- Email: [email protected]
Molecular and behavioral changes in nociception in a novel rat model of chronic pancreatitis for the study of pain
Pain 117 (2005) 214–222 www.elsevier.com/locate/pain
Molecular and behavioral changes in nociception in a novel rat model of chronic pancreatitis for the study of pain John H. Winstona, Zhi-Jun Hea, Mohan Shenoya, Shu-Yuan Xiaob, Pankaj Jay Pasrichaa,* a
Division of Gastroenterology and Hepatology, Department of Internal Medicine, The University of Texas Medical Branch, 4.106 McCullough Building, 301 University Boulevard, Galveston TX 77555-0764, USA b Department of Pathology, The University of Texas Medical Branch, Galveston, TX, USA Received 7 March 2005; received in revised form 3 June 2005; accepted 13 June 2005
Abstract The approach to the management of painful chronic pancreatitis has been empirical, primarily due to the lack of information about biological mechanisms producing pain. To facilitate research into pain mechanisms, our aim was to assess a rat model of chronic pancreatitis induced by pancreatic infusion of trinitrobenzene sulfonic acid as a model of painful pancreatitis. Nociception was assessed by measuring mechanical sensitivity of the abdomen and by recording the number of nocifensive behaviors in response to electrical stimulation of the pancreas. Expression of neuropeptides calcitonin gene-related peptide (CGRP) and substance P (SP) in the thoracic dorsal root ganglia receiving input from the pancreas and nerve growth factor (NGF) in the pancreas were measured. Rats with pancreatitis exhibited marked increase in sensitivity to mechanical probing of the abdomen and increased sensitivity to noxious electrical stimulation of the pancreas. There were significant increases in NGF protein in the pancreas and in expression of neuropeptides CGRP and SP in the sensory neurons from dorsal root ganglia receiving input from the pancreas. We have established quantitative measures of referred nociception and pancreatic hyperalgesia in a rat model of chronic pancreatitis that bears histological similarities to the human disease. This model has considerable construct, face and predictive validity for the human condition. It is of importance for the study of the pathogenesis of pain in this condition and can facilitate the development of new therapeutic options. q 2005 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.
1. Introduction The approach to the management of pain in patients with chronic pancreatitis has been empirical primarily due to the lack of information about biological mechanisms producing pain (DiMagno, 1999). A rodent model would facilitate research into pain mechanisms in chronic pancreatitis and help identify novel therapeutic targets. Previous studies have measured nociception in rat models of acute pancreatitis (Houghton et al., 1997; Smiley et al., 2000; Zhang et al., 2004) or pancreatitis that persists for seven to ten days (Vera-Portocarrero et al., 2003; Winston et al., 2003) Abbreviations: CGRP, calcitonin gene related peptide; NGF, nerve growth factor; SP, substance P; TNBS, trinitrobenzene sulfonic acid; VFF, Von Frey Filament. * Corresponding author. Tel.: C1 409 747 3082; fax: C1 409 772 4789. E-mail address: [email protected] (P.J. Pasricha).
by several methods including reductions in exploratory activity, as quantified by video tracking (Houghton et al., 1997; Vera-Portocarrero and Westlund, 2004; Zhang et al., 2004), sensitivity of the abdomen to mechanical stimulation as a measure of referred pain (Vera-Portocarrero et al., 2003; Winston et al., 2003), and direct delivery of noxious chemicals to the pancreas via an indwelling catheter (Hoogerwerf et al., 2004; Lu et al., 2003). These models have significant limitations. In humans, chronic pancreatitis is a progressive disease that often lasts for years without recovery (Ammann and Muellhaupt, 1999) and it is likely that there are significant differences between the neurobiology of these relatively acute inflammatory periods and a chronic inflammatory disease. Further, the assays used in these reports may also be problematic. Mechanical sensitivity of the abdomen does not necessarily implicate changes in the pancreas as the cause of the hypersensitivity, and changes in exploratory behavior can often be
0304-3959/$20.00 q 2005 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.pain.2005.06.013
J.H. Winston et al. / Pain 117 (2005) 214–222
confounded by effects due to sickness, disorientation, anxiety/depression and/or motor defects (Mogil and Crager, 2004). We therefore developed a more direct assay of pancreatic nociception in an animal model more representative of the human disease. A rat model with many histopathological similarities to the human disease including mono—and polymorphonuclear cell infiltrates, areas of fibrosis, duct strictures, dilated ducts and glandular atrophy was developed and characterized by (Puig-Divi et al., 1996). Unlike previously studied models, in our model inflammation and progressive fibrosis was seen for at least 6 weeks. Our aims were to assess this model as suitable for studying pancreatic nociception through application of both an established methodology, mechanical sensitivity of the abdomen, and electrical stimulation. We adapted a previously reported method (Bliss et al., 1950; Griesbacher, 1994) to apply a noxious electrical stimulus directly to the pancreas, using surgically implanted electrodes. The response was then measured by a simple numeration of pain-related nocifensive behaviors (Laird et al., 2001). To correlate changes in nociceptive behavior with neurochemical changes associated with pain, we also examined expression of molecules previously shown to be up-regulated in models of acute pancreatitis: nerve growth factor (NGF) in the pancreas (Toma et al., 2000) and calcitonin gene-related peptide (CGRP) and substance P (SP) in thoracic DRG and spinal cord segments (Vera-Portocarrero et al., 2003; Winston et al., 2003).
215
TNBS, nZ7) were tested before and 3 weeks after induction of pancreatitis. Testing was performed as described previously (Winston et al., 2003). Briefly, prior to testing, the belly was shaved and areas designated for stimulation were marked in relation to fore and hind limbs. Rats were placed in a plastic cage with a mesh floor and were given 30 min to adapt before testing. VFF of various calibers (Stoelting, Wood Dale, IL) were applied in ascending order to the abdomen 10 times each for 1–2 s with a 10 s interval between applications. A positive response consisted of the rat raising its belly (withdrawal response). The data were expressed as a percentage of the number of positive responses with each filament for each rat. All the tests were performed in a blinded manner. 2.3. Electrical stimulation After infusion of the pancreatic duct with vehicle (nZ5) or TNBS (nZ5), a pair of electrodes was attached to the pancreas and externalized behind the head. Rats were tested 3 weeks after infusion. Rats received successive applications of current at 2, 5 and 10 mA for 5 min with 20 min rest between stimulation periods. The number of nocifensive behaviors observed during 5 min of stimulation period were counted. Behaviors consisted of stretching, licking the abdomen and contraction of abdominal wall muscles and extension of the hind limbs as previously described in visceral pain models such as duodenal (DeLeo et al., 1989), colonic (Laird et al., 2001) and pancreatic pain (Lu et al., 2003). One week after testing, rats were again tested for nocifensive behaviors for 5 min at 5 mA. Then buprenorphine was administered subcutaneously at a dose of 0.1 mg/kg, and the rats were re-tested 2 h later. 2.4. Pancreatic histology and immunohistochemistry
A total of 60 male Sprague–Dawley rats (250–300 g) were used in all experiments. All procedures performed on animals were approved by the Institutional Animal Care and Use Committee (IACUC), UTMB. Animals were given free access to drinking water and standard food pellets until 12 h prior to induction of pancreatitis, at which point food was withdrawn. Pancreatitis was induced as previously described (Puig-Divi et al., 1996). Briefly, the common bile duct was closed temporarily near the liver with a small vascular clamp. A blunt 28 gauge needle with PE10 tubing attached was inserted into the duodenum and was guided through the papilla into the duct and was secured with suture. 0.5 ml of a 2% solution of Trinitrobenzene Sulfonic Acid (TNBS), in 10% ethanol in Phosphate Buffered Saline (PBS), pH 7.4 or vehicle was infused into the pancreatic duct over a period of 2–5 min at a pressure of 50 mmHg. After 30 min exposure to TNBS, needle and tubing were removed, the hole in the duodenum was sutured and the vascular clamp was removed restoring the bile flow.
The pancreas was fixed in 10% formalin in phosphate buffered saline (PBS) containing 1.0 mM MgCl2 at 4 8C overnight. Sections from paraffin-embedded specimens were stained with hematoxyline and eosin and observed under a light microscope (BX60, Olympus, Tokyo, Japan). The severity of pancreatitis was evaluated based upon the appearance of segmental gland atrophy, periductular and intralobular fibrosis, and presence of acute and chronic inflammatory infiltrates. For immunohistochemistry, deparaffinized sections were incubated in 0.3% H2O2 in distilled water for 30 min at room temperature (RT). After blocking in 5% normal goat serum (Vectastain ABC Kit, Vector Laboratories,) in PBS containing 0.3% Triton X-100 (Fisher Scientific, Pittsburgh, PA) for 30 min, sections were incubated overnight at 4 8C with NGF antibody (1/100, sc-549 Santa Cruz Biotechnology, Santa Cruz, CA) or insulin antibody (1/1000, Biomeda, Foster City, CA). Antibody binding was visualized using Vectastain ABC Kit (Vector Laboratories, Burlingame, CA) reagents and protocols. Slides were examined under a light microscope equipped with a video camera system (Nikon, Tokyo, Japan). In control experiments, staining was not observed when the NGF antibody was preincubated with a blocking peptide or if only a secondary antibody was used.
2.2. Von frey filament (VFF) testing
2.5. Serum amylase
In the time course study, 12 rats, (vehicle, nZ5, TNBS, nZ7) were tested before and once weekly for up to 6 weeks after induction of pancreatitis. In the dose–response study, rats (controls, nZ9,
Blood samples were collected by cardiac puncture at time of sacrifice and were allowed to clot. They were centrifuged at 10,000!g for 10 min at room temperature and were stored at 4 8C
2. Materials and methods 2.1. Animals and surgical procedures
216
J.H. Winston et al. / Pain 117 (2005) 214–222
until assayed. Serum amylase was measured by a commercial solution-based kit (Enzcheck Ultra Amylase assay kit, Molecular Probes, Eugene, Oregon). 2.6. NGF Tissue extracts were prepared as described (Toma et al., 2000) from four rats in each group (a subset of the rats used for the VFF dose–response curve) and NGF protein content was measured by ELISA using the NGF Emax immunoassay system ELISA kit (Promega, Madison, WI). 2.7. Extraction of total RNA from DRG and Quantitative RT-PCR Rats (nZ4 each group; a subset of the rats used for the VFF dose–response curve) were perfused with 200 ml ice-cold Tyrode’s after anesthesia. Dorsal root ganglia (DRG) from T9 to T11 of both sides of the spinal cord were collected from each rat at the time of sacrifice and snap frozen on dry ice. Total RNA was extracted from the DRG by modified guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987) and was treated with DNase I (RQ1, Promega, Madison, WI) in the presence of 20 units Rnasin (Promega, Madison, WI) at 37 8C for 30 min. RNA concentration was measured at 260 nM with DU 640B Spectrophotometer (Beckman, USA). TAQMAN two-step RT-PCR was performed using reagents and protocols supplied by Applied Biosystems, Foster City, CA on an Applied Biosystems SDS 5700 system. The following forward primer, reverse primer and probe sets were used, PPT: atccgacagtgaccaaatcaag, tcttcgggcgattctctgaa, caatgcccgagccctttgagcat, CGRP: actgcccagaagagatcctgc, gacctgctcagcaagcctg, cactgccacctgcgtgacccat, GAPDH: Applied Biosystems Rodent GAPDH kit. 2.8. Immunocytochemical analysis of spinal cord Rats (nZ4, each group) were anesthetized with sodium pentobarbital (50 mg/kg body weight, i.p.) and perfused with 150 ml of PBS followed by 400 ml of ice-cold freshly prepared 4% paraformaldehyde in PBS. Segments T8–T12 of the spinal cord were removed and post-fixed in 4% paraformaldehyde for 24 h at 4 8C, then placed in PBS (7.4) containing 30% sucrose for 24 h at 4 8C. Forty micron frozen sections (every third section) were stained for either CGRP or SP using a floating sections protocol (Oncogene Research Products, San Diego). The primary antibodies used were CGRP (1/500, Peninsula Laboratories), and SP (1/100, sc-9758 Santa Cruz Biotechnologies, Santa Cruz, CA) and antibody staining was visualized using a biotinylated secondary antisera and Vectorstain ABC peroxidase kit with DAB (Vector Laboratories, Burlingame, CA). The specificity of staining was assured by omitting the primary antibody. The amount of staining in lamina I/II outer was quantified using Metavision software (Universal Imaging Corporation, West Chester, PA) as follows: a defined area of staining in spinal cord lamina I and II outer was marked and the average intensity was measured (A2). The intensity of staining in a similar sized area in lamina III and IV was measured for each dorsal horn as background staining (A1). The amount of CGRP or SP staining in each section was calculated as the Log of the ratio of the staining intensities in these two areas (Log (A2/A1)).
2.9. Sensory neuron isolation and culture and CGRP release Three weeks following pancreatic infusion of TNBS (nZ7) or vehicle (nZ7), DRG T9–T11 were removed and placed in Hams F-12 medium. DRG L6-S1 were prepared separately. After stripping axons, ganglia were treated with collagenase (4 mg/ml) in Hams F-12 for 1 h at 37 8C. After washing with PBS, ganglia were treated with trypsin (2.5 mg/ml) for 15 min. A single cell suspension was obtained by trituration and neurons were enriched by centrifugation through a percoll cushion. Neurons were plated on polyornithine (0.01%, Sigma)/laminin coated 48 well tissue culture plates for CGRP release studies in high glucose DME supplemented with 10% FCS. Experiments were conducted within 6–18 h of plating. IR-CGRP release from DRG cultures was performed as described previously (Hingtgen et al., 1995). Briefly, neuron cultures were washed with Release Buffer (RB) (25 mM Hepes, pH7.4, 135 mM Nacl, 3.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 3.3 mM Glucose, 0.1%BSA, 1 mM phosphoramindon), and incubated for 10 min at 37 8C in RB plus 0.1% ethanol (capsaicin vehicle) to measure basal CGRP release. Fresh RB containing 50 nM capsaicin was added for an additional 10 min. IR-CGRP released by neurons was measured by ELISA. 2.10. Statistical analysis Data were expressed as mean (SEM). Statistical analyses were performed using proprietary software (SigmaStat, Systat Software Inc., Richmond, CA). Parametric t-tests, one-way or twoway repeated measures ANOVA were performed where appropriate. When significant main effects were observed, individual means were compared using the Tukey multiple comparison test, setting significance at P!0.05. For VFF testing. Response frequencies post-pancreatic infusion were compared to pre-infusion baseline response frequencies for each filament by two-way repeated measures ANOVA with treatment (TNBS or Vehicle) as the between-factor and time as the within-group factor. For Electrical Stimulation. Data were analyzed by repeated measures ANOVA with treatment as the between-factor and mA as the within-group factor. The effect of buprenorphine on nocifensive behaviors was analyzed by repeated measures ANOVA comparing baseline before treatment with response after drug treatment. For spinal cord immunohistochemistry. Data from 20 sections from each experimental group was averaged, expressed as meanGSEM. Ten sections/segment/rat were counted and averaged to produce a mean for each rat. Means were averaged and analyzed by two-way ANOVA (for treatment and segment).
3. Results 3.1. Referred mechanical hypersensitivity following TNBS infusion To determine the time course for the development of visceral pain after infusion of TNBS, we assessed abdominal sensitivity to probing with Von Frey filaments (VFF) before and every week thereafter up to 6 weeks. Mean response frequencies of TNBS treated rats were
J.H. Winston et al. / Pain 117 (2005) 214–222
217
rats 3 weeks after saline infusion were not significantly different compared to baseline at any filament tested (Fig. 1B). Response frequencies of rats 3 weeks after TNBS infusion were significantly higher at all filaments tested compared to both pretreatment baseline (PZ0.015) and to saline treated rats at 3 weeks (PZ0.003). Thus, pancreatic infusion of TNBS produced a marked increase in sensitivity to mechanical probing of the abdomen. 3.2. Pancreatic morphology and serum amylase
Fig. 1. Sensitivity of the abdomen to mechanical stimulation. (A) Response frequencies to mechanical stimulation of the abdomen with the 40.7 mN VFF before (BL) and up to 6 weeks after pancreatic infusion with TNBS (nZ7) or vehicle (nZ5) (*P!0.001). (B) Response frequencies to mechanical stimulation of the abdomen with VFF of various strengths before and 3 weeks after infusion of the pancreas with TNBS (nZ9) or vehicle (nZ7). Since baseline responses were similar for both groups, this data was pooled for graphical display. *P!0.05, **P!0.01 compared to vehicle at 3 weeks. CP!0.05,CCP!0.01 compared to baseline.
significantly elevated compared to saline treated rats at every time point tested up to 6 weeks and to pretreatment baseline (Fig. 1A, P!0.001). There was some variability in the mean response frequencies of TNBS treated rats from week to week; response frequencies at 4–6 weeks were significantly higher compared to response frequencies observed at 1–3 weeks. Saline treated rats showed no significant change in VFF response frequency at any time point tested. Next, we examined the sensitivity of TNBS and saline treated rats to VFF of various strengths from 2.75 to 120 mN at a single time point, 3 weeks, after pancreatic infusion. Response frequencies recorded before pancreatic infusions were similar for both groups; this data was pooled for graphical display (Fig. 1B). The response frequencies of
After VFF testing, the effect of TNBS or saline infusion on the pancreas was assessed by examination of H&E stained sections from the pancreas, and by measurement of serum amylase at 24 and 48 h and at 3 weeks. No significant morphological changes were observed in control rats (Fig. 2A). In TNBS treated rats, we observed inflammatory infiltrates, and large regions of acinar loss and periductular and intralobular fibrosis (Fig. 2B). Lost acinar tissue was replaced with tubular structures (Fig. 2C), but islets of Langerhans appeared to be intact. Similar pathology was observed in the pancreata of TNBS treated rats up to 6 weeks post-infusion (Fig. 2D). No significant pathology was observed in the liver or lungs of experimental rats at 3 weeks (data not shown). TNBS treated rats also showed a significant increase in serum amylase compared to controls at 24 h (12,700G1500 vs 4100G900 U/L P!0.001). At 3 weeks, no significant differences in amylase levels were seen, in keeping with the chronic nature of the inflammation (3820G440 vs 4220G450 U/L). Thus, pancreatic infusion of TNBS produced a long lasting pancreatitis as previously described (Puig-Divi et al., 1996). 3.3. Hypersensitivity to electrical stimulation To determine whether TNBS induced pancreatitis was associated with an increased sensitivity of the pancreas to noxious stimulation, electrical stimuli of increasing intensities were applied to the pancreas for 5 min each and the number of nocifensive behaviors that occurred during this stimulus period was counted. Increases in current from 2 to 10 mA mps produced a significant increase in the number of behaviors, PZ0.003 (Fig. 3A). At all three stimulus intensities examined, TNBS treated rats displayed a significantly greater number of nocifensive behaviors compared to saline treated rats, PZ0.012 (Fig. 3A). To confirm that the applied stimulus was specific for the pancreas, we compared the number of nocifensive behaviors evoked by a 5 mA stimulus before and after bilateral splanchnectomy. Splanchnectomy virtually eliminated the number of nocifensive behaviors whereas no significant change was observed in sham operated controls (data not shown).
218
J.H. Winston et al. / Pain 117 (2005) 214–222
Fig. 2. Effect of TNBS on pancreatic morphology. H&E stained sections from saline, A, or TNBS treated rat pancreas B, C, 3 weeks post-infusion. C. Higher magnification view of atrophied acini surrounded by inflammatory infiltrate. (Islet )) (D) TNBS treated pancreas 6 weeks post-infusion.
3.4. Effect of buprenorphine on hypersensitivity to electrical stimulation To examine the effect of analgesic treatment on electrically evoked nocifensive behavior, electrical stimulation at 5 mAmps was performed before and 2 h after administration of buprenorphine (0.1 mg/kg s.c.). After buprenorphine treatment, there was a significant decrease in the number of nocifensive behaviors in the TNBS treated group compared to its pre-treatment baseline (Fig. 3B, P! 0.0005). 3.5. NGF expression in the pancreas We measured NGF protein levels in the pancreas of saline and TNBS treated rats 3 weeks post-infusion. There was a significant increase in NGF protein in pancreas from TNBS treated rats compared to saline treated rats (187G 31.7 pg/mg vs 76.2G19.1, PZ0.01). In the pancreas from saline treated rats, NGF-like immunoreactivity (NGF-IR) was detected primarily in the islets and in the enodothelium of blood vessels and ducts (Fig. 4A,C). In pancreatic sections from TNBS treated rats, NGF-IR was observed in tubular structures in addition to duct and blood vessel endothelium and islets (Fig. 4B,E). To confirm that NGF expression was observed in islets, serial sections from both saline and TNBS treated rats were stained for insulin (Fig. 4C–F). Thus, NGF expression was detected in additional cell populations in TNBS-induced pancreatitis.
3.6. SP and CGRP expression in thoracic DRG We examined the effect of TNBS-induced pancreatitis on mRNA levels of SP (pre-pro-tachykinin, PPT) and CGRP in thoracic DRG T9–T11 that contain cell bodies of pancreatic afferent neurons by quantitative RT-PCR. In thoracic DRG T9–T11, both PPT (145% (10), P!0.02) and CGRP (117% (5), P!0.05) mRNA were significantly increased 3 weeks after induction of pancreatitis. To determine whether protein levels were also increased, we measured the intensity of SP and CGRP immunoreactivity (IR) in laminae I and II of spinal cord segments T8–T12 that contain spinal projections of nerve endings of pancreatic afferents. In spinal cord segment T10, SP-IR was increased 2.6 fold (P! 0.001) and CGRP-IR was increased 2.1 fold, (P!0.001) in TNBS treated rats compared to vehicle treated rats (Fig. 5A,B). There were no significant differences in SPIR or CGRP-IR between TNBS and Vehicle treated groups in the other spinal cord segments examined (data not shown). 3.7. Capsaicin-evoked CGRP release from thoracic DRG neurons To determine whether increased CGRP expression in thoracic DRG neurons produced increased stimulus-evoked release, we measured capsaicin-evoked CGRP release from acutely dissociated thoracic DRG neurons. CGRP release evoked by 50 nM capsaicin was significantly higher in DRG neurons from TNBS treated rats compared to DRG neurons
J.H. Winston et al. / Pain 117 (2005) 214–222
Fig. 3. The number of nocifensive behaviors evoked by electrical stimulation of the pancreas 3 weeks after pancreatic infusion with TNBS or vehicle. (A) Stimulus-response at 3 weeks post-infusion (nZ5). There was a significant overall effect of treatment PZ0.012. Comparison of individual means showed significant differences between control and TNBS treated rats at 2, 5 and 10 mA mps (*PZ0.042, ***PZ0.009, **PZ 0.014). (B) Effect of buprenorphine (0.1 mg/kg s.c.) treatment on the number of nocifensive behaviors evoked by a 5 mAmp stimulation for five minutes (#PZ0.0005 compared to pretreatment).
from saline treated rats in thoracic DRG (Table 1). There was no significant difference in capsaicin-evoked release from neurons isolated from lumbar/sacral DRG suggesting that this effect was specific for DRG receiving pancreatic afferents.
4. Discussion The incidence of chronic pancreatitis varies considerably amongst countries, ranging from 1.6 new cases per year per 100,000 population in Switzerland to 28 per year per 100, 000 in Japan, with about 65% of the cases attributed to alcohol use (Dufour and Adamson, 2003). Pancreatitis, acute or chronic, is also a significant contributor to the ‘burden of gastrointestinal disease’ in this country, according to a recent survey conducted by the American
219
Gastroenterological Association (Donowitz, 2001). In 1998, there were about 1.2 million prevalent cases, with 327,000 inpatient and 530,000 physician office visits. The estimated total direct cost for this group of diseases was $2.1 billion in 1998. Unfortunately, progress in our understanding of the biology of these diseases has been slow, particularly with respect to the pathogenesis of the cardinal symptom of pancreatitis i.e. pain. Our lack of knowledge about what causes pain in pancreatitis has been a serious obstacle to improvement of the care of these patients, leading to various empirical approaches that are often based on purely anatomical grounds, are generally highly invasive and at best of marginal value (Ammann and Muellhaupt, 1999; DiMagno, 1999; Warshaw et al., 1998). However, the study of the biology of pancreatic pain is a major challenge, in large part because of the anatomical location of this organ that prevents easy access for stimulation. Setting up valid models to study pancreatic pain is therefore an important first step in such an endeavor. In this study, we performed quantitative measurements of nociception on a rat model of chronic pancreatitis using both a previously validated method, mechanical sensitivity of the abdomen and a novel method, electrical stimulation of the pancreas. Rats with TNBS-induced pancreatitis showed a persistent mechanical hypersensitivity in the abdomen that was evident one week after TNBS infusion and persisted up to 6 weeks, the last time point examined. These findings correlated with the presence of a robust pancreatic inflammatory process, and extend and confirm the utility of mechanical sensitivity of somatic referral regions as a quantitative marker of visceral nociception (Bon et al., 2003; Laird et al., 2001). Two previous studies with this methodology used a model of selflimited pancreatitis and showed that abdominal hypersensitivity declined following resolution of the pancreatitis (Vera-Portocarrero et al., 2003; Winston et al., 2003). Thus, our model provides an opportunity to examine the effects of long-term, constant exposure to inflammatory mediators. A novel aspect of our study was a direct measure of pancreatic nociception. To this end, we applied electrical stimuli of various intensities directly to the pancreas, using surgically implanted electrodes. The responses counted consisted of stretching, licking the abdomen and contraction of abdominal wall muscles and extension of the hindlimbs as previously described in visceral pain models such as duodenal (DeLeo et al., 1989) colonic (Laird et al., 2001) and pancreatic pain (Lu et al., 2003). Thus, the stimulus protocol used here appears to be sufficient to activate nociceptors and to produce behavior indicative of pain. After the relatively brief stimuli used here, the pain behaviors subside indicating that the duration and intensity of the delivered stimulus can be controlled. After severing the splanchnic nerves, nocifensive behaviors are drastically reduced in response to pancreatic electrical stimulation showing that the stimulus is specific for the pancreas.
220
J.H. Winston et al. / Pain 117 (2005) 214–222
Fig. 4. NGF immunohistochemistry in pancreatic sections from control and TNBS treated rats 3 weeks post-induction A,B,C,E. Serial sections stained with an insulin antibody D, F. (A) Control, NGF. (B) TNBS, NGF. (C) Control, NGF (D) Control, Insulin. (E) TNBS, NGF. (F) TNBS, Insulin. (Islets ), ducts , tubular structures 3).
The number of nocifensive responses observed was dependent upon the magnitude of the stimulus delivered and TNBS induced pancreatitis resulted in a significant shift to the left of the stimulus response curve, confirming pancreatic nociceptive sensitization in our model. Subsequent treatment with buprenorphine resulted in significant attenuation of behavioral responses to noxious electrical stimulation of the pancreas showing that this assay can detect the effect of analgesic treatments. Although electrical stimulation is not a natural visceral stimulus, it has been shown to cause pain in both animals and humans. In a previous study in rats, electrical stimulation of the pancreas produced a drop in blood pressure a physiological indicator of nociception (Greisbacher, 1994). Electrical stimulation of the pancreas also produces pain in human subjects in a region specific manner (Bliss et al., 1950; Ray and Neill, 1947), thus providing additional validation for our method for the study of pancreatic nociception. A 2.5 fold up-regulation of NGF immunoreactivity was observed at 3 weeks post-induction in this model. An upregulation of similar magnitude but of shorter duration is observed in an acute pancreatitis model, with levels returning to normal with resolution of the pancreatitis
Fig. 5. Expression of nociceptive genes in spinal cord. (A) Immunohistochemical staining for SP and CGRP in spinal cord sections from segment T10 of saline and TNBS treated rats. (B). Histogram showing fold change in staining intensity in TNBS treated rats (*P!0.001, nZ4).
J.H. Winston et al. / Pain 117 (2005) 214–222 Table 1 Capsaicin-evoked CGRP release from acutely dissociated thoracic and lumbar/sacral DRG neurons CGRP-ir (ng/ml) Thoracic Lumbar/Sacral a
Vehicle TNBS Vehicle TNBS
Basal 0.37 (0.05) 0.48 (0.09) 0.24 (0.03) 0.30 (0.03)
50 nM Capsaicin 1.00 (0.11) 1.52a (0.18) 0.76 (0.03) 0.93 (0.16)
PZ0.03.
(Toma et al., 2000). In pancreatic sections from TNBS treated rats, NGF immunoreactivity was observed in tubular structures in addition to duct and blood vessel endothelium and islets, similar to what has been observed in human chronic pancreatitis. In a study investigating NGF expression in the pancreata of 24 patients with chronic pancreatitis (CP), enhanced NGF mRNA expression was present in metaplastic ductal cells, in degenerating acinar cells, and in acinar cells dedifferentiating into tubular structures (Friess et al., 1999). Since NGF sensitizes peptidergic nociceptors (McMahon and Jones, 2004; Mendell et al., 1999), our findings lend plausibility to the hypothesis that NGF plays a role in the pain of chronic pancreatitis. We have also shown an increased expression of the neurotransmitters SP and CGRP in animals with chronic pancreatitis. In thoracic DRGs T9–T11, containing pancreatic sensory neurons, both SP and CGRP mRNA were significantly increased 3 weeks after induction of pancreatitis. Although the magnitude of these increases, less than 1.5 fold, was small, this may be due to the fact that only a small subset of the neurons in these DRGs are actually pancreatic afferents. Stimulus-evoked release of CGRP from DRG neurons isolated from these same segments was significantly higher in DRG neurons from TNBS treated rats compared with DRG neurons from controls. Since CGRP and SP are found in the majority of pancreatic afferent nerves (Sharkey et al., 1984; Su et al., 1987; Won et al., 1998), it is possible that increased CGRP expression and/or increased sensitivity to capsaicin is responsible for the observed increase in stimulus-evoked CGRP release in cultures from TNBS treated rats. Increases in both SP and CGRP immunoreactivity were also observed in spinal cord segment T10 suggesting that increases in mRNA are accompanied by increases in protein levels. T10 is one of several spinal cord segments where c-fos expression is evoked by pancreatic infusion of noxious chemicals (Hoogerwerf et al., 2001; Kim et al., 2004). These data are consistent with a potential role for increased spinal neuropeptide release in pancreatic pain. Up-regulation of both SP and CGRP are reported in an acute model induced by L-arginine (Winston et al., 2003) as well as in a self-limited model of pancreatic sensitization (Vera-Portocarrero et al., 2003) and there
221
is circumstantial evidence implicating these factors in the pain of humans with chronic pancreatitis. Thus, Buchler et al. (1992) have demonstrated a marked intensification of the immunostaining for CGRP and substance P (which were co-expressed) in nerve fibers in specimens from chronic pancreatitis. Finally, it is quite possible that these changes in expression are being driven by excessive NGF production in the pancreas. In general, the utility of an animal model of disease may be assessed based on its construct validity (consistence with a particular theoretical rationale behind its development), face validity (resemblance to clinical or pathophysiological characteristics of the clinical condition), and predictive validity (prediction of response to treatment) (Mayer and Collins, 2000). Evidence for construct validity of our model comes from the morphological findings that resemble human pancreatitis. TNBS was first described as a potent agent for inducing chronic colitis via modification of endogenous proteins and induction of a vigorous immunological injury, resulting in chronic inflammation (Morris et al., 1989). Most forms of chronic pancreatitis in adults result from excessive alcohol intake but it has been exceedingly difficult to create a reliable rodent model of chronic alcoholic pancreatitis (Buckelew and Schenker, 1998; Siegmund et al., 2003). The pathophysiology of alcoholic pancreatitis is probably complex and involves several factors including direct acinar injury, changes in exocrine juice composition and ductular lesions, oxidative stress, conjugation with fatty acid ethyl esters, stellate cell activation, and neuroimmune mechanisms (Apte and Wilson, 2003; Berberat et al., 2000; Haber et al., 2001). However, for the purpose of studying nociceptive mechanisms, it is reasonable to assume that the neurobiological changes accompanying advanced chronic inflammation are likely to be similar, regardless of the nature of the initiating injury. Thus, chronic pancreatitis of various etiologies results in similar increases in nerve size and other neural alterations in humans (Friess et al., 2002). The behavioral assays for pain provide evidence of face validity of our model for studying pancreatic pain. This is further strengthened by the changes in expression and release of neurotransmitters. Finally, the predictive validity is borne out by the response to analgesics and splanchnectomy. In conclusion, we believe that this model is of considerable importance for the study of the pathogenesis of pain in this condition and can facilitate the development of new therapeutic options.
Acknowledgements This research was supported by a grant from the National Institutes of Health (RO1 DK62330-01) to PJP.
222
J.H. Winston et al. / Pain 117 (2005) 214–222
References Ammann RW, Muellhaupt B. The natural history of pain in alcoholic chronic pancreatitis. Gastroenterology 1999;116:1132–40. Apte MV, Wilson JS. Alcohol-induced pancreatic injury. Best Pract Res Clin Gastroenterol 2003;17(4):593–612. Berberat PO, Friess H, Buchler MW. Chronic pancreatitis—new pathophysiological concepts. Swiss Surg 2000;6(5):227–30. Bliss WR, Burch B, Martin MM, Zollinger RM. Localization of referred pancreatic pain induced by electric stimulation. Gastroenterology 1950; 16(2):317–23. Bon K, Lichtensteiger CA, Wilson SG, Mogil JS. Characterization of cyclophosphamide cystitis, a model of visceral and referred pain, in the mouse: species and strain differences. J Urol 2003;170:1008–12. Buchler M, Weihe E, Friess H, Malfertheiner P, Bockman E, Muller S, Nohr D, Beger HG. Changes in peptidergic innervation in chronic pancreatitis. Pancreas 1992;7(2):183–92. Buckelew DQ, Schenker S. Pathogenesis of alcoholic pancreatitis—a peak into a black box. Alcohol Clin Exp Res 1998;22(2):550–2. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9. DeLeo JA, Colburn RW, Coombs DW, Ellis MA. The differentiation of NSAIDs and prostaglandin action using a mechanical visceral pain model in the rat. Pharmacol Biochem Behav 1989;33(1):253–5. DiMagno EP. Toward understanding (and management) of painful chronic pancreatitis. Gastroenterology 1999;116(5):1252–7. Donowitz M. Burden of gastrointestinal diseases. Bethesda: AGA Publications; 2001. Dufour MC, Adamson MD. The epidemiology of alcohol-induced pancreatitis. Pancreas 2003;27:286–90. Friess H, Zhu ZW, di Mola FF, Kulli C, Graber HU, Andren-Sandberg A, Zimmermann A, Korc M, Reinshagen M, Buchler MW. Nerve growth factor and its high-affinity receptor in chronic pancreatitis. Ann Surg 1999;230(5):615–24. Friess H, Shrikhande S, Shrikhande M, Martignoni M, Kulli C, Zimmermann A, Kappeler A, Ramesh H, Buchler M. Neural alterations in surgical stage chronic pancreatitis are independent of the underlying aetiology. Gut 2002;50(5):682–6. Griesbacher T. Blood pressure reflexes following activation of capsaicinsensitive afferent neurones in the biliopancreatic duct of rats. Br J Pharmacol 1994;111(2):547–54. Haber P, Nakamura M, Tsuchimoto K, Ishii H, Keogh GW, Apte MV, Moran CS, Stewart NL, Crawford DH, McCaughan GW, Ramm GA, Wilson JS, Nishino H, Kohno M, Aizawa R, Tajima N, Maruyama K, Takahashi H, Matsushita S, Okuyama K, Yokoyama A, Nakamura Y, Shirakura K, Ishii H, Conigrave KM, Hu BF, Camargo Jr CA, Stampfer MJ, Willett WC, Rimm EB. Alcohol and the pancreas. Alcohol Clin Exp Res 2001;25(5 Suppl. ISBRA):244S–250. Hingtgen CM, Waite KJ, Vasko MR. Prostaglandins facilitate peptide release from rat sensory neurons by activating the adenosine 3 0 ,5 0 cyclic monophosphate transduction cascade. J Neurosci 1995;15: 5411–9. Hoogerwerf WA, Zou L, Shenoy M, Sun D, Micci MA, Lee-Hellmich H, Xiao SY, Winston JH, Pasricha PJ. The proteinase-activated receptor 2 is involved in nociception. J Neurosci 2001;21:9036–42. Hoogerwerf WA, Shenoy M, Winston JH, Xiao SY, He Z, Pasricha PJ. Trypsin mediates nociception via the proteinase-activated receptor 2: a potentially novel role in pancreatic pain. Gastroenterology 2004;127(3): 883–91. Houghton AK, Kadura S, Westlund KN. Dorsal column lesions reverse the reduction of homecage activity in rats with pancreatitis. NeuroReport 1997;8(17):3795–800.
Kim EH, Hoge SG, Lightner AM, Grady EF, Coelho AM, Kirkwood KS. Activation of nociceptive neurons in T9 and T10 in cerulein pancreatitis. J Surg Res 2004;117(2):195–201. Laird JMA, Martinez-Caro L, Garcia-Nicas E, Cervero F. A new model of visceral pain and referred hyperalgesia in the mouse. Pain 2001;92: 335–42. Lu Y, Vera-Portocarrero LP, Westlund KN. Intrathecal coadministration of D-APV and morphine is maximally effective in a rat experimental pancreatitis model. Anesthesiology 2003;98(3):734–40. Mayer EA, Collins SM. Evolving pathophysiologic models of functional gastrointestinal disorders. Gastroenterology 2000;122(7):2032–48. McMahon SB, Jones NG. Plasticity of pain signaling: role of neurotrophic factors exemplified by acid-induced pain. J Neurobiol 2004;61(1): 72–87. Mendell LM, Albers KM, Davis BM. Neurotrophins, nociceptors, and pain. Microsc Res Tech 1999;45(4–5):252–61. Mogil JS, Crager SE. What should we be measuring in behavioral studies of chronic pain in animals? Pain 2004;112:12–15. Morris GP, Beck PL, Herridge MS, Depew WT, Szewczuk MR, Wallace J L. Hapten-induced model of chronic inflammation and ulceration in the rat colon. Gastroenterology 1989;96(3):795–803. Puig-Divi V, Molero X, Salas A, Guarner F, Guarner L, Malagelada J-R. Induction of chronic pancreatic disease by trinitrobenzene sulfonic acid infusion into rat pancreatic ducts. Pancreas 1996;13(4):417–24. Ray B, Neill CL. Abdominal visceral sensation in man. Ann Surg 1947;126: 709. Sharkey KA, Williams RG, Dockray GJ. Sensory substance P innervation of the stomach and pancreas. Gastroenterology 1984;87:914–21. Siegmund S, Haas S, Schneider A, Singer MV. Animal models in gastrointestinal alcohol research-a short appraisal of the different models and their results. Best Pract Res Clin Gastroenterol 2003;17(4): 519–42. Smiley MM, Lu Y, Vera-Portocarrero LP, Zidan A, Westlund KN. Intrathecal gabapentin enhances the analgesic effects of subtherapeutic dose morphine in a rat experimental pancreatitis model. Anesthesiology 2000;101(3):759–65. Su HC, Bishop AE, Power RF, Hamada Y, Polak JM. Dual intrinsic and extrinsic origins of CGRP- and NPY-immunoreactive nerves of rat gut and pancreas. J Neurosci 1987;7:2674–87. Toma H, Winston J, Micci M-A, Shenoy M, Pasricha PJ. Nerve growth factor is upregulated in the rat model of L-Arginine-induced acute pancreatitis. Gastroenterology 2000;119:1373–81. Vera-Portocarrero LP, Westlund KN. Attenuation of nociception in a model of acute pancreatitis by an NK-1 antagonist. Pharmacol Biochem Behav 2004;77(3):631–40. Vera-Portocarrero LP, Lu Y, Westlund KN. Nociception in persistent pancreatitis in rats: effects of morphine and neuropeptide alterations. Anesthesiology 2003;98(2):474–84. Warshaw AL, Banks PA, Fernandez-Del Castillo C. AGA technical review: treatment of pain in chronic pancreatitis. Gastroenterology 1998; 115(3):765–76. Winston JH, Toma H, Shenoy M, He Z-J, Zou L, Xiao S-Y, Micci MA, Pasricha PJ. Acute pancreatitis results in referred mechanical hypersensitivity and neuropeptide up-regulation that can be suppressed by the protein kinase inhibitor k252a. J Pain 2003; 4(6):329–37. Won MH, Park HS, Jeong YG, Park HJ. Afferent innervation of the rat pancreas: retrograde tracing and immunohistochemistry in the dorsal root ganglia. 1998;16:80–7. Zhang L, Zhang X, Westlund KN. Restoration of spontaneous exploratory behaviors with an intrathecal NMDA receptor antagonist or a PKC inhibitor in rats with acute pancreatitis. Pharmacol Biochem Behav 2004;77(1):145–53.
Molecular and behavioral changes in nociception in a novel rat model of chronic pancreatitis for the study of pain John H. Winstona, Zhi-Jun Hea, Mohan Shenoya, Shu-Yuan Xiaob, Pankaj Jay Pasrichaa,* a
Division of Gastroenterology and Hepatology, Department of Internal Medicine, The University of Texas Medical Branch, 4.106 McCullough Building, 301 University Boulevard, Galveston TX 77555-0764, USA b Department of Pathology, The University of Texas Medical Branch, Galveston, TX, USA Received 7 March 2005; received in revised form 3 June 2005; accepted 13 June 2005
Abstract The approach to the management of painful chronic pancreatitis has been empirical, primarily due to the lack of information about biological mechanisms producing pain. To facilitate research into pain mechanisms, our aim was to assess a rat model of chronic pancreatitis induced by pancreatic infusion of trinitrobenzene sulfonic acid as a model of painful pancreatitis. Nociception was assessed by measuring mechanical sensitivity of the abdomen and by recording the number of nocifensive behaviors in response to electrical stimulation of the pancreas. Expression of neuropeptides calcitonin gene-related peptide (CGRP) and substance P (SP) in the thoracic dorsal root ganglia receiving input from the pancreas and nerve growth factor (NGF) in the pancreas were measured. Rats with pancreatitis exhibited marked increase in sensitivity to mechanical probing of the abdomen and increased sensitivity to noxious electrical stimulation of the pancreas. There were significant increases in NGF protein in the pancreas and in expression of neuropeptides CGRP and SP in the sensory neurons from dorsal root ganglia receiving input from the pancreas. We have established quantitative measures of referred nociception and pancreatic hyperalgesia in a rat model of chronic pancreatitis that bears histological similarities to the human disease. This model has considerable construct, face and predictive validity for the human condition. It is of importance for the study of the pathogenesis of pain in this condition and can facilitate the development of new therapeutic options. q 2005 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.
1. Introduction The approach to the management of pain in patients with chronic pancreatitis has been empirical primarily due to the lack of information about biological mechanisms producing pain (DiMagno, 1999). A rodent model would facilitate research into pain mechanisms in chronic pancreatitis and help identify novel therapeutic targets. Previous studies have measured nociception in rat models of acute pancreatitis (Houghton et al., 1997; Smiley et al., 2000; Zhang et al., 2004) or pancreatitis that persists for seven to ten days (Vera-Portocarrero et al., 2003; Winston et al., 2003) Abbreviations: CGRP, calcitonin gene related peptide; NGF, nerve growth factor; SP, substance P; TNBS, trinitrobenzene sulfonic acid; VFF, Von Frey Filament. * Corresponding author. Tel.: C1 409 747 3082; fax: C1 409 772 4789. E-mail address: [email protected] (P.J. Pasricha).
by several methods including reductions in exploratory activity, as quantified by video tracking (Houghton et al., 1997; Vera-Portocarrero and Westlund, 2004; Zhang et al., 2004), sensitivity of the abdomen to mechanical stimulation as a measure of referred pain (Vera-Portocarrero et al., 2003; Winston et al., 2003), and direct delivery of noxious chemicals to the pancreas via an indwelling catheter (Hoogerwerf et al., 2004; Lu et al., 2003). These models have significant limitations. In humans, chronic pancreatitis is a progressive disease that often lasts for years without recovery (Ammann and Muellhaupt, 1999) and it is likely that there are significant differences between the neurobiology of these relatively acute inflammatory periods and a chronic inflammatory disease. Further, the assays used in these reports may also be problematic. Mechanical sensitivity of the abdomen does not necessarily implicate changes in the pancreas as the cause of the hypersensitivity, and changes in exploratory behavior can often be
0304-3959/$20.00 q 2005 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.pain.2005.06.013
J.H. Winston et al. / Pain 117 (2005) 214–222
confounded by effects due to sickness, disorientation, anxiety/depression and/or motor defects (Mogil and Crager, 2004). We therefore developed a more direct assay of pancreatic nociception in an animal model more representative of the human disease. A rat model with many histopathological similarities to the human disease including mono—and polymorphonuclear cell infiltrates, areas of fibrosis, duct strictures, dilated ducts and glandular atrophy was developed and characterized by (Puig-Divi et al., 1996). Unlike previously studied models, in our model inflammation and progressive fibrosis was seen for at least 6 weeks. Our aims were to assess this model as suitable for studying pancreatic nociception through application of both an established methodology, mechanical sensitivity of the abdomen, and electrical stimulation. We adapted a previously reported method (Bliss et al., 1950; Griesbacher, 1994) to apply a noxious electrical stimulus directly to the pancreas, using surgically implanted electrodes. The response was then measured by a simple numeration of pain-related nocifensive behaviors (Laird et al., 2001). To correlate changes in nociceptive behavior with neurochemical changes associated with pain, we also examined expression of molecules previously shown to be up-regulated in models of acute pancreatitis: nerve growth factor (NGF) in the pancreas (Toma et al., 2000) and calcitonin gene-related peptide (CGRP) and substance P (SP) in thoracic DRG and spinal cord segments (Vera-Portocarrero et al., 2003; Winston et al., 2003).
215
TNBS, nZ7) were tested before and 3 weeks after induction of pancreatitis. Testing was performed as described previously (Winston et al., 2003). Briefly, prior to testing, the belly was shaved and areas designated for stimulation were marked in relation to fore and hind limbs. Rats were placed in a plastic cage with a mesh floor and were given 30 min to adapt before testing. VFF of various calibers (Stoelting, Wood Dale, IL) were applied in ascending order to the abdomen 10 times each for 1–2 s with a 10 s interval between applications. A positive response consisted of the rat raising its belly (withdrawal response). The data were expressed as a percentage of the number of positive responses with each filament for each rat. All the tests were performed in a blinded manner. 2.3. Electrical stimulation After infusion of the pancreatic duct with vehicle (nZ5) or TNBS (nZ5), a pair of electrodes was attached to the pancreas and externalized behind the head. Rats were tested 3 weeks after infusion. Rats received successive applications of current at 2, 5 and 10 mA for 5 min with 20 min rest between stimulation periods. The number of nocifensive behaviors observed during 5 min of stimulation period were counted. Behaviors consisted of stretching, licking the abdomen and contraction of abdominal wall muscles and extension of the hind limbs as previously described in visceral pain models such as duodenal (DeLeo et al., 1989), colonic (Laird et al., 2001) and pancreatic pain (Lu et al., 2003). One week after testing, rats were again tested for nocifensive behaviors for 5 min at 5 mA. Then buprenorphine was administered subcutaneously at a dose of 0.1 mg/kg, and the rats were re-tested 2 h later. 2.4. Pancreatic histology and immunohistochemistry
A total of 60 male Sprague–Dawley rats (250–300 g) were used in all experiments. All procedures performed on animals were approved by the Institutional Animal Care and Use Committee (IACUC), UTMB. Animals were given free access to drinking water and standard food pellets until 12 h prior to induction of pancreatitis, at which point food was withdrawn. Pancreatitis was induced as previously described (Puig-Divi et al., 1996). Briefly, the common bile duct was closed temporarily near the liver with a small vascular clamp. A blunt 28 gauge needle with PE10 tubing attached was inserted into the duodenum and was guided through the papilla into the duct and was secured with suture. 0.5 ml of a 2% solution of Trinitrobenzene Sulfonic Acid (TNBS), in 10% ethanol in Phosphate Buffered Saline (PBS), pH 7.4 or vehicle was infused into the pancreatic duct over a period of 2–5 min at a pressure of 50 mmHg. After 30 min exposure to TNBS, needle and tubing were removed, the hole in the duodenum was sutured and the vascular clamp was removed restoring the bile flow.
The pancreas was fixed in 10% formalin in phosphate buffered saline (PBS) containing 1.0 mM MgCl2 at 4 8C overnight. Sections from paraffin-embedded specimens were stained with hematoxyline and eosin and observed under a light microscope (BX60, Olympus, Tokyo, Japan). The severity of pancreatitis was evaluated based upon the appearance of segmental gland atrophy, periductular and intralobular fibrosis, and presence of acute and chronic inflammatory infiltrates. For immunohistochemistry, deparaffinized sections were incubated in 0.3% H2O2 in distilled water for 30 min at room temperature (RT). After blocking in 5% normal goat serum (Vectastain ABC Kit, Vector Laboratories,) in PBS containing 0.3% Triton X-100 (Fisher Scientific, Pittsburgh, PA) for 30 min, sections were incubated overnight at 4 8C with NGF antibody (1/100, sc-549 Santa Cruz Biotechnology, Santa Cruz, CA) or insulin antibody (1/1000, Biomeda, Foster City, CA). Antibody binding was visualized using Vectastain ABC Kit (Vector Laboratories, Burlingame, CA) reagents and protocols. Slides were examined under a light microscope equipped with a video camera system (Nikon, Tokyo, Japan). In control experiments, staining was not observed when the NGF antibody was preincubated with a blocking peptide or if only a secondary antibody was used.
2.2. Von frey filament (VFF) testing
2.5. Serum amylase
In the time course study, 12 rats, (vehicle, nZ5, TNBS, nZ7) were tested before and once weekly for up to 6 weeks after induction of pancreatitis. In the dose–response study, rats (controls, nZ9,
Blood samples were collected by cardiac puncture at time of sacrifice and were allowed to clot. They were centrifuged at 10,000!g for 10 min at room temperature and were stored at 4 8C
2. Materials and methods 2.1. Animals and surgical procedures
216
J.H. Winston et al. / Pain 117 (2005) 214–222
until assayed. Serum amylase was measured by a commercial solution-based kit (Enzcheck Ultra Amylase assay kit, Molecular Probes, Eugene, Oregon). 2.6. NGF Tissue extracts were prepared as described (Toma et al., 2000) from four rats in each group (a subset of the rats used for the VFF dose–response curve) and NGF protein content was measured by ELISA using the NGF Emax immunoassay system ELISA kit (Promega, Madison, WI). 2.7. Extraction of total RNA from DRG and Quantitative RT-PCR Rats (nZ4 each group; a subset of the rats used for the VFF dose–response curve) were perfused with 200 ml ice-cold Tyrode’s after anesthesia. Dorsal root ganglia (DRG) from T9 to T11 of both sides of the spinal cord were collected from each rat at the time of sacrifice and snap frozen on dry ice. Total RNA was extracted from the DRG by modified guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987) and was treated with DNase I (RQ1, Promega, Madison, WI) in the presence of 20 units Rnasin (Promega, Madison, WI) at 37 8C for 30 min. RNA concentration was measured at 260 nM with DU 640B Spectrophotometer (Beckman, USA). TAQMAN two-step RT-PCR was performed using reagents and protocols supplied by Applied Biosystems, Foster City, CA on an Applied Biosystems SDS 5700 system. The following forward primer, reverse primer and probe sets were used, PPT: atccgacagtgaccaaatcaag, tcttcgggcgattctctgaa, caatgcccgagccctttgagcat, CGRP: actgcccagaagagatcctgc, gacctgctcagcaagcctg, cactgccacctgcgtgacccat, GAPDH: Applied Biosystems Rodent GAPDH kit. 2.8. Immunocytochemical analysis of spinal cord Rats (nZ4, each group) were anesthetized with sodium pentobarbital (50 mg/kg body weight, i.p.) and perfused with 150 ml of PBS followed by 400 ml of ice-cold freshly prepared 4% paraformaldehyde in PBS. Segments T8–T12 of the spinal cord were removed and post-fixed in 4% paraformaldehyde for 24 h at 4 8C, then placed in PBS (7.4) containing 30% sucrose for 24 h at 4 8C. Forty micron frozen sections (every third section) were stained for either CGRP or SP using a floating sections protocol (Oncogene Research Products, San Diego). The primary antibodies used were CGRP (1/500, Peninsula Laboratories), and SP (1/100, sc-9758 Santa Cruz Biotechnologies, Santa Cruz, CA) and antibody staining was visualized using a biotinylated secondary antisera and Vectorstain ABC peroxidase kit with DAB (Vector Laboratories, Burlingame, CA). The specificity of staining was assured by omitting the primary antibody. The amount of staining in lamina I/II outer was quantified using Metavision software (Universal Imaging Corporation, West Chester, PA) as follows: a defined area of staining in spinal cord lamina I and II outer was marked and the average intensity was measured (A2). The intensity of staining in a similar sized area in lamina III and IV was measured for each dorsal horn as background staining (A1). The amount of CGRP or SP staining in each section was calculated as the Log of the ratio of the staining intensities in these two areas (Log (A2/A1)).
2.9. Sensory neuron isolation and culture and CGRP release Three weeks following pancreatic infusion of TNBS (nZ7) or vehicle (nZ7), DRG T9–T11 were removed and placed in Hams F-12 medium. DRG L6-S1 were prepared separately. After stripping axons, ganglia were treated with collagenase (4 mg/ml) in Hams F-12 for 1 h at 37 8C. After washing with PBS, ganglia were treated with trypsin (2.5 mg/ml) for 15 min. A single cell suspension was obtained by trituration and neurons were enriched by centrifugation through a percoll cushion. Neurons were plated on polyornithine (0.01%, Sigma)/laminin coated 48 well tissue culture plates for CGRP release studies in high glucose DME supplemented with 10% FCS. Experiments were conducted within 6–18 h of plating. IR-CGRP release from DRG cultures was performed as described previously (Hingtgen et al., 1995). Briefly, neuron cultures were washed with Release Buffer (RB) (25 mM Hepes, pH7.4, 135 mM Nacl, 3.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 3.3 mM Glucose, 0.1%BSA, 1 mM phosphoramindon), and incubated for 10 min at 37 8C in RB plus 0.1% ethanol (capsaicin vehicle) to measure basal CGRP release. Fresh RB containing 50 nM capsaicin was added for an additional 10 min. IR-CGRP released by neurons was measured by ELISA. 2.10. Statistical analysis Data were expressed as mean (SEM). Statistical analyses were performed using proprietary software (SigmaStat, Systat Software Inc., Richmond, CA). Parametric t-tests, one-way or twoway repeated measures ANOVA were performed where appropriate. When significant main effects were observed, individual means were compared using the Tukey multiple comparison test, setting significance at P!0.05. For VFF testing. Response frequencies post-pancreatic infusion were compared to pre-infusion baseline response frequencies for each filament by two-way repeated measures ANOVA with treatment (TNBS or Vehicle) as the between-factor and time as the within-group factor. For Electrical Stimulation. Data were analyzed by repeated measures ANOVA with treatment as the between-factor and mA as the within-group factor. The effect of buprenorphine on nocifensive behaviors was analyzed by repeated measures ANOVA comparing baseline before treatment with response after drug treatment. For spinal cord immunohistochemistry. Data from 20 sections from each experimental group was averaged, expressed as meanGSEM. Ten sections/segment/rat were counted and averaged to produce a mean for each rat. Means were averaged and analyzed by two-way ANOVA (for treatment and segment).
3. Results 3.1. Referred mechanical hypersensitivity following TNBS infusion To determine the time course for the development of visceral pain after infusion of TNBS, we assessed abdominal sensitivity to probing with Von Frey filaments (VFF) before and every week thereafter up to 6 weeks. Mean response frequencies of TNBS treated rats were
J.H. Winston et al. / Pain 117 (2005) 214–222
217
rats 3 weeks after saline infusion were not significantly different compared to baseline at any filament tested (Fig. 1B). Response frequencies of rats 3 weeks after TNBS infusion were significantly higher at all filaments tested compared to both pretreatment baseline (PZ0.015) and to saline treated rats at 3 weeks (PZ0.003). Thus, pancreatic infusion of TNBS produced a marked increase in sensitivity to mechanical probing of the abdomen. 3.2. Pancreatic morphology and serum amylase
Fig. 1. Sensitivity of the abdomen to mechanical stimulation. (A) Response frequencies to mechanical stimulation of the abdomen with the 40.7 mN VFF before (BL) and up to 6 weeks after pancreatic infusion with TNBS (nZ7) or vehicle (nZ5) (*P!0.001). (B) Response frequencies to mechanical stimulation of the abdomen with VFF of various strengths before and 3 weeks after infusion of the pancreas with TNBS (nZ9) or vehicle (nZ7). Since baseline responses were similar for both groups, this data was pooled for graphical display. *P!0.05, **P!0.01 compared to vehicle at 3 weeks. CP!0.05,CCP!0.01 compared to baseline.
significantly elevated compared to saline treated rats at every time point tested up to 6 weeks and to pretreatment baseline (Fig. 1A, P!0.001). There was some variability in the mean response frequencies of TNBS treated rats from week to week; response frequencies at 4–6 weeks were significantly higher compared to response frequencies observed at 1–3 weeks. Saline treated rats showed no significant change in VFF response frequency at any time point tested. Next, we examined the sensitivity of TNBS and saline treated rats to VFF of various strengths from 2.75 to 120 mN at a single time point, 3 weeks, after pancreatic infusion. Response frequencies recorded before pancreatic infusions were similar for both groups; this data was pooled for graphical display (Fig. 1B). The response frequencies of
After VFF testing, the effect of TNBS or saline infusion on the pancreas was assessed by examination of H&E stained sections from the pancreas, and by measurement of serum amylase at 24 and 48 h and at 3 weeks. No significant morphological changes were observed in control rats (Fig. 2A). In TNBS treated rats, we observed inflammatory infiltrates, and large regions of acinar loss and periductular and intralobular fibrosis (Fig. 2B). Lost acinar tissue was replaced with tubular structures (Fig. 2C), but islets of Langerhans appeared to be intact. Similar pathology was observed in the pancreata of TNBS treated rats up to 6 weeks post-infusion (Fig. 2D). No significant pathology was observed in the liver or lungs of experimental rats at 3 weeks (data not shown). TNBS treated rats also showed a significant increase in serum amylase compared to controls at 24 h (12,700G1500 vs 4100G900 U/L P!0.001). At 3 weeks, no significant differences in amylase levels were seen, in keeping with the chronic nature of the inflammation (3820G440 vs 4220G450 U/L). Thus, pancreatic infusion of TNBS produced a long lasting pancreatitis as previously described (Puig-Divi et al., 1996). 3.3. Hypersensitivity to electrical stimulation To determine whether TNBS induced pancreatitis was associated with an increased sensitivity of the pancreas to noxious stimulation, electrical stimuli of increasing intensities were applied to the pancreas for 5 min each and the number of nocifensive behaviors that occurred during this stimulus period was counted. Increases in current from 2 to 10 mA mps produced a significant increase in the number of behaviors, PZ0.003 (Fig. 3A). At all three stimulus intensities examined, TNBS treated rats displayed a significantly greater number of nocifensive behaviors compared to saline treated rats, PZ0.012 (Fig. 3A). To confirm that the applied stimulus was specific for the pancreas, we compared the number of nocifensive behaviors evoked by a 5 mA stimulus before and after bilateral splanchnectomy. Splanchnectomy virtually eliminated the number of nocifensive behaviors whereas no significant change was observed in sham operated controls (data not shown).
218
J.H. Winston et al. / Pain 117 (2005) 214–222
Fig. 2. Effect of TNBS on pancreatic morphology. H&E stained sections from saline, A, or TNBS treated rat pancreas B, C, 3 weeks post-infusion. C. Higher magnification view of atrophied acini surrounded by inflammatory infiltrate. (Islet )) (D) TNBS treated pancreas 6 weeks post-infusion.
3.4. Effect of buprenorphine on hypersensitivity to electrical stimulation To examine the effect of analgesic treatment on electrically evoked nocifensive behavior, electrical stimulation at 5 mAmps was performed before and 2 h after administration of buprenorphine (0.1 mg/kg s.c.). After buprenorphine treatment, there was a significant decrease in the number of nocifensive behaviors in the TNBS treated group compared to its pre-treatment baseline (Fig. 3B, P! 0.0005). 3.5. NGF expression in the pancreas We measured NGF protein levels in the pancreas of saline and TNBS treated rats 3 weeks post-infusion. There was a significant increase in NGF protein in pancreas from TNBS treated rats compared to saline treated rats (187G 31.7 pg/mg vs 76.2G19.1, PZ0.01). In the pancreas from saline treated rats, NGF-like immunoreactivity (NGF-IR) was detected primarily in the islets and in the enodothelium of blood vessels and ducts (Fig. 4A,C). In pancreatic sections from TNBS treated rats, NGF-IR was observed in tubular structures in addition to duct and blood vessel endothelium and islets (Fig. 4B,E). To confirm that NGF expression was observed in islets, serial sections from both saline and TNBS treated rats were stained for insulin (Fig. 4C–F). Thus, NGF expression was detected in additional cell populations in TNBS-induced pancreatitis.
3.6. SP and CGRP expression in thoracic DRG We examined the effect of TNBS-induced pancreatitis on mRNA levels of SP (pre-pro-tachykinin, PPT) and CGRP in thoracic DRG T9–T11 that contain cell bodies of pancreatic afferent neurons by quantitative RT-PCR. In thoracic DRG T9–T11, both PPT (145% (10), P!0.02) and CGRP (117% (5), P!0.05) mRNA were significantly increased 3 weeks after induction of pancreatitis. To determine whether protein levels were also increased, we measured the intensity of SP and CGRP immunoreactivity (IR) in laminae I and II of spinal cord segments T8–T12 that contain spinal projections of nerve endings of pancreatic afferents. In spinal cord segment T10, SP-IR was increased 2.6 fold (P! 0.001) and CGRP-IR was increased 2.1 fold, (P!0.001) in TNBS treated rats compared to vehicle treated rats (Fig. 5A,B). There were no significant differences in SPIR or CGRP-IR between TNBS and Vehicle treated groups in the other spinal cord segments examined (data not shown). 3.7. Capsaicin-evoked CGRP release from thoracic DRG neurons To determine whether increased CGRP expression in thoracic DRG neurons produced increased stimulus-evoked release, we measured capsaicin-evoked CGRP release from acutely dissociated thoracic DRG neurons. CGRP release evoked by 50 nM capsaicin was significantly higher in DRG neurons from TNBS treated rats compared to DRG neurons
J.H. Winston et al. / Pain 117 (2005) 214–222
Fig. 3. The number of nocifensive behaviors evoked by electrical stimulation of the pancreas 3 weeks after pancreatic infusion with TNBS or vehicle. (A) Stimulus-response at 3 weeks post-infusion (nZ5). There was a significant overall effect of treatment PZ0.012. Comparison of individual means showed significant differences between control and TNBS treated rats at 2, 5 and 10 mA mps (*PZ0.042, ***PZ0.009, **PZ 0.014). (B) Effect of buprenorphine (0.1 mg/kg s.c.) treatment on the number of nocifensive behaviors evoked by a 5 mAmp stimulation for five minutes (#PZ0.0005 compared to pretreatment).
from saline treated rats in thoracic DRG (Table 1). There was no significant difference in capsaicin-evoked release from neurons isolated from lumbar/sacral DRG suggesting that this effect was specific for DRG receiving pancreatic afferents.
4. Discussion The incidence of chronic pancreatitis varies considerably amongst countries, ranging from 1.6 new cases per year per 100,000 population in Switzerland to 28 per year per 100, 000 in Japan, with about 65% of the cases attributed to alcohol use (Dufour and Adamson, 2003). Pancreatitis, acute or chronic, is also a significant contributor to the ‘burden of gastrointestinal disease’ in this country, according to a recent survey conducted by the American
219
Gastroenterological Association (Donowitz, 2001). In 1998, there were about 1.2 million prevalent cases, with 327,000 inpatient and 530,000 physician office visits. The estimated total direct cost for this group of diseases was $2.1 billion in 1998. Unfortunately, progress in our understanding of the biology of these diseases has been slow, particularly with respect to the pathogenesis of the cardinal symptom of pancreatitis i.e. pain. Our lack of knowledge about what causes pain in pancreatitis has been a serious obstacle to improvement of the care of these patients, leading to various empirical approaches that are often based on purely anatomical grounds, are generally highly invasive and at best of marginal value (Ammann and Muellhaupt, 1999; DiMagno, 1999; Warshaw et al., 1998). However, the study of the biology of pancreatic pain is a major challenge, in large part because of the anatomical location of this organ that prevents easy access for stimulation. Setting up valid models to study pancreatic pain is therefore an important first step in such an endeavor. In this study, we performed quantitative measurements of nociception on a rat model of chronic pancreatitis using both a previously validated method, mechanical sensitivity of the abdomen and a novel method, electrical stimulation of the pancreas. Rats with TNBS-induced pancreatitis showed a persistent mechanical hypersensitivity in the abdomen that was evident one week after TNBS infusion and persisted up to 6 weeks, the last time point examined. These findings correlated with the presence of a robust pancreatic inflammatory process, and extend and confirm the utility of mechanical sensitivity of somatic referral regions as a quantitative marker of visceral nociception (Bon et al., 2003; Laird et al., 2001). Two previous studies with this methodology used a model of selflimited pancreatitis and showed that abdominal hypersensitivity declined following resolution of the pancreatitis (Vera-Portocarrero et al., 2003; Winston et al., 2003). Thus, our model provides an opportunity to examine the effects of long-term, constant exposure to inflammatory mediators. A novel aspect of our study was a direct measure of pancreatic nociception. To this end, we applied electrical stimuli of various intensities directly to the pancreas, using surgically implanted electrodes. The responses counted consisted of stretching, licking the abdomen and contraction of abdominal wall muscles and extension of the hindlimbs as previously described in visceral pain models such as duodenal (DeLeo et al., 1989) colonic (Laird et al., 2001) and pancreatic pain (Lu et al., 2003). Thus, the stimulus protocol used here appears to be sufficient to activate nociceptors and to produce behavior indicative of pain. After the relatively brief stimuli used here, the pain behaviors subside indicating that the duration and intensity of the delivered stimulus can be controlled. After severing the splanchnic nerves, nocifensive behaviors are drastically reduced in response to pancreatic electrical stimulation showing that the stimulus is specific for the pancreas.
220
J.H. Winston et al. / Pain 117 (2005) 214–222
Fig. 4. NGF immunohistochemistry in pancreatic sections from control and TNBS treated rats 3 weeks post-induction A,B,C,E. Serial sections stained with an insulin antibody D, F. (A) Control, NGF. (B) TNBS, NGF. (C) Control, NGF (D) Control, Insulin. (E) TNBS, NGF. (F) TNBS, Insulin. (Islets ), ducts , tubular structures 3).
The number of nocifensive responses observed was dependent upon the magnitude of the stimulus delivered and TNBS induced pancreatitis resulted in a significant shift to the left of the stimulus response curve, confirming pancreatic nociceptive sensitization in our model. Subsequent treatment with buprenorphine resulted in significant attenuation of behavioral responses to noxious electrical stimulation of the pancreas showing that this assay can detect the effect of analgesic treatments. Although electrical stimulation is not a natural visceral stimulus, it has been shown to cause pain in both animals and humans. In a previous study in rats, electrical stimulation of the pancreas produced a drop in blood pressure a physiological indicator of nociception (Greisbacher, 1994). Electrical stimulation of the pancreas also produces pain in human subjects in a region specific manner (Bliss et al., 1950; Ray and Neill, 1947), thus providing additional validation for our method for the study of pancreatic nociception. A 2.5 fold up-regulation of NGF immunoreactivity was observed at 3 weeks post-induction in this model. An upregulation of similar magnitude but of shorter duration is observed in an acute pancreatitis model, with levels returning to normal with resolution of the pancreatitis
Fig. 5. Expression of nociceptive genes in spinal cord. (A) Immunohistochemical staining for SP and CGRP in spinal cord sections from segment T10 of saline and TNBS treated rats. (B). Histogram showing fold change in staining intensity in TNBS treated rats (*P!0.001, nZ4).
J.H. Winston et al. / Pain 117 (2005) 214–222 Table 1 Capsaicin-evoked CGRP release from acutely dissociated thoracic and lumbar/sacral DRG neurons CGRP-ir (ng/ml) Thoracic Lumbar/Sacral a
Vehicle TNBS Vehicle TNBS
Basal 0.37 (0.05) 0.48 (0.09) 0.24 (0.03) 0.30 (0.03)
50 nM Capsaicin 1.00 (0.11) 1.52a (0.18) 0.76 (0.03) 0.93 (0.16)
PZ0.03.
(Toma et al., 2000). In pancreatic sections from TNBS treated rats, NGF immunoreactivity was observed in tubular structures in addition to duct and blood vessel endothelium and islets, similar to what has been observed in human chronic pancreatitis. In a study investigating NGF expression in the pancreata of 24 patients with chronic pancreatitis (CP), enhanced NGF mRNA expression was present in metaplastic ductal cells, in degenerating acinar cells, and in acinar cells dedifferentiating into tubular structures (Friess et al., 1999). Since NGF sensitizes peptidergic nociceptors (McMahon and Jones, 2004; Mendell et al., 1999), our findings lend plausibility to the hypothesis that NGF plays a role in the pain of chronic pancreatitis. We have also shown an increased expression of the neurotransmitters SP and CGRP in animals with chronic pancreatitis. In thoracic DRGs T9–T11, containing pancreatic sensory neurons, both SP and CGRP mRNA were significantly increased 3 weeks after induction of pancreatitis. Although the magnitude of these increases, less than 1.5 fold, was small, this may be due to the fact that only a small subset of the neurons in these DRGs are actually pancreatic afferents. Stimulus-evoked release of CGRP from DRG neurons isolated from these same segments was significantly higher in DRG neurons from TNBS treated rats compared with DRG neurons from controls. Since CGRP and SP are found in the majority of pancreatic afferent nerves (Sharkey et al., 1984; Su et al., 1987; Won et al., 1998), it is possible that increased CGRP expression and/or increased sensitivity to capsaicin is responsible for the observed increase in stimulus-evoked CGRP release in cultures from TNBS treated rats. Increases in both SP and CGRP immunoreactivity were also observed in spinal cord segment T10 suggesting that increases in mRNA are accompanied by increases in protein levels. T10 is one of several spinal cord segments where c-fos expression is evoked by pancreatic infusion of noxious chemicals (Hoogerwerf et al., 2001; Kim et al., 2004). These data are consistent with a potential role for increased spinal neuropeptide release in pancreatic pain. Up-regulation of both SP and CGRP are reported in an acute model induced by L-arginine (Winston et al., 2003) as well as in a self-limited model of pancreatic sensitization (Vera-Portocarrero et al., 2003) and there
221
is circumstantial evidence implicating these factors in the pain of humans with chronic pancreatitis. Thus, Buchler et al. (1992) have demonstrated a marked intensification of the immunostaining for CGRP and substance P (which were co-expressed) in nerve fibers in specimens from chronic pancreatitis. Finally, it is quite possible that these changes in expression are being driven by excessive NGF production in the pancreas. In general, the utility of an animal model of disease may be assessed based on its construct validity (consistence with a particular theoretical rationale behind its development), face validity (resemblance to clinical or pathophysiological characteristics of the clinical condition), and predictive validity (prediction of response to treatment) (Mayer and Collins, 2000). Evidence for construct validity of our model comes from the morphological findings that resemble human pancreatitis. TNBS was first described as a potent agent for inducing chronic colitis via modification of endogenous proteins and induction of a vigorous immunological injury, resulting in chronic inflammation (Morris et al., 1989). Most forms of chronic pancreatitis in adults result from excessive alcohol intake but it has been exceedingly difficult to create a reliable rodent model of chronic alcoholic pancreatitis (Buckelew and Schenker, 1998; Siegmund et al., 2003). The pathophysiology of alcoholic pancreatitis is probably complex and involves several factors including direct acinar injury, changes in exocrine juice composition and ductular lesions, oxidative stress, conjugation with fatty acid ethyl esters, stellate cell activation, and neuroimmune mechanisms (Apte and Wilson, 2003; Berberat et al., 2000; Haber et al., 2001). However, for the purpose of studying nociceptive mechanisms, it is reasonable to assume that the neurobiological changes accompanying advanced chronic inflammation are likely to be similar, regardless of the nature of the initiating injury. Thus, chronic pancreatitis of various etiologies results in similar increases in nerve size and other neural alterations in humans (Friess et al., 2002). The behavioral assays for pain provide evidence of face validity of our model for studying pancreatic pain. This is further strengthened by the changes in expression and release of neurotransmitters. Finally, the predictive validity is borne out by the response to analgesics and splanchnectomy. In conclusion, we believe that this model is of considerable importance for the study of the pathogenesis of pain in this condition and can facilitate the development of new therapeutic options.
Acknowledgements This research was supported by a grant from the National Institutes of Health (RO1 DK62330-01) to PJP.
222
J.H. Winston et al. / Pain 117 (2005) 214–222
References Ammann RW, Muellhaupt B. The natural history of pain in alcoholic chronic pancreatitis. Gastroenterology 1999;116:1132–40. Apte MV, Wilson JS. Alcohol-induced pancreatic injury. Best Pract Res Clin Gastroenterol 2003;17(4):593–612. Berberat PO, Friess H, Buchler MW. Chronic pancreatitis—new pathophysiological concepts. Swiss Surg 2000;6(5):227–30. Bliss WR, Burch B, Martin MM, Zollinger RM. Localization of referred pancreatic pain induced by electric stimulation. Gastroenterology 1950; 16(2):317–23. Bon K, Lichtensteiger CA, Wilson SG, Mogil JS. Characterization of cyclophosphamide cystitis, a model of visceral and referred pain, in the mouse: species and strain differences. J Urol 2003;170:1008–12. Buchler M, Weihe E, Friess H, Malfertheiner P, Bockman E, Muller S, Nohr D, Beger HG. Changes in peptidergic innervation in chronic pancreatitis. Pancreas 1992;7(2):183–92. Buckelew DQ, Schenker S. Pathogenesis of alcoholic pancreatitis—a peak into a black box. Alcohol Clin Exp Res 1998;22(2):550–2. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9. DeLeo JA, Colburn RW, Coombs DW, Ellis MA. The differentiation of NSAIDs and prostaglandin action using a mechanical visceral pain model in the rat. Pharmacol Biochem Behav 1989;33(1):253–5. DiMagno EP. Toward understanding (and management) of painful chronic pancreatitis. Gastroenterology 1999;116(5):1252–7. Donowitz M. Burden of gastrointestinal diseases. Bethesda: AGA Publications; 2001. Dufour MC, Adamson MD. The epidemiology of alcohol-induced pancreatitis. Pancreas 2003;27:286–90. Friess H, Zhu ZW, di Mola FF, Kulli C, Graber HU, Andren-Sandberg A, Zimmermann A, Korc M, Reinshagen M, Buchler MW. Nerve growth factor and its high-affinity receptor in chronic pancreatitis. Ann Surg 1999;230(5):615–24. Friess H, Shrikhande S, Shrikhande M, Martignoni M, Kulli C, Zimmermann A, Kappeler A, Ramesh H, Buchler M. Neural alterations in surgical stage chronic pancreatitis are independent of the underlying aetiology. Gut 2002;50(5):682–6. Griesbacher T. Blood pressure reflexes following activation of capsaicinsensitive afferent neurones in the biliopancreatic duct of rats. Br J Pharmacol 1994;111(2):547–54. Haber P, Nakamura M, Tsuchimoto K, Ishii H, Keogh GW, Apte MV, Moran CS, Stewart NL, Crawford DH, McCaughan GW, Ramm GA, Wilson JS, Nishino H, Kohno M, Aizawa R, Tajima N, Maruyama K, Takahashi H, Matsushita S, Okuyama K, Yokoyama A, Nakamura Y, Shirakura K, Ishii H, Conigrave KM, Hu BF, Camargo Jr CA, Stampfer MJ, Willett WC, Rimm EB. Alcohol and the pancreas. Alcohol Clin Exp Res 2001;25(5 Suppl. ISBRA):244S–250. Hingtgen CM, Waite KJ, Vasko MR. Prostaglandins facilitate peptide release from rat sensory neurons by activating the adenosine 3 0 ,5 0 cyclic monophosphate transduction cascade. J Neurosci 1995;15: 5411–9. Hoogerwerf WA, Zou L, Shenoy M, Sun D, Micci MA, Lee-Hellmich H, Xiao SY, Winston JH, Pasricha PJ. The proteinase-activated receptor 2 is involved in nociception. J Neurosci 2001;21:9036–42. Hoogerwerf WA, Shenoy M, Winston JH, Xiao SY, He Z, Pasricha PJ. Trypsin mediates nociception via the proteinase-activated receptor 2: a potentially novel role in pancreatic pain. Gastroenterology 2004;127(3): 883–91. Houghton AK, Kadura S, Westlund KN. Dorsal column lesions reverse the reduction of homecage activity in rats with pancreatitis. NeuroReport 1997;8(17):3795–800.
Kim EH, Hoge SG, Lightner AM, Grady EF, Coelho AM, Kirkwood KS. Activation of nociceptive neurons in T9 and T10 in cerulein pancreatitis. J Surg Res 2004;117(2):195–201. Laird JMA, Martinez-Caro L, Garcia-Nicas E, Cervero F. A new model of visceral pain and referred hyperalgesia in the mouse. Pain 2001;92: 335–42. Lu Y, Vera-Portocarrero LP, Westlund KN. Intrathecal coadministration of D-APV and morphine is maximally effective in a rat experimental pancreatitis model. Anesthesiology 2003;98(3):734–40. Mayer EA, Collins SM. Evolving pathophysiologic models of functional gastrointestinal disorders. Gastroenterology 2000;122(7):2032–48. McMahon SB, Jones NG. Plasticity of pain signaling: role of neurotrophic factors exemplified by acid-induced pain. J Neurobiol 2004;61(1): 72–87. Mendell LM, Albers KM, Davis BM. Neurotrophins, nociceptors, and pain. Microsc Res Tech 1999;45(4–5):252–61. Mogil JS, Crager SE. What should we be measuring in behavioral studies of chronic pain in animals? Pain 2004;112:12–15. Morris GP, Beck PL, Herridge MS, Depew WT, Szewczuk MR, Wallace J L. Hapten-induced model of chronic inflammation and ulceration in the rat colon. Gastroenterology 1989;96(3):795–803. Puig-Divi V, Molero X, Salas A, Guarner F, Guarner L, Malagelada J-R. Induction of chronic pancreatic disease by trinitrobenzene sulfonic acid infusion into rat pancreatic ducts. Pancreas 1996;13(4):417–24. Ray B, Neill CL. Abdominal visceral sensation in man. Ann Surg 1947;126: 709. Sharkey KA, Williams RG, Dockray GJ. Sensory substance P innervation of the stomach and pancreas. Gastroenterology 1984;87:914–21. Siegmund S, Haas S, Schneider A, Singer MV. Animal models in gastrointestinal alcohol research-a short appraisal of the different models and their results. Best Pract Res Clin Gastroenterol 2003;17(4): 519–42. Smiley MM, Lu Y, Vera-Portocarrero LP, Zidan A, Westlund KN. Intrathecal gabapentin enhances the analgesic effects of subtherapeutic dose morphine in a rat experimental pancreatitis model. Anesthesiology 2000;101(3):759–65. Su HC, Bishop AE, Power RF, Hamada Y, Polak JM. Dual intrinsic and extrinsic origins of CGRP- and NPY-immunoreactive nerves of rat gut and pancreas. J Neurosci 1987;7:2674–87. Toma H, Winston J, Micci M-A, Shenoy M, Pasricha PJ. Nerve growth factor is upregulated in the rat model of L-Arginine-induced acute pancreatitis. Gastroenterology 2000;119:1373–81. Vera-Portocarrero LP, Westlund KN. Attenuation of nociception in a model of acute pancreatitis by an NK-1 antagonist. Pharmacol Biochem Behav 2004;77(3):631–40. Vera-Portocarrero LP, Lu Y, Westlund KN. Nociception in persistent pancreatitis in rats: effects of morphine and neuropeptide alterations. Anesthesiology 2003;98(2):474–84. Warshaw AL, Banks PA, Fernandez-Del Castillo C. AGA technical review: treatment of pain in chronic pancreatitis. Gastroenterology 1998; 115(3):765–76. Winston JH, Toma H, Shenoy M, He Z-J, Zou L, Xiao S-Y, Micci MA, Pasricha PJ. Acute pancreatitis results in referred mechanical hypersensitivity and neuropeptide up-regulation that can be suppressed by the protein kinase inhibitor k252a. J Pain 2003; 4(6):329–37. Won MH, Park HS, Jeong YG, Park HJ. Afferent innervation of the rat pancreas: retrograde tracing and immunohistochemistry in the dorsal root ganglia. 1998;16:80–7. Zhang L, Zhang X, Westlund KN. Restoration of spontaneous exploratory behaviors with an intrathecal NMDA receptor antagonist or a PKC inhibitor in rats with acute pancreatitis. Pharmacol Biochem Behav 2004;77(1):145–53.