- Email: [email protected]
Molecular analysis of the PArkin co-regulated gene and association with male infertility
Molecular analysis of the PArkin co-regulated gene and association with male infertility Gabrielle R. Wilson, B.Sc.(Hons.),a Marcus L.-J. Sim, B.Sc.(Hons.),a Kate M. Brody, B.Sc.(Hons.),a Juliet M. Taylor, Ph.D.,a Robert I. McLachlan, Ph.D.,b Moira K. O’Bryan, Ph.D.,c Martin B. Delatycki, Ph.D.,a,d and Paul J. Lockhart, Ph.D.a,d a Bruce Lefroy Centre for Genetic Health Research, Murdoch Children’s Research Institute; b Prince Henry’s Institute of Medical Research; c Monash Institute of Medical Research, Monash University; and d Department of Paediatrics, University of Melbourne, Melbourne, Victoria, Australia
Objective: To investigate the potential role of PArkin co-regulated gene (PACRG) in human male infertility. Design: Case-control study. Setting: Academic reproductive biology department. Patient(s): Blood samples were obtained from 610 patients and 156 normal control subjects. Intervention(s): Genomic DNA was used as template for polymerase chain reaction amplification of the PACRG promoter and coding exons. The amplified fragments were tested for DNA sequence variations by direct sequencing and restriction enzyme analysis. Main Outcome Measure(s): Gene structure and sequence alterations of PACRG in infertile male patients. Result(s): The structure of PACRG was determined to comprise 5 coding exons, generating a single transcript in the testis which encoded a predicted protein of 257 amino acids. No pathogenic mutations were identified; however, a variant in the promoter of PACRG was shown to be significantly associated with azoospermia, but not oligospermia, in the case-control cohort. Conclusion(s): Mutation of PACRG was not identified as a cause of male infertility, but variation in the promoter was demonstrated to be a risk factor associated with azoospermia. (Fertil Steril 2010;93:2262–8. 2010 by American Society for Reproductive Medicine.) Key Words: Male infertility, azoospermia, PArkin co-regulated gene, gene structure, mutation screen
Declining fertility rates and increased incidence of reproductive difficulties are a major health problem affecting industrialised nations (1). Approximately 15% of couples are considered to be infertile, i.e., unable to conceive within 1 year of unprotected intercourse, and a male factor problem is implicated in one-half of these cases (2). Spermatogenic disorders are the leading cause of male infertility and are thought to have a significant genetic component. A variety of genetic abnormalities have been linked to impaired spermatogenesis in men, including multifactorial diseases where infertility is associated with a syndrome, Received December 18, 2008; revised January 15, 2009; accepted January 16, 2009; published online March 6, 2009. G.W. has nothing to disclose. M.S. has nothing to disclose. K.B. has nothing to disclose. J.T. has nothing to disclose. R.M. has nothing to disclose. M.O. has nothing to disclose. M.D. has nothing to disclose. P.L. has nothing to disclose. Supported in part by National (Australia) Health and Medical Research Council (NHMRC) project grant no. 436977 to P.J.L. and by funding from Andrology Australia and Monash IVF, Pty., Ltd. G.R.W. holds an NHMRC Postgraduate Scholarship (no. 384489), M.K.O.B. is an NHMRC Senior Research Fellow (no. 384132), R.I.McL. is an NHMRC Principal Research Fellow (no. 441103), M.B.D. is an NHMRC Practitioner Fellow (no. 284520), and P.J.L. is an NHMRC R. D. Wright Fellow (no. 334346). Reprint requests: Paul Lockhart, Bruce Lefroy Centre for Genetic Health Research, Murdoch Childrens Research Institute, 10th Floor, Royal Children’s Hospital, Flemington Road Parkville, 3052, Victoria, Australia (FAX: þ61 3 8341 6390; E-mail: [email protected]).
2262
chromosome abnormalities, and single gene disorders (3). Deletions of the long arm of the Y chromosome (Yq) are the most frequently recognized genetic cause of male infertility, with a prevalence of approximately 5% in azoospermic or severely oligospermic men (4). Despite advances in understanding the molecular pathogenesis of spermatogenesis, a genetic diagnosis can only occasionally be provided and most cases are labeled as ‘‘idiopathic’’ in the clinic. Understanding the molecular causes of abnormal spermatogenesis and the genes involved is important in developing both diagnostic tools and treatment strategies for male infertility. Mouse models, in particular, may provide a powerful system to investigate genes involved in male infertility. To date, >150 mouse strains with testicular dysfunction have been identified, although translational studies to the human condition remain to be performed for the majority (5). Defects in spermatogenesis, resulting in decreased sperm number, motility, or morphology are commonly observed with ciliopathies. This phenotype is generally associated with deficits in the axoneme, which forms the central structural core of the cilia and flagella. In humans, mutations in several dynein genes can result in the ciliopathy Kartagener syndrome, which is an autosomal recessive disorder characterized by ciliary dyskinesia, male infertility, and situs inversus (6). Similarly, mutations in several genes encoding
Fertility and Sterility Vol. 93, No. 7, May 1, 2010 Copyright ª2010 American Society for Reproductive Medicine, Published by Elsevier Inc.
0015-0282/10/$36.00 doi:10.1016/j.fertnstert.2009.01.079
axonemal proteins, e.g., Spag6 and Tektin-T, have been shown to result in cilial defects and male infertility in mouse models (7, 8). The recently identified PArkin co-regulated gene (PACRG) is a candidate for involvement in human male infertility. The gene was initially shown to be co-regulated with parkin by a bidirectional promoter and has been implicated in neurodegenerative disease (9). However, studies in lower-order species have provided evidence that PACRG orthologues are involved in the function of cilia and flagella. For example, BUG21, the PACRG orthologue of the green alga Chlamydomonas reinhardtii, was recently identified as a core component of the centriole/basal body and axoneme (10, 11). Similarly, PACRG orthologues in the flagellated protozoa Trypanosoma brucei were demonstrated to be critical for axoneme formation, stability, and motility (12, 13). The phenotype of the spontaneous recessive mouse mutant Quakingviable (Qkv) is consistent with a role for PACRG in axoneme formation and mammalian spermiogenesis. Qkvhomozygous males demonstrate severe oligospermia and infertility due to the failure of spermatids to complete differentiation (14), although they are able to produce fertile offspring when immature spermatids are injected into normal oocytes (15). The genetic defect in the Qkv mouse is a large deletion of chromosome 17 which affects three genes, including Pacrg (16). Transgenic expression of Pacrg is necessary and sufficient to rescue the spermiogenic deficit (17). To investigate the potential contribution of variation in PACRG to human male infertility, we determined the structure of the mRNA transcript in the testes and performed sequence analysis and a case-control association study in a cohort of 610 infertile male patients characterized by azoospermia or severe oligospermia.
MATERIALS AND METHODS Study Subjects Subjects were selected from the Monash Male Infertility Repository (MMIR), which consists of peripheral genomic DNA collected from infertile men and fertile control subjects in Metropolitan Melbourne, Victoria, Australia. Racial/ancestral details were not recorded during collection; however, >85% of Melbournians are of Anglo-Irish descent, and this has not altered significantly over the time of sample collection (Australian Bureau of Statistics census data; http://www.abs. gov.au/). Previous studies using Y haplotypes demonstrated that the ethnicity of the fertile and infertile samples did not differ significantly (18). The data set represents a set of nonconsecutive men presenting for infertility treatment where female infertility had been extensively ruled out through previous investigations. Patients were otherwise healthy men with idiopathic spermatogenic disorders which were identified thorough clinical evaluation by an andrologist along with semen analysis and hormonal profiles. To minimize heterogeneity and increase power to detect novel genetic effects, all men with a definitive diagnosis were excluded. This included cases Fertility and Sterility
with karyotypic abnormalities (including Yq deletions), androgen receptor and cystic fibrosis transmembrane receptor (CFTR) mutations, cryptorchidism, or cancer treatment. In addition, all cases characterized by obstructive defects were also excluded from the analysis. To identify potentially unreported or population specific sequence variants within the PACRG gene a cohort of 74 male individuals, diagnosed with azoospermia (n ¼ 68) or severe oligospermia (<5 106 sperm/mL; n ¼ 6) were selected for PACRG sequence analysis. An association analysis of the identified sequence variants was performed using an additional 138 azoospermia, 398 oligospermia (<20 106 sperm/mL), and 156 control subjects. The latter group consisted of fertile men (healthy men who had fathered at least one child; n ¼ 101) and clinically fertile control individuals (healthy men who have not fathered a child, but whose sperm concentrations, morphology, and motility are classified normal in accordance with the World Health Organization [1999]; n ¼ 55). The study was approved by the Human Ethics and Research Committees of Epworth Medical Centre, Monash Day Surgery Hospital, Monash University, and Concorde Hospital, and all of the participants provided informed consent. Power calculations performed using a genotypic association test (power for association with error [19]) demonstrated that the cohort was sufficiently powered to detect relatively weak genetic effects. The entire cohort was predicted to have 92% power to detect an association assuming case/control risk allele frequencies of 0.15/0.075. Segregating the cases by phenotype (206 azoospermia, 404 oligospermia) resulted in power estimates of 85% and 90%, respectively. This analysis assumed a genetic model free analysis, type I error of .05, and a genotype error rate of 1% (http://linkage.rockefeller.edu/).
Gene Structure and Sequence Analysis of PACRG The structure of PACRG was determined by polymerase chain reaction (PCR) analysis of human testes PCR-ready cDNA (Ambion). Forward and reverse primers were designed to amplify the six predicted exons of the human PACRG transcript (Refseq Sequence NM_152410). The PCR was performed with 1 mL cDNA using a 60 C to 50 C touchdown protocol over 35 cycles using the primer sets described in Table 1. Reaction products were resolved on 1.5% agarose gels and visualized with ethidium bromide. To test if exon 5 represented a minor splice form, primers located in the 50 and 30 UTR (forward primer 50 -CATCCGand reverse primer 50 TAAAGCCCACGAT-30 TGGAAAGCCTTGCTCTCAAT-30 ) were used in a primary PCR reaction. This PCR product (0.5 mL) was then used as template for a nested PCR reaction using the primer sets listed in Table 1. Two testis PCR-ready cDNA samples were obtained from commercial sources (Ambion and Stratagene). In addition, cDNA was prepared from ten normal testis biopsies using the Recoverall Total Nucleic Acid Isolation kit (Ambion). 2263
TABLE 1 Primer sets used for cDNA analysis of PACRG. The predicted sizes of the polymerase chain reaction products are shown for the two alternative structures of PACRG. Primer pair Set 1 Set 2 Set 3 Set 4 Set 5 Set 6 Set 7 Set 8 Set 9 Set 10 Set 11
Forward primer
Reverse primer
CATCCGTAAAGCCCACGAT CATCCGTAAAGCCCACGAT CATCCGTAAAGCCCACGAT CATCCGTAAAGCCCACGAT GACAAGATGCCGAAGAGGAC CTGCAGGGGCATTTAAAGAA TTGAGAAGCTGGATTACCATCA CCGACAGGTCATCTGTGTCA CATCCGTAAAGCCCACGAT CCGACAGGTCATCTGTGTCA GTCTTACTCTTTGCCCAGG
TGGAAAGCCTTGCTCTCAAT CTTCCAGGCGATTTTGTTTC ATCGGGATAATGAGCTGTGG CAGGGAGGATTTGACGGTAA CTTCCAGGCGATTTTGTTTC ATCGGGATAATGAGCTGTGG CAGGGAGGATTTGACGGTAA TGGAAAGCCTTGCTCTCAAT AGGTGGTCGAGGTTGCAAC AGGTGGTCGAGGTTGCAAC TGGAAAGCCTTGCTCTCAAT
NM_152410 AF_546872 1125 355 522 650 249 286 288 579 744 198 447
1008 355 522 650 249 286 288 462 — — —
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
To identify sequence variants, point mutations, and small insertion and deletions, the promoter and coding exons of PACRG were sequenced on both strands of genomic DNA. Primer pairs for amplification and sequencing are listed in Table 2. Each amplicon, including 50–100 bp of flanking intronic sequence, was PCR amplified using 25 ng gDNA and a 60–50 C touchdown protocol. The products were purified using ExoSAP-IT (Amersham Biosciences) and directly sequenced using Big Dye Terminator v3.1 (Applied Biosystems) in accordance with the manufacturer’s directions. Sequences were analyzed using Sequencher software (Gene Codes), and any alterations found were independently verified. The frequency of all identified sequence alterations was assessed in control samples by a restriction enzyme assay specific for that change. Associations were measured by twoway contingency analysis and Fisher exact test with P<.05 considered to be statistically significant. RESULTS Determination of the Structure of PACRG The reference sequence for PACRG (NM_152410) identifies a cDNA comprising six exons encoding a predicted protein of
296 amino acids. Our previous experimental studies have identified a cDNA (AF546872) encoding five exons and a predicted protein of 257 amino acids (9), which lacks exon 5 of NM_152410. To determine the correct gene structure for analysis, each coding exon predicted by the Refseq sequence NM_152410 was subjected to a BLAST search against the human genome (March 2006 assembly). For all exons except 5, this analysis identified a single unique match to 6q26, the genomic location of PACRG. In comparison, exon 5 of NM_152410 aligned with moderate homology to >150 locations distributed throughout the genome. A BLAST analysis of the 117 bp encoding the 39 amino acid exon 5 against the National Center for Biotechnology Information alu_repeats database demonstrated that the sequence was 85% identical to the Alu-J consensus sequence (HSU14567). Furthermore, an alignment of the Alu-J consensus sequence to the human genome identified 83% identity with a contiguous 282 bp sequence which included all of exon 5 and 161 bp of intronic sequence 30 to exon 5 (Fig. 1). To investigate the in vivo expression of PACRG, each coding exon predicted by the RefSeq sequence NM_152410 was subjected to a BLAST search against the database of
TABLE 2 Primer sets used to amplify and sequence each exon of PACRG. The predicted size of the polymerase chain reaction products is shown. Amplicon
Forward primer
Reverse primer
Product (bp)
Promoter Exon 1 Exon 2 Exon 3 Exon 4 Exon 5
CCTGGCAGGTACCCACGTA ATCAACCTGGGCACTACG CTTTCCCAGGTGTTTGTATTA TATGTGGATGGGAGATTTAAC GTCCCCAGTAGAGCACAGT GTTTGTGTCTCCTAATAAGCA
GGCGCGATAATGGTAGAAAT CCAACCTCTGTAAATCTCG CAAGGTGGATGGCTGACA AGTCTGTCATGGTTTATTGCT AGAAGGCGTGGGAATATG AGGGCTAACAGTCCAATG
499 365 475 469 417 417
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
2264
Wilson et al.
Mutation analysis of PACRG
Vol. 93, No. 7, May 1, 2010
FIGURE 1 Alignment of the AluJ consensus sequence (reverse complement) and NM_152410 PACRG exon 5. The predicted exon is shown in uppercase type and boxed, the flanking intronic sequence is shown in lowercase italic type, and the predicted splice acceptor/donor consensus sequences are indicated in boldface type.
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
human expressed sequence tags (ESTs). This analysis provided strong experimental support for the expression of exons 1, 2, 3, 4, and 6 of NM_152410, with an average of 36 independent highly similar EST matches. In comparison, exon 5 had only two highly similar EST matches, but 124 matches to EST sequences that were similar to Alu repetitive elements. An analysis of genomic databases and PCR amplification of gDNA from 25 control samples (50 chromosomes) confirmed that exon 5 was generally present in the human genome and did not represent a rare genomic variant (data not shown). To experimentally determine the structure of the PACRG transcript expressed in human testes, cDNA primers were designed to test the exon boundaries predicted by NM_152410 and AF546872. For all primer pairs used, we were unable to identify a PCR product that was predicted by size to contain exon 5; all of the observed product sizes corresponded to those predicted by AF546872 (Fig. 2, lanes 2–9). Sequence analysis confirmed that exon 5 was not present in the amplification products (data not shown). Similarly, no PCR product was observed when primers specific for exon 5 of NM_152410 were used in the PCR reaction (Fig. 2, lanes 10–12). Similar results were observed when cDNA derived from 11 independent testis samples and other tissues, including brain, heart, kidney, ovary, and trachea, were analyzed (data not shown). These results suggest that if exon 5 is expressed, it is present as a minor isoform below the level of detection by the methodology used. Fertility and Sterility
Patient Sequence Analysis and Association Study For 74 cases, the promoter and 5 coding exons of PACRG predicted by AF546872 were sequenced to identify sequence variants or mutations that might be associated with male infertility. No sequence alterations were detected in the coding sequence of any sample analyzed, although three noncoding sequence variants were identified (see below). Database analysis identified 12 potential single-nucleotide polymorphisms (SNPs) within approximately 100 bp of each coding exon that, if present, would be identified by the sequence analysis performed. Three of these SNPs have reported minor allele frequencies greater than 0.05, whereas nine did not have any frequency data or were present with a heterozygosity of <0.05. None of these 12 potential SNPs were identified in the sequence analysis of 74 samples (148 chromosomes). Three noncoding sequence variants were identified by the sequence analysis. Two of these were located in the PACRG promoter/50 UTR sequence and have been previously identified (20). Rs9347683 (previously called 258T>G) is located 213 bp upstream of the initiating PACRG methionine (NM_001080379:c-213A>C). Fifteen patients were heterozygous and three patients were homozygous for the minor allele of rs9347683. Four patients were heterozygous for the second SNP (NM_001080379:c-244T>C, previously called 227A>G), which is located 244 bp upstream of the initiating PACRG methionine. In addition, three patients were heterozygous and one was homozygous for the novel intronic sequence alteration IVS1þ85744insC, which corresponds 2265
FIGURE 2 Analysis of the structure of the PACRG transcript in human testis. Agarose gel electrophoresis of reverse-transcription polymerase chain reaction amplification of PACRG. The amplification products using primers corresponding to both NM_152410 and AF_546876 (set 1 to set 8) are shown. The final three lanes use primer sequences specific for exon 5 of NM_152410 (set 9 to set 11). The fragment sizes of the DNA molecular weight marker are indicated in basepairs.
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
to a single cytosine nucleotide insertion 11 bp upstream of PACRG exon 2. The frequency of all three variants in the entire case-control cohort of 766 samples was assessed by restriction endonuclease digest analysis. The presence of the minor allele of rs9347683, NM_001080379:c-244T>C, or IVS1þ85744 resulted in the generation of a novel BstNI, StuI, or MboII restriction site, respectively. All three variants were in HardyWeinberg equilibrium in the control population (data not shown). The NM_001080379:c-244T>C and IVS1þ85744 variants were relatively rare, with a minor allele frequency of <0.1. There were no significant differences in allele frequencies between case and control samples for either of these SNPs, as assessed by two-way contingency analysis, suggesting that the variants are not associated with male infertility. In contrast, the minor allele of rs9347683 was observed at a frequency of >0.1, allowing stratification of the analysis based on infertility subgroup. Earlier studies have shown that analysis of cohorts as small as 100 cases, when stratified by a defined subphenotype, can result in substantial power increases (21). Rs9347683 was significantly associated with azoospermia (c2 ¼ 6.93; P¼.009; odds ratio 1.6), and this was maintained after correction for multiple testing (Table 3). 2266
Wilson et al.
Mutation analysis of PACRG
However, there was no association with oligospermia, precluding further analysis of potential phenotype-genotype correlations, e.g., the effect of homozygosity for the minor allele on sperm concentration or structure.
DISCUSSION PACRG is a novel protein implicated in axoneme structure and mammalian spermiogenesis, although to date no studies have investigated the potential role of the gene in human male infertility. Two different gene structures for PACRG are identified in the literature, NM_152410 and AF546872. The major difference between these sequences is the inclusion of exon 5 in NM_152410, a sequence that is not well conserved through evolution. A comparison of PACRG with orthologous protein sequences in the dog, mouse, and zebrafish failed to identify a similar exon 5 sequence, despite a remarkable level of protein conservation across other regions of the protein. For example, the 232 amino acid zebrafish Pacrg orthologue (AAH85440) displayed 85% identity to PACRG despite an evolutionary divergence of over 450 million years (data not shown). Similarly, transgenic expression of the human cDNA lacking exon 5 was fully functional and able to correct the spermiogenic defect in the Qkv mouse (17). The present analysis suggests that exon 5 of NM_152410 represents an exonized Alu-J element (22). Alu repetitive elements are unique to primates and can be found in coding and noncoding regions, making up approximately 10% of the genome. These elements have been identified in >5% of all human alternative exons and have been associated with the development of human disease (22, 23). It is possible that NM_152410 represents a minor splice variant of PACRG or perhaps a tissue-specific isoform. However, we were unable to detect expression of the variant in cDNA derived from human testes or other tissues, and it was excluded from subsequent analysis in the infertility cohort. The infertility cohort selected for initial sequence analysis consisted of men specifically affected with azoospermia or severe oligospermia, because this phenotype closely corresponds to the type of infertility observed in the Qkv mouse. No potentially pathologic mutations or sequence variants were identified in the coding sequence of 74 cases with male infertility. This analysis permitted an assessment of PACRG sequence variation within the Australian cohort. None of the 12 PACRG SNPs reported in public databases were identified, suggesting that either the SNPs were not present at a significant frequency in the population analyzed or may represent database errors. Three noncoding sequence variants were identified. Two of these variants were located in the 50 UTR/promoter region and have previously been identified (rs9347683 and NM_001080379:c-244T>C), whereas the third variant (IVS1þ85744insC) has not been reported before. The NM_001080379:c-244T>C polymorphism was not predicted to alter any potential transcription factor binding sites and was not associated with infertility in our cohort. The IVS1þ85744insC variant is located 11 bp 50 to exon 2 Vol. 93, No. 7, May 1, 2010
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
Note: CI ¼ confidence interval; SNP ¼ single-nucleotide polymorphism. * The association of rs9347683 and azoospermia was significant after correction for multiple testing (P¼ .036, Bonferroni inequality method).
0.75 (0.49–1.17) .23 1.62
1.2 (0.78–1.83) .46 0.68
1.6 (1.13–2.36) 1.2 (0.83–1.64) .009* .37 6.93 0.82
0.25 0.2 0.17 0.11 0.09 0.08 0.09 0.75 0.8 0.83 0.89 0.91 0.92 0.91 14 (7%) 13 (3%) 4 (3%) 10 (2%) — 12 (2%) 1 (0.6%) 77 (37%) 133 (33%) 46 (29%) 109 (18%) 28 (18%) 63 (11%) 27 (17.8%) 115 (56%) 258 (64%) 106 (68%) 488 (80%) 127 (82%) 517 (87%) 124 (81.6%) Azoospermia Oligospermia Control NM_001080379:c- Infertile 244T>C Control IVS1þ85744insC Infertile Control Rs9347683
Odds ratio (95% CI) SNP
Sample
Fisher Homozygous Homozygous Major allele Minor allele Pearson c2, exact major allele Heterozygous minor allele frequency frequency uncorrected test
Genotype and allele frequencies for PACRG sequence variants in infertile case and control samples. Association analysis was performed by two-way contingency analysis.
TABLE 3
Fertility and Sterility
and could potentially disrupt the splice acceptor branchpoint sequence and polypyrimidine tract. However, analysis using several prediction programs suggested that the alteration was unlikely to compromise splice site function (24). In addition, there was no evidence of association between IVS1þ85744insC and male infertility in the case-control analysis, and we conclude that it is unlikely that either of these sequence variants is of pathologic relevance. A significant association was identified between a sequence variant located in the PACRG 50 UTR (rs9347683) and male infertility characterized by azoospermia but not oligospermia. The calculated odds ratio suggests that males carrying the minor allele of rs9347683 are 1.6 times more likely to be affected by male infertility than those without the allele. This effect size is similar to that observed for other candidate male infertility genes, such as the KIT tyrosine kinase receptor (4). One possible explanation for the observed association is that rs9347683 is the causative mutation. The minor allele is located within the core bidirectional promoter region of both PACRG and Parkin. It is predicted to disrupt an NF1like consensus sequence and does demonstrate reduced gene transcription in vitro when cloned into luciferase reporter constructs in the sense orientation to parkin (20). It is possible that the minor allele of rs9347683 may similarly affect the gene transcription and expression of PACRG. Alternatively, rs9347683 may be in linkage disequilibrium with the pathogenic mutation. Although we failed to identify any pathogenic mutations in 74 cases, given that PACRG spans approximately 600 kbp of genomic DNA, it is possible that the causative mutation may be located outside the regions that were analyzed. The risk allele is also present in fertile individuals, albeit at significantly lower frequency; it is probable that the minor allele functions as a risk or susceptibility factor. This could be mediated by gene-environment or gene-gene interactions. Studies of PACRG orthologues in mice and lower-order species have suggested a role for the protein in microtubule dynamics, e.g., interaction with tubulins and centriole/basal body function (10, 25) in addition to flagella formation and/or function. Notably, spermiogenesis in the Qkv mouse proceeds until nuclear condensation and elongation. Both remodeling of the head and elaboration/ elongation of the axoneme are impaired (14), and Pacrg plays a role in both of these processes (17). In humans, it is possible that decreased level of wildtype PACRG, or expression of a mutant form of the protein, similarly effects both processes and the defective sperm are efficiently resorbed by the Sertoli cells. However, understanding the molecular basis of the observed association with azoospermia will require additional studies characterizing the function of PACRG and identifying interacting protein partners. The present results suggest that mutation of PACRG is not a common cause of male infertility, but that variation in the regulatory region functions as a genetic susceptibility factor associated with azoospermia. Although these data cannot specifically exclude that the association relates to the influence of parkin, we consider this to be unlikely. Loss of parkin 2267
function does not result in male infertility in humans or mice. Similarly, we are unaware of any reports in the literature suggesting a role for parkin in sperm structure or function. Additional genetic studies in cohorts derived from geographic and ethnically diverse populations will be necessary to determine the robustness of the observed association with infertility and potential interaction with other susceptibility genes. However, given that rs9347683 disrupts a known NF1-type consensus sequence, functional investigations to determine if the presence of the minor allele affects the transcriptional activity of PACRG are required. Acknowledgments: The authors express sincere appreciation for the advice and assistance given by laboratory colleagues and for the participation of the patients. They thank Simone Rowley and Anne Reilly for technical assistance and Professor David Handelsman for providing additional assistance.
REFERENCES 1. Skakkebaek NE, Jorgensen N, Main KM, Rajpert-De Meyts E, Leffers H, Andersson AM, et al. Is human fecundity declining? Int J Androl 2006;29:2–11. 2. Shah K, Sivapalan G, Gibbons N, Tempest H, Griffin DK. The genetic basis of infertility. Reproduction 2003;126:13–25. 3. Griffin DK, Finch KA. The genetic and cytogenetic basis of male infertility. Hum Fertil (Camb) 2005;8:19–26. 4. Krausz C, Giachini C. Genetic risk factors in male infertility. Arch Androl 2007;53:125–33. 5. O’Bryan MK, de Kretser DM. Mouse models for genes involved in impaired spermatogenesis. Int J Androl 2006;29:76–89. 6. Satir P, Christensen ST. Overview of structure and function of mammalian cilia. Annu Rev Physiol 2007;69:377–400. 7. Sapiro R, Kostetskii I, Olds-Clarke P, Gerton GL, Radice GL, Strauss IJ. Male infertility, impaired sperm motility, and hydrocephalus in mice deficient in sperm-associated antigen 6. Mol Cell Biol 2002;22: 6298–305. 8. Tanaka H, Iguchi N, Toyama Y, Kitamura K, Takahashi T, Kaseda K, et al. Mice deficient in the axonemal protein Tektin-t exhibit male infertility and immotile-cilium syndrome due to impaired inner arm dynein function. Mol Cell Biol 2004;24:7958–64. 9. West AB, Lockhart PJ, O’Farell C, Farrer MJ. Identification of a novel gene linked to parkin via a bi-directional promoter. J Mol Biol 2003;326:11–9.
2268
Wilson et al.
Mutation analysis of PACRG
10. Keller LC, Romijn EP, Zamora I, Yates JR, third, Marshall WF. Proteomic analysis of isolated chlamydomonas centrioles reveals orthologs of ciliary-disease genes. Curr Biol 2005;15:1090–8. 11. Ikeda K, Ikeda T, Morikawa K, Kamiya R. Axonemal localization of Chlamydomonas PACRG, a homologue of the human Parkin-coregulated gene product. Cell Motil Cytoskeleton 2007;64:814–21. 12. Dawe HR, Farr H, Portman N, Shaw MK, Gull K. The Parkin co-regulated gene product, PACRG, is an evolutionarily conserved axonemal protein that functions in outer-doublet microtubule morphogenesis. J Cell Sci 2005;118:5421–30. 13. Broadhead R, Dawe HR, Farr H, Griffiths S, Hart SR, Portman N, et al. Flagellar motility is required for the viability of the bloodstream trypanosome. Nature 2006;440:224–7. 14. Bennett WI, Gall AM, Southard JL, Sidman RL. Abnormal spermiogenesis in Quaking, a myelin-deficient mutant mouse. Biol Reprod 1971;5: 30–58. 15. Yanagimachi R, Wakayama T, Kishikawa H, Fimia GM, Monaco L, Sassone-Corsi P. Production of fertile offspring from genetically infertile male mice. Proc Natl Acad Sci U S A 2004;101:1691–5. 16. Lockhart PJ, O’Farrell CA, Farrer MJ. It’s a double knock-out! The Quaking mouse is a spontaneous deletion of Parkin and Parkin co-regulated gene (PACRG). Mov Disord 2004;19:101–4. 17. Lorenzetti D, Bishop CE, Justice MJ. Deletion of the Parkin coregulated gene causes male sterility in the Quaking(viable) mouse mutant. Proc Natl Acad Sci U S A 2004;101:8402–7. 18. Lynch M, Cram DS, Reilly A, O’Bryan MK, Baker HW, de Kretser DM, et al. The Y chromosome gr/gr subdeletion is associated with male infertility. Mol Hum Reprod 2005;11:507–12. 19. Gordon D, Finch SJ, Nothnagel M, Ott J. Power and sample size calculations for case-control genetic association tests when errors are present: application to single nucleotide polymorphisms. Hum Hered 2002;54: 22–33. 20. West AB, Maraganore D, Crook J, Lesnick T, Lockhart PJ, Wilkes KM, et al. Functional association of the Parkin gene promoter with idiopathic Parkinson’s disease. Hum Mol Genet 2002;11:2787–92. 21. Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS, Haynes C, et al. Complement factor H polymorphism in age-related macular degeneration. Science 2005;308:385–9. 22. Kreahling J, Graveley BR. The origins and implications of Aluternative splicing. Trends Genet 2004;20:1–4. 23. Jurka J. Evolutionary impact of human Alu repetitive elements. Curr Opin Genet Dev 2004;14:603–8. 24. Baralle D, Baralle M. Splicing in action: assessing disease causing sequence changes. J Med Genet 2005;42:737–48. 25. Ikeda T. Parkin-co-regulated gene (PACRG) product interacts with tubulin and microtubules. FEBS Lett 2008;582:1413–8.
Vol. 93, No. 7, May 1, 2010
Objective: To investigate the potential role of PArkin co-regulated gene (PACRG) in human male infertility. Design: Case-control study. Setting: Academic reproductive biology department. Patient(s): Blood samples were obtained from 610 patients and 156 normal control subjects. Intervention(s): Genomic DNA was used as template for polymerase chain reaction amplification of the PACRG promoter and coding exons. The amplified fragments were tested for DNA sequence variations by direct sequencing and restriction enzyme analysis. Main Outcome Measure(s): Gene structure and sequence alterations of PACRG in infertile male patients. Result(s): The structure of PACRG was determined to comprise 5 coding exons, generating a single transcript in the testis which encoded a predicted protein of 257 amino acids. No pathogenic mutations were identified; however, a variant in the promoter of PACRG was shown to be significantly associated with azoospermia, but not oligospermia, in the case-control cohort. Conclusion(s): Mutation of PACRG was not identified as a cause of male infertility, but variation in the promoter was demonstrated to be a risk factor associated with azoospermia. (Fertil Steril 2010;93:2262–8. 2010 by American Society for Reproductive Medicine.) Key Words: Male infertility, azoospermia, PArkin co-regulated gene, gene structure, mutation screen
Declining fertility rates and increased incidence of reproductive difficulties are a major health problem affecting industrialised nations (1). Approximately 15% of couples are considered to be infertile, i.e., unable to conceive within 1 year of unprotected intercourse, and a male factor problem is implicated in one-half of these cases (2). Spermatogenic disorders are the leading cause of male infertility and are thought to have a significant genetic component. A variety of genetic abnormalities have been linked to impaired spermatogenesis in men, including multifactorial diseases where infertility is associated with a syndrome, Received December 18, 2008; revised January 15, 2009; accepted January 16, 2009; published online March 6, 2009. G.W. has nothing to disclose. M.S. has nothing to disclose. K.B. has nothing to disclose. J.T. has nothing to disclose. R.M. has nothing to disclose. M.O. has nothing to disclose. M.D. has nothing to disclose. P.L. has nothing to disclose. Supported in part by National (Australia) Health and Medical Research Council (NHMRC) project grant no. 436977 to P.J.L. and by funding from Andrology Australia and Monash IVF, Pty., Ltd. G.R.W. holds an NHMRC Postgraduate Scholarship (no. 384489), M.K.O.B. is an NHMRC Senior Research Fellow (no. 384132), R.I.McL. is an NHMRC Principal Research Fellow (no. 441103), M.B.D. is an NHMRC Practitioner Fellow (no. 284520), and P.J.L. is an NHMRC R. D. Wright Fellow (no. 334346). Reprint requests: Paul Lockhart, Bruce Lefroy Centre for Genetic Health Research, Murdoch Childrens Research Institute, 10th Floor, Royal Children’s Hospital, Flemington Road Parkville, 3052, Victoria, Australia (FAX: þ61 3 8341 6390; E-mail: [email protected]).
2262
chromosome abnormalities, and single gene disorders (3). Deletions of the long arm of the Y chromosome (Yq) are the most frequently recognized genetic cause of male infertility, with a prevalence of approximately 5% in azoospermic or severely oligospermic men (4). Despite advances in understanding the molecular pathogenesis of spermatogenesis, a genetic diagnosis can only occasionally be provided and most cases are labeled as ‘‘idiopathic’’ in the clinic. Understanding the molecular causes of abnormal spermatogenesis and the genes involved is important in developing both diagnostic tools and treatment strategies for male infertility. Mouse models, in particular, may provide a powerful system to investigate genes involved in male infertility. To date, >150 mouse strains with testicular dysfunction have been identified, although translational studies to the human condition remain to be performed for the majority (5). Defects in spermatogenesis, resulting in decreased sperm number, motility, or morphology are commonly observed with ciliopathies. This phenotype is generally associated with deficits in the axoneme, which forms the central structural core of the cilia and flagella. In humans, mutations in several dynein genes can result in the ciliopathy Kartagener syndrome, which is an autosomal recessive disorder characterized by ciliary dyskinesia, male infertility, and situs inversus (6). Similarly, mutations in several genes encoding
Fertility and Sterility Vol. 93, No. 7, May 1, 2010 Copyright ª2010 American Society for Reproductive Medicine, Published by Elsevier Inc.
0015-0282/10/$36.00 doi:10.1016/j.fertnstert.2009.01.079
axonemal proteins, e.g., Spag6 and Tektin-T, have been shown to result in cilial defects and male infertility in mouse models (7, 8). The recently identified PArkin co-regulated gene (PACRG) is a candidate for involvement in human male infertility. The gene was initially shown to be co-regulated with parkin by a bidirectional promoter and has been implicated in neurodegenerative disease (9). However, studies in lower-order species have provided evidence that PACRG orthologues are involved in the function of cilia and flagella. For example, BUG21, the PACRG orthologue of the green alga Chlamydomonas reinhardtii, was recently identified as a core component of the centriole/basal body and axoneme (10, 11). Similarly, PACRG orthologues in the flagellated protozoa Trypanosoma brucei were demonstrated to be critical for axoneme formation, stability, and motility (12, 13). The phenotype of the spontaneous recessive mouse mutant Quakingviable (Qkv) is consistent with a role for PACRG in axoneme formation and mammalian spermiogenesis. Qkvhomozygous males demonstrate severe oligospermia and infertility due to the failure of spermatids to complete differentiation (14), although they are able to produce fertile offspring when immature spermatids are injected into normal oocytes (15). The genetic defect in the Qkv mouse is a large deletion of chromosome 17 which affects three genes, including Pacrg (16). Transgenic expression of Pacrg is necessary and sufficient to rescue the spermiogenic deficit (17). To investigate the potential contribution of variation in PACRG to human male infertility, we determined the structure of the mRNA transcript in the testes and performed sequence analysis and a case-control association study in a cohort of 610 infertile male patients characterized by azoospermia or severe oligospermia.
MATERIALS AND METHODS Study Subjects Subjects were selected from the Monash Male Infertility Repository (MMIR), which consists of peripheral genomic DNA collected from infertile men and fertile control subjects in Metropolitan Melbourne, Victoria, Australia. Racial/ancestral details were not recorded during collection; however, >85% of Melbournians are of Anglo-Irish descent, and this has not altered significantly over the time of sample collection (Australian Bureau of Statistics census data; http://www.abs. gov.au/). Previous studies using Y haplotypes demonstrated that the ethnicity of the fertile and infertile samples did not differ significantly (18). The data set represents a set of nonconsecutive men presenting for infertility treatment where female infertility had been extensively ruled out through previous investigations. Patients were otherwise healthy men with idiopathic spermatogenic disorders which were identified thorough clinical evaluation by an andrologist along with semen analysis and hormonal profiles. To minimize heterogeneity and increase power to detect novel genetic effects, all men with a definitive diagnosis were excluded. This included cases Fertility and Sterility
with karyotypic abnormalities (including Yq deletions), androgen receptor and cystic fibrosis transmembrane receptor (CFTR) mutations, cryptorchidism, or cancer treatment. In addition, all cases characterized by obstructive defects were also excluded from the analysis. To identify potentially unreported or population specific sequence variants within the PACRG gene a cohort of 74 male individuals, diagnosed with azoospermia (n ¼ 68) or severe oligospermia (<5 106 sperm/mL; n ¼ 6) were selected for PACRG sequence analysis. An association analysis of the identified sequence variants was performed using an additional 138 azoospermia, 398 oligospermia (<20 106 sperm/mL), and 156 control subjects. The latter group consisted of fertile men (healthy men who had fathered at least one child; n ¼ 101) and clinically fertile control individuals (healthy men who have not fathered a child, but whose sperm concentrations, morphology, and motility are classified normal in accordance with the World Health Organization [1999]; n ¼ 55). The study was approved by the Human Ethics and Research Committees of Epworth Medical Centre, Monash Day Surgery Hospital, Monash University, and Concorde Hospital, and all of the participants provided informed consent. Power calculations performed using a genotypic association test (power for association with error [19]) demonstrated that the cohort was sufficiently powered to detect relatively weak genetic effects. The entire cohort was predicted to have 92% power to detect an association assuming case/control risk allele frequencies of 0.15/0.075. Segregating the cases by phenotype (206 azoospermia, 404 oligospermia) resulted in power estimates of 85% and 90%, respectively. This analysis assumed a genetic model free analysis, type I error of .05, and a genotype error rate of 1% (http://linkage.rockefeller.edu/).
Gene Structure and Sequence Analysis of PACRG The structure of PACRG was determined by polymerase chain reaction (PCR) analysis of human testes PCR-ready cDNA (Ambion). Forward and reverse primers were designed to amplify the six predicted exons of the human PACRG transcript (Refseq Sequence NM_152410). The PCR was performed with 1 mL cDNA using a 60 C to 50 C touchdown protocol over 35 cycles using the primer sets described in Table 1. Reaction products were resolved on 1.5% agarose gels and visualized with ethidium bromide. To test if exon 5 represented a minor splice form, primers located in the 50 and 30 UTR (forward primer 50 -CATCCGand reverse primer 50 TAAAGCCCACGAT-30 TGGAAAGCCTTGCTCTCAAT-30 ) were used in a primary PCR reaction. This PCR product (0.5 mL) was then used as template for a nested PCR reaction using the primer sets listed in Table 1. Two testis PCR-ready cDNA samples were obtained from commercial sources (Ambion and Stratagene). In addition, cDNA was prepared from ten normal testis biopsies using the Recoverall Total Nucleic Acid Isolation kit (Ambion). 2263
TABLE 1 Primer sets used for cDNA analysis of PACRG. The predicted sizes of the polymerase chain reaction products are shown for the two alternative structures of PACRG. Primer pair Set 1 Set 2 Set 3 Set 4 Set 5 Set 6 Set 7 Set 8 Set 9 Set 10 Set 11
Forward primer
Reverse primer
CATCCGTAAAGCCCACGAT CATCCGTAAAGCCCACGAT CATCCGTAAAGCCCACGAT CATCCGTAAAGCCCACGAT GACAAGATGCCGAAGAGGAC CTGCAGGGGCATTTAAAGAA TTGAGAAGCTGGATTACCATCA CCGACAGGTCATCTGTGTCA CATCCGTAAAGCCCACGAT CCGACAGGTCATCTGTGTCA GTCTTACTCTTTGCCCAGG
TGGAAAGCCTTGCTCTCAAT CTTCCAGGCGATTTTGTTTC ATCGGGATAATGAGCTGTGG CAGGGAGGATTTGACGGTAA CTTCCAGGCGATTTTGTTTC ATCGGGATAATGAGCTGTGG CAGGGAGGATTTGACGGTAA TGGAAAGCCTTGCTCTCAAT AGGTGGTCGAGGTTGCAAC AGGTGGTCGAGGTTGCAAC TGGAAAGCCTTGCTCTCAAT
NM_152410 AF_546872 1125 355 522 650 249 286 288 579 744 198 447
1008 355 522 650 249 286 288 462 — — —
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
To identify sequence variants, point mutations, and small insertion and deletions, the promoter and coding exons of PACRG were sequenced on both strands of genomic DNA. Primer pairs for amplification and sequencing are listed in Table 2. Each amplicon, including 50–100 bp of flanking intronic sequence, was PCR amplified using 25 ng gDNA and a 60–50 C touchdown protocol. The products were purified using ExoSAP-IT (Amersham Biosciences) and directly sequenced using Big Dye Terminator v3.1 (Applied Biosystems) in accordance with the manufacturer’s directions. Sequences were analyzed using Sequencher software (Gene Codes), and any alterations found were independently verified. The frequency of all identified sequence alterations was assessed in control samples by a restriction enzyme assay specific for that change. Associations were measured by twoway contingency analysis and Fisher exact test with P<.05 considered to be statistically significant. RESULTS Determination of the Structure of PACRG The reference sequence for PACRG (NM_152410) identifies a cDNA comprising six exons encoding a predicted protein of
296 amino acids. Our previous experimental studies have identified a cDNA (AF546872) encoding five exons and a predicted protein of 257 amino acids (9), which lacks exon 5 of NM_152410. To determine the correct gene structure for analysis, each coding exon predicted by the Refseq sequence NM_152410 was subjected to a BLAST search against the human genome (March 2006 assembly). For all exons except 5, this analysis identified a single unique match to 6q26, the genomic location of PACRG. In comparison, exon 5 of NM_152410 aligned with moderate homology to >150 locations distributed throughout the genome. A BLAST analysis of the 117 bp encoding the 39 amino acid exon 5 against the National Center for Biotechnology Information alu_repeats database demonstrated that the sequence was 85% identical to the Alu-J consensus sequence (HSU14567). Furthermore, an alignment of the Alu-J consensus sequence to the human genome identified 83% identity with a contiguous 282 bp sequence which included all of exon 5 and 161 bp of intronic sequence 30 to exon 5 (Fig. 1). To investigate the in vivo expression of PACRG, each coding exon predicted by the RefSeq sequence NM_152410 was subjected to a BLAST search against the database of
TABLE 2 Primer sets used to amplify and sequence each exon of PACRG. The predicted size of the polymerase chain reaction products is shown. Amplicon
Forward primer
Reverse primer
Product (bp)
Promoter Exon 1 Exon 2 Exon 3 Exon 4 Exon 5
CCTGGCAGGTACCCACGTA ATCAACCTGGGCACTACG CTTTCCCAGGTGTTTGTATTA TATGTGGATGGGAGATTTAAC GTCCCCAGTAGAGCACAGT GTTTGTGTCTCCTAATAAGCA
GGCGCGATAATGGTAGAAAT CCAACCTCTGTAAATCTCG CAAGGTGGATGGCTGACA AGTCTGTCATGGTTTATTGCT AGAAGGCGTGGGAATATG AGGGCTAACAGTCCAATG
499 365 475 469 417 417
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
2264
Wilson et al.
Mutation analysis of PACRG
Vol. 93, No. 7, May 1, 2010
FIGURE 1 Alignment of the AluJ consensus sequence (reverse complement) and NM_152410 PACRG exon 5. The predicted exon is shown in uppercase type and boxed, the flanking intronic sequence is shown in lowercase italic type, and the predicted splice acceptor/donor consensus sequences are indicated in boldface type.
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
human expressed sequence tags (ESTs). This analysis provided strong experimental support for the expression of exons 1, 2, 3, 4, and 6 of NM_152410, with an average of 36 independent highly similar EST matches. In comparison, exon 5 had only two highly similar EST matches, but 124 matches to EST sequences that were similar to Alu repetitive elements. An analysis of genomic databases and PCR amplification of gDNA from 25 control samples (50 chromosomes) confirmed that exon 5 was generally present in the human genome and did not represent a rare genomic variant (data not shown). To experimentally determine the structure of the PACRG transcript expressed in human testes, cDNA primers were designed to test the exon boundaries predicted by NM_152410 and AF546872. For all primer pairs used, we were unable to identify a PCR product that was predicted by size to contain exon 5; all of the observed product sizes corresponded to those predicted by AF546872 (Fig. 2, lanes 2–9). Sequence analysis confirmed that exon 5 was not present in the amplification products (data not shown). Similarly, no PCR product was observed when primers specific for exon 5 of NM_152410 were used in the PCR reaction (Fig. 2, lanes 10–12). Similar results were observed when cDNA derived from 11 independent testis samples and other tissues, including brain, heart, kidney, ovary, and trachea, were analyzed (data not shown). These results suggest that if exon 5 is expressed, it is present as a minor isoform below the level of detection by the methodology used. Fertility and Sterility
Patient Sequence Analysis and Association Study For 74 cases, the promoter and 5 coding exons of PACRG predicted by AF546872 were sequenced to identify sequence variants or mutations that might be associated with male infertility. No sequence alterations were detected in the coding sequence of any sample analyzed, although three noncoding sequence variants were identified (see below). Database analysis identified 12 potential single-nucleotide polymorphisms (SNPs) within approximately 100 bp of each coding exon that, if present, would be identified by the sequence analysis performed. Three of these SNPs have reported minor allele frequencies greater than 0.05, whereas nine did not have any frequency data or were present with a heterozygosity of <0.05. None of these 12 potential SNPs were identified in the sequence analysis of 74 samples (148 chromosomes). Three noncoding sequence variants were identified by the sequence analysis. Two of these were located in the PACRG promoter/50 UTR sequence and have been previously identified (20). Rs9347683 (previously called 258T>G) is located 213 bp upstream of the initiating PACRG methionine (NM_001080379:c-213A>C). Fifteen patients were heterozygous and three patients were homozygous for the minor allele of rs9347683. Four patients were heterozygous for the second SNP (NM_001080379:c-244T>C, previously called 227A>G), which is located 244 bp upstream of the initiating PACRG methionine. In addition, three patients were heterozygous and one was homozygous for the novel intronic sequence alteration IVS1þ85744insC, which corresponds 2265
FIGURE 2 Analysis of the structure of the PACRG transcript in human testis. Agarose gel electrophoresis of reverse-transcription polymerase chain reaction amplification of PACRG. The amplification products using primers corresponding to both NM_152410 and AF_546876 (set 1 to set 8) are shown. The final three lanes use primer sequences specific for exon 5 of NM_152410 (set 9 to set 11). The fragment sizes of the DNA molecular weight marker are indicated in basepairs.
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
to a single cytosine nucleotide insertion 11 bp upstream of PACRG exon 2. The frequency of all three variants in the entire case-control cohort of 766 samples was assessed by restriction endonuclease digest analysis. The presence of the minor allele of rs9347683, NM_001080379:c-244T>C, or IVS1þ85744 resulted in the generation of a novel BstNI, StuI, or MboII restriction site, respectively. All three variants were in HardyWeinberg equilibrium in the control population (data not shown). The NM_001080379:c-244T>C and IVS1þ85744 variants were relatively rare, with a minor allele frequency of <0.1. There were no significant differences in allele frequencies between case and control samples for either of these SNPs, as assessed by two-way contingency analysis, suggesting that the variants are not associated with male infertility. In contrast, the minor allele of rs9347683 was observed at a frequency of >0.1, allowing stratification of the analysis based on infertility subgroup. Earlier studies have shown that analysis of cohorts as small as 100 cases, when stratified by a defined subphenotype, can result in substantial power increases (21). Rs9347683 was significantly associated with azoospermia (c2 ¼ 6.93; P¼.009; odds ratio 1.6), and this was maintained after correction for multiple testing (Table 3). 2266
Wilson et al.
Mutation analysis of PACRG
However, there was no association with oligospermia, precluding further analysis of potential phenotype-genotype correlations, e.g., the effect of homozygosity for the minor allele on sperm concentration or structure.
DISCUSSION PACRG is a novel protein implicated in axoneme structure and mammalian spermiogenesis, although to date no studies have investigated the potential role of the gene in human male infertility. Two different gene structures for PACRG are identified in the literature, NM_152410 and AF546872. The major difference between these sequences is the inclusion of exon 5 in NM_152410, a sequence that is not well conserved through evolution. A comparison of PACRG with orthologous protein sequences in the dog, mouse, and zebrafish failed to identify a similar exon 5 sequence, despite a remarkable level of protein conservation across other regions of the protein. For example, the 232 amino acid zebrafish Pacrg orthologue (AAH85440) displayed 85% identity to PACRG despite an evolutionary divergence of over 450 million years (data not shown). Similarly, transgenic expression of the human cDNA lacking exon 5 was fully functional and able to correct the spermiogenic defect in the Qkv mouse (17). The present analysis suggests that exon 5 of NM_152410 represents an exonized Alu-J element (22). Alu repetitive elements are unique to primates and can be found in coding and noncoding regions, making up approximately 10% of the genome. These elements have been identified in >5% of all human alternative exons and have been associated with the development of human disease (22, 23). It is possible that NM_152410 represents a minor splice variant of PACRG or perhaps a tissue-specific isoform. However, we were unable to detect expression of the variant in cDNA derived from human testes or other tissues, and it was excluded from subsequent analysis in the infertility cohort. The infertility cohort selected for initial sequence analysis consisted of men specifically affected with azoospermia or severe oligospermia, because this phenotype closely corresponds to the type of infertility observed in the Qkv mouse. No potentially pathologic mutations or sequence variants were identified in the coding sequence of 74 cases with male infertility. This analysis permitted an assessment of PACRG sequence variation within the Australian cohort. None of the 12 PACRG SNPs reported in public databases were identified, suggesting that either the SNPs were not present at a significant frequency in the population analyzed or may represent database errors. Three noncoding sequence variants were identified. Two of these variants were located in the 50 UTR/promoter region and have previously been identified (rs9347683 and NM_001080379:c-244T>C), whereas the third variant (IVS1þ85744insC) has not been reported before. The NM_001080379:c-244T>C polymorphism was not predicted to alter any potential transcription factor binding sites and was not associated with infertility in our cohort. The IVS1þ85744insC variant is located 11 bp 50 to exon 2 Vol. 93, No. 7, May 1, 2010
Wilson. Mutation analysis of PACRG. Fertil Steril 2010.
Note: CI ¼ confidence interval; SNP ¼ single-nucleotide polymorphism. * The association of rs9347683 and azoospermia was significant after correction for multiple testing (P¼ .036, Bonferroni inequality method).
0.75 (0.49–1.17) .23 1.62
1.2 (0.78–1.83) .46 0.68
1.6 (1.13–2.36) 1.2 (0.83–1.64) .009* .37 6.93 0.82
0.25 0.2 0.17 0.11 0.09 0.08 0.09 0.75 0.8 0.83 0.89 0.91 0.92 0.91 14 (7%) 13 (3%) 4 (3%) 10 (2%) — 12 (2%) 1 (0.6%) 77 (37%) 133 (33%) 46 (29%) 109 (18%) 28 (18%) 63 (11%) 27 (17.8%) 115 (56%) 258 (64%) 106 (68%) 488 (80%) 127 (82%) 517 (87%) 124 (81.6%) Azoospermia Oligospermia Control NM_001080379:c- Infertile 244T>C Control IVS1þ85744insC Infertile Control Rs9347683
Odds ratio (95% CI) SNP
Sample
Fisher Homozygous Homozygous Major allele Minor allele Pearson c2, exact major allele Heterozygous minor allele frequency frequency uncorrected test
Genotype and allele frequencies for PACRG sequence variants in infertile case and control samples. Association analysis was performed by two-way contingency analysis.
TABLE 3
Fertility and Sterility
and could potentially disrupt the splice acceptor branchpoint sequence and polypyrimidine tract. However, analysis using several prediction programs suggested that the alteration was unlikely to compromise splice site function (24). In addition, there was no evidence of association between IVS1þ85744insC and male infertility in the case-control analysis, and we conclude that it is unlikely that either of these sequence variants is of pathologic relevance. A significant association was identified between a sequence variant located in the PACRG 50 UTR (rs9347683) and male infertility characterized by azoospermia but not oligospermia. The calculated odds ratio suggests that males carrying the minor allele of rs9347683 are 1.6 times more likely to be affected by male infertility than those without the allele. This effect size is similar to that observed for other candidate male infertility genes, such as the KIT tyrosine kinase receptor (4). One possible explanation for the observed association is that rs9347683 is the causative mutation. The minor allele is located within the core bidirectional promoter region of both PACRG and Parkin. It is predicted to disrupt an NF1like consensus sequence and does demonstrate reduced gene transcription in vitro when cloned into luciferase reporter constructs in the sense orientation to parkin (20). It is possible that the minor allele of rs9347683 may similarly affect the gene transcription and expression of PACRG. Alternatively, rs9347683 may be in linkage disequilibrium with the pathogenic mutation. Although we failed to identify any pathogenic mutations in 74 cases, given that PACRG spans approximately 600 kbp of genomic DNA, it is possible that the causative mutation may be located outside the regions that were analyzed. The risk allele is also present in fertile individuals, albeit at significantly lower frequency; it is probable that the minor allele functions as a risk or susceptibility factor. This could be mediated by gene-environment or gene-gene interactions. Studies of PACRG orthologues in mice and lower-order species have suggested a role for the protein in microtubule dynamics, e.g., interaction with tubulins and centriole/basal body function (10, 25) in addition to flagella formation and/or function. Notably, spermiogenesis in the Qkv mouse proceeds until nuclear condensation and elongation. Both remodeling of the head and elaboration/ elongation of the axoneme are impaired (14), and Pacrg plays a role in both of these processes (17). In humans, it is possible that decreased level of wildtype PACRG, or expression of a mutant form of the protein, similarly effects both processes and the defective sperm are efficiently resorbed by the Sertoli cells. However, understanding the molecular basis of the observed association with azoospermia will require additional studies characterizing the function of PACRG and identifying interacting protein partners. The present results suggest that mutation of PACRG is not a common cause of male infertility, but that variation in the regulatory region functions as a genetic susceptibility factor associated with azoospermia. Although these data cannot specifically exclude that the association relates to the influence of parkin, we consider this to be unlikely. Loss of parkin 2267
function does not result in male infertility in humans or mice. Similarly, we are unaware of any reports in the literature suggesting a role for parkin in sperm structure or function. Additional genetic studies in cohorts derived from geographic and ethnically diverse populations will be necessary to determine the robustness of the observed association with infertility and potential interaction with other susceptibility genes. However, given that rs9347683 disrupts a known NF1-type consensus sequence, functional investigations to determine if the presence of the minor allele affects the transcriptional activity of PACRG are required. Acknowledgments: The authors express sincere appreciation for the advice and assistance given by laboratory colleagues and for the participation of the patients. They thank Simone Rowley and Anne Reilly for technical assistance and Professor David Handelsman for providing additional assistance.
REFERENCES 1. Skakkebaek NE, Jorgensen N, Main KM, Rajpert-De Meyts E, Leffers H, Andersson AM, et al. Is human fecundity declining? Int J Androl 2006;29:2–11. 2. Shah K, Sivapalan G, Gibbons N, Tempest H, Griffin DK. The genetic basis of infertility. Reproduction 2003;126:13–25. 3. Griffin DK, Finch KA. The genetic and cytogenetic basis of male infertility. Hum Fertil (Camb) 2005;8:19–26. 4. Krausz C, Giachini C. Genetic risk factors in male infertility. Arch Androl 2007;53:125–33. 5. O’Bryan MK, de Kretser DM. Mouse models for genes involved in impaired spermatogenesis. Int J Androl 2006;29:76–89. 6. Satir P, Christensen ST. Overview of structure and function of mammalian cilia. Annu Rev Physiol 2007;69:377–400. 7. Sapiro R, Kostetskii I, Olds-Clarke P, Gerton GL, Radice GL, Strauss IJ. Male infertility, impaired sperm motility, and hydrocephalus in mice deficient in sperm-associated antigen 6. Mol Cell Biol 2002;22: 6298–305. 8. Tanaka H, Iguchi N, Toyama Y, Kitamura K, Takahashi T, Kaseda K, et al. Mice deficient in the axonemal protein Tektin-t exhibit male infertility and immotile-cilium syndrome due to impaired inner arm dynein function. Mol Cell Biol 2004;24:7958–64. 9. West AB, Lockhart PJ, O’Farell C, Farrer MJ. Identification of a novel gene linked to parkin via a bi-directional promoter. J Mol Biol 2003;326:11–9.
2268
Wilson et al.
Mutation analysis of PACRG
10. Keller LC, Romijn EP, Zamora I, Yates JR, third, Marshall WF. Proteomic analysis of isolated chlamydomonas centrioles reveals orthologs of ciliary-disease genes. Curr Biol 2005;15:1090–8. 11. Ikeda K, Ikeda T, Morikawa K, Kamiya R. Axonemal localization of Chlamydomonas PACRG, a homologue of the human Parkin-coregulated gene product. Cell Motil Cytoskeleton 2007;64:814–21. 12. Dawe HR, Farr H, Portman N, Shaw MK, Gull K. The Parkin co-regulated gene product, PACRG, is an evolutionarily conserved axonemal protein that functions in outer-doublet microtubule morphogenesis. J Cell Sci 2005;118:5421–30. 13. Broadhead R, Dawe HR, Farr H, Griffiths S, Hart SR, Portman N, et al. Flagellar motility is required for the viability of the bloodstream trypanosome. Nature 2006;440:224–7. 14. Bennett WI, Gall AM, Southard JL, Sidman RL. Abnormal spermiogenesis in Quaking, a myelin-deficient mutant mouse. Biol Reprod 1971;5: 30–58. 15. Yanagimachi R, Wakayama T, Kishikawa H, Fimia GM, Monaco L, Sassone-Corsi P. Production of fertile offspring from genetically infertile male mice. Proc Natl Acad Sci U S A 2004;101:1691–5. 16. Lockhart PJ, O’Farrell CA, Farrer MJ. It’s a double knock-out! The Quaking mouse is a spontaneous deletion of Parkin and Parkin co-regulated gene (PACRG). Mov Disord 2004;19:101–4. 17. Lorenzetti D, Bishop CE, Justice MJ. Deletion of the Parkin coregulated gene causes male sterility in the Quaking(viable) mouse mutant. Proc Natl Acad Sci U S A 2004;101:8402–7. 18. Lynch M, Cram DS, Reilly A, O’Bryan MK, Baker HW, de Kretser DM, et al. The Y chromosome gr/gr subdeletion is associated with male infertility. Mol Hum Reprod 2005;11:507–12. 19. Gordon D, Finch SJ, Nothnagel M, Ott J. Power and sample size calculations for case-control genetic association tests when errors are present: application to single nucleotide polymorphisms. Hum Hered 2002;54: 22–33. 20. West AB, Maraganore D, Crook J, Lesnick T, Lockhart PJ, Wilkes KM, et al. Functional association of the Parkin gene promoter with idiopathic Parkinson’s disease. Hum Mol Genet 2002;11:2787–92. 21. Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS, Haynes C, et al. Complement factor H polymorphism in age-related macular degeneration. Science 2005;308:385–9. 22. Kreahling J, Graveley BR. The origins and implications of Aluternative splicing. Trends Genet 2004;20:1–4. 23. Jurka J. Evolutionary impact of human Alu repetitive elements. Curr Opin Genet Dev 2004;14:603–8. 24. Baralle D, Baralle M. Splicing in action: assessing disease causing sequence changes. J Med Genet 2005;42:737–48. 25. Ikeda T. Parkin-co-regulated gene (PACRG) product interacts with tubulin and microtubules. FEBS Lett 2008;582:1413–8.
Vol. 93, No. 7, May 1, 2010