molecular analysis of poliovirus 3 isolated from an aerosol generated by a waste water treatment plant
Pergamon PII: S0043-1354(97)00158-9
Wat. Res. Vol. 31, No. 12, pp. 3125-3131, 1997 © 1997ElsevierScienceLtd. All fights reserved Printed in Great Britain 0043-1354/97$17.00+ 0.00
M O L E C U L A R ANALYSIS OF P O L I O V I R U S 3 ISOLATED F R O M A N A E R O S O L G E N E R A T E D BY A WASTE W A T E R TREATMENT PLANT MICHELE MUSCILLO @l*, GIUSEPPINA LA ROSA t, ANNALAURA CARDUCCI @2, LAURA CANTIANF and CINZIA MARIANELLP ~Department of Environmental Hygiene, Istituto Superiore di Sanita', Rome, Italy and 2HygieneSection of the Biomedicine Department, University of Pisa, Italy (Received June 1996; accepted in revised form April 1997) Abstract--We examined three samples of lysates from cell cultures that had previously been infected by the aerosol generated by a waste water treatment plant near Pisa. We first attempted to confirm that we were dealing with one of the enterovirus family, using an inversePCR analysis of the RNA extracted from the cell lysates. This identified a single genome sequences in all the samples, which corresponded to poliovirus 3. Sequence analyses revealed that the genotyping of poliovirus 3 was accurate for the species, irrespective of the genomic region sequenced. Subspecies genotyping is only possible for the translated region, and in this case, it identified the Poliovirus type 3 Leon 12alb strain as ancestor of the virus isolated. Molecular analyses were then carried out on the wild virus in the regions VP2 (9623 bp), VP3 (922bp) and VPI (l128bp) and found various nucleotide mutations (e.g. 472T~C; 970C~C.Cys,S,; ! 3196~r,Val.t,,u; 1743r~c.Va~A~a;1817C~X.Hys~ryr).Thermosensitivitytests at 34°C and 44°C showed a slight reversion to the heat resistant phenotype. The need for adequate protective measures for plant staff, together with the frequent use of treated water for irrigation, means that effectivemethods of aerosol borne pathogen detection and risk determination must be adopted. © 1997 Elsevier Science Ltd. Key words--polymerase chain reaction, viruses, poliovirus 3, sewage, aerosol, nucleotide-sequence,health
IINTRODUCTION The micro-organisms in the aerosols from waste water treatment processes or the use of treated water for agricultural irrigation (Teltsch et al., 1980) are a potential danger to human health (Alvarez et al., 1995). Aerosols axe, indeed, together with recreational and drinking water and food, one of the means of enteric virus transmission in humans. Various authors have reported the isolation of enteric viruses from the aerosols produced by a sludge treatment plant (Fannin et al., 1985; Fattal et al., 1987; Pfirrmann and Bossche, 1994; Alvarez et al., 1995). We conducted a molecular characterisation of the viral strains isolated from viral particle containing lysates obtained from the aerosol of a waste water treatment plant on the outskirts of Pisa, Italy (Carducci et al., 1995). On the basis of genetic differences, it is possible to establish new taxonomic (Stanway, 1990) and epidemiological (Drebot et al., 1994; Calisher et al., 1995) standards for the surveillance of the environmental diffusion of viruses that are dangerous to human health. PCR techniques are being more widely employed in environmental
*Author to whom correspondence should be addressed. [Tel: (+39) 6 49902718; Fax: (+39) 6 4938703; e-mail: [email protected]].
fields as a result of their promising speed and sensitivity (Metcalf et al., 1995). These techniques, followed by the nucleotide sequencing of the amplicon, permit the identification of the genus, the species and sometimes even the strain of the virus. The rapidity of the evolution of the regions of a viral genome may lead to diverging results, depending on the region chosen for analysis. The extremely heterogeneous nature of the enteroviruses calls for the use of groups specifc techniques, as a result of the presence in the non-translated enteroviral 5' region (5NC) of segments containing highly conserved sequences (Diedrich et al., 1995; Rotbart, 1990). Analysing the molecular sequences of this region does not give good molecular taxonomy results for the greater part of the non-polioviruses, but is quite accurate for Poliovirus 1, 2 and 3. This paper has two main objectives: (a) to compare the results obtained using the sequences of various regions to see how far an analysis of a short sequence from the non-translated 5' region may be diagnostically useful, and (b) to analyse the significance of the different secondary structure mutations of the structural proteins and consider the relationship of these mutations with the biological characteristics of the viruses in relation to heat. The risk to human health from enteric viruses bearing aerosols in the environment is evaluated in the discussion section.
3125
3126
M. Muscillo et al. Table 1. Primer used for Poliovirus 3 amplification. The restriction site of each sequence is indicated
Region 5' no coding t (5NC) (length of the predicted fragment = 168 bp) - EV B-436 (436-465): BPV445 TTGA G G A T C C TCCGGCCCCTGAATGCG + EV H-603 (577~fi03) ATCT A A G C T T GTCACCATAAGCAGCC
Ref: Muscillo et al., 1995 Ref: Muscillo et al., 1995
Region VP3-VPI (length of the predicted fragment = 1128 bp) + VP1 - PV3 - B2361 (2361-2392) 5'-TGCCA GGATCC ACCCCTAAGAGTATGAGCATG 3'
Ref: Muscillo et al., 1994
- VPI - PV3.H3488 (3466-3488) 5'-TCTCTATTC CACATG A A G C T T ACAG-3' Region VP3 (length of the predicted fragment = 922 bp) + VP3 - PV3 - B1649 (1649-1749) 5'-TCACCGCT GGATCC TGCTCAAGATTCATCAG- VP3 - PV3 - H2570 (2541-2570) 5"-CACTGGCCTTAGTATCAGGT AAGCTT TCCT-3' Region VP2 (length of the predicted fragment = 962 bp) + VP2 - PV3 - B869 (869 895) 5'-AAACAAGATTACTCACA GGATCC ATCA- VP2 - PV3 - H1830 (1800-1830) 5'-ATGGTGATTG AAGCI'T GTCTGACGTCAGGTThe primers are indicated above ( + ) and below ( - ) the target. All primers, except those indicated in the references, are original. The selection criteria for the primer sequences take account of the need for as little change as possible in the primer sequences in correspondence to the purposely created restriction sites.
A : p e l i o 3 12 a l b ( v a c c i m strain) -1 0 +1 ,!I~ 1.
1
*****S
2 3
P N*****
B : sample -1 !. - - t
1
*****S
2
P
6
4 $ 6
7~
7 ~
8 9
8 9
10 11 12
10 11 12
5
R*****
!259 260
T~ *F N*
262
0
+1 - - 1 - -
I~*** R*****
!
!259 260
!~
!
*F N*
262
263 264 265 m266 267 268
269+ 271 272
265
~
267
268 K *F ***Q
269+ 270 271
K *F ***Q
Fig. 1. C o m p a r i s o n of the h y d r o p a t h i c profile averages o f the VP2 region, m a d e up o f 271 a m i n o acids. The n u m b e r i n g on the left is the position o f the acid in the VP2 protein. H y d r o p h o b i a is indicated by a negative value on the left ( - 1 ) a n d h y d r o p h i l i a by a positive value on the right ( + 1). Only the m o s t affected a m i n o acid is s h o w n (indicated with --.). The d o m a i n affected by m u t a t i o n is s h o w n with an ellipse. Left or right shifting of the ellipse indicates the c h a n g i n g p o l a r i t y of the d o m a i n as a results o f a m i n o acid m u t a t i o n .
Viruses in an aerosol
A t pdlo3 l ~ t l b (vaednestmin) -1 0 +1 [.I-!. . . . . . . 12 **********Q 13 **********Y
3127
-1 - - ! 12 13 14
0 !-**********Q
+1 I.
**********Y ******L
15 16
16
17
17
18 19
18
21 22 23 24 25
********C ****A
****I
23 24 25
********C
****A ****I
Fig. 2. Comparison of the hydropathic profile averages of the VP3 region, made up of 238 amino acids. MATERIALS AND METHODS
Biological materials Wild viruses from a lab collection were used for this study. In a previous work (Carducci et al., 1995), qualitative virological analyses were carried out on 24 sewage (100 ml sample -~) and 24 air samples (0.9 m 3 sample-t), which were collected contemporaneously (in pairs) twice monthly from May 1992 to April 1993 from a waste water treatment plant serving a community of 300,000 inhabitants on the outskirts of Pisa, having a throughput of 500 m 3 h-~. Samples were collected from sewage at the inflow of the aeration tank and contemporaneously from the air in their proximity. Basically, sewage ancL aerosol samples were processed and inoculated into buffalo green monkey (BGM) kidney cell monolayers to evidem:e a cytopathic effect. Fourteen sewage samples (58%), collected from June 1992 to January 1993, and six aerosol samples (25%), collected from August to November 1992, gaw~ positive results for enteroviruses as deduced by indirect immunofluorescence. Three of the latter were further identified as poliovirus type 3 by RT-PCR and nucleotide sequencing in the 5' region (data not shown) following the procedure described further in the text. Consequently, as it was assumed that the three samples contained the same virus strain, only one of them was further characterized and is described in this paper. Temperature sensitivi~ T This was assayed (L6pine and Maurice, 1964) by infecting BGM cells at differerLt temperatures using the sample with a Poliovirus 3 Sabin and a wild poliovirus 3 as controls. Two series of four tubes were inoculated with scalar dilutions of each virus, and then incubated at 34°C and 44°C. The viruses assayed here were defined as temperature sensitive (ts +) by comparative evolution of the growth, at the two
temperatures used, of the sample and the controls. The TCIDs0 was calculated according to K,~irber (Dougherty, 1984).
Viral RNA preparation The R N A was extracted directly from the cell lysates obtained, freezing and thawing cells from the cultures after the fourth step of the treatment. The nucleic acids were extracted from 0.45 ml o f lysate using one proteinase K/phenol/isopropanole extraction cycle (Muscillo et al., 1995). They were then dissolved once more in 20/~1 of di-ethyl-pyrocarbonate at 0.1%; 0.2-1/~1 o f this mixture was then used for PCR analysis. Primers and PCR The oligonucleotides used as PCR primer were synthesized using a 392DNA/RNA Synthesizer (Applied Biosystems, Perkin Elmer Corporation). Working solutions were prepared for PCR in water at a concentration o f 22 pmol /zl-~; 1/~1 of the solution was used for the PCR analysis. The transcription and amplification reactions were carried out as previously described (Muscillo et al., 1995). The preparation of the master mix and amplificate handling were carried out in two separate environments. Forty microlitres of the raw amplification mixture were purified on agarose gel. The amplicons extracted from the gel were digested with BamHI and HindlII (Boehringer Mannheim) and then cloned in plasmidic vector pGEM-4z. For each transformation, 10 miniprep and at least two clones were analysed, with the size predicted (Table I), were sequenced in both directions. The sequences in the capside regions were contiguous and could be partially superimposed to check whether they belonged to the same viral strain as the selected clones. Sequencing was carded out labelling the primer with
Table 2. Results of the comparative sequence analysis obtained with the FASTA programme in the GCG packet ver. 8 (University of Wisconsin, Genetic Computer Group) $ 467 CTAAT T CTAACCATGGAGCAGGCAGCTGCAACCCAGCAGCCAGCCTGTCG 516 Polio3 12alb 1 CTAAT C CTAACCATGGAGCAGGCAGCTGCAACCCAGCAGCCAGCCTGTCG 50 sample 517 TAACGCGCAAGTCCGTGGCGGAACCGACTACTTTGGGTGTCCGTGTTTCC 566 51 TAACGCGCAAGTCCGTGGCGGAACCGACTAC '1T+]GGGTGTCCGTGTTTCC 100 567 I T l-I A'['TCTTGAA 579 IOl ITITA'['TCTTGAA 113 The alignments obtain from a site by site comparison of the sequences and the references in the EMBL and GenBank databases showed that 100% pairing is obtained with the P3/Leon/37 and P3/119 polio viruses. The table shows a comparison with the vaccine form of Poliovirus 3 (P3 12alb). The presence of a C in 472 indicates the spontaneous tendency of the vaccine strains to revert to neurovirulent strains.
3128
M. Muscillo et al.
Table 3. All mutations, both synonymous and synonymous, obtained with FASTA considered, taking the vaccine strain P3 12 alb as the ancestral strain (Accession No. X00925) Changing of hydropathicity Percentage of Type of Region Range identitywith the Codons Aminoacids. region limits sequenced ancestor Mutations affected mutated Hydropathicity Hydrophilia 5NC 1-743 467-579 99. l 472 T--*C . . . . VP2 950-1762 898-1796 99.5 970 GoC TGT~TCT Cys~Ser < + 1319 G--*T GTG--,TTG Val--,Leu = 1405 A~G AGG~GGG Gly--*Gly = = 1743 T~C GTG--*GCG Val~Ala < + VP3 1763-2476 1677-2540 99.7 1810 A~G TCA--*TCG Ser--*Ser = = 1817 C---,T CAC---,TAC Hys--,Tyr + < 2191 C--*T ACC~ACT Thr~Thr = = VPI 2477-7360 2393-3464 99.8 2931 T--*C GTG---,GCG Val--*Ala ~< = 3394 T--*C AAT~AAC Asn~Asn = = The tract examined does not, of course, include the part relating to the primer sequences. The numbering of the nucleotidemutations refers to the genomic position, whereas that of the amino acids (aa) refers to their position in the single proteins.
[~t33P]-dATP (DuPont, De Nemours), using T7 sequencing kits (Pharmacia-LKB) and a standard sequencing gel made of 6% polyacrylamide in 8M urea. The run was made at 55°C for 3 h. The compressed sequences were resolved with T7 sequencing deaza G/A kits.
amplicon sequences obtained by the routine amplification reaction of 5NC (Table 2), showed that the same viral isolate was present in the three samples. Sequence analysis in the translated regions (Table 3) gave concordant results, identifying poliovirus 3 Leon Software and computers 12alb as the ancestor of the strain isolated. The strain Sequence analysis and database searches were carried out using IG software (Intelligenetics Inc., Mountain View, CA) that we isolated had only one of the two molecular on a Sun Sparc-classic Workstation connected via the markers indicating neurovirulence, that in position Internet to a Sun Sparc-10 Server at the Virology 472, which consists of a cytosine (C) instead of a Laboratory of our Institute, and using GCG ver. 8 uracile (in c D N A , this becomes T), i.e. the basis of the programmes (University of Wisconsin, Genetic Computer Sabin phenotype (Minor et al., 1989) (cytosine in Group), part of a service offered by a Alpha server virulent strains). Similarly, in B G M cells, the growth Digital Equipment Model 2100 4/275, present at the Italian National node of EMBNET, in the Bari of the environmental virus (Table 4) was strongly research area of the Consiglio Nazionale delle Richerche affected by temperature, whereas P3/Sabin titre ([email protected]). The VP2 and VP3 protein sec- dropped dramatically and wild P3 only slightly. ondary structure flexibility diagrams were obtained as Postscript files from the Peptidestructure and Plotstructure Although none of the mutations found in three regions examined corresponds to those identified in programs of the GCG package and were then transformed into bitmaps using the XV program (John Bradley, the antigenic regions of the Mediterranean variants [email protected]). The images were then manipulated (P6yry et al., 1990) isolated in epidemic centres using Paint and Harvard Graphics running under Windows ° between 1970 and the present day, the possibility 95. The hydropathic profile in Figs 1 and 2 was obtained using the PEP programme in the IG package, following the cannot be excluded that they may contribute to the partial heat resistance of the environmental isolates. procedure of Hopp and Woods (1981). Analysis of the hydrophobic/hydrophilic profiles of RESULTS the amino acid sequences (various authors), deduced from nucleotide sequences, shows different variants in The presence of restriction sites (Table 1) in the different regions. For VP2 (271 residues), the two primer sequence used for this study proved most domains affected by the 7cys~S~r and 265va~Ala useful, in that, although in no way reducing the mutations (Fig. 2) tend to increase the hydrophilic specificity and sensitivity of the reaction, they nature of the chain, without affecting the flexibility of produced amplicons at the 5' and 3' ends, which were the polypeptide chain (Fig. 3). Interesting changes are predisposed to digestion by the restriction enzymes found in the hydrophobic profiles of the VP3 regions BamHI and HindlII, greatly facilitating directional (Fig. 4). The domain affected by mutations, 19Hys~Tyr, cloning in the plasmidic vector pGEM-4z. inverts its polarity, with considerable loss of No analogous restriction sites were found in the hydrophilic quality and an increase in local amplicons, and the cloning operations were thus able hydrophobia, which does not, however, affect the to provide complete insertions. Analysis of the position of the minimum (residue 119) and maximum (residue 145) values calculated in a window of 6 Table 4. Temperature sensitivity: effect of log~0 titre and the temperature sensitivityof severalstrains of Poliovirus3 in BGM cells residues. This mutation significantly affects the at two temperatures flexibility of the molecule, which covers one rotation more (Fig. 5, indicated by an arrow) in the vicinity Virus 34°C 44°C of the mutation, with a consequent drastic change in Sample 6.50 1.50 Poliovirus 3 vaccine strain 4.50 0 its primary structure. In the VP1 region, in the 300 Poliovirus 3 wild 6.50 3.50 amino acids that precede the P2-3b region, the
Viruses in an aerosol
mn
i~unple
3129
12 alb
poliovirm $ ~
VP2
HOOC
I
Fig. 3. Analysis of the flexibility of the VP2 protein sub-unit, the structures of vaccinal poliovirus and of that isolated from the environmental samples. The arrows indicate the positions of the two mutations. The numbering refers to the polypeptide chain residues. The circles on the chain indicate the domains where it is most flexible.
152VaI.ALA mutation leads to a slight reduction in hydrophobia in the affected domain, without any consequences for the flexibility of the molecule. DISCUSSION In terms of diagnosis, all the regions examined diagnosed the same viral species, Polio 3. Subspecies definition was only possible by examination of the comparative molecular data obtained from the
polio'virus 3 leon 12 mlb
N
regions coding the capside proteins. It is difficult to predict which structural changes these mutations may have caused in the general make-up of the viral capside, which contains 60 protein sub-units. Although they may be only slight, as the heat resistance data imply, they cannot be ignored. The extreme genetic instability of polio viruses is well known when attenuated for use as oral vaccines. In fact, a few days after vaccination, they tend to revert spontaneously in the h u m a n intestine, through an
smnpk
mu'-~
5°
VP3
Ill
Fig. 4. Analysis of the flexibility of the VP3 chain. The arrow indicates the domain where mutation has caused the bending of the molecule. As the greater density of the circles indicates, this area is highly flexible.
3130
M. Muscillo et al.
on-going development process. There is ample documentation of the neuropathogenic potential of reverting vaccines in position 480 (Kawakura et al., 1989), and 6203 (Furione et al., 1993) of Poliovirus 1 and positions 472 and 2034 of Poliovirus 3 (Evans et al., 1985; Westrop et al., 1989). Poliovirus 3 surveillance studies in the U.K. (Evans et al., 1985) and U.S.A. (Tatem et al., 1991) on the viruses excreted by healthy persons vaccinated with attenuated live poliovirus have shown that position 472 reverted by uracile to o-cytosine is almost the norm, and that this corresponds to the nucleotide generally found in new neurovirulent strains. In recent epidemics in Finland (Oostvogel et al., 1994) and Holland (Van der Avoort et al., 1995), it was found that the strains responsible had been in circulation for many years and that strains of poliovirus 3 had been isolated from domestic waste water and river water some time before the outbreaks of the epidemics (Van der Avoort et al., 1995). It is not necessarily alarming to find even partially mutated vaccine strains in environmental samples. The risk of infection depends on the level of the host's immune defences. The presence of such strains is, however, interesting in terms of the epidemiological monitoring of poliovirus in the environment, and, moreover, gives an indication of the level of viral contamination of the environment examined.
REFERENCES
Alvarez A., Buttner M. P. and Stetzenbach L. (1995) PCR for bioaerosol monitoring: sensitivity and environmental interference. Appl. Environ. Microbiol. 61, 3639-3644. Calisher C. H., Horzincek M. C., Mayo M. A,, Ackermann H. W. and Maniloff J. (1995) Sequence analyses and a unifying system of virus taxonomy: consensus via consent. Arch. Virol. 140, 2093-2099. Carducci A., Arrighi S. and Ruschi (1995) Detection of coliphages and enteroviruses in sewage and aerosol from an activated sludge treatment plant. Lett. Appl. Microbiol. 21, 207-209. Diedrich S., Driesel G. and Schreier E. (1995) Sequence comparison of echovirus type 30 isolates to other enteroviruses in the 5' noncoding region. J. Med. Virol. 46, 148-152. Dougherty R. M. (1984) Animal virus titration techniques. In Technique in Experimental Virology (Edited by Harris R. G. C.), pp. 169-223. Academic Press, London. Drebot M. A., Nguan C. Y., Campbell J. J., Lee S. H. S. and Forward K. R. (1994) Molecular epidemiology of enterovirus outbreaks in Canada during 1991-1992. Identification of echovirusis 30 and coxsackievirus B1 strains by amplicon sequencing. J. Med. Virol. 44, 340-347. Evans D. M. A., Dunn G., Minor P. D., Schild G. C., Cann A. J., Stanway G., Almond J. W., Currey K. and Maizel J. V. (1985) A single nucleotide change in the 5' non-coding region of the genome of the Sabin type 3 poliovaeeine is associated with increased neurovirulenee. Nature (Lond.) 314, 548-550. Fannin K. F., Vana S. T. and Jakubowski W. (1985) Effect of activated sludge wastewater treatment plant on ambient air densities of aerosols containing bacteria and viruses. Appl. Environ. Microbiol. 49, 1191-1196.
Fattal B., Margalith M., Shuval H. I., Wax Y. and Morag A. (1987) Viral antibodies in agricultural populations exposed to aerosols from wastewater irrigation during a viral disease outbreak. Am. J. Epidemiol. 125, 899906. Furione M., Guillot S., Otelea D., Balanant J., Candrea A. and Crainic R. 0993) Polioviruses with natural recombinant genomes isolated from vaccine-associated paralytic poliomyelitis. Virology 196, 199-208. Hopp T. P. and Woods K. R. (1981) Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. U.S.A. 78, 3824-3828. Kawakura N., Kohara M., Abe S., Komatsu T., Tago K., Arita M. and Nomoto A. (1989) Determinants in the 5' noncoding region of poliovirus sabin 1 RNA that influence the attenuation phenotype. J. Virol. 63, 1302-1309. L6pine P. and Maurice J. (1964) La poliomyelite. In Techniques de Laboratoire en Virologic Humaine (Edited by L6pine P.), pp. 463-515. Masson, Paris. Metcalf T. G., Melnick J. L. and Estes M. K. (1995) Environmental virology: from detection of virus in sewage and water by isolation to identification by molecular biology--A trip of over 50 years. Annu. Rev. Microbiol. 49, 461-487. Minor P. D., Dunn G., Evans D. M. A., Magrath D. I., John A., Howlett J., Phillips A., Westrop G., Wareham K., Almond J. W. and Hogle J. M. (1989) The temperature-sensitivity of the Sabin type 3 vaccine strain of poliovirus: Molecular and structural effects of a mutation in the capside protein VP3. J. Virol. 70, 111%1123. Moore B. E., Sagik B. P. and Sorber C. A. (1979) Procedure for the recovery of the airborne human enteric viruses during spray irrigation of treated wastewater, Appl. Environ. Microbiol. 38, 688-693. Muscillo M. and La Rosa G. (1994) Detection of enteroviruses in cellular lysates by RT-PCR: differentiation between poliovirus and nonpolioviruses. L'Igiene Moderna. 103, 223-236. Muscillo M., La Rosa G., Aulicino F. A., Orsini P., Bellucci C. and Micarelli R. (1995) Comparison of eDNA probe hybridizations and RT-PCR detection methods for the identification and differentiation of enteroviruses isolated from sea water samples. Wat. Res. 29, 13091316. Oostvogel P. M., Van Wijngaarden J. K., Van Der Avoort H. G. A. M., Conyn-Van, Spaendonck M. A. E., Rumke H. C., Van Steenis G. and Van Loon A. M. (1994) Poliomyelitis outbreak in an unvaccinated community in the Netherlands, 1992-93. Lancet 344, 665-670. Pfirrmann A. and Bossche G. V. (1994) Occurrence and isolation of airborne human enteroviruses from waste disposal and utilization plants. Zbl. Hyg. 196, 38-51. P6yry T., Kinnunen, Kapsenberg J., Kew O. and Bovi T. (1990) Type 3 poliovirus/finland/1984 is genetically related to common Mediterranean strains. J. Gen. Virol. 71, 2535-2541. Rotbart H. A. (1990) Enzymatic RNA amplification of the enteroviruses. J. Clin. Microbiol. 28, 438-442. Stanway G. (1990) Structure, function and evolution of picornaviruses. J. Gen. Virol. 71, 2483-2501. Tatem J. M., Weeks-Levy C., Mento S. J., DiMichele S. J., Georgiu A., Waterfield W. F., Sheip B., Costalas C., Davies T., Ritchey M. B. and Cano F. R. (1991) Oral poliovirus vaccine in the United States: Molecular characterization of Sabin type 3 after replication in the gut of vaccinees. J. Med. Virol. 35, 101-109. Teltsch B., Kedmi S., Bonnet L., Borenzstajn-Rotem Y. and Katzenelson E. (1980) Isolation and identification of pathogenic microorganisms at wastewater-irrigated fields: ratios in air and wastewater. Appl. Environ. Microbiol. 39, 1183-1190.
Viruses in an aerosol Van der Avoort H. (3. A. M., Reimerink J. H. J., Ras A., Mulders M. N. and Van Loon A. M. (1995) Isolation of epidemic polioviru:~ from sewage during the 1992-3 type 3 outbreak in the Netherlands. Epidemiol. Infect. 114, 481~191.
3131
Westrop G. D., Wareham K. A., Evans D. M. A., Dunn G., Minor P. D., Magrath D. I., Tails F., Marsden S., Skinner M. A., Sehild G. C. and Almond J. W. (1989) Genetic basis of attenuation of the Sabin Type 3 Oral poliovirus Vaccine. J. Virol. 63, 1388-1344.
Wat. Res. Vol. 31, No. 12, pp. 3125-3131, 1997 © 1997ElsevierScienceLtd. All fights reserved Printed in Great Britain 0043-1354/97$17.00+ 0.00
M O L E C U L A R ANALYSIS OF P O L I O V I R U S 3 ISOLATED F R O M A N A E R O S O L G E N E R A T E D BY A WASTE W A T E R TREATMENT PLANT MICHELE MUSCILLO @l*, GIUSEPPINA LA ROSA t, ANNALAURA CARDUCCI @2, LAURA CANTIANF and CINZIA MARIANELLP ~Department of Environmental Hygiene, Istituto Superiore di Sanita', Rome, Italy and 2HygieneSection of the Biomedicine Department, University of Pisa, Italy (Received June 1996; accepted in revised form April 1997) Abstract--We examined three samples of lysates from cell cultures that had previously been infected by the aerosol generated by a waste water treatment plant near Pisa. We first attempted to confirm that we were dealing with one of the enterovirus family, using an inversePCR analysis of the RNA extracted from the cell lysates. This identified a single genome sequences in all the samples, which corresponded to poliovirus 3. Sequence analyses revealed that the genotyping of poliovirus 3 was accurate for the species, irrespective of the genomic region sequenced. Subspecies genotyping is only possible for the translated region, and in this case, it identified the Poliovirus type 3 Leon 12alb strain as ancestor of the virus isolated. Molecular analyses were then carried out on the wild virus in the regions VP2 (9623 bp), VP3 (922bp) and VPI (l128bp) and found various nucleotide mutations (e.g. 472T~C; 970C~C.Cys,S,; ! 3196~r,Val.t,,u; 1743r~c.Va~A~a;1817C~X.Hys~ryr).Thermosensitivitytests at 34°C and 44°C showed a slight reversion to the heat resistant phenotype. The need for adequate protective measures for plant staff, together with the frequent use of treated water for irrigation, means that effectivemethods of aerosol borne pathogen detection and risk determination must be adopted. © 1997 Elsevier Science Ltd. Key words--polymerase chain reaction, viruses, poliovirus 3, sewage, aerosol, nucleotide-sequence,health
IINTRODUCTION The micro-organisms in the aerosols from waste water treatment processes or the use of treated water for agricultural irrigation (Teltsch et al., 1980) are a potential danger to human health (Alvarez et al., 1995). Aerosols axe, indeed, together with recreational and drinking water and food, one of the means of enteric virus transmission in humans. Various authors have reported the isolation of enteric viruses from the aerosols produced by a sludge treatment plant (Fannin et al., 1985; Fattal et al., 1987; Pfirrmann and Bossche, 1994; Alvarez et al., 1995). We conducted a molecular characterisation of the viral strains isolated from viral particle containing lysates obtained from the aerosol of a waste water treatment plant on the outskirts of Pisa, Italy (Carducci et al., 1995). On the basis of genetic differences, it is possible to establish new taxonomic (Stanway, 1990) and epidemiological (Drebot et al., 1994; Calisher et al., 1995) standards for the surveillance of the environmental diffusion of viruses that are dangerous to human health. PCR techniques are being more widely employed in environmental
*Author to whom correspondence should be addressed. [Tel: (+39) 6 49902718; Fax: (+39) 6 4938703; e-mail: [email protected]].
fields as a result of their promising speed and sensitivity (Metcalf et al., 1995). These techniques, followed by the nucleotide sequencing of the amplicon, permit the identification of the genus, the species and sometimes even the strain of the virus. The rapidity of the evolution of the regions of a viral genome may lead to diverging results, depending on the region chosen for analysis. The extremely heterogeneous nature of the enteroviruses calls for the use of groups specifc techniques, as a result of the presence in the non-translated enteroviral 5' region (5NC) of segments containing highly conserved sequences (Diedrich et al., 1995; Rotbart, 1990). Analysing the molecular sequences of this region does not give good molecular taxonomy results for the greater part of the non-polioviruses, but is quite accurate for Poliovirus 1, 2 and 3. This paper has two main objectives: (a) to compare the results obtained using the sequences of various regions to see how far an analysis of a short sequence from the non-translated 5' region may be diagnostically useful, and (b) to analyse the significance of the different secondary structure mutations of the structural proteins and consider the relationship of these mutations with the biological characteristics of the viruses in relation to heat. The risk to human health from enteric viruses bearing aerosols in the environment is evaluated in the discussion section.
3125
3126
M. Muscillo et al. Table 1. Primer used for Poliovirus 3 amplification. The restriction site of each sequence is indicated
Region 5' no coding t (5NC) (length of the predicted fragment = 168 bp) - EV B-436 (436-465): BPV445 TTGA G G A T C C TCCGGCCCCTGAATGCG + EV H-603 (577~fi03) ATCT A A G C T T GTCACCATAAGCAGCC
Ref: Muscillo et al., 1995 Ref: Muscillo et al., 1995
Region VP3-VPI (length of the predicted fragment = 1128 bp) + VP1 - PV3 - B2361 (2361-2392) 5'-TGCCA GGATCC ACCCCTAAGAGTATGAGCATG 3'
Ref: Muscillo et al., 1994
- VPI - PV3.H3488 (3466-3488) 5'-TCTCTATTC CACATG A A G C T T ACAG-3' Region VP3 (length of the predicted fragment = 922 bp) + VP3 - PV3 - B1649 (1649-1749) 5'-TCACCGCT GGATCC TGCTCAAGATTCATCAG- VP3 - PV3 - H2570 (2541-2570) 5"-CACTGGCCTTAGTATCAGGT AAGCTT TCCT-3' Region VP2 (length of the predicted fragment = 962 bp) + VP2 - PV3 - B869 (869 895) 5'-AAACAAGATTACTCACA GGATCC ATCA- VP2 - PV3 - H1830 (1800-1830) 5'-ATGGTGATTG AAGCI'T GTCTGACGTCAGGTThe primers are indicated above ( + ) and below ( - ) the target. All primers, except those indicated in the references, are original. The selection criteria for the primer sequences take account of the need for as little change as possible in the primer sequences in correspondence to the purposely created restriction sites.
A : p e l i o 3 12 a l b ( v a c c i m strain) -1 0 +1 ,!I~ 1.
1
*****S
2 3
P N*****
B : sample -1 !. - - t
1
*****S
2
P
6
4 $ 6
7~
7 ~
8 9
8 9
10 11 12
10 11 12
5
R*****
!259 260
T~ *F N*
262
0
+1 - - 1 - -
I~*** R*****
!
!259 260
!~
!
*F N*
262
263 264 265 m266 267 268
269+ 271 272
265
~
267
268 K *F ***Q
269+ 270 271
K *F ***Q
Fig. 1. C o m p a r i s o n of the h y d r o p a t h i c profile averages o f the VP2 region, m a d e up o f 271 a m i n o acids. The n u m b e r i n g on the left is the position o f the acid in the VP2 protein. H y d r o p h o b i a is indicated by a negative value on the left ( - 1 ) a n d h y d r o p h i l i a by a positive value on the right ( + 1). Only the m o s t affected a m i n o acid is s h o w n (indicated with --.). The d o m a i n affected by m u t a t i o n is s h o w n with an ellipse. Left or right shifting of the ellipse indicates the c h a n g i n g p o l a r i t y of the d o m a i n as a results o f a m i n o acid m u t a t i o n .
Viruses in an aerosol
A t pdlo3 l ~ t l b (vaednestmin) -1 0 +1 [.I-!. . . . . . . 12 **********Q 13 **********Y
3127
-1 - - ! 12 13 14
0 !-**********Q
+1 I.
**********Y ******L
15 16
16
17
17
18 19
18
21 22 23 24 25
********C ****A
****I
23 24 25
********C
****A ****I
Fig. 2. Comparison of the hydropathic profile averages of the VP3 region, made up of 238 amino acids. MATERIALS AND METHODS
Biological materials Wild viruses from a lab collection were used for this study. In a previous work (Carducci et al., 1995), qualitative virological analyses were carried out on 24 sewage (100 ml sample -~) and 24 air samples (0.9 m 3 sample-t), which were collected contemporaneously (in pairs) twice monthly from May 1992 to April 1993 from a waste water treatment plant serving a community of 300,000 inhabitants on the outskirts of Pisa, having a throughput of 500 m 3 h-~. Samples were collected from sewage at the inflow of the aeration tank and contemporaneously from the air in their proximity. Basically, sewage ancL aerosol samples were processed and inoculated into buffalo green monkey (BGM) kidney cell monolayers to evidem:e a cytopathic effect. Fourteen sewage samples (58%), collected from June 1992 to January 1993, and six aerosol samples (25%), collected from August to November 1992, gaw~ positive results for enteroviruses as deduced by indirect immunofluorescence. Three of the latter were further identified as poliovirus type 3 by RT-PCR and nucleotide sequencing in the 5' region (data not shown) following the procedure described further in the text. Consequently, as it was assumed that the three samples contained the same virus strain, only one of them was further characterized and is described in this paper. Temperature sensitivi~ T This was assayed (L6pine and Maurice, 1964) by infecting BGM cells at differerLt temperatures using the sample with a Poliovirus 3 Sabin and a wild poliovirus 3 as controls. Two series of four tubes were inoculated with scalar dilutions of each virus, and then incubated at 34°C and 44°C. The viruses assayed here were defined as temperature sensitive (ts +) by comparative evolution of the growth, at the two
temperatures used, of the sample and the controls. The TCIDs0 was calculated according to K,~irber (Dougherty, 1984).
Viral RNA preparation The R N A was extracted directly from the cell lysates obtained, freezing and thawing cells from the cultures after the fourth step of the treatment. The nucleic acids were extracted from 0.45 ml o f lysate using one proteinase K/phenol/isopropanole extraction cycle (Muscillo et al., 1995). They were then dissolved once more in 20/~1 of di-ethyl-pyrocarbonate at 0.1%; 0.2-1/~1 o f this mixture was then used for PCR analysis. Primers and PCR The oligonucleotides used as PCR primer were synthesized using a 392DNA/RNA Synthesizer (Applied Biosystems, Perkin Elmer Corporation). Working solutions were prepared for PCR in water at a concentration o f 22 pmol /zl-~; 1/~1 of the solution was used for the PCR analysis. The transcription and amplification reactions were carried out as previously described (Muscillo et al., 1995). The preparation of the master mix and amplificate handling were carried out in two separate environments. Forty microlitres of the raw amplification mixture were purified on agarose gel. The amplicons extracted from the gel were digested with BamHI and HindlII (Boehringer Mannheim) and then cloned in plasmidic vector pGEM-4z. For each transformation, 10 miniprep and at least two clones were analysed, with the size predicted (Table I), were sequenced in both directions. The sequences in the capside regions were contiguous and could be partially superimposed to check whether they belonged to the same viral strain as the selected clones. Sequencing was carded out labelling the primer with
Table 2. Results of the comparative sequence analysis obtained with the FASTA programme in the GCG packet ver. 8 (University of Wisconsin, Genetic Computer Group) $ 467 CTAAT T CTAACCATGGAGCAGGCAGCTGCAACCCAGCAGCCAGCCTGTCG 516 Polio3 12alb 1 CTAAT C CTAACCATGGAGCAGGCAGCTGCAACCCAGCAGCCAGCCTGTCG 50 sample 517 TAACGCGCAAGTCCGTGGCGGAACCGACTACTTTGGGTGTCCGTGTTTCC 566 51 TAACGCGCAAGTCCGTGGCGGAACCGACTAC '1T+]GGGTGTCCGTGTTTCC 100 567 I T l-I A'['TCTTGAA 579 IOl ITITA'['TCTTGAA 113 The alignments obtain from a site by site comparison of the sequences and the references in the EMBL and GenBank databases showed that 100% pairing is obtained with the P3/Leon/37 and P3/119 polio viruses. The table shows a comparison with the vaccine form of Poliovirus 3 (P3 12alb). The presence of a C in 472 indicates the spontaneous tendency of the vaccine strains to revert to neurovirulent strains.
3128
M. Muscillo et al.
Table 3. All mutations, both synonymous and synonymous, obtained with FASTA considered, taking the vaccine strain P3 12 alb as the ancestral strain (Accession No. X00925) Changing of hydropathicity Percentage of Type of Region Range identitywith the Codons Aminoacids. region limits sequenced ancestor Mutations affected mutated Hydropathicity Hydrophilia 5NC 1-743 467-579 99. l 472 T--*C . . . . VP2 950-1762 898-1796 99.5 970 GoC TGT~TCT Cys~Ser < + 1319 G--*T GTG--,TTG Val--,Leu = 1405 A~G AGG~GGG Gly--*Gly = = 1743 T~C GTG--*GCG Val~Ala < + VP3 1763-2476 1677-2540 99.7 1810 A~G TCA--*TCG Ser--*Ser = = 1817 C---,T CAC---,TAC Hys--,Tyr + < 2191 C--*T ACC~ACT Thr~Thr = = VPI 2477-7360 2393-3464 99.8 2931 T--*C GTG---,GCG Val--*Ala ~< = 3394 T--*C AAT~AAC Asn~Asn = = The tract examined does not, of course, include the part relating to the primer sequences. The numbering of the nucleotidemutations refers to the genomic position, whereas that of the amino acids (aa) refers to their position in the single proteins.
[~t33P]-dATP (DuPont, De Nemours), using T7 sequencing kits (Pharmacia-LKB) and a standard sequencing gel made of 6% polyacrylamide in 8M urea. The run was made at 55°C for 3 h. The compressed sequences were resolved with T7 sequencing deaza G/A kits.
amplicon sequences obtained by the routine amplification reaction of 5NC (Table 2), showed that the same viral isolate was present in the three samples. Sequence analysis in the translated regions (Table 3) gave concordant results, identifying poliovirus 3 Leon Software and computers 12alb as the ancestor of the strain isolated. The strain Sequence analysis and database searches were carried out using IG software (Intelligenetics Inc., Mountain View, CA) that we isolated had only one of the two molecular on a Sun Sparc-classic Workstation connected via the markers indicating neurovirulence, that in position Internet to a Sun Sparc-10 Server at the Virology 472, which consists of a cytosine (C) instead of a Laboratory of our Institute, and using GCG ver. 8 uracile (in c D N A , this becomes T), i.e. the basis of the programmes (University of Wisconsin, Genetic Computer Sabin phenotype (Minor et al., 1989) (cytosine in Group), part of a service offered by a Alpha server virulent strains). Similarly, in B G M cells, the growth Digital Equipment Model 2100 4/275, present at the Italian National node of EMBNET, in the Bari of the environmental virus (Table 4) was strongly research area of the Consiglio Nazionale delle Richerche affected by temperature, whereas P3/Sabin titre ([email protected]). The VP2 and VP3 protein sec- dropped dramatically and wild P3 only slightly. ondary structure flexibility diagrams were obtained as Postscript files from the Peptidestructure and Plotstructure Although none of the mutations found in three regions examined corresponds to those identified in programs of the GCG package and were then transformed into bitmaps using the XV program (John Bradley, the antigenic regions of the Mediterranean variants [email protected]). The images were then manipulated (P6yry et al., 1990) isolated in epidemic centres using Paint and Harvard Graphics running under Windows ° between 1970 and the present day, the possibility 95. The hydropathic profile in Figs 1 and 2 was obtained using the PEP programme in the IG package, following the cannot be excluded that they may contribute to the partial heat resistance of the environmental isolates. procedure of Hopp and Woods (1981). Analysis of the hydrophobic/hydrophilic profiles of RESULTS the amino acid sequences (various authors), deduced from nucleotide sequences, shows different variants in The presence of restriction sites (Table 1) in the different regions. For VP2 (271 residues), the two primer sequence used for this study proved most domains affected by the 7cys~S~r and 265va~Ala useful, in that, although in no way reducing the mutations (Fig. 2) tend to increase the hydrophilic specificity and sensitivity of the reaction, they nature of the chain, without affecting the flexibility of produced amplicons at the 5' and 3' ends, which were the polypeptide chain (Fig. 3). Interesting changes are predisposed to digestion by the restriction enzymes found in the hydrophobic profiles of the VP3 regions BamHI and HindlII, greatly facilitating directional (Fig. 4). The domain affected by mutations, 19Hys~Tyr, cloning in the plasmidic vector pGEM-4z. inverts its polarity, with considerable loss of No analogous restriction sites were found in the hydrophilic quality and an increase in local amplicons, and the cloning operations were thus able hydrophobia, which does not, however, affect the to provide complete insertions. Analysis of the position of the minimum (residue 119) and maximum (residue 145) values calculated in a window of 6 Table 4. Temperature sensitivity: effect of log~0 titre and the temperature sensitivityof severalstrains of Poliovirus3 in BGM cells residues. This mutation significantly affects the at two temperatures flexibility of the molecule, which covers one rotation more (Fig. 5, indicated by an arrow) in the vicinity Virus 34°C 44°C of the mutation, with a consequent drastic change in Sample 6.50 1.50 Poliovirus 3 vaccine strain 4.50 0 its primary structure. In the VP1 region, in the 300 Poliovirus 3 wild 6.50 3.50 amino acids that precede the P2-3b region, the
Viruses in an aerosol
mn
i~unple
3129
12 alb
poliovirm $ ~
VP2
HOOC
I
Fig. 3. Analysis of the flexibility of the VP2 protein sub-unit, the structures of vaccinal poliovirus and of that isolated from the environmental samples. The arrows indicate the positions of the two mutations. The numbering refers to the polypeptide chain residues. The circles on the chain indicate the domains where it is most flexible.
152VaI.ALA mutation leads to a slight reduction in hydrophobia in the affected domain, without any consequences for the flexibility of the molecule. DISCUSSION In terms of diagnosis, all the regions examined diagnosed the same viral species, Polio 3. Subspecies definition was only possible by examination of the comparative molecular data obtained from the
polio'virus 3 leon 12 mlb
N
regions coding the capside proteins. It is difficult to predict which structural changes these mutations may have caused in the general make-up of the viral capside, which contains 60 protein sub-units. Although they may be only slight, as the heat resistance data imply, they cannot be ignored. The extreme genetic instability of polio viruses is well known when attenuated for use as oral vaccines. In fact, a few days after vaccination, they tend to revert spontaneously in the h u m a n intestine, through an
smnpk
mu'-~
5°
VP3
Ill
Fig. 4. Analysis of the flexibility of the VP3 chain. The arrow indicates the domain where mutation has caused the bending of the molecule. As the greater density of the circles indicates, this area is highly flexible.
3130
M. Muscillo et al.
on-going development process. There is ample documentation of the neuropathogenic potential of reverting vaccines in position 480 (Kawakura et al., 1989), and 6203 (Furione et al., 1993) of Poliovirus 1 and positions 472 and 2034 of Poliovirus 3 (Evans et al., 1985; Westrop et al., 1989). Poliovirus 3 surveillance studies in the U.K. (Evans et al., 1985) and U.S.A. (Tatem et al., 1991) on the viruses excreted by healthy persons vaccinated with attenuated live poliovirus have shown that position 472 reverted by uracile to o-cytosine is almost the norm, and that this corresponds to the nucleotide generally found in new neurovirulent strains. In recent epidemics in Finland (Oostvogel et al., 1994) and Holland (Van der Avoort et al., 1995), it was found that the strains responsible had been in circulation for many years and that strains of poliovirus 3 had been isolated from domestic waste water and river water some time before the outbreaks of the epidemics (Van der Avoort et al., 1995). It is not necessarily alarming to find even partially mutated vaccine strains in environmental samples. The risk of infection depends on the level of the host's immune defences. The presence of such strains is, however, interesting in terms of the epidemiological monitoring of poliovirus in the environment, and, moreover, gives an indication of the level of viral contamination of the environment examined.
REFERENCES
Alvarez A., Buttner M. P. and Stetzenbach L. (1995) PCR for bioaerosol monitoring: sensitivity and environmental interference. Appl. Environ. Microbiol. 61, 3639-3644. Calisher C. H., Horzincek M. C., Mayo M. A,, Ackermann H. W. and Maniloff J. (1995) Sequence analyses and a unifying system of virus taxonomy: consensus via consent. Arch. Virol. 140, 2093-2099. Carducci A., Arrighi S. and Ruschi (1995) Detection of coliphages and enteroviruses in sewage and aerosol from an activated sludge treatment plant. Lett. Appl. Microbiol. 21, 207-209. Diedrich S., Driesel G. and Schreier E. (1995) Sequence comparison of echovirus type 30 isolates to other enteroviruses in the 5' noncoding region. J. Med. Virol. 46, 148-152. Dougherty R. M. (1984) Animal virus titration techniques. In Technique in Experimental Virology (Edited by Harris R. G. C.), pp. 169-223. Academic Press, London. Drebot M. A., Nguan C. Y., Campbell J. J., Lee S. H. S. and Forward K. R. (1994) Molecular epidemiology of enterovirus outbreaks in Canada during 1991-1992. Identification of echovirusis 30 and coxsackievirus B1 strains by amplicon sequencing. J. Med. Virol. 44, 340-347. Evans D. M. A., Dunn G., Minor P. D., Schild G. C., Cann A. J., Stanway G., Almond J. W., Currey K. and Maizel J. V. (1985) A single nucleotide change in the 5' non-coding region of the genome of the Sabin type 3 poliovaeeine is associated with increased neurovirulenee. Nature (Lond.) 314, 548-550. Fannin K. F., Vana S. T. and Jakubowski W. (1985) Effect of activated sludge wastewater treatment plant on ambient air densities of aerosols containing bacteria and viruses. Appl. Environ. Microbiol. 49, 1191-1196.
Fattal B., Margalith M., Shuval H. I., Wax Y. and Morag A. (1987) Viral antibodies in agricultural populations exposed to aerosols from wastewater irrigation during a viral disease outbreak. Am. J. Epidemiol. 125, 899906. Furione M., Guillot S., Otelea D., Balanant J., Candrea A. and Crainic R. 0993) Polioviruses with natural recombinant genomes isolated from vaccine-associated paralytic poliomyelitis. Virology 196, 199-208. Hopp T. P. and Woods K. R. (1981) Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. U.S.A. 78, 3824-3828. Kawakura N., Kohara M., Abe S., Komatsu T., Tago K., Arita M. and Nomoto A. (1989) Determinants in the 5' noncoding region of poliovirus sabin 1 RNA that influence the attenuation phenotype. J. Virol. 63, 1302-1309. L6pine P. and Maurice J. (1964) La poliomyelite. In Techniques de Laboratoire en Virologic Humaine (Edited by L6pine P.), pp. 463-515. Masson, Paris. Metcalf T. G., Melnick J. L. and Estes M. K. (1995) Environmental virology: from detection of virus in sewage and water by isolation to identification by molecular biology--A trip of over 50 years. Annu. Rev. Microbiol. 49, 461-487. Minor P. D., Dunn G., Evans D. M. A., Magrath D. I., John A., Howlett J., Phillips A., Westrop G., Wareham K., Almond J. W. and Hogle J. M. (1989) The temperature-sensitivity of the Sabin type 3 vaccine strain of poliovirus: Molecular and structural effects of a mutation in the capside protein VP3. J. Virol. 70, 111%1123. Moore B. E., Sagik B. P. and Sorber C. A. (1979) Procedure for the recovery of the airborne human enteric viruses during spray irrigation of treated wastewater, Appl. Environ. Microbiol. 38, 688-693. Muscillo M. and La Rosa G. (1994) Detection of enteroviruses in cellular lysates by RT-PCR: differentiation between poliovirus and nonpolioviruses. L'Igiene Moderna. 103, 223-236. Muscillo M., La Rosa G., Aulicino F. A., Orsini P., Bellucci C. and Micarelli R. (1995) Comparison of eDNA probe hybridizations and RT-PCR detection methods for the identification and differentiation of enteroviruses isolated from sea water samples. Wat. Res. 29, 13091316. Oostvogel P. M., Van Wijngaarden J. K., Van Der Avoort H. G. A. M., Conyn-Van, Spaendonck M. A. E., Rumke H. C., Van Steenis G. and Van Loon A. M. (1994) Poliomyelitis outbreak in an unvaccinated community in the Netherlands, 1992-93. Lancet 344, 665-670. Pfirrmann A. and Bossche G. V. (1994) Occurrence and isolation of airborne human enteroviruses from waste disposal and utilization plants. Zbl. Hyg. 196, 38-51. P6yry T., Kinnunen, Kapsenberg J., Kew O. and Bovi T. (1990) Type 3 poliovirus/finland/1984 is genetically related to common Mediterranean strains. J. Gen. Virol. 71, 2535-2541. Rotbart H. A. (1990) Enzymatic RNA amplification of the enteroviruses. J. Clin. Microbiol. 28, 438-442. Stanway G. (1990) Structure, function and evolution of picornaviruses. J. Gen. Virol. 71, 2483-2501. Tatem J. M., Weeks-Levy C., Mento S. J., DiMichele S. J., Georgiu A., Waterfield W. F., Sheip B., Costalas C., Davies T., Ritchey M. B. and Cano F. R. (1991) Oral poliovirus vaccine in the United States: Molecular characterization of Sabin type 3 after replication in the gut of vaccinees. J. Med. Virol. 35, 101-109. Teltsch B., Kedmi S., Bonnet L., Borenzstajn-Rotem Y. and Katzenelson E. (1980) Isolation and identification of pathogenic microorganisms at wastewater-irrigated fields: ratios in air and wastewater. Appl. Environ. Microbiol. 39, 1183-1190.
Viruses in an aerosol Van der Avoort H. (3. A. M., Reimerink J. H. J., Ras A., Mulders M. N. and Van Loon A. M. (1995) Isolation of epidemic polioviru:~ from sewage during the 1992-3 type 3 outbreak in the Netherlands. Epidemiol. Infect. 114, 481~191.
3131
Westrop G. D., Wareham K. A., Evans D. M. A., Dunn G., Minor P. D., Magrath D. I., Tails F., Marsden S., Skinner M. A., Sehild G. C. and Almond J. W. (1989) Genetic basis of attenuation of the Sabin Type 3 Oral poliovirus Vaccine. J. Virol. 63, 1388-1344.