reductase member 3 (DHRS3)

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 Chemico-Biological Interactions xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint 5 6

Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3)

3 4 7 8 9 10 11 12 1 2 4 4 15 16 17 18 19 20 21 22 23

Q1

Tereza Lundová a, Lucie Zemanová a, Beata Malcˇeková a, Adam Skarka a, Hana Štambergová a, Jana Havránková a, Miroslav Šafr b, Vladimír Wsól a,⇑ a b

Department of Biochemical Sciences, Faculty of Pharmacy in Hradec Králové, Charles University in Prague, Heyrovského 1203, 500 05 Hradec Králové, Czech Republic Institute of Legal Medicine, Faculty of Medicine, Charles University and University Hospital in Hradec Králové, Sokolská 581, 500 05 Hradec Králové, Czech Republic

a r t i c l e

i n f o

Article history: Available online xxxx Keywords: DHRS3 retSDR1 Expression Membrane topology Reductase activity

a b s t r a c t Dehydrogenase/reductase (SDR family) member 3 (DHRS3), also known as retinal short-chain dehydrogenase/reductase (retSDR1) is a member of SDR16C family. This family is thought to be NADP(H) dependent and to have multiple substrates; however, to date, only all-trans-retinal has been identified as a DHRS3 substrate. The reductive reaction catalysed by DHRS3 seems to be physiological, and recent studies proved the importance of DHRS3 for maintaining suitable retinoic acid levels during embryonic development in vivo. Although it seems that DHRS3 is an important protein, knowledge of the protein and its properties is quite limited, with the majority of information being more than 15 years old. This study aimed to generate a more comprehensive characterisation of the DHRS3 protein. Recombinant enzyme was prepared and demonstrated to be a microsomal, integral-membrane protein with the C-terminus oriented towards the cytosol, consistent with its preference of NADPH as a cofactor. It was determined that DHRS3 also participates in the metabolism of other endogenous compounds, such as androstenedione, estrone, and DL-glyceraldehyde, and in the biotransformation of xenobiotics (e.g., NNK and acetohexamide) in addition to all-trans-retinal. Purified and reconstituted enzyme was prepared for the first time and will be used for further studies. Expression of DHRS3 was shown at the level of both mRNA and protein in the human liver, testis and small intestine. This new information could open other areas of DHRS3 protein research. Ó 2014 Elsevier Ireland Ltd. All rights reserved.

25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

45 46

1. Introduction

47

Dehydrogenase/reductase (SDR family) member 3 (DHRS3), also known as a retinal short-chain dehydrogenase/reductase 1 (retSDR1) or SDR16C1, is a member of the SDR superfamily representing a large and diverse group of more than 163,000 members with low (20–30%) sequence similarity. Over 75 SDR genes were identified

48 49 50 51

Abbreviations: SDR, short-chain dehydrogenases/reductases; DHRS3, dehydrogenase/reductase (SDR family) member 3; retSDR1, retinal short-chain dehydrogenase/reductase 1; RA, retinoic acid; ER, endoplasmic reticulum; DOPC, 1,2-dioleoyl-sn-glycero-3-phosphocholine; DOPS, 1,2-dioleoyl-sn-glycero-3-phospho-L-serine; DPPC, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine; DPPE, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine; qPCR, quantitative polymerase chain reaction; Sf9-Mi-DHRS3, Sf9 microsomes containing overexpressed DHRS3; NNK, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone. ⇑ Corresponding author. Tel.: +420 739488218. E-mail addresses: [email protected] (T. Lundová), [email protected] (L. Zemanová), [email protected] (B. Malcˇeková), [email protected] (A. Skarka), [email protected] (H. Štambergová), [email protected] (J. Havránková), [email protected] (M. Šafr), [email protected] (V. Wsól).

within the human genome [1]. Based on cofactor and substrate binding sequence motifs, seven types of SDRs have been distinguished. The most common, the classical SDR type, comprises the SDR16C family, including DHRS3 [1,2]. DHRS3 was described for the first time by Haeseleer et al. [3] as an enzyme localised predominantly in the cone photoreceptors of outer segment in bovine retina. It was speculated that DHRS3 could participate in the reduction of all-trans-retinal in the visual cycle [3]; consequently, further studies were focused on its role in retinoid metabolism. However, retinoids also play an important role in the control of cell proliferation and differentiation, therefore enzymes involved in their metabolism may affect these processes [4]. It was shown that mRNA encoding DHRS3 is present in some extraocular human tissues such as liver, pancreas, and testis, but knowledge regarding DHRS3 protein expression is insufficient [3,5,6]. There have also been some initial suggestions of DHRS3 regulation, as this enzyme is strongly induced by retinoic acid (RA) in human neuroblastoma and leukemic monocyte cell lines [5,7]. DHRS3 catalyses the reduction of all-trans-retinal, which is

http://dx.doi.org/10.1016/j.cbi.2014.10.018 0009-2797/Ó 2014 Elsevier Ireland Ltd. All rights reserved.

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 2

T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx

87

the opposite reaction of RA formation [3,8]. DHRS3 overexpression in the aforementioned cases was experimentally proven to be connected with increased formation of retinyl esters, the storage form of RA [5]. Another mechanism for activation of DHRS3 expression, i.e. via p53 family of transcription factors, has been described [9]. A significant role for DHRS3 in maintaining RA levels during embryonic development was recently indicated by two in vivo studies utilising DHRS3-deficient mouse and Xenopus laevis embryos [10,11]. Although it seems that the DHRS3 enzyme is a physiologically important enzyme due to its participation in retinoid metabolism, knowledge of the protein itself is quite poor, and the majority of available information is more than 15 years old [3]. This study aimed to bring new knowledge to the unexplored areas of DHRS3 properties such as membrane topology, enzyme activity toward carbonyl bearing substrates other than all-transretinal, a description of purified and reconstituted protein and expression in the human tissues.

88

2. Materials and methods

89

2.1. Chemicals

90

108

For cloning and preparation of recombinant DHRS3, the following reagents were used: Platinum Pfx DNA polymerase (Invitrogen, USA), T4 DNA polymerase (Fermentas, Lithuania), BfuAI restriction enzyme (New England Biolabs, USA), XL1-Blue supercompetent cells (Stratagene, USA), DH10Bac cells, Sf9 (Spodoptera frugiperda) cells (Invitrogen, USA), and the Nanofectin kit (PAA, Austria). C12E8, DDM, Igepal CA-630 (Sigma–Aldrich, Czech Republic) and digitonin (Merck, Germany) detergents were used for solubilisation. 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), and 1,2-dipalmitoylsn-glycero-3-phosphoethanolamine (DPPE) phospholipids were purchased from Avanti Polar Lipids (USA) for liposome preparation. For western blotting, membrane and non-fat dry milk from Bio-Rad (USA) were used. Substrates, cofactors for enzymatic assays and HPLC analytical standards were purchased from Sigma–Aldrich (Czech Republic) and Toronto Research Chemical (Canada). Other high-purity chemicals were obtained from Sigma–Aldrich (Czech Republic) or Penta (Czech Republic).

109

2.2. Tissue samples

110

119

A collection of 16 human tissue samples was obtained from the Institute of Legal Medicine, Faculty of Medicine of Charles University and University Hospital in Hradec Králové, Czech Republic, after the sudden death of a middle aged male 3 subjects without apparent disease. Samples were collected following autopsy during a short post-mortem interval in accordance with Czech legislation. Removal and usage of human tissue samples was approved by the responsible ethics committee. Samples for RNA isolation were immediately placed in RNAlater (QIAGEN, Germany) and stored at 20 °C. Samples for protein isolation were stored at 80 °C.

120

2.3. Cloning and expression of DHRS3 in Sf9 cells

121

The full-length human DHRS3 cDNA sequence was obtained from the SGC clone collection (accession number BC002730). The cloning and expression of recombinant DHRS3 in insect Sf9 cells using the Baculovirus expression system (Invitrogen, USA) was carried out as previously described for another DHRS enzyme [12]. Briefly, DHRS3 cDNA was amplified by PCR using Platinum Pfx DNA Polymerase and specific primers (fwd, 50 -TTAAGAAGGAGATATACTATGGTGTGGAAACGG-30 ; rev, 50 -GATTGGAAGTAGAGGTTCTC-

71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86

91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107

111 112 113 114 115 116 117 118

122 123 124 125 126 127 128

TGCCTATGTCCGCCCT-30 ). The resulting insert was cloned into the pFB-CT10HF-LIC transfer vector, enabling transposition into the recombinant bacmid in DH10Bac cells. Isolated bacmid DNA was transfected into Sf9 cells using the Nanofectin kit according to the manufacturer’s instructions. The resulting recombinant virus was amplified and used to produce recombinant DHRS3.

129

2.4. Preparation of DHRS3 microsomal fraction

135

Sf9 cell suspension cultures were infected with recombinant DHRS3 virus and incubated for 65 h at 27 °C. Sf9 microsomes containing overexpressed DHRS3 (Sf9-Mi-DHRS3) were obtained by differential centrifugation similarly to the method described for the DHRS7 enzyme [12] and resuspended in a solution of 0.1 M potassium phosphate buffer (pH 7.5), 50 mM potassium chloride, 1.1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 0.5 mM AEBSF, and 20% (v/v) glycerol.

136

2.5. Sequence analysis

144

Bioinformatics on-line programs SOSUI (http://bp.nuap.nagoyau.ac.jp/sosui/) [13], PSORT II (http://psort.hgc.jp/form2.html) [14], HMMTOP (http://www.enzim.hu/hmmtop/html/submit.html) [15], TMpred (http://www.ch.embnet.org/software/TMPRED_form. html) [16] and PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred/) [17] were used to predict transmembrane regions of human enzyme DHRS3. Amino acid sequences of SDR16C family members were aligned by the on-line ClustalW program (http://www.ebi.ac.uk/ Tools/msa/clustalw2/) [18].

145

2.6. Determination of membrane topology

154

Sf9-Mi-DHRS3 microsomes were used for three assays to determine membrane topology. Alkaline extraction was performed based on Lapshina et al. [19] with minor modifications. Samples of Sf9 microsomes (500 lg of protein in 50 ll) were adjusted to a volume of 500 ll with 0.1 M sodium phosphate buffer (pH 7.4) containing 1.2% Triton X-100 or 0.1 M sodium carbonate (pH 11.5). Samples were incubated on a rotator at 4 °C for 30 min and subsequently centrifuged at 105,000g at 4 °C for 60 min. Pellets were resuspended in 50 ll of 0.1 M sodium phosphate buffer. Supernatants were precipitated by the addition of an equal volume of ice-cold 72% trichloroacetic acid at 4 °C for 10 min and centrifuged at 11,000 rpm for 3 min. The resulting pellets were washed twice with ice-cold acetone, dried and dissolved in 50 ll of 0.1 M sodium phosphate buffer. Then, 10 ll of the resulting samples corresponding to the supernatants and pellets after extraction were used for DHRS3 detection. For protease protection assay, microsomes (10 or 30 lg diluted in sodium phosphate buffer, pH 7.4) were incubated with 1 lg of proteinase K (New England Biolabs, USA) for 1 h at 37 °C in the presence or absence of 1% Triton X-100, and the reactions were stopped by the addition of PMSF to a final concentration of 4 mM [19,20]. Samples were then analysed by SDS–PAGE and western blotting using anti-FLAG tag antibody as described in Section 2.11.

155

2.7. Solubilisation, purification and preparation of DHRS3 proteoliposomes

179

The procedure was performed similarly to that described by Skarka et al. [21]. Briefly, four detergents (C12E8, DDM, Igepal CA-630 or digitonin) at final concentrations of 0.1%, 0.5% and 1.0% (w/v) were used for extraction of DHRS3 from microsomes. Levels of solubilised DHRS3 were analysed via western blotting using anti-FLAG antibody. The purification process was carried

181

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

130 131 132 133 134

137 138 139 140 141 142 143

146 147 148 149 150 151 152 153

156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178

180

182 183 184 185 186

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx

197

out using an ÄKTApurifier equipped with a 1-ml HisTrap FF Column (GE Life Sciences, UK), and the pure enzyme was eluted in buffer containing 500 mM imidazole. Purified DHRS3 was mixed with freshly prepared liposomal solution (40.9% DPPC, 16.7% DOPC, 36.5% DPPE and 5.9% DOPS) at a ratio of 1:25 (w/w). Bio-Beads SM2 (Bio-Rad, USA) at a ratio of 1:80 (detergent: wet beads, w/w) were used for detergent removal. The pellet obtained from centrifugation at 150,000g for 60 min was resuspended in 1 ml of Tris– HCl buffer (25 mM Tris–HCl, 150 mM NaCl, and 20% glycerol (v/v), at pH 8.0). The whole process was analysed by SDS–PAGE and blue silver staining [22].

198

2.8. RNA isolation, reverse transcription and RNA integrity

199

221

Total RNA was isolated from RNAlater-immersed tissues (100 mg) using 1 ml of Tri-Reagent (Biotech, Czech Republic) according to the manufacturer’s protocol. RNA concentrations were determined by measurement of the absorbance at 260 nm using a NanoDrop ND-1000 UV–Vis Spectrophotometer (Thermo Fisher Scientific, Czech Republic). Only samples with an A260/A280 ratio greater than 1.75 were used for further experiments. For removal of genomic DNA contamination, 10 lg of RNA were treated with DNase I (NEB, USA) for 30 min at 37 °C and heat-inactivated for 10 min at 75 °C. RNA integrity was checked by a 30 :50 assay using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the target sequence [23]; the primers used in this assay are listed in Table 1. DNA-free RNA (4 lg) was used to generate cDNA using Oligo-dT primer (Generi Biotech, Czech Republic) and Superscript II Reverse Transcriptase in 20 ll reactions according to the manufacturer’s protocol (Invitrogen, Life Technologies, CA, USA). After initial heating for 5 min at 65 °C, the reactions (RNA plus 100 pmol Oligo-dT) were quick-chilled on ice. Following the addition of the other reaction components (5 First-Strand Buffer, 0.1 M DTT, 10 nM dNTP mix, and SuperScript II RT), the 20 ll reactions were incubated for 50 min at 42 °C and then inactivated for 15 min at 75 °C. Following first strand synthesis, all cDNAs were stored at 80 °C until use in quantitative PCR (qPCR).

222

2.9. Absolute quantification of DHRS3 mRNA

187 188 189 190 191 192 193 194 195 196

200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220

223 224 225 226 227 228 229 230 231 232 233 234 235 236

2.9.1. Primer design Q2 Specific primers for the quantification of DHRS3 mRNA were designed using Primer-BLAST at http://www.ncbi.nlm.nih.gov/ tools/primer-blast/ and analysed in silico regarding specificity using BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/) (Table 1). DHRS3 sequence was checked for the presence of secondary structures at primer binding sites using mFOLD (http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form). All primers were synthesized by Generi Biotech (Czech Republic). 2.9.2. Quantitative PCR 80 ng cDNA was used as a template for qPCR in a 20 ll reaction system using the qPCR Core kit for SYBR Green I (Eurogentec, Belgium) and 5 pmol of specific primers. The PCR reactions were initiated by denaturation for 10 min at 95 °C, followed by 45 cycles

Table 1 DHRS3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer sets. Genes

Forward primer sequences 50 -30

Reverse primer sequences 50 -30

DHRS3 GAPDH 30 end GAPDH 50 end

TGGTCCATGGGAAGAGCCTA GGTCTCCTCTGACTTCAACAGC

TGTCCGCCCTTTGAAAGTGT TGTAGCCAAATTCGTTGTCATACC

TGGTCACCAGGGCTGCTT

AGCTTCCCGTTCTCAGCCTT

3

of amplification (95 °C for 15 s and 60 °C for 1 min), and then subjected to melting-curve analysis with temperatures ranging from 56 to 95 °C with 0.5 °C increases every 30 s. The experiments were carried out using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, USA), and three independent replicates were performed for each sample. No template controls (master mix + H2O) were used in each PCR experiment. The absolute quantification was used to determine the quantity of DHRS3 transcripts, i.e., the transcript copy number per 1 ng total RNA, for each tissue based on linear regression calculations using the standards. The calibration curve was based on known concentrations of DNA standard molecules, e.g., linearised recombinant plasmid DNA (pFB-CT10HF-LIC) containing DHRS3 sequence. The calibration curve had a dynamic range of up to nine orders of magnitude from <101 to >108 initial molecules. Amplification efficiency was 100%.

237

2.10. Expression of DHRS3 protein in human tissues

253

Frozen tissues were thawed on ice, cut into small pieces and homogenised in 0.1 M potassium phosphate buffer (pH 7.4), 50 mM KCl, 250 mM sucrose, 1.1 mM EDTA, 0.5 mM AEBSF, 0.5 mM PMSF and 1:500 protease inhibitor cocktail (Calbiochem, Germany) using a Potter–Elvehjem homogeniser. Tissue homogenates (50 lg of total protein) were analysed by western blotting using rabbit anti-DHRS3 antibody as described in Section 2.11. As a positive control, 1 lg of purified recombinant DHRS3 was used.

254

2.11. Western blotting

262

The samples were separated on a 12.5% SDS polyacrylamide gel and transferred to a supported nitrocellulose membrane at 25 V, 1 mA, for 15 min using the Trans-Blot Turbo system (Bio-Rad, USA). The three buffers used were as follows: anode buffer 1, 300 mM Tris with 20% methanol (v/v); anode buffer 2, 25 mM Tris with 20% methanol (v/v); and cathode buffer, 25 mM Tris with 40 mM 6-aminohexane acid and 20% methanol (v/v). The membranes were rinsed for 90 min in blocking buffer composed of 5% non-fat dry milk (w/v) in PBS-T buffer containing 0.1% TWEEN20 (v/v) in PBS buffer. The blocked membranes were incubated overnight with rabbit anti-FLAG (1:16,000; F7425, Sigma–Aldrich, Czech Republic) or rabbit anti-DHRS3 (1:8000; Ab95297, Abcam, UK) primary antibodies. Subsequently, the membranes were washed three times for 10 min in PBS-T and incubated with HRPconjugated swine anti-rabbit secondary antibody (1:20,000; Dako, Denmark) for 90 min. All antibodies were diluted in 3% non-fat dry milk (w/v) in PBS-T buffer. After three washes in PBS-T, the membranes were incubated with Amersham ECL Prime reagent (GE Life Sciences, UK), and the chemiluminescence was detected by exposure to CL-XPosure Film (Thermo Scientific, USA). Bands were analysed using the Image Studio Lite software (LiCor, USA).

263

2.12. Enzyme activities

284

Screening of DHRS3 catalytic efficiency was performed using 30 lg of Sf9-Mi-DHRS3 protein. Sf9 microsomes containing overexpressed green fluorescent protein (GFP) were used as a control. Purified and reconstituted DHRS3 protein (1 lg) obtained as described in Section 2.7 was also used in this assay. All activity assays were performed in 0.1 M potassium phosphate buffer (pH 7.4) in a final reaction volume of 100 ll. Estrone, 4-androstene-3,17-dione (a-dione), progesterone and cortisone were dissolved in ethanol. For those substances, the final concentration of ethanol in the reaction mixture was 2% (v/v). Alltrans-retinal was dissolved in methanol and sonicated with an equimolar amount of bovine serine albumin as described previ-

285

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

238 239 240 241 242 243 244 245 246 247 248 249 250 251 252

255 256 257 258 259 260 261

264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283

286 287 288 289 290 291 292 293 294 295 296

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 4

T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx

327

ously [24]. NNK (4-methylnitrosamino-1-(3-pyridyl)-1-butanone), doxorubicin, idarubicin, daunorubicin, bupropion and oracin were dissolved in water. Reactions were started by the addition of potential substrate (Table 2) and incubated 90 min at 37 °C in the presence of an NADPH-generation system (0.16 mM NADP+, 1.2 mM glucose-6-phosphate, 7 U glucose-6-phosphate dehydrogenase, and 0.6 mM MgCl2 final concentrations). The formed metabolites were extracted into 1 ml of ethyl acetate for 15 min following termination of reactions with 25% NH3, with the exception of all-trans-retinol which was extracted into 1 ml of ethyl acetate three times, evaporated, dissolved in appropriate mobile phase and analysed on an HPLC Agilent 1100 series (Agilent, USA) or a UHPLC Agilent 1290 series (Agilent, USA) under the conditions described in Table 2. All samples were measured in triplicate, and specific activities were expressed as pmol of product formed per mg of protein per minute. Cofactor preference was determined using the same activity assay. Sf9-Mi-DHRS3 was incubated in the presence of different cofactors (NAD+, NADH, NADP+, or NADPH) in concentrations ranging from 1 to 1000 lM, with a-dion or testosterone substrates. Enzymatic activity towards other potential substrates was tested using a universal spectrophotometric assay measuring the decrease in NADPH absorbance at 340 nm. The reactions were carried out under the same conditions as described above using a 0.2 mM final concentration of NADPH. In this case, the tested compounds were dissolved in DMSO. Reactions were monitored for 10 min at 37 °C using a multi-well plate reader (Tecan, Infinite 200 PRO), and the assays were performed in 96-well plates. Activities were calculated using the NADPH extinction coefficient 6220 M1 cm1 and expressed as nmol of consumed NADPH per mg of protein per minute.

328

2.13. Determination of protein concentration

329

Protein concentrations were determined using two methods: the bicinchoninic acid method for Sf9 microsomes and homoge-

297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326

330

Q7

nates of human tissues according to the Thermo Scientific protocol (USA) and the Bradford assay (Sigma–Aldrich, Czech Republic) for samples from Section 2.7 due to better buffer compatibility.

331

3. Results

334

3.1. Cloning and expression of DHRS3 in Sf9 cells

335

To clarify the basic biochemical properties of DHRS3 in terms of membrane topology and enzymatic activity, recombinant protein was prepared. The transfer vector pFB-CT10HF-LIC was utilised in the cloning of DHRS3; hence, the recombinant form contains both His10 and FLAG tags on its C-terminus. The successful expression of DHRS3 in Sf9 cells using a baculovirus expression system was confirmed by immunodetection with specific anti-FLAG peptide and anti-human DHRS3 antibodies (data not shown). The molecular weight of the distinct protein band corresponded to a predicted size of approximately 36 kDa.

336

3.2. Sequence analysis

346

DHRS3 sequence was compared with the other members of the SDR16C family, and although they are the closest relatives, they share only 35% sequence identity. One of the common motifs is the nucleotide binding motif (TGxxxGxG), and analysis of this area revealed the presence of an arginine before the second G that indicates a preference of DHRS3 for an NADP(H) cofactor [30], in contrast with the preference of the other family members (Fig. 1). Various bioinformatics tools (SOSUI, PSORTII, TMpred, HMMTOP and PSIpred) were used for prediction of DHRS3 transmembrane segments. Almost all programs predicted a transmembrane helix at the N-terminus between approximately the 5th and 30th amino acids. PSORTII and TMpred predicted two more transmembrane domains but with lower probability. Moreover, the PSORTII tool predicted that the membrane topology of DHRS3 was type 3, meaning that the hydrophobic segment is located at N-terminus

347

Table 2 Tested carbonyl compounds with their final concentration and HPLC condition for detection of the corresponding metabolites. Compound

Final concentration (lM)

Metabolite

Mobile phase composition

Flow (ml/ min)

Column

Detection

Reference

Doxorubicin

500

Doxorubicinol

0.1% FA and ACN 76:24 (v/v)

1

Zorbax C18

FLD 480/560 nm

Daunorubicin

500

Daunorubicinol

0.1% FA and ACN 74:26 (v/v)

1

Zorbax C18

FLD 480/560 nm

Idarubicin

250

Idarubicinol

0.1% FA and ACN 73:27 (v/v)

1

Zorbax C18

FLD 480/560 nm

Oracin

500

Dihydrooracin

1

Zorbax C18

FLD 340/418 nm

1

Zorbax C18

DAD 230 nm

Erythro- and threohydrobupropion Testosterone

10 mM hexanesulfonic buffer (pH 3.27) and ACN 78:22 (v/v) 10 mM sodium phosphate buffer (pH 7.4) and ACN 90:10 (v/v) 20 mM sodium dihydrogen-phosphate buffer (pH 5.45) (TEA) and ACN 80:20 (v/v) H2O and MeOH 30:70 (v/v)

1.2

Symmetry column BDS Hypersil C18 ODS 2 Supersorb BDS Hypersil C18 BDS Hypersil C18 Chromolith RP-18e

DAD 214 nm

[47] modified for UHPLC [47] modified for UHPLC [47] modified for UHPLC [48] modified for UHPLC [49] modified for UHPLC [50]

DAD 240 nm

[51]

FLD 280/312 nm, DAD 206 nm DAD 240 nm

– –

DAD 240 nm

–

DAD 325 nm and 383 nm

–

NNK

2,000

NNAL

Bupropion

500

A-dione

120

Estrone

15

b-Estradiol

ACN and H2O 62:38 (v/v)

0.7

Cortisone

50

Cortisol

H2O and MeOH 50:50 (v/v)

1.2

20 -hydroxy progesterone

ACN and H2O 68:32 (v/v)

1.3

All-trans-retinol

ACN and 1% sodium acetate 90:10 (v/v)

2.5

Progesterone

All-transretinal

120

30

0.6

Legend: Zorbax C18 Eclipse Plus (2.1  50 mm, 1.8 lm) (Agilent, USA); BDS Hypersil C18 (250  4 mm, 5 lm) (Thermo Electron Corporation, UK); symmetry column C18 (100  4.6 mm; 5 lm) (Waters, USA); ODS 2 Supersorb (250  4 mm, 5 lm) (Hewlett Packard, USA); chromolith RP-18e (100  4.6 mm) (Merck, Germany). ACN – acetonitrile, FA – formic acid, MeOH – methanol, H2O – ultrapure water.

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

332 333

337 338 339 340 341 342 343 344 345

348 349 350 351 352 353 354 355 356 357 358 359 360 361

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx 362 363

that is oriented into the lumen [31]. Only the SOSUI algorithm did not reveal any transmembrane segments.

364

3.3. Determination of membrane topology

365

DHRS3 membrane topology was characterised by three methods using Sf9-Mi-DHRS3 as described in Section 2.6. Alkaline extraction was used to determine whether membrane proteins are integral or peripheral. As shown in Fig. 2A, extraction with sodium carbonate or Triton X-100 indicated that DHRS3 is a transmembrane protein, as detergent but not alkali could partially extract the protein from microsomal membranes. Protease protection assay was used in this study to clarify the orientation of DHRS3 within the endoplasmic reticulum (ER) membrane. This assay is based on the proteolysis of protein by proteinase K in the presence or absence of Triton X-100. Complete proteinase K digestion of DHRS3 in both cases (Fig. 2B) indicates

366 367 368 369 370 371 372 373 374 375 376

5

that DHRS3 is exposed to the cytosol. Immunodetection results also indicated that the C-terminal FLAG tag is located in the cytosol.

377

3.4. Solubilisation, purification and reconstitution of DHRS3

380

The most adequate detergent for the extraction of membranebound DHRS3 was selected from among four types, polyethylene oxide Igepal CA-630, maltoside DDM, glycol ether C12E8, and glycoside digitonin, used at three increasing concentrations of 0.1%, 0.5%, and 1.0%, all w/v. The most efficient extraction occurred when either 0.5% or 1.0% Igepal CA-630 was present in the solubilisation buffer (Table 3). As it is necessary to balance solubilisation efficiency and the possible negative effects of detergent on enzyme activity, the lower detergent concentration was selected for large-scale solubilisation processes.

381

Fig. 1. Sequence alignment of SDR16C family members. The amino acid sequences were aligned using the ClustalW2 program.

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

378 379

382 383 384 385 386 387 388 389 390

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 6

T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx

Fig. 2. Membrane topology. (A) Alkaline and detergent extraction of DHRS3 from Sf9 microsomes. Lane PA – pellet after alkaline extraction by 0.1 M sodium carbonate, lane SA – supernatant after alkaline extraction by 0.1 M sodium carbonate, lane PD – pellet after detergent extraction by 1.2% Triton X-100, lane SD – supernatant after detergent extraction by 1.2% Triton X-100. (B) Protease protection assay. Sf9-Mi-DHRS3 were digested by proteinase K (PK) in the absence (lane PK-T) or presence (lane PK + T) of 1% Triton X-100 (TX-100) for 1 h at 37 °C. The control was performed in the absence PK and TX-100 (lane C).

391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408

409 410 411 412 413 414 415

As described in Section 3.1, recombinant DHRS3 contains C-terminal His10 and FLAG tags, and both of these tags can be used for the simple purification of DHRS3. Under the conditions described by Skarka et al. [21], a Ni-IMAC approach was used for the purification of His10-tagged DHRS3 (Fig. 3). Phospholipid selection was inspired by the structure of the human liver ER membrane described previously [21]; consequently, a mixture of 40.9% DPPC, 16.7% DOPC, 36.5% DPPE, and 5.9% DOPS was the basic composition of the liposomes. Pure recombinant DHRS3 was incorporated into the large unilamellar vesicles (LUVs) made of the above phospholipids through the classic method of detergent removal using Bio-Beads SM-2 (see the Section 2.7). The incorporation of DHRS3 into the liposomes was confirmed by strong bands at 36 kDa (Fig. 3), and all of the available DHRS3 was present in the liposomes. Identity of purified protein was confirmed by western blotting with anti-FLAG antibody. This purified and reconstituted form of DHRS3 was used for further enzyme activity studies (Section 3.7). 3.5. Expression of DHRS3 mRNA in human tissues 0

0

The integrity of isolated RNA was confirmed by the 3 :5 assay using GAPDH [23], and only samples with a 30 :50 ratio between 1 and 5 were used for further experiments. As shown in Fig. 4, DHRS3 mRNA is most strongly expressed in the thyroid, followed by liver, testes and prostate. Weak expression was detected in the kidney, adrenal glands and stomach. Individual subjects did

Fig. 3. Purification and reconstitution of DHRS3 on an SDS–PAGE gel stained using the blue silver method. Lane M – microsomes with DHRS3, lane SM – solubilised fraction of Sf9 microsomes after Igepal CA-630 treatment, lane FT – flow-through fraction, lane PUR – eluted pure DHRS3, lane SOL – DHRS3 not integrated into the liposomes and lane LIP – DHRS3 integrated into the liposomes.

show differences, but there was no or very low expression in lungs, spleen, pancreas, large intestine and eye for all three tested subjects.

416

3.6. DHRS3 protein expression

419

DHRS3 protein expression in human tissue from three subjects was investigated using western blotting with specific anti-DHRS3 antibody. The control, pure recombinant fusion DHRS3 protein with synthetic tags, was detected at 36 kDa as explained in Section 3.1, whereas natural human DHRS3 was detected at 33.5 kDa. The skeletal muscle samples were excluded from protein expression analysis due to cross-reactivity with the secondary antibody. The data in Fig. 5 shows representative DHRS3 expression patterns in selected human tissues. DHRS3 was observed in samples from testes and the liver and weakly in samples from the small intestine. In contrast to our qPCR data, expression of

420

Table 3 Detergent-based extraction of overexpressed DHRS3 from Sf9 microsomes. Detergent

Concentration [%] w/v

Extraction [%]

C12E8

0.1 0.5 1.0

29.6 29.8 30.3

Igepal CA-630

0.1 0.5 1.0

31.1 36.4 44.4

DDM

0.1 0.5 1.0

26.4 28.4 34.3

Digitonin

0.1 0.5 1.0

1.3 21.0 21.0

Fig. 4. Number of transcripts from normal human tissues determined by absolute quantification using real-time qPCR and linearised DHRS3 plasmid standards. The results are presented as the number of transcripts per ng total RNA.

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

417 418

421 422 423 424 425 426 427 428 429 430

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx 431 432

433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456

DHRS3 protein was not detected in either the prostate or the thyroid. 3.7. DHRS3 activity DHRS3 substrate specificity screening was performed with both Sf9-Mi-DHRS3 and the pure reconstituted form using two methods: end-point analysis with HPLC detection of products, and kinetic analysis with spectrophotometric monitoring of NADPH cofactor consumption. Nearly 30 diverse carbonyl-bearing compounds including steroids, aldehydes, ketones and quinones were tested as potential DHRS3 substrates. For screening, a large concentration range of tested substrates was used based on their solubility and naturally occurring levels. Reductive activity directed towards a-dione and estrone, two precursors of important steroid hormones, leads to their activation and was observed in vitro; however, cortisone and progesterone are not DHRS3 substrates. Another endogenous compound, DL-glyceraldehyde, was reduced by Sf9-Mi-DHRS3. As shown in Fig. 6, the tobacco specific carcinogen NNK, drug acetohexamide and model substances 4-nitroacetophenone and benzil were also identified as DHRS3 substrates in the presence of NADPH. These substances were also tested as substrates of purified DHRS3 embedded in liposomes, but no activity was detected. Cofactor preference was tested in assays containing either a-dione or testosterone. Oxidative activity was detected with NADP+ but was lower than reductase activity with NADPH. There was no effect in the presence of NAD+ or NADH (data not shown).

457

4. Discussion

458

DHRS3 does not belong to the widely studied enzymes from SDR superfamily. The majority of the published articles are focused on a possible DHRS3 role in the metabolism of retinoids [3,32], as well as on the mechanism of its induction, often in connection with retinoids [5–7,9]. Although some recent in vivo studies have confirmed the significant DHRS3 role in RA level maintenance during embryonic development [10,11,32], it is not unreasonable to

459 460 461 462 463 464

Fig. 5. Western blot detection of DHRS3 protein expression in human tissue. For SDS–PAGE separation, equal amounts (50 lg) of total cellular protein were used and 1 lg of pure recombinant DHRS3 protein (36 kDa) was used as a control. Human DHRS3 protein was detected by anti-DHRS3 antibody at approximately 33.5 kDa.

7

investigate this enzyme from another point of view. There are some SDR enzymes that possess other newly revealed functions (e.g., RDH12 in protection against oxidative stress [28]) in addition to their well-established functions (e.g., RDH12 in the visual cycle [34]). DHRS3 is characterised as being a membrane-bound enzyme localised to the ER [5,6] but the exact membrane topology has been unknown. Membrane topology has a large impact on enzymatic activity due to the varied distribution of NAD(P)(H) cofactor forms within cells. For the first time, this study experimentally demonstrated that DHRS3 is an integral membrane protein with its C-terminus localised in the cytosol. This finding coincides with computational predictions of an N-terminal transmembrane region (this study) and experimentally determined N-terminal hydrophobic region [6], as well as a previously published in silico model of DHRS3 tertiary structure [3]. As SDRs active sites are generally localised to the C-terminal region [30], the orientation of the DHRS3 C-terminus towards the cytosol, together with the known ratios of NAD+/NADH and NADP+/NADPH cofactors in this cell compartment [35] supports activity screening using carbonyl-bearing substances rather than hydroxyl-bearing compounds. An SDR relative, RDH11, having similar membrane topology is regarded to be an NADPH-dependent reductase [20]. DHRS3 is one of five human members of the SDR16C family (also named a Multisubstrate NADP(H)-dependent family [1]), and thus far, its members have been implicated in retinoid and steroid metabolism [32,36–38]. Screening of potential DHRS3 substrates was based on the assumption that its function is potentially similar to those of its relatives. However, SDR16C2-5 were described predominantly as dehydrogenases (RDH10, DHRS8, and RDHE2 [36,39,40]) whereas SDR16C1/DHRS3 was described as a retinal reductase [3,32]. These findings are in accordance with the analysis of their amino sequences (Fig. 1), as unlike other SDR16C members, DHRS3 contains residues typical of a cofactor preference for NADP(H) [30]. Consequently, compounds with a carbonyl group were selected for testing according to the known substrates of other reductive SDR members (e.g., 11b-HSD1, CBR1, 17b-HSD1, and 17b-HSD3 [41–43]). For initial screening, Sf9-MiDHRS3 were used as in the case of the Haeseleer et al. [3] study. It was proven that in vitro, DHRS3 takes part in the reduction of endogenic compounds such as a-dione, estrone and DL-glyceraldehyde. Activity toward steroids was also tested in the Haeseleer et al. [3] study, but no activity was detected. The same study [3] described reducing activity of DHRS3 toward all-trans-retinal, but this assay failed in our study. The activity of the sample in our study was nearly identical to the activity of the control sample, so it was not possible to find a statistically significant difference. The activity described by Haeseleer et al. [3] was quite low (approximately 1 pmol/min), and moreover, it was measured by a more sensitive radioactive method. Furthermore, different buffers (25 mM MES buffer (pH 5.5) versus 100 mM potassium phosphate buffer (pH 7.4)) were used in both studies. However, based on recent in vivo studies, it seems that the reduction of retinal is a physiological function of DHRS3 [10,11]. Despite this fact and the aforementioned predictions, all possible cofactor forms (NAD+/NADH/NADP+/NADPH) were tested to determine the in vitro cofactor preference of this enzyme with selected substrates (a pair of a-dione/testosterone and all-trans-retinal/all-trans-retinol). In addition to reducing activity toward a-dione with NADPH, only low oxidative activity with NADP+ toward testosterone was detected (data not shown). Due to its tissue expression pattern (discussed below) some xenobiotic and model substances were also screened (Fig. 6). The antidiabetic drug acetohexamide, carcinogen NNK and model compounds 4-nitroacetophenone and benzil were determined to be in vitro substrates of DHRS3. Although the reductive activities appear to be lower in comparison with some

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 8

T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx

Fig. 6. Substrate specificity of DHRS3 protein. (A) End-point analysis of catalytic efficiency of DHRS3 protein expressed in Sf9 cells. Microsomes containing overexpressed DHRS3 were incubated with tested substrates for 90 min and resulting products were analysed by HPLC. (B) Kinetic analysis of the consumption of NADPH cofactor. Sf9-MiDHRS3 activity was measured by the spectrophotometric assay described in the experimental procedures. 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556

SDR enzymes e.g., 11b-HSD1 or CBR1 in reduction of NNK [44,45]. These substrates of DHRS3 were described for the first time. The DHRS3 protein itself has been studied in cell lysates [3,32] but to the best of our knowledge, the purified form has not yet been investigated. In this study, a purified and reconstituted form of DHRS3 was successfully prepared (Fig. 3) through utilisation of Igepal CA-630 detergent and liposomes composed of phospholipids similar to those found in liver ER [46]. An analogous procedure was used in the case of another DHRS enzyme, DHRS7 [21]. Additionally, one member of SDR16C family, RDHE2, was solubilised from Sf9 microsomes and purified in presence of DHPC detergent. DHPC is a short-chain phospholipid; therefore, the next step, insertion of enzyme into a phospholipid bilayer, was not performed [47]. Both of the aforementioned enzymes retained their activity following purification or purification/reconstitution, but in the case of DHRS3, the activity was lost. Optimisation of the whole procedure did not improve DHRS3 activity; however, during our investigation of DHRS3, a recent article was published explaining the no or low activity of DHRS3 towards all-trans-retinal and potentially other substrates described by Haeseleer et al. [3]. It was shown that DHRS3 requires an interaction with enzyme RDH10 to display full catalytic activity [32]. When suitable conditions and methods are utilised, it is possible to measure the low activity of DHRS3 in cell lysates as interaction of DHRS3 with other proteins can lead to the partial activation, but in the case of purified DHRS3 it is clear that the activity must be lost. Prepared proteoliposomes containing

DHRS3 will be used for structural studies, but for functional studies it will be necessary to prepare mixed proteoliposomes containing both DHRS3 and RDH10; furthermore, this preparation will be useful as their interaction has only been studied in cell lysates with overexpressed enzymes and mutants [32]. To better understand a possible role for DHRS3 in humans it is necessary to know its tissue expression pattern. For an initial study, samples of 16 human tissues were used. DHRS3 mRNA expression was published previously [3,5]; however, modern, sensitive qPCR with absolute quantification was utilised for this purpose for the first time. Previous studies utilised northern blot analysis with GAPDH or G3PDH as reference genes, but relative quantification for expression comparisons between diverse tissues is not suitable due to significant differences in the levels of reference genes [48]; consequently, absolute quantification seems to be better choice. Our results are mostly in accordance with previous reports [3,5]; however, our study did not reveal DHRS3 mRNA in pancreas or lungs. In addition to the results of previous studies, DHRS3 mRNA expression in the prostate was described. Although DHRS3 was initially detected in bovine retina [3], our study revealed extremely low expression of DHRS3 mRNA in human eye, although only the whole back part of the eye was available, rather than the retina itself. As proteins rather than mRNA are responsible for protein function, it is better to determine the DHRS3 protein expression pattern. Furthermore, mRNA and corresponding protein levels are

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx

600

sometimes poorly correlated [49]. This study described DHRS3 protein expression in the human tissues for the first time. Western blotting results (Fig. 5) clearly showed the presence of DHRS3 in testes, liver and small intestine. These results are in accordance with mRNA expression in testes and liver. Expression cannot be compared in the case of small intestine tissue where the integrity of RNA was poor and DHRS3 expression was not determined. However, there are tissues where DHRS3 mRNA was shown but protein expression was not detected. It is clear that in addition to method detection limits there are many processes in cells that influence the correlation between protein and mRNA levels, such as mRNA decay, velocity and regulation of translation and protein stability [50]. Consequently, for the description of an unknown protein it is preferable to determine its expression on the protein level. Our DHRS3 protein expression results in liver are in agreement with its presence in a hepatocellular cell line [6] and led to screening of DHRS3 activity toward xenobiotics. Moreover, DHRS3 protein was also detected previously in adipocytes [6].

601

5. Conclusions

602

613

This study represents a deeper characterisation of the DHRS3 protein. Its membrane topology was experimentally proven and is in agreement with a predicted cofactor preference that was also confirmed. New DHRS3 substrates, such as steroids or xenobiotics, were identified. These results, together with proven protein expression in tissues, can open a new research area in terms of its possible additional functions in the human body. For the first time, DHRS3 was purified and embedded in a reconstitution system. As a result of known information regarding functional dependence on protein–protein interactions, this form will be used for structural studies because this area is totally unexplored and may help to explain its function.

614

Conflict of Interest

583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599

603 604 605 606 607 608 609 610 611 612

615

Q3

The authors declare that there are no conflicts of interest.

616

Transparency Document

617

The Transparency document associated with this article can be found in the online version.

618 619

6. Uncited references

620 621

622 623 624 625 626 627 628 629 630 631 632 633 634 635 636

Q4

[25–27,29,33]. Acknowledgements

This project was supported by the Grant Agency of Charles UniQ5 versity (Grant No. 677012/C/2012) and by Charles University proQ6 ject SVV 260 065. The publication is co-financed by the European Social Fund and the state budget of the Czech Republic (TEAB, Project No. CZ.1.07/2.3.00/20.0235) and by the European Social Fund and the state budget of the Czech Republic (Project No. CZ.1.07/ 2.3.00/30.0022). We would like to thank Professor Udo Oppermann (Structural Genomics Consortium, University of Oxford, UK) for broad support and for providing the DHRS3 entry clone, Dr. Peter Cain (Botnar Research Centre, University of Oxford, UK) for providing DNA encoding GFP, Dr. Dunford (Botnar Research Centre, Nuffield Orthopaedic Centre, University of Oxford, UK) and the NIHR Nuffield Orthopaedic Centre, Biomedical Research Unit for support.

9

We also thank Elsevier for providing English grammar correction.

637

References

639

[1] B. Persson, Y. Kallberg, Classification and nomenclature of the superfamily of short-chain dehydrogenases/reductases (SDRs), Chem. Biol. Interact. 202 (2013) 111–115, http://dx.doi.org/10.1016/j.cbi.2012.11.009. [2] J.E. Bray, B.D. Marsden, U. Oppermann, The human short-chain dehydrogenase/ reductase (SDR) superfamily: a bioinformatics summary, Chem. Biol. Interact. 178 (2009) 99–109, http://dx.doi.org/10.1016/j.cbi.2008.10.058. [3] F. Haeseleer, J. Huang, L. Lebioda, J.C. Saari, K. Palczewski, Molecular characterization of a novel short-chain dehydrogenase/reductase that reduces all-trans-retinal, J. Biol. Chem. 273 (1998) 21790–21799. [4] N.Y. Kedishvili, Enzymology of retinoic acid biosynthesis and degradation, J. Lipid Res. 54 (2013) 1744–1760, http://dx.doi.org/10.1194/jlr.R037028. [5] F. Cerignoli, X. Guo, B. Cardinali, C. Rinaldi, J. Casaletto, L. Frati, et al., retSDR1, a short-chain retinol dehydrogenase/reductase, is retinoic acid-inducible and frequently deleted in human neuroblastoma cell lines, Cancer Res. 62 (2002) 1196–1204. [6] C. Deisenroth, Y. Itahana, L. Tollini, A. Jin, Y. Zhang, P53-Inducible DHRS3 is an endoplasmic reticulum protein associated with lipid droplet accumulation, J. Biol. Chem. 286 (2011) 28343–28356, http://dx.doi.org/10.1074/ jbc.M111.254227. [7] R. Zolfaghari, Q. Chen, A.C. Ross, DHRS3, a retinal reductase, is differentially regulated by retinoic acid and lipopolysaccharide-induced inflammation in THP-1 cells and rat liver, Am. J. Physiol. Gastrointest. Liver Physiol. 303 (2012) G578–88, http://dx.doi.org/10.1152/ajpgi.00234.2012. [8] R. Blomhoff, H.K. Blomhoff, Overview of retinoid metabolism and function, J. Neurobiol. 66 (2006) 606–630, http://dx.doi.org/10.1002/neu.20242. [9] R.D. Kirschner, K. Rother, G.A. Müller, K. Engeland, The retinal dehydrogenase/ reductase retSDR1/DHRS3 gene is activated by p53 and p63 but not by mutants derived from tumors or EEC/ADULT malformation syndromes, Cell Cycle 9 (2010) 2177–2188, http://dx.doi.org/10.4161/cc.9.11.11844. [10] S.E. Billings, K. Pierzchalski, N.E. Butler Tjaden, X.-Y. Pang, P.A. Trainor, M.A. Kane, et al., The retinaldehyde reductase DHRS3 is essential for preventing the formation of excess retinoic acid during embryonic development, FASEB J. 27 (2013) 4877–4889, http://dx.doi.org/10.1096/fj.13-227967. [11] R.K.T. Kam, W. Shi, S.O. Chan, Y. Chen, G. Xu, C.B.-S. Lau, et al., Dhrs3 protein attenuates retinoic acid signaling and is required for early embryonic patterning, J. Biol. Chem. 288 (2013) 31477–31487, http://dx.doi.org/ 10.1074/jbc.M113.514984. [12] H. Štambergová, L. Škarydová, J.E. Dunford, V. Wsól, Biochemical properties of human dehydrogenase/reductase (SDR family) member 7, Chem. Biol. Interact. 207 (2014) 52–57, http://dx.doi.org/10.1016/j.cbi.2013.11.003. [13] T. Hirokawa, S. Boon-Chieng, S. Mitaku, SOSUI: classification and secondary structure prediction system for membrane proteins, Bioinformatics 14 (1998) 378–379, http://dx.doi.org/10.1093/bioinformatics/14.4.378. [14] E. Hartmann, T.A. Rapoport, H.F. Lodish, Predicting the orientation of eukaryotic membrane-spanning proteins, Proc. Natl. Acad. Sci. U.S.A. 86 (1989) 5786–5790. [15] G.E. Tusnády, I. Simon, The HMMTOP transmembrane topology prediction server, Bioinformatics 17 (2001) 849–850. [16] K. Hofmann, W. Stoffel, TMbase – a database of membrane spanning protein segments, Biol. Chem. Hoppe-Seyler 374 (1993) 166. [17] D.W.A. Buchan, F. Minneci, T.C.O. Nugent, K. Bryson, D.T. Jones, Scalable web services for the PSIPRED Protein Analysis Workbench, Nucleic Acids Res. 41 (2013) W349–57, http://dx.doi.org/10.1093/nar/gkt381. [18] M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, et al., Clustal W and Clustal X version 2.0, Bioinformatics 23 (2007) 2947–2948, http://dx.doi.org/10.1093/bioinformatics/btm404. [19] E.A. Lapshina, O.V. Belyaeva, O.V. Chumakova, N.Y. Kedishvili, Differential recognition of the free versus bound retinol by human microsomal retinol/ sterol dehydrogenases: characterization of the holo-CRBP dehydrogenase activity of RoDH-4, Biochemistry 42 (2003) 776–784, http://dx.doi.org/ 10.1021/bi026836r. [20] O.V. Belyaeva, A.V. Stetsenko, P. Nelson, N.Y. Kedishvili, Properties of shortchain dehydrogenase/reductase RalR1: characterization of purified enzyme, its orientation in the microsomal membrane, and distribution in human tissues and cell lines, Biochemistry 42 (2003) 14838–14845, http://dx.doi.org/ 10.1021/bi035288u. [21] A. Skarka, L. Škarydová, H. Štambergová, V. Wsól, Purification and reconstitution of human membrane-bound DHRS7 (SDR34C1) from Sf9 cells, Protein Expr. Purif. 95 (2014) 44–49, http://dx.doi.org/10.1016/ j.pep.2013.11.013. [22] G. Candiano, M. Bruschi, L. Musante, L. Santucci, G.M. Ghiggeri, B. Carnemolla, et al., Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis, Electrophoresis 25 (2004) 1327–1333, http://dx.doi.org/ 10.1002/elps.200305844. [23] T. Nolan, R.E. Hands, W. Ogunkolade, S.A. Bustin, SPUD: a quantitative PCR assay for the detection of inhibitors in nucleic acid preparations, Anal. Biochem. 351 (2006) 308–310, http://dx.doi.org/10.1016/j.ab.2006.01.051. [24] O. Gallego, O.V. Belyaeva, S. Porté, F.X. Ruiz, A.V. Stetsenko, E.V. Shabrova, et al., Comparative functional analysis of human medium-chain dehydrogenases, short-chain dehydrogenases/reductases and aldo-keto

640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

638

CBI 7168

No. of Pages 10, Model 5G

3 November 2014 10 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

T. Lundová et al. / Chemico-Biological Interactions xxx (2014) xxx–xxx reductases with retinoids, Biochem. J. 399 (2006) 101–109, http://dx.doi.org/ 10.1042/BJ20051988. A. Skarka, L. Škarydová, H. Štambergová, V. Wsól, Anthracyclines and their metabolism in human liver microsomes and the participation of the new microsomal carbonyl reductase, Chem. Biol. Interact. 191 (2011) 66–74, http:// dx.doi.org/10.1016/j.cbi.2010.12.016. V. Wsól, B. Szotáková, E. Kvasnicˇková, A.F. Fell, High-performance liquid chromatography study of stereospecific microsomal enzymes catalysing the reduction of a potential cytostatic drug, oracin. Interspecies comparison, J. Chromatogr. A 797 (1998) 197–201. L. Škarydová, M. Zveˇrˇinová, H. Štambergová, V. Wsól, A simple identification of novel carbonyl reducing enzymes in the metabolism of the tobacco specific carcinogen NNK, Drug Metab. Lett. 6 (2012) 174–181, http://dx.doi.org/ 10.2174/1872312811206030004. L. Škarydová, R. Tomanová, L. Havlíková, H. Štambergová, P. Solich, V. Wsól, Deeper insight into the reducing biotransformation of bupropion in the human liver, Drug Metab. Pharmacokinet. 29 (2014) 177–184, http://dx.doi.org/ 10.2133/dmpk.DMPK-13-RG-051. L. Škarydová, J. Hofman, J. Chlebek, J. Havránková, K. Kosánová, A. Skarka, et al., Isoquinoline alkaloids as a novel type of AKR1C3 inhibitors, J. Steroid Biochem. Mol. Biol. 143 (2014) 250–258, http://dx.doi.org/10.1016/j.jsbmb.2014.04.005. Y. Kallberg, U. Oppermann, H. Jörnvall, B. Persson, Short-chain dehydrogenases/reductases (SDRs), Eur. J. Biochem. 269 (2002) 4409–4417, http://dx.doi.org/10.1046/j.1432-1033.2002.03130.x. H.R. Petty, Overview of the physical state of proteins within cells, Curr. Protoc. Protein Sci. (2003), http://dx.doi.org/10.1002/0471140864.ps0105s31. Chapter 1, Unit 1.5. M.K. Adams, O.V. Belyaeva, L. Wu, N.Y. Kedishvili, The retinaldehyde reductase activity of DHRS3 is reciprocally activated by retinol dehydrogenase 10 to control retinoid homeostasis, J. Biol. Chem. 289 (2014) 14868–14880, http:// dx.doi.org/10.1074/jbc.M114.552257. L.D. Marchette, D.A. Thompson, M. Kravtsova, T.N. Ngansop, M.N. Mandal, A. Kasus-Jacobi, Retinol dehydrogenase 12 detoxifies 4-hydroxynonenal in photoreceptor cells, Free Radic. Biol. Med. 48 (2010) 16–25, http:// dx.doi.org/10.1016/j.freeradbiomed.2009.08.005. O.V. Belyaeva, O.V. Korkina, A.V. Stetsenko, T. Kim, P.S. Nelson, N.Y. Kedishvili, Biochemical properties of purified human retinol dehydrogenase 12 (RDH12): catalytic efficiency toward retinoids and C9 aldehydes and effects of cellular retinol-binding protein type I (CRBPI) and cellular retinaldehyde-binding protein (CRALBP) on the oxi, Biochemistry 44 (2005) 7035–7047, http:// dx.doi.org/10.1021/bi050226k. R.L. Veech, L.V. Eggleston, H.A. Krebs, The redox state of free nicotinamideadenine dinucleotide phosphate in the cytoplasm of rat liver, Biochem. J. 115 (1969) 609–619. O.V. Belyaeva, S.-A. Lee, M.K. Adams, C. Chang, N.Y. Kedishvili, Short chain dehydrogenase/reductase rdhe2 is a novel retinol dehydrogenase essential for frog embryonic development, J. Biol. Chem. 287 (2012) 9061–9071, http:// dx.doi.org/10.1074/jbc.M111.336727. B.X. Wu, Y. Chen, Y. Chen, J. Fan, B. Rohrer, R.K. Crouch, Cloning and characterization of a novel all-trans from the RPE, Invest. Ophthalmol. Vis. Sci. 43 (2002) 3365–3372.

[38] P. Brereton, T. Suzuki, H. Sasano, K. Li, C. Duarte, V. Obeyesekere, et al., Pan1b (17bHSD11)-enzymatic activity and distribution in the lung, Mol. Cell. Endocrinol. 171 (2001) 111–117, http://dx.doi.org/10.1016/S03037207(00)00417-2. [39] B.X. Wu, G. Moiseyev, Y. Chen, B. Rohrer, R.K. Crouch, J.-X. Ma, Identification of RDH10, an all-trans retinol dehydrogenase, in retinal muller cells, Invest. Ophthalmol. Vis. Sci. 45 (2004) 3857–3862, http://dx.doi.org/10.1167/iovs.031302. [40] Z. Chai, P. Brereton, T. Suzuki, H. Sasano, V. Obeyesekere, G. Escher, et al., 17 beta-hydroxysteroid dehydrogenase type XI localizes to human steroidogenic cells, Endocrinology 144 (2003) 2084–2091, http://dx.doi.org/10.1210/ en.2002-221030. [41] L. Škarydová, V. Wsól, Human microsomal carbonyl reducing enzymes in the metabolism of xenobiotics: well-known and promising members of the SDR superfamily, Drug Metab. Rev. 44 (2012) 173–191, http://dx.doi.org/10.3109/ 03602532.2011.638304. [42] U. Oppermann, Carbonyl reductases: the complex relationships of mammalian carbonyl- and quinone-reducing enzymes and their role in physiology, Annu. Rev. Pharmacol. Toxicol. 47 (2007) 293–322, http://dx.doi.org/10.1146/ annurev.pharmtox.47.120505.105316. [43] P. Malátková, E. Maser, V. Wsól, Human carbonyl reductases, Curr. Drug Metab. 11 (2010) 639–658, http://dx.doi.org/10.2174/138920010794233530. [44] A. Atalla, U. Breyer-Pfaff, E. Maser, Purification and characterization of oxidoreductases-catalyzing carbonyl reduction of the tobacco-specific nitrosamine 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK) in human liver cytosol, Xenobiotica 30 (2000) 755–769, http://dx.doi.org/ 10.1080/00498250050119826. [45] E. Maser, J. Friebertshäuser, B. Völker, Purification, characterization and NNK carbonyl reductase activities of 11b-hydroxysteroid dehydrogenase type 1 from human liver: enzyme cooperativity and significance in the detoxification of a tobacco-derived carcinogen, Chem. Biol. Interact. 143–144 (2003) 435– 448, http://dx.doi.org/10.1016/S0009-2797(02)00180-1. [46] L. Waskell, D. Koblin, E. Canova-Davis, The lipid composition of human liver microsomes, Lipids 17 (1982) 317–320, http://dx.doi.org/10.1007/ BF02534948. [47] S.-A. Lee, O.V. Belyaeva, N.Y. Kedishvili, Biochemical characterization of human epidermal retinol dehydrogenase 2, Chem. Biol. Interact. 178 (2009) 182–187, http://dx.doi.org/10.1016/j.cbi.2008.09.019. [48] R.D. Barber, D.W. Harmer, R.A. Coleman, B.J. Clark, GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues, Physiol. Genomics. 21 (2005) 389–395, http://dx.doi.org/10.1152/ physiolgenomics.00025.2005. [49] M. Gry, R. Rimini, S. Strömberg, A. Asplund, F. Pontén, M. Uhlén, et al., Correlations between RNA and protein expression profiles in 23 human cell lines, BMC Genomics 10 (2009), http://dx.doi.org/10.1186/1471-2164-10-365. [50] C. Vogel, R.D.S. Abreu, D. Ko, S.-Y. Le, B.A. Shapiro, S.C. Burns, et al., Sequence signatures and mRNA concentration can explain two-thirds of protein abundance variation in a human cell line, Mol. Syst. Biol. 6 (2010) 1–9, http://dx.doi.org/10.1038/msb.2010.59.

Please cite this article in press as: T. Lundová et al., Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3), Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/j.cbi.2014.10.018

771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820