- Email: [email protected]
Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing
Clinica Chimica Acta 423 (2013) 35–38
Contents lists available at SciVerse ScienceDirect
Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim
Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing☆,☆☆ Wan-Jin Chen a, b,⁎, Qi-Fang Lin a, Qi-Jie Zhang a, Jin He a, Xin-Yi Liu a, Min-Ting Lin a, Shen-Xing Murong a, Chia-Wei Liou c, Ning Wang a, b a b c
Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian, China Center of Neuroscience, Fujian Medical University Fuzhou, Fujian, China Department of Neurology, Mitochondrial Research Unit, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan
a r t i c l e
i n f o
Article history: Received 21 November 2012 Received in revised form 5 April 2013 Accepted 6 April 2013 Available online 13 April 2013 Keywords: Duchenne/Becker muscular dystrophy Dystrophin gene Genetic diagnosis Genotypephenotype Multiplex ligation-dependent probe amplification Sanger sequence
a b s t r a c t Background: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. Methods: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. Results: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype–phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. Conclusion: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Duchenne/Becker muscular dystrophy (DMD/BMD) is the most common X-linked recessive inherited neuromuscular disease, with a high frequency of 1 in 3500 boys [1]. The severe form, DMD is characterised by progressive muscle weakness, pseudo-hypertrophy in calf muscle and Gowers' sign [2]; patients are usually diagnosed at the age of 5 and die of respiratory failure or cardiomyopathy near 20 years of age [3]. With a milder manifestation and slow progression, BMD patients are capable of
☆ Author contributions: Study concept and design (Drs. W-J Chen and Wang); acquisition of data (Drs. W-J Chen, Q-F Lin, Zhang, He, Liu, M-T Lin, Murong, Liou and Wang); analysis and interpretation of data (Drs. W-J Chen, Q-F Lin, Zhang, He, Liu and Wang); drafting of the manuscript (Drs.W-J Chen, Q-F Lin and Zhang); obtaining of funding (Drs. W-J Chen and Wang); administrative, technical, or material support (Drs. W-J Chen, Q-F Lin, Zhang, He, Liu and Wang); study supervision (Dr. Chen). ☆☆ Disclosure: The authors report no conflicts of interest. ⁎ Corresponding author at: Department of Neurology, First Affiliated Hospital, Fujian Medical University, 20 Chazhong Road, Fuzhou 350005, China. Tel.: +86 591 87982772; fax: +86 591 83375472. E-mail address: [email protected] (W.-J. Chen). 0009-8981/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.cca.2013.04.006
walking independently at 12 years of age and have a normal life expectancy [4]. The disease-causing gene, dystrophin, which is located in Xq21 with 79 exons, encodes a membrane protein called dystrophin [5]. Mutations in this gene are responsible for the differences between DMD and BMD. When a frame shift mutation occurs and produces a non-functional protein, the patients suffer from DMD; in contrast, when the reading frame is maintained and encodes a partially functional protein, the patients will show the milder clinical symptoms of BMD [6]. Based on this reading-frame rule, restoration of the open reading frame (ORF) using a morpholino oligomer is a major strategy to treat DMD patients now [7]. Although multiplex PCR has been widely used in genetic diagnosis of DMD/BMD, it is time-consuming and difficult to cover all of the exons. In addition, approximately 10% patients with duplication mutations will be misdiagnosed [8]. In 2002, multiplex ligation-dependent probe amplification (MLPA), was invented by Schouten [9], which possesses the capacity to quantify all 79 exons in only 2 reactions and facilitates the diagnosis of DMD/BMD. Interestingly, for certain subtle mutations at the probe ligation site, failure probe hybridisation
36
W.-J. Chen et al. / Clinica Chimica Acta 423 (2013) 35–38
can occur and lead to confusion with the deletion mutation, which enables MLPA to detect certain subtle mutations. Here, we screen the dystrophin gene mutations in a large cohort of 407 DMD/BMD patients in China using MLPA to explore the mutation distribution and identify a reliable genotype-phenotype correlation.
Written informed consent was obtained from every participant or their guardian, and our study was approved by the ethics committee of the First Affiliated Hospital of Fujian Medical University.
2.2. MLPA analysis 2. Materials and methods 2.1. Samples From June 1997 to June 2012, 407 patients from 166 unrelated DMD/BMD Chinese Han families were recruited. All of the patients fulfilled the DMD/BMD diagnosis criterion [10] and were further divided into 3 types based on their age of wheelchair dependency: DMD (before 12 years), IMD (13–15 years) and BMD (after 16 years) [11]. 76 mothers were enrolled for carrier screening. In addition, 20 healthy males and 20 healthy females were selected as controls for the MLPA analysis, and another 100 healthy controls (50 males and 50 females) were selected to confirm the three novel mutations that we reported in this manuscript.
MLPA was carried out using the SALSA MLPA kit P034/P035 DMD (MRC-Holland®). After denaturation, hybridisation, ligation and amplification, the products were separated using capillary electrophoresis (ABI 3130). The raw data were analysed using Genemapper 3.0 and Excel software, and the copy number was calculated according to the MLPA kit instruction (http://www.mlpa.com).
2.3. PCR and Sanger sequencing For the samples with a suspected single exon deletion, PCR and direct sequencing were employed to clarify the occurrence of subtle mutations at the probe ligation site. If the result of PCR shows no deletion,
Fig. 1. The five subtle mutations from five unrelated families confirmed by Sanger sequencing. c.7148dupT mutation in exon 49 (a, patient; b, mother) c.2071-2093del AGGGAACAGATCCTGGTAAAGCA mutation in exon 17 (c, patient; d, mother; e, father) c.8608C > T mutation in exon 58 (f, patient; g, mother) c.2302C > T mutation in exon 19 (h, patient; I, mother) c.10855C > T mutation in exon 76 (j, patient).
W.-J. Chen et al. / Clinica Chimica Acta 423 (2013) 35–38
it's reasonable to suspect the sample carry a subtle mutation, and can further be confirmed by Sanger sequencing.
Table 1 Correlation between dystrophin mutation types and disease severity. Mutation types
2.4. Data statistics The genotype–phenotype correlation was analysed by Chi-square test using SPSS 16.0. P value b0.05 (two-tailed) was considered to be statistically significant. 3. Results 3.1. Mutations of dystrophin gene Among the 407 clinically suspected DMD/BMD patients, 217 ones possessed one to eight exons deletions and 40 had duplications. Combined with PCR and Sanger sequencing, 5 patients with a copy number ratio below 0.7 carried 5 subtle mutations: c.8608C > T, c.7148dupT, c.2302C > T, c.10855C > T, c.2071-2093del AGGGAACAGATCCTGGT AAAGCA (Fig. 1); the latter three mutations were novel and not detected in 150 X chromosomes from 100 healthy controls. However, in the other 145 patients, neither deletion nor duplication mutations were detected. To identify the hot mutation regions in dystrophin, we calculated the deletion and duplication frequency for each exon. This calculation revealed that most of the deletions (43.7%) occurred in exons 45 to 52 (Fig. 2a), whereas no frequent duplication exons were found (Fig. 2b). 3.2. Results of carrier status Among the 76 mothers, 63 were the mothers of patients with exon deletions and the rest 13 were those with exon duplications. After MLPA analysis, 46 mothers possessed the same deletion (36/63) or duplication (10/13) mutations as their children; the remaining 30 mothers were normal, indicating that the de novo mutation frequency was 39.5% (30/76). 3.3. Analysis of the genotype–phenotype association All of the patients were divided into DMD, IMD and BMD to further investigate the correlation between disease severity and mutation type and extent of deletion. The results showed that ORF lost was a highly related factor to the disease severity (χ2 = 122.53, P b 0.001; Table 1).
Fig. 2. The frequency of deletion and duplication mutation for all 79 exons in dystrophin gene. The deletion mutation can occur in every exon especially in a mutation rich region from exon 45 to 52 (2a). As to duplication mutation, from exon 2 to 63 can occur without significant frequent region, but none harbors duplication mutation in exon 1, 64 to 79 in this cohort of patients (2b).
37
Frame shift mutation Non-frame shift mutation Total Deletion mutation Duplication mutation Total One exon deletion Two–three exons deletion Four–five exons deletion Six–seven exons deletion Eight exons deletion Total
Disease severity DMD
IMD
BMD
148 16 164 136 24 160 21 34 29 19 33 136
26 12 38 29 8 37 9 5 5 3 7 29
8 52 60 52 8 60 4 20 15 6 17 52
Total
χ2/P
182 80 262 217 40 257 34 59 49 28 47 217
122.53 P = 0.000
1.299 P = 0.522
1.692 P = 0.429
However, no significant differences were found in the distributions of deletion and duplication mutation among different types of patients (χ 2 = 1.299, P = 0.522; Table 1). The correlation of disease severity and the extent of deletion was not statistically remarkable as well (χ 2 = 1.692, P = 0.429; Table 1).
4. Discussion After mutation analysis of the dystrophin gene in 407 DMD/BMD children and 76 mothers, 257 of the affected patients possessed deletion/duplication mutations, with a de novo mutation frequency of 39.5% and a mutation-rich area (exon 45–52). We further investigated the relationship between phenotype severity and mutation types. Among the 262 genetically confirmed patients, the frame shift mutations were highly associated with the disease severity. It is clear that a frame shift mutation tends to profoundly change the amino acid sequence and encode a non-functional protein. Approximately 90.2% (148/164) of DMD patients and 86.7% (52/60) of BMD patients followed this reading-frame rule, which was consistent with a previous study [11], the remaining 24 patients may be attributed to alternative splicing, exon skipping or an internal promoter [12,13]. Except for frame shift mutations, deletions/duplications and the number of deleted exons did not seem to influence the progression of the disease, which is similar to the findings of Magri et al. [14]. Challenges remain in the detection of subtle mutations among the 79 exons, which are often misdiagnosed using multiple PCR or MLPA. Because they are time-consuming and cost-prohibitive, few studies on subtle mutations have been performed. In our study, the patients with a ratio below 0.7 were further screened for point mutations using PCR and Sanger sequencing, and five subtle mutations were confirmed. Among these mutations, c.8608C > T, c.2302C > T, and c.10855C > T give rise to a premature stop codon, whereas c.7148dupT and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA produce frame shift mutations. However, for the other 145 patients who did not exhibit exon deletions or duplications, subtle mutation screening is a hard procedure if it depends on direct Sanger sequencing. Fortunately, using next-generation sequencing, Xie S et al. detected a c.10141C > T mutation in a Chinese DMD pedigree [15], which offers a new promising avenue for the efficient detection of subtle mutations. In conclusion, MLPA is a fast, accurate and reliable deletion/ duplication mutation screening method for the dystrophin gene. ORF disruption is a meaningful prognostic factor for progressive muscular dystrophy. For the patients with a suspected single exon deletion, MLPA combined with Sanger sequencing offers the capability to distinguish a portion of the subtle mutations at the probe ligation site. Although considerable progress has been made in the diagnosis of DMD/BMD using MLPA, the detection of subtle mutations among the 79 exons remains a cumbersome procedure.
38
W.-J. Chen et al. / Clinica Chimica Acta 423 (2013) 35–38
Acknowledgments The authors sincerely thank the DMD/BMD families for their help and willingness to participate in this study. This work was supported by the grant 2012 J06016 from the Natural Science Foundation of Fujian Province of China, grant JA12129 from the Program for New Century Excellent Talents in Fujian Province University, a Program for clinical medical key discipline of Fujian Medical University (XK201108), a key program of scientific research of Fujian Medical University (2009D064), and a key clinical specialty discipline construction program of Fujian.
References [1] Manzur AY, Muntoni F. Diagnosis and new treatments in muscular dystrophies. Postgrad Med J 2009;85:622–30. [2] Bushby K, Finkel R, Birnkrant DJ, et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. Lancet Neurol 2010;9:77–93. [3] Essex C, Roper H. Lesson of the week: late diagnosis of Duchenne's muscular dystrophy presenting as global developmental delay. BMJ 2001;323:37–8. [4] Bushby KM, Gardner-Medwin D, Nicholson LV, et al. The clinical, genetic and dystrophin characteristics of Becker muscular dystrophy. II. Correlation of phenotype with genetic and protein abnormalities. J Neurol 1993;240:105–12. [5] Roberts RG. Dystrophin, its gene, and the dystrophinopathies. Adv Genet 1995;33: 177–231.
[6] Koenig M, Beggs AH, Moyer M, et al. The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am J Hum Genet 1989;45:498–506. [7] Kinali M, Arechavala-Gomeza V, Feng L, et al. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet Neurol 2009;8:918–28. [8] Hallwirth Pillay KD, Bill PL, Madurai S, et al. Molecular deletion patterns in Duchenne and Becker muscular dystrophy patients from KwaZulu Natal. J Neurol Sci 2007;252:1–3. [9] Schouten JP, McElgunn CJ, Waaijer R, et al. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res 2002;30:e57. [10] Emery AEH. Duchenne muscular dystrophy.New York: Oxford University Press; 1993392–8 [New York]. [11] Tuffery-Giraud S, Béroud C, Leturcq F, et al. Genotype-phenotype analysis in 2,405 patients with a dystrophinopathy using the UMD-DMD database: a model of nationwide knowledgebase. Hum Mutat 2009;30:934–45. [12] Gualandi F, Rimessi P, Trabanelli C, et al. Intronic breakpoint definition and transcription analysis in DMD/BMD patients with deletion/duplication at the 5’ mutation hot spot of the dystrophin gene. Gene 2006;370:26–33. [13] Kesari A, Pirra LN, Bremadesam L, et al. Integrated DNA, cDNA, and protein studies in Becker muscular dystrophy show high exception to the reading frame rule. Hum Mutat 2008;29:728–37. [14] Magri F, Govoni A, D'Angelo MG, et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol 2011;258: 1610–23. [15] Xie S, Lan Z, Qu N, et al. Detection of truncated dystrophin lacking the C-terminal domain in a Chinese pedigree by next-generation sequencing. Gene 2012;499: 139–42.
Contents lists available at SciVerse ScienceDirect
Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim
Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing☆,☆☆ Wan-Jin Chen a, b,⁎, Qi-Fang Lin a, Qi-Jie Zhang a, Jin He a, Xin-Yi Liu a, Min-Ting Lin a, Shen-Xing Murong a, Chia-Wei Liou c, Ning Wang a, b a b c
Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian, China Center of Neuroscience, Fujian Medical University Fuzhou, Fujian, China Department of Neurology, Mitochondrial Research Unit, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan
a r t i c l e
i n f o
Article history: Received 21 November 2012 Received in revised form 5 April 2013 Accepted 6 April 2013 Available online 13 April 2013 Keywords: Duchenne/Becker muscular dystrophy Dystrophin gene Genetic diagnosis Genotypephenotype Multiplex ligation-dependent probe amplification Sanger sequence
a b s t r a c t Background: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. Methods: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. Results: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype–phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. Conclusion: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Duchenne/Becker muscular dystrophy (DMD/BMD) is the most common X-linked recessive inherited neuromuscular disease, with a high frequency of 1 in 3500 boys [1]. The severe form, DMD is characterised by progressive muscle weakness, pseudo-hypertrophy in calf muscle and Gowers' sign [2]; patients are usually diagnosed at the age of 5 and die of respiratory failure or cardiomyopathy near 20 years of age [3]. With a milder manifestation and slow progression, BMD patients are capable of
☆ Author contributions: Study concept and design (Drs. W-J Chen and Wang); acquisition of data (Drs. W-J Chen, Q-F Lin, Zhang, He, Liu, M-T Lin, Murong, Liou and Wang); analysis and interpretation of data (Drs. W-J Chen, Q-F Lin, Zhang, He, Liu and Wang); drafting of the manuscript (Drs.W-J Chen, Q-F Lin and Zhang); obtaining of funding (Drs. W-J Chen and Wang); administrative, technical, or material support (Drs. W-J Chen, Q-F Lin, Zhang, He, Liu and Wang); study supervision (Dr. Chen). ☆☆ Disclosure: The authors report no conflicts of interest. ⁎ Corresponding author at: Department of Neurology, First Affiliated Hospital, Fujian Medical University, 20 Chazhong Road, Fuzhou 350005, China. Tel.: +86 591 87982772; fax: +86 591 83375472. E-mail address: [email protected] (W.-J. Chen). 0009-8981/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.cca.2013.04.006
walking independently at 12 years of age and have a normal life expectancy [4]. The disease-causing gene, dystrophin, which is located in Xq21 with 79 exons, encodes a membrane protein called dystrophin [5]. Mutations in this gene are responsible for the differences between DMD and BMD. When a frame shift mutation occurs and produces a non-functional protein, the patients suffer from DMD; in contrast, when the reading frame is maintained and encodes a partially functional protein, the patients will show the milder clinical symptoms of BMD [6]. Based on this reading-frame rule, restoration of the open reading frame (ORF) using a morpholino oligomer is a major strategy to treat DMD patients now [7]. Although multiplex PCR has been widely used in genetic diagnosis of DMD/BMD, it is time-consuming and difficult to cover all of the exons. In addition, approximately 10% patients with duplication mutations will be misdiagnosed [8]. In 2002, multiplex ligation-dependent probe amplification (MLPA), was invented by Schouten [9], which possesses the capacity to quantify all 79 exons in only 2 reactions and facilitates the diagnosis of DMD/BMD. Interestingly, for certain subtle mutations at the probe ligation site, failure probe hybridisation
36
W.-J. Chen et al. / Clinica Chimica Acta 423 (2013) 35–38
can occur and lead to confusion with the deletion mutation, which enables MLPA to detect certain subtle mutations. Here, we screen the dystrophin gene mutations in a large cohort of 407 DMD/BMD patients in China using MLPA to explore the mutation distribution and identify a reliable genotype-phenotype correlation.
Written informed consent was obtained from every participant or their guardian, and our study was approved by the ethics committee of the First Affiliated Hospital of Fujian Medical University.
2.2. MLPA analysis 2. Materials and methods 2.1. Samples From June 1997 to June 2012, 407 patients from 166 unrelated DMD/BMD Chinese Han families were recruited. All of the patients fulfilled the DMD/BMD diagnosis criterion [10] and were further divided into 3 types based on their age of wheelchair dependency: DMD (before 12 years), IMD (13–15 years) and BMD (after 16 years) [11]. 76 mothers were enrolled for carrier screening. In addition, 20 healthy males and 20 healthy females were selected as controls for the MLPA analysis, and another 100 healthy controls (50 males and 50 females) were selected to confirm the three novel mutations that we reported in this manuscript.
MLPA was carried out using the SALSA MLPA kit P034/P035 DMD (MRC-Holland®). After denaturation, hybridisation, ligation and amplification, the products were separated using capillary electrophoresis (ABI 3130). The raw data were analysed using Genemapper 3.0 and Excel software, and the copy number was calculated according to the MLPA kit instruction (http://www.mlpa.com).
2.3. PCR and Sanger sequencing For the samples with a suspected single exon deletion, PCR and direct sequencing were employed to clarify the occurrence of subtle mutations at the probe ligation site. If the result of PCR shows no deletion,
Fig. 1. The five subtle mutations from five unrelated families confirmed by Sanger sequencing. c.7148dupT mutation in exon 49 (a, patient; b, mother) c.2071-2093del AGGGAACAGATCCTGGTAAAGCA mutation in exon 17 (c, patient; d, mother; e, father) c.8608C > T mutation in exon 58 (f, patient; g, mother) c.2302C > T mutation in exon 19 (h, patient; I, mother) c.10855C > T mutation in exon 76 (j, patient).
W.-J. Chen et al. / Clinica Chimica Acta 423 (2013) 35–38
it's reasonable to suspect the sample carry a subtle mutation, and can further be confirmed by Sanger sequencing.
Table 1 Correlation between dystrophin mutation types and disease severity. Mutation types
2.4. Data statistics The genotype–phenotype correlation was analysed by Chi-square test using SPSS 16.0. P value b0.05 (two-tailed) was considered to be statistically significant. 3. Results 3.1. Mutations of dystrophin gene Among the 407 clinically suspected DMD/BMD patients, 217 ones possessed one to eight exons deletions and 40 had duplications. Combined with PCR and Sanger sequencing, 5 patients with a copy number ratio below 0.7 carried 5 subtle mutations: c.8608C > T, c.7148dupT, c.2302C > T, c.10855C > T, c.2071-2093del AGGGAACAGATCCTGGT AAAGCA (Fig. 1); the latter three mutations were novel and not detected in 150 X chromosomes from 100 healthy controls. However, in the other 145 patients, neither deletion nor duplication mutations were detected. To identify the hot mutation regions in dystrophin, we calculated the deletion and duplication frequency for each exon. This calculation revealed that most of the deletions (43.7%) occurred in exons 45 to 52 (Fig. 2a), whereas no frequent duplication exons were found (Fig. 2b). 3.2. Results of carrier status Among the 76 mothers, 63 were the mothers of patients with exon deletions and the rest 13 were those with exon duplications. After MLPA analysis, 46 mothers possessed the same deletion (36/63) or duplication (10/13) mutations as their children; the remaining 30 mothers were normal, indicating that the de novo mutation frequency was 39.5% (30/76). 3.3. Analysis of the genotype–phenotype association All of the patients were divided into DMD, IMD and BMD to further investigate the correlation between disease severity and mutation type and extent of deletion. The results showed that ORF lost was a highly related factor to the disease severity (χ2 = 122.53, P b 0.001; Table 1).
Fig. 2. The frequency of deletion and duplication mutation for all 79 exons in dystrophin gene. The deletion mutation can occur in every exon especially in a mutation rich region from exon 45 to 52 (2a). As to duplication mutation, from exon 2 to 63 can occur without significant frequent region, but none harbors duplication mutation in exon 1, 64 to 79 in this cohort of patients (2b).
37
Frame shift mutation Non-frame shift mutation Total Deletion mutation Duplication mutation Total One exon deletion Two–three exons deletion Four–five exons deletion Six–seven exons deletion Eight exons deletion Total
Disease severity DMD
IMD
BMD
148 16 164 136 24 160 21 34 29 19 33 136
26 12 38 29 8 37 9 5 5 3 7 29
8 52 60 52 8 60 4 20 15 6 17 52
Total
χ2/P
182 80 262 217 40 257 34 59 49 28 47 217
122.53 P = 0.000
1.299 P = 0.522
1.692 P = 0.429
However, no significant differences were found in the distributions of deletion and duplication mutation among different types of patients (χ 2 = 1.299, P = 0.522; Table 1). The correlation of disease severity and the extent of deletion was not statistically remarkable as well (χ 2 = 1.692, P = 0.429; Table 1).
4. Discussion After mutation analysis of the dystrophin gene in 407 DMD/BMD children and 76 mothers, 257 of the affected patients possessed deletion/duplication mutations, with a de novo mutation frequency of 39.5% and a mutation-rich area (exon 45–52). We further investigated the relationship between phenotype severity and mutation types. Among the 262 genetically confirmed patients, the frame shift mutations were highly associated with the disease severity. It is clear that a frame shift mutation tends to profoundly change the amino acid sequence and encode a non-functional protein. Approximately 90.2% (148/164) of DMD patients and 86.7% (52/60) of BMD patients followed this reading-frame rule, which was consistent with a previous study [11], the remaining 24 patients may be attributed to alternative splicing, exon skipping or an internal promoter [12,13]. Except for frame shift mutations, deletions/duplications and the number of deleted exons did not seem to influence the progression of the disease, which is similar to the findings of Magri et al. [14]. Challenges remain in the detection of subtle mutations among the 79 exons, which are often misdiagnosed using multiple PCR or MLPA. Because they are time-consuming and cost-prohibitive, few studies on subtle mutations have been performed. In our study, the patients with a ratio below 0.7 were further screened for point mutations using PCR and Sanger sequencing, and five subtle mutations were confirmed. Among these mutations, c.8608C > T, c.2302C > T, and c.10855C > T give rise to a premature stop codon, whereas c.7148dupT and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA produce frame shift mutations. However, for the other 145 patients who did not exhibit exon deletions or duplications, subtle mutation screening is a hard procedure if it depends on direct Sanger sequencing. Fortunately, using next-generation sequencing, Xie S et al. detected a c.10141C > T mutation in a Chinese DMD pedigree [15], which offers a new promising avenue for the efficient detection of subtle mutations. In conclusion, MLPA is a fast, accurate and reliable deletion/ duplication mutation screening method for the dystrophin gene. ORF disruption is a meaningful prognostic factor for progressive muscular dystrophy. For the patients with a suspected single exon deletion, MLPA combined with Sanger sequencing offers the capability to distinguish a portion of the subtle mutations at the probe ligation site. Although considerable progress has been made in the diagnosis of DMD/BMD using MLPA, the detection of subtle mutations among the 79 exons remains a cumbersome procedure.
38
W.-J. Chen et al. / Clinica Chimica Acta 423 (2013) 35–38
Acknowledgments The authors sincerely thank the DMD/BMD families for their help and willingness to participate in this study. This work was supported by the grant 2012 J06016 from the Natural Science Foundation of Fujian Province of China, grant JA12129 from the Program for New Century Excellent Talents in Fujian Province University, a Program for clinical medical key discipline of Fujian Medical University (XK201108), a key program of scientific research of Fujian Medical University (2009D064), and a key clinical specialty discipline construction program of Fujian.
References [1] Manzur AY, Muntoni F. Diagnosis and new treatments in muscular dystrophies. Postgrad Med J 2009;85:622–30. [2] Bushby K, Finkel R, Birnkrant DJ, et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. Lancet Neurol 2010;9:77–93. [3] Essex C, Roper H. Lesson of the week: late diagnosis of Duchenne's muscular dystrophy presenting as global developmental delay. BMJ 2001;323:37–8. [4] Bushby KM, Gardner-Medwin D, Nicholson LV, et al. The clinical, genetic and dystrophin characteristics of Becker muscular dystrophy. II. Correlation of phenotype with genetic and protein abnormalities. J Neurol 1993;240:105–12. [5] Roberts RG. Dystrophin, its gene, and the dystrophinopathies. Adv Genet 1995;33: 177–231.
[6] Koenig M, Beggs AH, Moyer M, et al. The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am J Hum Genet 1989;45:498–506. [7] Kinali M, Arechavala-Gomeza V, Feng L, et al. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet Neurol 2009;8:918–28. [8] Hallwirth Pillay KD, Bill PL, Madurai S, et al. Molecular deletion patterns in Duchenne and Becker muscular dystrophy patients from KwaZulu Natal. J Neurol Sci 2007;252:1–3. [9] Schouten JP, McElgunn CJ, Waaijer R, et al. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res 2002;30:e57. [10] Emery AEH. Duchenne muscular dystrophy.New York: Oxford University Press; 1993392–8 [New York]. [11] Tuffery-Giraud S, Béroud C, Leturcq F, et al. Genotype-phenotype analysis in 2,405 patients with a dystrophinopathy using the UMD-DMD database: a model of nationwide knowledgebase. Hum Mutat 2009;30:934–45. [12] Gualandi F, Rimessi P, Trabanelli C, et al. Intronic breakpoint definition and transcription analysis in DMD/BMD patients with deletion/duplication at the 5’ mutation hot spot of the dystrophin gene. Gene 2006;370:26–33. [13] Kesari A, Pirra LN, Bremadesam L, et al. Integrated DNA, cDNA, and protein studies in Becker muscular dystrophy show high exception to the reading frame rule. Hum Mutat 2008;29:728–37. [14] Magri F, Govoni A, D'Angelo MG, et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol 2011;258: 1610–23. [15] Xie S, Lan Z, Qu N, et al. Detection of truncated dystrophin lacking the C-terminal domain in a Chinese pedigree by next-generation sequencing. Gene 2012;499: 139–42.