Molecular and biochemical characterization of defense responses in ginseng (Panax quinquefolius) roots challenged with Fusarium equiseti

Physiological and Molecular Plant Pathology 72 (2008) 10–20

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp

Molecular and biochemical characterization of defense responses in ginseng (Panax quinquefolius) roots challenged with Fusarium equiseti Rubella S. Goswami*, Zamir K. Punja Department of Biological Sciences, Simon Fraser University, 8888 University Drive, Burnaby, BC V5A 1S6, Canada

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 24 April 2008

Fusarium equiseti causes a discoloration on ginseng roots that significantly affects their marketability. The cellular and biochemical changes in affected roots that lead to this symptom, as well as differential gene expression following pathogen inoculation were studied. Accumulation of phenolics, cell disruption, and development of a zone of lignified cells were observed in affected tissues. A number of genes involved in host defense responses, particularly those induced by jasmonic acid and genes mediating phenolic production and detoxification, were up-regulated. The defense reactions in the perennial roots of ginseng are highlighted and compared to those of other plant species. Crown Copyright Ó 2008 Published by Elsevier Ltd. All rights reserved.

Keywords: Expressed sequence tags Suppression subtractive hybridization Defense response Ginseng Disease resistance Root infection

1. Introduction Ginseng is a slow-growing perennial root that has been used for medicinal purposes for centuries to provide relief from stress, disease and exhaustion [1,2]. The plant belongs to the family Araliaceae, which has seven major species that are distributed throughout East Asia, Central Asia and North America [3,4]. The most widely cultivated species are Panax ginseng (Asian ginseng), Panax quinquefolius (American ginseng) and Panax japonicus (Japanese ginseng). American ginseng is grown in eastern and western Canada, mainly for export to Asian markets for use in traditional medicine. The roots contain valuable pharmaceutically-active components, which include ginsenosides (saponins), polyacetylenes, polyphenolic compounds and acidic polysaccharides [5]. Ginseng quality is determined by size, shape and overall appearance, and surface discolorations can significantly reduce their marketability. One factor which significantly affects the quality of ginseng grown in Canada is the development of reddish–brown superficial discolored areas that eventually become dry, corky and slough-off, leaving the root unmarketable [6]. The role of several root infecting Fusarium species, notably F. equiseti and F. sporotrichiodes, in causing this discoloration of ginseng roots was recently established [6], with F. equiseti being the most pathogenic species [7]. The physiological basis of this discoloration appears to be accumulation of

* Corresponding author. Department of Plant Pathology, North Dakota State University, 306 Walster Hall, Fargo, ND 58105, USA. Tel.: þ1 701 231 7077; fax: þ1 701 231 7851. E-mail address: [email protected] (R.S. Goswami).

phenolic compounds in the roots [8]. However, the corresponding changes that take place at the cellular level and the associated changes in gene expression are not known. The interaction of F. equiseti with ginseng roots to induce phenolic compounds which results in a visual discoloration provides an opportunity to study the biochemical and genomic changes that take place in roots in response to an invading fungus. Previous genomic studies on ginseng have been conducted only on Asian ginseng, which were aimed at elucidating the production and biosynthesis of commercially valuable ginsenosides and other secondary metabolites [1,9]. There are also reports of the development of a BAC library [10] and analysis of ESTs from ginseng leaves [5] and methyl jasmonate – treated hairy roots in culture [9]. There are no previous reports of genomic studies with roots of American ginseng. In this study, we characterized the changes in gene expression in roots challenged with F. equiseti compared to healthy roots using suppression subtractive hybridization (SSH). Our goal was to document the changes that take place at the cellular and genomic levels to explain the discoloration which eventually leads to disfiguration of the roots and reduces their marketability. Our observations provide information about previously uncharacterized defense-related gene expression in ginseng root tissues. 2. Materials and methods 2.1. Light microscopy and measurement of phenolics Sections of inoculated root tissues were prepared for light microscopy as described by Punja et al. [6]. The samples were

0885-5765/$ – see front matter Crown Copyright Ó 2008 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.pmpp.2008.04.006

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

examined at 100 and 400 magnification. A minimum of 30 sections of each tissue sample was examined and photographed using a PENTAX *ist camera (Tokyo, Japan). Observations made included the extent of cellular integrity, depth and cell type of the affected area, presence of fungal mycelia, and accumulation of phenolic compounds in the tissues. Discolored areas from artificially inoculated roots and adjacent healthy areas were scraped off with a scalpel and analyzed separately for total and specific phenolic compounds. Extraction and quantification of total and specific phenolic compounds was performed as described by Rahman and Punja [8]. Standards constituting known phenolic compounds (Sigma Chemical Co., St. Louis, MO) were included for comparison with sample peaks. 2.2. Fungal isolates, inoculation procedure and nucleic acid extraction Healthy, blemish-free ginseng roots originating from 3-year-old ginseng gardens located in Kamloops, British Columbia were washed, surface-sterilized by soaking in 0.5% NaOCl for 10 min, followed by three rinses in distilled water, and used for inoculations. Inoculations were conducted as using two highly aggressive isolates of F. equiseti (S5A-DAOM ID. DQ842061 and S9DAOM ID. AJ543569) previously isolated from ginseng gardens previously as described by Punja et al. [6]. Mycelial plugs from 10day-old colonies of grown on potato dextrose agar medium were placed on the root surface and the inoculated roots were incubated on moist paper towels in a sterile container. Control inoculations were done using plugs from un-inoculated PDA plates. Seven days after inoculation, the plugs were removed and discrete superficial reddish–brown lesions measuring 1–2 mm in diameter under and around the mycelial plug were carefully dissected and immediately frozen for RNA extraction. The time of sampling was selected based on previous observations where approximately 7 days was required for the development of tissue discoloration and detectable mycotoxin accumulation [6,11]. Similar sections were also taken from the area under the agar plugs on control roots. Total RNA extraction was performed using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The total RNA samples were also subjected to DNase treatment using the RQ1 RNaseFree DNase from Promega (Madison, WI). DNA extraction from the ginseng roots was conducted using the DNeasy Plant Mini Kit (Qiagen USA, Valencia, CA). 2.3. Library preparation and differential screening Total RNA from inoculated roots was pre-amplified using the SMART PCR cDNA Synthesis Kit (Clontech Laboratories Inc., Palo Alto, CA). Suppression subtractive hybridization was subsequently performed using the PCR-Select cDNA Subtraction kit according to the manufacturer’s directions (Clontech Laboratories Inc.). The procedure was used to prepare two forward subtracted libraries. The ‘driver’ sequences were derived from control ginseng roots. The first and second subtractions involved ‘tester’ sequences derived from roots inoculated with the F. equiseti isolates S5A and S9, respectively. The PCR products from the forward subtraction, enriched in differentially expressed genes from the F. equiseti strains S5A and S9 inoculated ginseng were cloned into the pGEM-T Easy vector (Promega) and transformed into TOP 10 competent cells (Invitrogen, Carlsbad, CA). Individual white colonies from the two root libraries, named Ginseng-FeqS5A and Ginseng-FeqS9, respectively, were randomly picked and stored in 96-well plates. For differential screening, the clones were transferred to Hybond XL nylon membranes (Amersham, Piscataway, NJ) and grown at 37  C for colony hybridization. Triplicate membranes were prepared from both libraries and screened by hybridization with cDNA from the

11

driver and each of the testers individually. The probes were labeled using the Prime-a-gene labeling kit (Promega) and hybridized with PerfectHybÔ Plus Hybridization Buffer (Sigma-Aldrich, St. Louis, MO) at 68  C. The experiment was repeated two times. After the initial screening, clones showing obviously greater hybridization intensities with the tester were selected and re-screened using the same probes. Several of these were subsequently sent for sequencing. 2.4. EST sequencing and analysis DNA sequencing was completed at McLab (South San Francisco, CA). In brief, the procedure used rolling circle amplification of the inserts from the bacterial colonies. Sequencing was performed with standard Big Dye (Applied Biosystems, Foster City, CA) in an ABI 3730XL sequencer. The EST sequences were trimmed manually with the aid of EGassembler (http://egassembler.hgc.jp/) using information from NCBI’s vector library to remove vector sequences and other sequencing ambiguities. The CAP3 sequence assembly program based on a multiple sequence alignment method [12] was used to align the ESTs in each library and generate consensus sequences for contigs using the default parameters. Sequences have been deposited in the GenBank database under accession numbers EW712039–EW712307. Sequences of fungal origin were identified based on BLASTN searches against the F. graminearum wholegenome sequence available at the Broad Institute website http:// www.broad.mit.edu/annotation/fungi/fusarium/ (F. graminearum sequencing project). Sequences with E-values <1e-10 were considered to be derived from the pathogen unless they had better matches, according to BLASTX, with other sequences in GenBank. The edited sequences (contigs and singletons) were analyzed using the BLASTX program at NCBI (http://www.ncbi.nlm.nlh.gov/BLAST/). ESTs showing significant sequence similarity with an E-value 1e-10 were considered to be highly homologous to known sequences, whereas ESTs with E-values >1e-10 were considered to have an unknown function. Comparisons were also made with the Munich information center for protein sequence (MIPS) Arabidopsis database (http://mips.gsf.de/proj/thal/db), Gene Ontology database at TAIR (http://www.arabidopsis.org/tools/bulk/go/ index.jsp) and ginseng EST sequences available at GenBank including those from a methyl-jasmonate treated ginseng hairy root library [9]. 2.5. Reverse transcriptase-PCR and Virtual Northerns (cDNA Southerns) Initial validation of selected genes was performed using RT-PCR. Total RNA from each sample was reverse transcribed using Table 1 PCR primers used for RT-PCR and virtual northern probes Gene homolog

Sequence

PR-4

ATCGGAGAATATTGGGTGGGA CTGGCCAAAGATGCCTTATT TACGCGGGGAAAACCCTA ACCTCCGCCATTGAATTTGA AATTCGATTTCGAGCGGC CAAACCACATTCTTCCGTCA GGCAGGTACCCAAAAATGAT TCAATGAGAGATCTCAACCCG ACTGCGGGAATTCGATTTC CTAGTGATTAGCGTGGTCGC AGATGTCATCAGAATTATGCG TCAACCAATAGTAGGGATCCT CAAAATCACAGGGAAAACAGG GGTGGCTTAGGGCAAGAGA CAGAAGAGCACCCTGTTCTTT ATAAATGGGGACTGTGTGGCT

Mn Superoxide dismutase 14-3-3 family protein Orcinol O-methyltransferase Peroxidase Protease inhibitor Gluathione S-transferase Actin

12

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

Fig. 1. Light microscopy of ginseng roots artificially inoculated with F. equiseti. Panels a–e, 7 days post-inoculation; panels f and g, 12 days post-inoculation. (a) Lesions developing after 7 days. These were fixed in FAA, dehydrated in ethanol, and embedded in Technovit before being sectioned at 4 mm thickness and stained with Toluidine blue O. (b) Close-up of epidermal cells (epi) stained a greenish–blue with Toluidine blue O reflecting an accumulation of phenolic compounds (bar ¼ 15 mm). (c) Same as (b) showing hyphae (hy) in epidermal cells. (d) Hyphae (hy) penetrating through epidermal cells (bar ¼ 12 mm). (e) Transverse section through a developing lesion showing necrotic cells in the center surrounded by cells with disrupted cytoplasm and staining a deep blue (bar ¼ 100 mm). (f) Development of a zone of phellogen or cork cambium (arrows) which has contained the infected epidermal cells (epi) (bar ¼ 50 mm). (g) Staining of cells in the zone of active division (marked by the box in f) with phloroglucinol and fluorescence under blue light, indicating accumulation of lignin. Underlying healthy cortical cells have not picked up the stain (bar ¼ 50 mm).

Table 2 Phenolic compounds present in epidermal tissues of healthy and Fusarium-infected roots of North American ginseng Phenolic compound

Concentration (mg/g fresh wt) Healthy

Infected

p-Coumaric acid Quercetin 3,4,5 Tri methyl benzoic acid Cinnamic acid Gallic acid Chlorogenic acid

0 0 0.27 0.05 0.92 0.2

0.34 1.92 1.67 6.2 1.44 0.76

The F. equiseti isolate S5A was used for the experiment and the analysis was conducted twice using two different root samples. Data are from one representative experiment, with two replicates.

PowerScriptÔ Reverse Transcriptase (Clontech Laboratories Inc.) according to the manufacturer’s instructions. A 10-fold dilution of the PCR product was used as template for RT-PCR which was performed with TITANIUMÔ Taq DNA Polymerase (Clontech Laboratories Inc.) and the reaction was set up as per the manufacturer’s instructions. The cycling parameters for the PCR amplification were as follows: an initial cycle at 94  C for 5 min and a final cycle at 68  C for 10 min. In between there were 30 cycles of 94  C for 1 min, 50–58  C (depending on Tm values of the primer pairs) for 1 min and 68  C for 1 min 30 s. Gene specific primers designed for seven selected ESTs and one constitutively expressed actin gene from ginseng were used (Table 1). Virtual Northerns [13,14] were conducted using 2.5 mg of cDNA obtained using the SMART PCR cDNA Synthesis Kit (Clontech Laboratories Inc.). Samples from

Table 3 ESTs/Contigs from Fusarium – inoculated ginseng root libraries coding for proteins homologous to A. thaliana that can be placed in defined functional categories EST/Contig ID

EST length

Hit accession

E-value

Similar proteins in A. thaliana

Unknown protein Hypothetical protein Putative stress-responsive protein DnaJ homolog Putative DnaJ protein Monodehydroascorbate reductase (MDAR) Glutathione S-transferase Superoxide dismutase [Mn] Ascorbate peroxidase Cationic peroxidase 1 precursor (PNPC1) Phenylpropanoid:glucosyltransferase 1 Putative glutathione S-transferase T3 Glutathione S-transferase GST 13 Monodehydroascorbate reductase Ubiquitin

Arabidopsis thaliana Fragaria x ananassa Tamarix androssowii Nicotiana tabacum Oryza sativa (japonica-group) Lycopersicon esculentum Arabidopsis thaliana Nicotiana plumbaginifolia Pimpinella brachycarpa Arachis hypogaea Nicotiana tabacum Lycopersicon esculentum Glycine max Hordeum vulgare subsp. vulgare Hevea brasiliensis

NP_563997 AAU05601 AAT01418 BAC53943 CAD29846 Q43497 AAG30140 P11796 AAF22246 P22195 AAK28303 AAG16758 AAG34803 CAC69935 AAP31578

1.45962E-31 2.54839E-19 1.82862E-77 8.27644E-62 2.84292E-32 4.32713E-97 7.06863E-69 7.98995E-83 8.74994E-92 9.6797E-117 4.3632E-53 1.17924E-56 9.51349E-42 2.86792E-80 1.0633E-123

At1g16430 At1g26360 At3g50830 At3g44110 At3g44110 At3g52880 At1g10360 At3g10920 At1g07890 At5g05340 At4g34131 At3g09270 At3g09270 At3g27820 At5g20620

Arabidopsis thaliana Medicago truncatula Medicago truncatula Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Medicago truncatula Cleome spinosa Fagus sylvatica Medicago truncatula Ricinus communis

AAF19706 ABN08027 ABO78415 NP_194952 CAA63387 NP_200200 ABE81462 ABD96912 CAB90634 ABE82399 CAC80550

4.70476E-33 3.81105E-32 1.81216E-83 5.66999E-63 6.03385E-41 1.36878E-92 2.9448E-103 2.94165E-81 2.44223E-68 1.8597E-118 4.94068E-80

At1g63430 At3g16570 At1g65410 At4g32250 At3g27560 At5g53890 At5g55560 At5g16050 At4g38520 At3g62260 At2g16600

Cellular transport, transport facilitation and transport routes Contig33 463 Hypothetical protein OsI_015550 5ASeq3P10D02_M13F_G09 561 Aquaporin PIP2;4 5ASeqP1A09_M13_A09 1242 Putative reverse transcriptase 5ASeqP1A10_M13_A10 1229 Putative aquaporin 5ASeqP1F06_M13_F06 1234 Plasma membrane intrinsic protein PIP1-1 Contig38 1221 ATMRP3 (multidrug resistance-associated protein 3) II9Seq2P10D02_M13F_C07 911 Rab11 GTPase II9Seq2P9D05_M13F_B03 807 Plant lipid transfer protein/Par allergen

Oryza sativa (indica group) Vitis vinifera Zingiber officinale Vitis vinifera Fraxinus excelsior Arabidopsis thaliana Solanum lycopersicum Medicago truncatula

EAY94317 ABN14353 ABK60177 ABH09327 AAT74898 NP_187915 CAB65172 ABE87133

7.33126E-55 9.38984E-57 1.34215E-11 6.19126E-86 1.0831E-138 7.1326E-118 2.30766E-78 1.36468E-20

At5g14040 At3g54820 At4g36790 At4g35100 At4g00430 At3g13080 At1g06400 At3g22600

Interaction with the environment (systemic) Contig30 777 5ASeq2P5E03_M13_B09 595 5ASeq2P7D07_M13_E07 1155 5ASeq2P8G03_M13_D09 474 5ASeqP1E05_M13_E05 1122 II9Seq2P8G09_M13F_D08 744 II9SeqP1H10_M13F_B02 783

Pathogenesis-related protein PR-4 type Protease inhibitor Unknown Allene oxide cyclase Avr9/Cf-9 rapidly elicited protein 271 Carbohydrate kinase, FGGY Putative auxin-repressed protein

Sambucus nigra Vitis vinifera Brassica rapa Medicago truncatula Nicotiana tabacum Medicago truncatula Prunus armeniaca

CAA87070 AAN85825 ABL97971 CAC83767 AAV92907 ABE79990 AAB88876

1.74063E-49 3.76608E-17 2.64329E-59 7.09739E-31 1.22165E-32 9.7084E-100 3.54556E-18

At3g04720 At5g43580 At3g17020 At3g25770 At5g53000 At1g80460 At1g56220

475 854 570 1223 471

Cytochrome P450 Hydrogen-transporting ATP synthase Ubiquinol-cytochrome-c reductase Cytochrome P450 monooxygenase CYP716A12 Fructose-bisphosphate aldolase

Panax ginseng Arabidopsis thaliana Arabidopsis thaliana Medicago truncatula Codonopsis lanceolata

BAD15331 NP_191432 NP_197927 ABC59076 BAE48790

3.61145E-59 1.4739E-108 5.80725E-33 2.42254E-74 3.49102E-66

At5g06900 At3g58730 At5g25450 At5g36110 At2g36460

747 940

TUA3 Nucleosome assembly protein 1-like protein 4

Arabidopsis thaliana Nicotiana tabacum

NP_197478 CAD27463

3.72884E-91 5.06796E-92

At5g19780 At2g19480

Cellular communication/signal 5ASeq3P10D08_M13F_D10 5ASeq3P9F04_M13F_B10 5ASeq2P5C08_M13_B02 5ASeq2P6C08_M13_A07 5ASeq2P6G02_M13_C02 5ASeq2P7D01_M13_E04 5ASeq2P9C09_M13_G05 Contig2 II9Seq2P7G02_M13F_C02 II9Seq2P9B10_M13F_B02 II9SeqP3F06_M13F_F01

Energy 5ASeq2P5A06_M13_A01 5ASeq2P7B09_M13_D10 5ASeq2P9B03_M13_F07 5ASeqP1G02_M13_G02 Contig23 Subcellular localization II9Seq2P10G04_M13F_H07 II9SeqP6F08_M13F_E12

transduction 1019 850 897 657 656 709 1188 882 1173 949 854

mechanism F2K11.19 Rapid Alkalinization Factor AAA ATPase ATP binding protein kinase/serine/therionine kinase Protein kinase ATP binding/protein kinase/protein serine/threonine kinase Protein kinase Hypothetical protein Protein phosphatase 2C (PP2C) Protein phosphatase 2C Cyclophilin

(continued on next page)

13

Organism

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

Description of BLASTX hit in GenBank

Cell rescue, defense and virulence 5ASeq3P9E02_M13F_A09 1206 5ASeq3P9E09_M13F_F09 798 5ASeq2P5B09_M13_A10 876 II9Seq2P10C02_M13F_A07 661 5ASeq2P5H03_M13_D02 464 5ASeq2P7E09_M13_E12 772 5ASeqP1A08_M13_A08 1257 5ASeqP1B12_M13_B12 1179 5ASeqP1F05_M13_F05 1136 Contig6 1134 II9Seq2P10B02_M13F_D06 543 II9SeqP1E02_M13F_A08 941 II9Seq2P10B11_M13F_G06 661 II9Seq2P9H12_M13F_E05 1199 II9SeqP6F02_M13F_E11 912

EST/Contig ID

14

Table 3 (continued) EST length

Organism

Hit accession

E-value

Similar proteins in A. thaliana

Ribosomal protein L10; Ribosomal protein 60S Hypothetical protein OsI_020753 Probable histone H2A.3 Syntaxin Unknown protein GRP-like protein 2 Endochitinase (chitinase Ib) Endochitinase (chitinase Ib)

Medicago truncatula Oryza sativa (indica cultivar-group) Medicago truncatula Glycine max Arabidopsis thaliana Gossypium hirsutum Castanea sativa Castanea sativa

ABE83633 EAY99520 Q1S053 AAN03474 NP_176646 ABG76000 AAB01895 AAB01895

2.79888E-26 1.02126E-32 2.78984E-39 2.86116E-41 5.6773E-140 6.7213E-117 5.71442E-93 7.39274E-18

At2g40010 At5g10980 At5g02560 At5g46860 At1g64650 At5g15650 At3g12500 At3g12500

Oryza sativa (japonica group) Arabidopsis thaliana

EAZ11134 NP_850984

4.91272E-51 3.91974E-95

Mesembryanthemum crystallinum Arabidopsis thaliana Oryza sativa (japonica cultivar-group) Medicago truncatula Petunia x hybrida Solanum tuberosum Trifolium pratense Nicotiana plumbaginifolia

AAD11431 NP_199096 NP_001048071 ABE84624 BAA21923 ABB55392 BAE71188 CAB75429

7.30624E-60 1.54494E-55 3.83108E-79 1.04304E-55 2.99642E-35 9.06922E-49 3.25029E-70 1.04203E-56

At3g06880 At1g79920 At5g15790 At1g24510 At5g42820 At4g04180 At1g24440 At2g37430 At2g04520 At2g35940 At3g14100

Protein fate (folding, modification, destination) 5ASeq3P9G07_M13F_B11 1182 Ubiquitin 5ASeqP1D09_M13_D09 1226 Peptidyl-prolyl isomerase FKBP12 (Immunophilin FKBP12) 5ASeqP1F03_M13_F03 1232 ATUBP3 (ubiquitin-specific protease 3) II9Seq2P8A12_M13F_H03 772 PBB2; endopeptidase/peptidase/threonine endopeptidase

Medicago truncatula Vicia faba Arabidopsis thaliana Arabidopsis thaliana

ABD32351 O04287 NP_568074 NP_198874

4.0965E-100 9.94036E-52 1.69217E-83 7.00456E-96

At4g05320 At5g64350 At4g39910 At5g40580

Protein synthesis 5ASeqP1A06_M13_A06 5ASeqP1B03_M13_B03 5ASeqP1B08_M13_B08 Contig13

867 828 1229 1068

Hypothetical protein OsI_005823 Structural constituent of ribosome Ribosomal protein L3 Os02g0321900 (putative ribosomal protein L10a)

Oryza sativa (indica cultivar-group) Arabidopsis thaliana Lycopersicon esculentum Oryza sativa (japonica group)

EAY84590 NP_566655 AAR17783 NP_001046690

1.63822E-46 4.03016E-23 1.84798E-94 1.31434E-97

At3g52580 At3g20230 At1g43170 At1g08360

Transcription 5ASeq2P5E11_M13_C05 5ASeq2P9A04_M13_F06 5ASeqP1A01_M13_A01 5ASeqP1A12_M13_A12 5ASeqP1F12_M13_F12

334 1161 1208 1081 1204

Putative multiprotein bridging factor 1 bZIP transcription factor bZIP109 Like-Sm ribonucleoprotein-related, core KIWI; DNA binding/transcription coactivator 6b-interacting protein 1

Nicotiana tabacum Glycine max Medicago truncatula Arabidopsis thaliana Nicotiana tabacum

BAB88859 ABI34660 ABE94617 NP_196487 BAB83610

1.98991E-25 8.00355E-64 3.01538E-61 5.77001E-29 4.85212E-19

At3g58680 At1g27000 At1g20580 At5g09250 At3g58630

Metabolism 5ASeq3P10E01_M13F_E11 5ASeq2P5H12_M13_D07 5ASeq2P6E07_M13_B07 5ASeq2P6F02_M13_B11 5ASeq2P6F12_M13_C01 5ASeq2P7H04_M13_G02 5ASeq2P8B03_M13_G09 5ASeq2P8D07_M13_H08 5ASeq2P9C04_M13_F12 5ASeqP1A05_M13_A05 5ASeqP1C05_M13_C05 5ASeqP1E12_M13_E12 5ASeqP1F09_M13_F09 5ASeqP1G08_M13_G08 5ASeqP1H07_M13_H07 5ASeqP1H09_M13_H09 Contig10

1128 899 1224 599 803 1211 511 1231 363 1211 1246 1143 1063 1201 1243 1192 886

Phenylcoumaran benzylic ether reductase homolog Fi1 OSJNBa0081C01.18 Hypothetical protein FG00260.1 Pectate lyase-like protein Squalene epoxidase Flavonoid 1–2 rhamnosyltransferase Beta-amylase Lactoylglutathione lyase Ubiquitin conjugating enzyme/ubiquitin-like activating enzyme Glutamate decarboxylase isozyme 1 Aspartate transaminase/catalytic/transferase, transferring nitrogenous groups Putative DNA binding protein Lipolytic enzyme, G-D-S-L Omega-6 fatty acid desaturase SHM4 (Serine hydroxymethyltransferase 4) Raucaffricine-O-beta-D-glucosidase Delta-12 fatty acid desaturase

Forsythia x intermedia Oryza sativa (japonica-group) Gibberella zeae PH-1 Arabidopsis thaliana Panax ginseng Citrus maxima Castanea crenata Arabidopsis thaliana Arabidopsis thaliana Nicotiana tabacum Arabidopsis thaliana Atriplex hortensis Medicago truncatula Sesamum indicum Arabidopsis thaliana Rauvolfia serpentina Tropaeolum majus

AAF64174 CAE03868 XP_380436 T46165 BAD15330 AAL06646 AAK30294 NP_176896 NP_565834 AAK18620 NP_850022 AAF91445 ABO78922 AAF80560 NP_193129 AAF03675 AAV52834

2.83831E-76 5.75853E-66 8.47377E-27 7.79589E-87 2.76583E-66 5.70799E-60 2.57938E-38 2.45651E-79 9.16838E-39 7.43759E-68 2.74417E-89 5.49975E-54 2.04848E-55 1.92648E-84 5.33651E-85 2.97979E-37 1.08774E-59

At4g39230 At2g24190 At3g51840 At3g53190 At4g37760 At5g65550 At2g32290 At1g67280 At2g36060 At5g17330 At2g22250 At3g51800 At3g26430 At3g12120 At4g13930 At2g44450 At3g12120

Protein with binding function 5ASeq3P10B07_M13F_C12 5ASeq3P9G04_M13F_H10 5ASeq2P9D09_M13_H10 5ASeqP1A11_M13_A11 5ASeqP1C09_M13_C09 5ASeqP1H12_M13_H12 II9Seq2P10A02_M13F_G05 II9Seq2P7G04_M13F_D02 II9Seq2P8F08_M13F_C08 II9SeqP2H05_M13F_D01 II9SeqP4H08_M13F_H02

or cofactor requirement (structural or catalytic) 862 Hypothetical protein OsJ_000959 716 ATP binding 399 No significant hits in GenBank 1204 T-complex protein 1 epsilon subunit 1267 RNA binding/nucleic acid binding 1133 Os02g0740300 (putative AAA family ATPase) 1213 Zinc finger, RING-type 1172 ZPT2-14 808 Putative translation initiation factor eIF-1A-like 706 BEL1-like homeodomain transcription factor 1075 Oligouridylate binding protein

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

Description of BLASTX hit in GenBank

Biogenesis of cellular components 5ASeq2P5B08_M13_A09 750 5ASeq2P6C02_M13_A03 644 5ASeq2P8B06_M13_G10 783 5ASeq2P8D03_M13_H07 491 5ASeqP1D06_M13_D06 1268 5ASeqP1D11_M13_D11 835 Contig35 916 II9SeqP5E09_M13F_B12 714

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

1.6989E-14 3.99425E-62 7.9553E-103 4.76223E-31 4.32729E-16 4.29728E-40 8.67883E-33 1.16755E-45 6.6144E-49 9.1444E-83 1.2584E-132 1.05811E-34 1.92298E-52 3.14059E-10 2.93407E-17 2.35557E-95 4.3044E-150 3.40289E-48 1.905E-115 1.45789E-22 4.39965E-92 1.91069E-41 1.91069E-41 6.19724E-19

At1g79870 At5g59590 At1g34060 At3g12120 At4g26140 At3g01980 At2g31490 At5g16980 At5g37980 At3g12120 At5g57655 At5g16990 At4g15210 At1g01800 At4g39230 At3g12120 At2g36390 At1g64520 At5g14760 At1g75280 At3g12120 At2g16790 At1g34060 At4g23560

mock-inoculated ginseng roots and those inoculated with isolates S5A and S9 were run side by side on a 1% agarose gel using 1XTBE and transferred onto Hybond XL nylon membranes (Amersham, Piscataway, NJ) as described by ref. [15]. Individual gene probes were prepared by PCR amplification of gene specific sequences from ginseng genomic DNA using primers mentioned in Table 1. The methods for probe labeling and hybridization were the same as those used for colony screening. These experiments were repeated at least twice for each gene. 2.6. Fungitoxicity of phenolic compounds The effect of total phenolic compounds produced in discolored tissues on Fusarium equiseti spore germination was determined. Extracts were obtained using 80% methanol containing 8% formic acid as described previously [7]. The extract was evaporated to dryness using a rotary evaporator. The dry residue was dissolved in 20 ml dd H2O and diluted by 10-fold and compared to extracts from healthy tissues and a water control. Spores of F. equiseti were obtained from mung bean agar plates [16] and added to the treatment extract or water to achieve a concentration of 15– 20 spores/ml. Five ml drops of spore suspension were placed on glass slides and germinating spores were counted after incubating for 16 h inside Petri dishes containing water agar. Germ tube growth was determined from 100 spores in two replicates. EST sequences showing significant TBLASTX matches to sequences from MeJA treated ginseng library are depicted in bold in the table.

NP_178105 NP_200767 NP_564435 P30924 BAF31233 BAE48662 NP_565726 BAA89423 BAA89423 AAO38031 ABE83402 BAA89423 O65015 ABD28442 AAF64174 AAO38031 AAZ20130 ABI31652 CAC01875 AAF64174 AAS19533 AAM63104 AAM63104 P22503 Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Solanum tuberosum Persea americana Prunus mume Arabidopsis thaliana Nicotiana tabacum Nicotiana tabacum Hedera helix Medicago truncatula Nicotiana tabacum Trifolium repens Medicago truncatula Forsythia x intermedia Hedera helix Malus x domestica Camellia sinensis Arabidopsis thaliana Forsythia x intermedia Cucurbita pepo Arabidopsis thaliana Arabidopsis thaliana Phaseolus vulgaris Oxidoreductase family protein UDP-glucoronosyl/UDP-glucosyl transferase family protein Alliinase family protein 1,4-alpha-glucan branching enzyme (Starch branching enzyme) Beta-D-galactosidase Alcohol dehydrogenase Unknown protein Allyl alcohol dehydrogenase Allyl alcohol dehydrogenase Delta12-fatty acid acetylenase Xylose isomerase Allyl alcohol dehydrogenase Beta-amylase (1,4-alpha-D-glucan maltohydrolase) Short-chain dehydrogenase/reductase SDR Phenylcoumaran benzylic ether reductase homolog Fi1 Delta12-fatty acid acetylenase Starch branching enzyme I 26S proteasome regulatory particle non-ATPase subunit 12 L-aspartate oxidase-like protein Phenylcoumaran benzylic ether reductase homolog Fi1 Omega-6 fatty acid desaturase Putative gluconokinase Putative gluconokinase Endoglucanase precursor (Endo-1,4-beta-glucanase) (Abscission cellulase) 1205 801 1040 748 1164 501 500 407 676 545 826 476 431 259 742 775 1151 616 1117 620 869 826 826 413 Contig11 Contig12 Contig14 Contig5 Contig17 Contig24 Contig25 Contig26 Contig27 Contig31 Contig36 II9Seq2P10D03_M13F_D07 II9Seq2P9H08_M13F_B05 II9Seq2P9H11_M13F_D05 II9SeqP1F08_M13F_A11 II9SeqP2A03_M13F_B05 II9SeqP2C03_M13F_B09 II9SeqP3E01_M13F_E09 II9SeqP3G04_M13F_F06 II9SeqP4C01_M13F_G10 II9SeqP4C11_M13F_G05 II9SeqP5E08_M13F_B11 II9SeqP6A11_M13F_E06 II9SeqP6D04_M13F_F11

15

3. Results 3.1. Light microscopy of artificially inoculated roots Discrete superficial reddish–brown lesions that developed following inoculation with F. equiseti isolate S5A (Fig. 1a) were sectioned and examined under the light microscope. The uppermost 3–4 cell layers of the epidermis were stained a greenish–blue color with Toluidine blue (Fig. 1b), indicating an accumulation of phenolic compounds [8]. Hyphae could be seen ramifying between and through epidermal cells 7 days after inoculation (Fig. 1c,d). A transverse section through the developing lesion revealed an intense staining with Toluidine blue and the cells appeared to be disrupted (Fig. 1e). At a more advanced stage of lesion development (12 days after inoculation), a zone of actively dividing cells developed in the region between the epidermis and the cortex (Fig. 1f), which restricted the lesioned area. The zone contained lignified cells which fluoresced when stained with phloroglucinol (Fig. 1g). 3.2. Measurement of phenolic compounds Tissue extracts from discolored areas on artificially inoculated ginseng roots contained 3-fold higher total phenolics, measured using the Folin–Ciocalteau method, compared to extracts from adjacent healthy areas. HPLC analysis revealed that several phenolic compounds were enhanced following Fusarium infection, in particular cinnamic acid, quercetin and chlorogenic acid (Table 2). 3.3. Sequence analysis and assembly Two cDNA libraries, Ginseng-Feq S5A and S9, were constructed using suppression subtractive hybridization, and 960 colonies were selected from each library by blue–white screening and used for the preparation of membrane arrays. To determine whether similar genes were expressed in both libraries, the arrays for the GinsengFeq S5A library, created using ginseng roots inoculated with F. equiseti strain S5A, were hybridized with cDNA from those inoculated with the strain S9 and vice-versa. Data demonstrate the overall similarity of the S5A and S9 disease interactions. Therefore,

16

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

Table 4 ESTs/Contigs from Fusarium – inoculated ginseng root libraries coding for proteins homologous to A. thaliana that cannot be placed in defined functional categories EST/Contig ID

EST length Description of BLASTX hit in GenBank

Gin-FeqS5ASeq3P10C04_M13F_F12 Gin-FeqS5ASeq3P10C08_M13F_H12

315 570

Mitochondrial prohibitin 1 Cytochrome P450 monooxygenase CYP716A12 Nucleic acid binding, related Os02g0139100 unknown protein

Gin-FeqS5ASeq3P9F10_M13F_G10 Gin-FeqS5ASeq3P9H07_M13F_F11

915 394

Gin-FeqS5ASeq2P5A10_M13_A06

1181

Gin-FeqS5ASeq2P5C09_M13_B08 Gin-FeqS5ASeq2P5F11_M13_C08 Gin-FeqS5ASeq2P5G10_M13_C10 Gin-FeqS5ASeq2P6D06_M13_A12 Gin-FeqS5ASeq2P6D09_M13_B03 Gin-FeqS5ASeq2P6D12_M13_B05 Gin-FeqS5ASeq2P6G05_M13_C04 Gin-FeqS5ASeq2P6H09_M13_C11

608 759 860 632 1200 516 829 1173

Gin-FeqS5ASeq2P7B10_M13_D11 Gin-FeqS5ASeq2P7E12_M13_F03 Gin-FeqS5ASeq2P9B08_M13_F08

667 591 709

Gin-FeqS5ASeq2P9D01_M13_H03 Gin-FeqS5ASeq2P9D06_M13_H09 Gin-FeqS5ASeqP1A04_M13_A04 Gin-FeqS5ASeqP1C11_M13_C11 Gin-FeqS5ASeqP1D03_M13_D03 Gin-FeqS5ASeqP1D08_M13_D08 Gin-FeqS5ASeqP1E02_M13_E02 Gin-FeqS5ASeqP1G06_M13_G06

851 864 1223 1201 1260 1235 954 997

Putative pollen specific LIM domain-containing protein No significant hits in GenBank Unknown Fb27 Unknown Cytochrome P450 Unknown protein WD-40 repeat family protein Cytochrome P450 monooxygenase CYP83E8 SF21D1 splice variant protein Unknown protein Guercetin 3-O-glucoside-600 -O-malonyltransferase Unknown protein Unknown protein Unknown EDGP precursor Unknown protein Unknown protein Putative tumor-related protein Hypothetical protein OsI_015859

Gin-FeqS5ASeqP1G10_M13_G10 Gin-FeqS5ASeqP1G12_M13_G12 Gin-FeqS5ASeqP1H02_M13_H02 Gin-FeqS5ASeqP1H03_M13_H03 Gin-FeqS5ASeqP1H04_M13_H04

1230 1181 1125 1174 1222

DC2.15 like protein Hydrolase, acting on glycosyl bonds No significant hits in GenBank CXE carboxylesterase Os02g0741900

Gin-Feq Contig1 Gin-Feq Contig16 Gin-Feq Contig28 Gin-Feq Contig3 Gin-Feq Contig32 Gin-Feq Contig39

602 667 865 744 1051 690

Major latex-like protein RNase-like major storage protein CXE carboxylesterase RabGAP/TBC F-box family protein-like Putative orcinol O-methyltransferase

Gin-Feq Contig4 Gin-Feq Contig8 Gin-FeqS9Seq2P10A01_M13F_F05 Gin-FeqS9Seq2P10C03_M13F_B07 Gin-FeqS9Seq2P10F08_M13F_G07

1047 587 651 661 617

Gin-FeqS9Seq2P7H05_M13F_F02 Gin-FeqS9Seq2P7H06_M13F_A03 Gin-FeqS9Seq2P8G12_M13F_E08 Gin-FeqS9Seq2P8H11_M13F_F01 Gin-FeqS9SeqP2A11_M13F_B06 Gin-FeqS9SeqP2E09_M13F_C06 Gin-FeqS9SeqP3A05_M13F_D05 Gin-FeqS9SeqP3B11_M13F_D12 Gin-FeqS9SeqP3C01_M13F_E01 Gin-FeqS9SeqP3D06_M13F_E07 Gin-FeqS9SeqP4F12_M13F_G09

692 576 1057 862 654 435 830 864 864 726 909

Cationic peroxidase No significant hits in GenBank Pheromone receptor-like protein Cytochrome P450 Translocon-associated protein beta family protein-like At1g51540 DREPP2 protein Unknown protein Oxysterol binding Catalytic/epoxide hydrolase/hydrolase Lemir Negatively light-regulated protein Unknown protein Unknown protein Unknown protein Putative peptidyl-prolyl cis-trans isomerase

Gin-FeqS9SeqP7C01_M13F_H07 Gin-Feq Contig18 Gin-Feq Contig20 Gin-Feq Contig22

1153 741 1135 523

Gin-Feq Contig37 Gin-FeqS9SeqP4H01_M13F_G12

621 521

Putative dessication-related protein Basic blue copper protein Unknown Putative alanine-glyoxylate aminotransferase N-terminal FAD linked oxidase Putative actin related protein 2

Gin-Feq Contig29

635

MYB transcription factor

Organism

Hit accession

E-value

GenBank Acc. no. for similar proteins in A. thaliana

Petunia x hybrida Medicago truncatula

AAW83328 ABC59076

1.67217E-11 1.21088E-30

At3g27280 At5g36140

Medicago truncatula ABN08873 2.76406E-71 At1g55790 Oryza sativa (japonica NP_001045842 7.73565E-30 At5g58110 cultivar-group Lycopersicon esculentum AAX73300 1.25529E-88 At1g10200 At3g13520 At4g02370 At3g12030 At1g76560 At3g48280 At1g08480 At3g18140 At4g31500

Arabidopsis thaliana Gossypium hirsutum Arabidopsis thaliana Solanum tuberosum Arabidopsis thaliana Gossypium hirsutum Glycine max

AAM63118 AAY43795 AAM62589 CAC24711 NP_563819 AAX18231 ABC68397

5.83843E-39 8.63655E-40 6.62409E-12 2.13492E-75 1.25099E-27 1.41688E-60 6.41204E-77

Helianthus annuus Arabidopsis thaliana Verbena x hybrida

ABB82547 NP_196231 AAS77402

3.83039E-30 At5g56750 5.73064E-18 At5g06130 1.64717E-29 At3g29670

Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Daucus carota Arabidopsis thaliana Arabidopsis thaliana Medicago truncatula Oryza sativa (indica cultivar-group) Daucus carota Arabidopsis thaliana

NP_194233 NP_197065 AAM60966 BAA03413 NP_173730 NP_564000 ABE81141 EAY94626

2.01144E-49 1.71507E-19 9.26993E-50 6.25503E-51 5.82985E-55 6.32368E-38 5.5207E-86 6.62445E-53

Malus pumila Oryza sativa (japonica group) Prunus persica Panax ginseng Actinidia arguta Medicago truncatula Solanum tuberosum Rosa hybrid cultivar ‘ Kazanlik’ Nelumbo nucifera

At4g25030 At5g15610 At1g28120 At1g03220 At1g23170 At1g16520 At1g73320 At5g43050

BAA99575 NP_186921

4.09357E-29 At2g45180 1.5461E-107 At3g02720 At3g14280 ABB89012 7.8591E-89 At5g06570 NP_001048085 2.43381E-58 At1g24050 AAK14060 P83618 ABB89014 ABE88406 ABB29946 CAH05083

1.83835E-26 6.11951E-87 6.34741E-76 1.23877E-71 4.51732E-98 5.04103E-65

ABN46984

1.2245E-111

At1g70830 At1g14210 At5g62180 At3g49350 At5g39250 At4g35160

Quercus robur Nicotiana tabacum Solanum tuberosum

CAE12164 AAD47832 ABB87132

At4g21960 At1g25520 1.43029E-18 At2g15760 1.62276E-41 At3g48270 7.58085E-48 At5g14030

Arabidopsis thaliana Nicotiana tabacum Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Lycopersicon esculentum Vernicia fordii Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Oryza sativa (japonica-group) Arabidopsis thaliana Cicer arietinum Panax ginseng Arabidopsis thaliana

AAO42878 CAB91552 NP_191644 NP_567662 NP_567228 AAC63057 AAD05437 NP_564892 NP_564892 NP_199238 AAP12903

8.3599E-100 3.53984E-26 4.7234E-20 1.65968E-98 1.38459E-53 1.62933E-19 1.16988E-30 1.25671E-37 1.25671E-37 2.24877E-42 1.27383E-57

At1g51540 At4g20260 At3g60850 At4g22540 At4g02340 At1g17860 At1g69510 At2g37940 At1g67250 At5g44250 At1g13690

AAG51530 CAA10134 ABD73296 NP_187498

2.20307E-98 3.7646E-36 5.72769E-85 3.42635E-67

At1g47980 At2g02850 At5g44380 At3g08860

Medicago truncatula Oryza sativa (japonica-group) Catharanthus roseus

ABE90048 BAD03487

4.30726E-32 At5g44400 2.2487E-61 At3g27000

ABL63124

2.05615E-50 At1g70000

EST sequences showing significant TBLASTX matches to sequences from MeJA treated ginseng library are depicted in bold in the table.

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

17

Table 5 ESTs/Contigs from Fusarium – inoculated ginseng root libraries coding for protein homologs in GenBank but not similar to A. thaliana EST/Contig ID

EST length

BLASTX hit in GenBank

Organism

Hit accession

E-value

Gin-FeqS5ASeqP1A03_M13_A03 Gin-FeqS5ASeqP1B06_M13_B06 Gin-FeqS5ASeqP1D05_M13_D05 Gin-FeqS5ASeqP1E01_M13_E01 Gin-FeqS5ASeqP1E07_M13_E07 Gin-FeqS5ASeqP1F02_M13_F02 Gin-FeqS9SeqP1D11_M13F_A07

1222 1154 1184 1202 435 1247 866

Hypothetical protein 3 Putative reverse transcriptase Putative reverse transcriptase Hypothetical protein 3 Hypothetical protein 3 Putative reverse transcriptase Ribonuclease 2

Microplitis demolitor bracovirus Zingiber officinale Zingiber officinale Microplitis demolitor bracovirus Microplitis demolitor bracovirus Zingiber officinale Panax ginseng

YP_239367 ABK60177 ABK60177 YP_239367 YP_239367 ABK60177 P80890

5.68E-15 3.6E-16 1.86E-12 1.36E-13 1.93E-12 5.84E-15 7.84E-73

EST sequences showing significant TBLASTX matches to sequences from MeJA treated ginseng library are depicted in bold in the table.

sequences from both libraries were pooled together for further analysis. The arrays from these two libraries were also hybridized with cDNA probes from control ginseng roots to confirm differential expression and identify clones of interest. Twenty-five percent of the colonies which did not hybridize to the control cDNA probe were considered to be induced or significantly up-regulated only during this interaction. Three 96-well plates containing randomly selected screened colonies from the Ginseng-Feq S5A library and two similar plates from the Ginseng-Feq S9 library were sequenced. Subsequent to screening the sequences for quality and vector contamination, 196 good quality EST sequences from the GinsengFeq S5A library and 146 from the Ginseng-Feq S9 library were obtained. The average sequence size was approximately 890 bp. The CAP3 sequence assembly program [12] was used to group together redundant ESTs which had overlapping sequences from both the libraries. A consensus sequence was obtained for each contig, and every EST in the contig was considered to be a copy of the transcript from the same gene. The 342 EST sequences could be aligned into 39 contigs and 230 singletons (269 unigenes). 3.4. Comparisons to other sequence databases and verification of differential gene expression One hundred and eighty-five of the unigene sequences had significant matches (E-value
differential expression of these genes in both Ginseng-Feq S5A and Ginseng-Feq S9 libraries as compared to the non-inoculated control (Fig. 3). 3.5. Fungitoxicity of phenolic compounds The effect of total phenolic extracts from healthy and inoculated ginseng tissues on spore germination of F. equiseti is shown in Fig. 4. The extent of germ tube growth was reduced by up to 70% in the presence of extracts from inoculated tissues compared to healthy tissue and a water control (Fig. 4). 4. Discussion The light microscopic observations of ginseng root tissues following inoculation with F. equiseti showed that the affected cells were mostly localized to the uppermost 8–14 cell layers or 100– 200 mm depth and they stained a greenish–blue with Toluidine blue, indicating an accumulation of phenolic compounds [17–19]. Further expansion of this zone was restricted by the development of a narrow layer of dividing cells in the region adjacent to the cortex, resembling a phellogen or cork cambium layer [20,21]. The cells in this region had lignin in their walls. These observations suggest that the ginseng roots had initiated a response to restrict the progression of the fungus, resembling the responses of other plant species to wounding or pathogen infection [20–22]. Biochemical changes that accompanied the visual tissue response included elevated levels of phenolic compounds, such as several flavonoids (quercetin, catechin, tannic acid), which are intermediates or end-products in the phenylpropanoid pathway leading to the production of lignin and other defense-related compounds in plants [23–27]. Our results showed that extracts containing phenolic compounds produced by infected ginseng roots were toxic to F. equiseti, in agreement with the well-known role of phenolics in limiting pathogen invasion of plant tissues during plant defense responses [28–32]. The surface discoloration of epidermal tissues is likely the outcome of oxidation and polymerization of these phenolic compounds by enzymes such as peroxidases [18,33–35]. Quinones and free radicals produced as a result of oxidation of phenols possess the ability to inactivate enzymes. Moreover, oxidized phenolic species have been shown to possess increased antimicrobial activity and could play a role in inhibiting pathogen development [36]. These enzymes also

Table 6 ESTs/Contigs from libraries considered to be of fungal origin EST/Contig ID

EST length

F. graminearum hit

BLASTN E-Value

Description of BLASTX against sequences in GenBank

Gin-FqS9SeqP6F02_M13F_E11 Gin-FeqS5ASeq3P9G07_M13F_B11 Gin-FeqS5ASeq3P10B04_M13F_B12 Gin-FeqS5ASeq2P9C11_M13_G08 Gin-FeqS5ASeq2P7D12_M13_E08 Gin-FeqS5ASeq2P6E07_M13_B07

1224 1183 1193 501 1182 912

fg_contig_1.10 fg_contig_1.224 fg_contig_1.111 fg_contig_1.250 fg_contig_1.354 fg_contig_1.354

2.43E-46 1.82E-131 2.15E-37 3.10E-51 5.86E-44 4.85E-26

Hypothetical protein FG00260.1 from F. graminearum No significant matches in GenBank Hypothetical protein FG02077.1from F. graminearum No significant matches in GenBank Ubiquitin from Medicago truncatula (ABD32351) E-Value: 4.1E-100 Polyubiquitin 6 from Petroselinum crispum (S30151) E-Value: 4.8E-124

18

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

Fig. 2. Distribution of ESTs and contigs from Fusarium – inoculated ginseng root SSH libraries into functional groups according to their BLASTX hits to A. thaliana proteins.

C

S5A

S9

C

S5A

S9

a

400bp

b

300bp

c

400bp

d

850bp

e

350bp

f

400bp

g

500bp

h

650bp

Fig. 3. RT-PCR and Virtual Northern blots using total RNA and cDNA from mock-inoculated (M), S5A inoculated (S5A) and S9 inoculated (S9) ginseng roots, 7 days after inoculation. The left column shows virtual Northern blots for each gene and the right column shows the RT-PCR results for the same gene. (a) PR-4 (Contig 30); (b) MnSOD (S5ASeqP1B12_M13_B12); (c) 14-3-3 family protein (Contig2); (d) orcinol O-methyltransferase (Contig 39); (e) cationic peroxidase (Contig 4); (f) protease inhibitor (S5ASeq2P5E03_M13_B09); (g) glutathione S-transferase (S5ASeqP1A08_M13_A08); (h) ginseng actin (GI AY907207).

polymerize phenolic acids to form lignin, thereby further enhancing resistance to pathogens [22,24,26,27,37,38]. The above biochemical changes were supported by findings from analysis of gene expression in infected root tissues. A large number of genes with putative defense functions were detected, along with those encoding proteins involved in the production of reactive oxygen species and phenolics. Homologs of previously reported defense response genes expressed during this interaction included a pathogenesis-related chitinase gene-PR4 [39], glucanase [40], protease inhibitors [41], glutathione S-transferases [42], cytochrome P450 monooxygenases [4,43,44] and other cytochrome p450 genes [45]. Transcription of genes involved in signal transduction and regulation of defense pathways, such as protein kinases [46] and members of the 14-3-3 family of proteins [47], were also elevated. Expression of a gene similar to that encoding syntaxin, a phosphorylation target [48] in the early Avr9/Cf-9 signaling pathway and an Avr9/Cf-9 rapidly elicited protein, was also detected in infected ginseng roots. Production of reactive oxygen species (ROS), O 2 or its dismutation product hydrogen peroxide (H2O2), is one of the earliest responses to pathogen invasion. Plants have well-developed systems for limiting the formation of ROS as well as enabling its removal through antioxidant processes [49]. Therefore, enzymes involved in detoxification of these species are often associated with defense responses. Superoxide dismutases (SODs) form the first line of defense against the ROS and the presence of MnSOD transcripts among the ESTs in infected ginseng roots suggests the release of ROS during this interaction [50]. Additionally, three ESTs coding for homologs of glutathione S-transferases that protect the cell from oxidative damage by quenching and sequestering reactive molecules with the addition of glutathione (GSH) [51] were identified in infected ginseng roots. Two of these appear to belong to the group participating in the broad network with regulatory and catalytic functions associated with oxidative stress responses [52]. Several genes encoding peroxidases, which catalyze the oxidoreduction of various substrates using H2O2 [53], were also expressed

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

19

Fig. 4. Spore germination of F. equiseti and germ tube growth on glass slides in 5 mL droplets containing water or extracts from ginseng roots. (a) Water control; (b) extract from healthy roots; (c) extract from Fusarium-inoculated root. Photos were taken after 16 h of incubation inside a Petri dish containing water agar. Scale bar ¼ 25 mm for all photos.

in ginseng roots. Furthermore, gene transcripts coding for monodehydroascorbate reductase, an enzyme crucial for the regeneration of ascorbate, a major antioxidant and free-radical scavenger in plants [54], were found to be present. Lignification of plant cells around sites of infection is reported to be a defense response that can potentially slow down pathogen ingress [29]. Identification of a number of genes involved in the phenylpropanoid biosynthesis pathway supports the observation of lignin deposition and accumulation of phenolic intermediates in infected roots. The most abundant transcripts in the libraries were homologs of genes encoding peroxidases, which are required for the final polymerization of phenolic derivatives into lignin and may also be involved in suberization or wound healing [19]. A gene encoding a homolog of phenylcoumaran benzoic ether reductase (PCBER), an enzyme involved in lignan synthesis and known to be elevated in lignifying tissues [55,56], was shown to be up-regulated in ginseng roots. Another transcript of interest was a homolog of a gene coding for transcription factor NtLIM from tobacco. NtLIM has been demonstrated to bind to the Pal-box sequence and regulate transcription of phenylpropanoid biosynthesis genes [57]. ESTs coding for enzymes involved in the production of volatile phenolic derivatives, such as orcinol Omethyltransferase, were also detected in ginseng roots. This enzyme is closely related to other plant methyltransferases, with substrates ranging from isoflavones to phenylpropenes [58] and is believed to function in plant defense [59]. Our analysis of gene expression further demonstrated that a number of genes encoding proteins known to be expressed in jasmonic acid-mediated defense response, were induced or upregulated during infection by Fusarium. Allene oxide synthase and allene oxide cyclase, two key enzymes in the biosynthesis of jasmonic acid [60], were represented in the library. ESTs similar to genes coding for delta 12 and omega 6 fatty acid desaturases, involved in the conversion of oleic to linoleic acid, a substrate for jasmonic acid synthesis [61], were also identified in infected ginseng roots. Additionally, transcripts of homologs for genes such as epoxide hybrolase [62], PR-4 [37], 14-3-3 family protein [63] and AAA ATPase (NtAAA1) from tobacco, reported to be induced in the presence of JA, were isolated. The latter finding is strengthened by the significant similarity of nearly 40% of the EST-encoded proteins in the present study to those expressed in a methyl jasmonate treated P. ginseng hairy root library [9]. Our results support the hypothesis that the tissue responses in the ginseng root are the culmination of defense responses to preclude further invasion by Fusarium. Detection of mRNA coding for products potentially involved in lignification, detoxification, anthocyanin production and cell wall reinforcement could explain the progression of the root discoloration symptom. Presence of a large number of ESTs associated with the JA pathway and detoxification

of ROS in the subtraction libraries strongly suggests the involvement of these mechanisms in the F. equiseti-ginseng interaction. The fungitoxicity of the phenolic compounds produced as a result of this interaction suggests that root discoloration on ginseng is likely to be a pathogen-induced defense response. These findings indicate that in many respects, the ginseng root tissues respond similarly to root tissues of other plant species [13,64] or leaves challenged with potential pathogenic fungi [12,65–67]. However, several genes whose homologs were detected during this study have not been characterized for their possible roles in defense responses. Genes with similarity to sequences encoding unknown proteins and others homologous to genes coding for proteins such as major latex like proteins, CXE carboylase and pheromone receptor like protein belong to this group. Such genes could account for differences in gene expression specific to ginseng root tissues and need to be examined further. Acknowledgements This research was funded by the Natural Sciences and Engineering Research Council of Canada through the University/Industry Collaborative Research and Development (CRD) Program. We thank N. Verma and J. Lussio for assistance with the library construction, L. Lieppi for technical support, M. Rahman for conducting the phenolics assay, and T. Holmes for assistance with the light microscopic work. References [1] Jung JD, Park HW, Hahn Y, Hur CG, In DS, Chung HJ, et al. Discovery of genes for ginsenoside biosynthesis by analysis of ginseng expressed sequence tags. Plant Cell Rep 2003;22:224–30. [2] Stitcher O. Getting to the root of ginseng. Chemtech 1998;28:26–32. [3] Attele AS, Wu JA, Yuan CS. Ginseng pharmacology: multiple constituents and multiple actions. Biochem Pharmacol 1999;58:1685–93. [4] Nam MH, Kim S, Liu JR, Yang DC, Lim YP, Kwon K-H, et al. Proteomic analysis of Korean ginseng (Panax ginseng CA Meyer). J Chromatogr B 2004;815:147–55. [5] Kim MK, Yoon JH, Yang DC, Sun H, Lee BS, In JG. Comparative analysis of expressed sequence tags (ESTs) of ginseng leaf. Plant Cell Rep 2006;25:599–606. [6] Punja ZK, Wan A, Goswami RS, Verma N, Rahman M, Barasubiye T, et al. Diversity of Fusarium species associated with discolored ginseng roots in British Columbia. Can J Plant Pathol 2007;29:340–53. [7] Punja ZK, Wan A, Rahman M, Goswami RS, Barasubiye T, Seifert KA, et al. Growth, population dynamics, and diversity of Fusarium equiseti in ginseng fields. Eur J of Plant Pathol 2008 in press. [8] Rahman M, Punja ZK. Biochemistry of ginseng root tissues affected by rusty root symptoms. Plant Physiol Biochem 2005;43:1103–14. [9] Choi DW, Jung JD, Ha YI, Park HW, In DS, Chung HJ, et al. Analysis of transcripts in methyl jasmonate-treated ginseng hairy roots to identify genes involved in the biosynthesis of ginsenosides and other secondary metabolites. Plant Cell Rep 2004;23:557–66. [10] Hong CP, Lee SJ, Park JY, Plaha P, Park YS, Lee YK, et al. Construction of a BAC library of Korean ginseng and initial analysis of BAC-end sequences. Mol Genet Genomics 2004;271:709–16.

20

R.S. Goswami, Z.K. Punja / Physiological and Molecular Plant Pathology 72 (2008) 10–20

[11] Goswami RS, Dong YH, Punja ZK. Host range and mycotoxin production by Fusarium equiseti isolates originating from ginseng fields. Can J Plant Pathol 2007;29:340–53. [12] Huang XQ, Madan A. CAP3: A DNA sequence assembly program. Genome Res 1999;9:868–77. [13] Cramer RA, Lawrence CB. Identification of Alternaria brassicicola genes expressed in planta during pathogenesis of Arabidopsis thaliana. Fungal Genet Biol 2004;41:115–28. [14] Nimbalkar SB, Harsulkar AM, Giri AP, Sainani MN, Franceschi V, Gupta VS. Differentially expressed gene transcripts in roots of resistant and susceptible chickpea plant (Cicer arietinum L) upon Fusarium oxysporum infection. Physiol Mol Plant Pathol 2006;68:176–88. [15] Rosewich UL, Pettway RE, McDonald BA, Kistler HC. High levels of gene flow and heterozygote excess characterize Rhizoctonia solani AG-1 IA (Thanatephorus cucumeris) from Texas. Fungal Genet Biol 1999;28:148–59. [16] Evans CK, Xie W, Dill-Macky R, Mirocha CJ. Biosynthesis of deoxynivalenol in spikelets of barley inoculated with macroconidia of Fusarium graminearum. Plant Dis 2000;84:654–60. [17] Gutmann M. Improved staining procedures for photographic documentation of phenolic deposits in semithin sections of plant-tissue. J Microscopy-Oxford 1995;179:277–81. [18] Krishnamurthy KV. Methods in cell wall cytochemistry. Boca Raton, FL: CRC Press; 1999. [19] Punja ZK. Genetic engineering of plants to enhance resistance to fungal pathogens. In: Punja ZK, editor. Fungal disease resistance in plants-biochemistry, molecular biology and genetic engineering. New York: The Haworth Press Inc; 2004. p. 207–41. [20] Esau K. Plant Anatomy. 2nd ed. New York: John Wiley and Sons Inc; 1965. [21] Jones AP. The histology of potato scab. Ann Appl Biol 1931;18:313–33. [22] Hammerschmidt R. Rapid deposition of lignin in potato tuber tissue as a response to fungi non-pathogenic on potato. Physiol Plant Pathol 1984;24:33–42. [23] Boerjan W, Ralph J, Baucher M. Lignin biosynthesis. Annu Rev Plant Biol 2003; 54:519–46. [24] Dixon RA, Achnine L, Kota P, Liu C, Reddy SMS, Wang L. The phenylpropanoid pathway and plant defense – a genomic perspective. Mol Plant Pathol 2002;3: 371–90. [25] Friend J. Plant phenolics, lignification and plant disease. Prog Phytochem 1981;7:197–261. [26] Hahlbrock K, Scheel D. Physiology and molecular biology of phenylpropanoid metabolism. Annu Rev Plant Physiol Plant Mol Biol 1989;40:347–69. [27] Vance CP, Kirk TK, Sherwood RT. Lignification as a mechanism of disease resistance. Annu Rev Phytopathol 1980;18:259–88. [28] Matern U, Kneusel RE. Phenolic compounds in plant disease resistance. Phytoparasitica 1988;16:153–70. [29] Nicholson RL, Hammerschmidt R. Phenolic compounds and their role in disease resistance. Annu Rev Phytopathol 1992;156:369–89. [30] Skadhauge B, Thomsen KK, Von Wettstein D. The role of the barley testa layer and its flavonoid content in resistance to Fusarium infections. Hereditas 1997; 126:147–60. [31] Southerton SG, Deverall BJ. Changes in phenolic acid levels in wheat leaves expressing resistance to Puccinia recondita fsp tritici. Physiol Mol Plant Pathol 1990;37:231–43. [32] Baidez AG, Gomez P, Del Rio JA, Ortudo A. Antifungal capacity of major phenolic compounds of Olea europaea L against Phytophthora megasperma Drechsler and Cylindrocarpon destructans (Zinssm) Scholten. Physiol Mol Plant Pathol 2006;69:224–9. [33] Alca´zar MD, Egea C, Eapin A, Candela ME. Peroxidase isoenzymes in the defence response of Capsicum annuum to Phytophthora capsici. Physiol Plant 1995;94:736–42. [34] Cheng GW, Crisosto CH. Browning potential phenolic composition and polyphenoloxidase activity of buffer extracts of peach and nectarine skin tissue. J Am Soc Hort Sci 1995;120:835–8. [35] Mayer AM, Harel E. Polyphenoloxidases in plants. Phytochemistry 1979;18: 193–215. [36] Hammerschmidt R. Phenols and plant-pathogen interactions: the saga continues. Physiol Mol Plant Pathol 2005;66:77–8. [37] Dicko MH, Gruppen H, Barro C, Traore AS, van Berkel WJH, Voragen AGJ. Impact of phenolic compounds and related enzymes in sorghum varieties for resistance and susceptibility to biotic and abiotic stresses. J Chem Ecol 2005; 31:2671–88. [38] Mohammadi M, Kazemi H. Changes in peroxidase and polyphenol oxidase activities in susceptible and resistant wheat heads inoculated with Fusarium graminearum and induced resistance. Plant Sci 2002;162:491–8. [39] Thomma BP, Eggermont K, Penninckx IA, Mauch-Mani B, Vogelsang R, Cammue BP, et al. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc Natl Acad Sci USA 1998;95:15107–11. [40] Mauch F, Staehelin LA. Functional implications of the subcellular-localization of ethylene-induced chitinase and beta-13-glucanase in bean leaves. Plant Cell 1989;1:447–57.

[41] Valueva TA, Mosolov VV. Role of inhibitors of proteolytic enzymes in plant defense against phytopathogenic microorganisms. Biochemistry 2004;69: 1305–9. [42] Szatmari A, Ott PG, Varga GJ, Besenyei E, Czelleng A, Klement Z, et al. Characterisation of basal resistance (BR) by expression patterns of newly isolated representative genes in tobacco. Plant Cell Rep 2006;25:728–40. [43] Frey M, Chomet P, Glawischnig E, Stettner C, Grun S, Winklmair A, et al. Analysis of a chemical plant defense mechanism in grasses. Science 1997;277: 696–9. [44] Hammond-Kosack KE, Jones JDG. Resistance gene-dependent plant defense responses. Plant Cell 1996;8:1773–91. [45] Takemoto D, Hayashi M, Doke N, Nishimura M, Kawakita K. Molecular cloning of a defense-response-related cytochrome P450 gene from tobacco. Plant Cell Physiol 1999;40:1232–42. [46] Hardee DJ. Plant protein serine/threonine kinases: classification and functions. Plant Mol Biol 1999;50:97–131. [47] Finnie C, Borch J, Collinge DB. 14-3-3 proteins: eukaryotic regulatory proteins with many functions. Plant Mol Biol 1999;40:545–54. [48] Heese A, Ludwig AA, Jones JDG. Rapid phosphorylation of a syntaxin during the Avr9/Cf-9-race-specific signaling pathway. Plant Physiol 2005;138: 2406–16. [49] Alscher RG, Hess JL. Antioxidants in higher plants. Boca Raton FL: CRC Press; 1993. [50] Alscher RG, Erturk N, Heath LS. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J Expt Bot 2002;53:1331–41. [51] McGonigle B, Keeler SJ, Lau S-M, Koeppe MK, O’Keefe DP. A genomics approach to the comprehensive analysis of the glutathione S-transferase gene family in soybean and maize. Plant Physiol 2000;124:1105–20. [52] Kilili KG, Atanassovam N, Vardanyan A, Clatot N, Al-Sabarna K, Kanellopoulos PN, Makris AM, Kampranis SC. Differential roles of tau class glutathione S-transferases in oxidative stress. J Biol Chem 2004;279: 24540–51. [53] Torres MA, Jones JDG, Dangl JL. Reactive oxygen species signaling in response to pathogens. Plant Physiol 2006;141:373–8. [54] Eltayeb AE, Kawano N, Badawi GH, Hironori Kaminaka H, Sanekata T, Shibahara S, et al. Overexpression of monodehydroascorbate reductase in transgenic tobacco confers enhanced tolerance to ozone, salt, and polyethylene glycol stresses. Planta 2006;225:1255–64. [55] Gang DR, Kasahara H, Xia ZQ, Vander Mijnsbrugge K, Bauw G, Boerjan W, et al. Evolution of plant defense mechanisms relationships of phenylcoumaran benzylic ether reductases to pinoresinol-lariciresinol and isoflavone reductases. J Biol Chem 1999;274:7516–27. [56] Mijnsbrugge KV, Beeckman H, De Rycke R, d Van Montagu M, Engler G, Boerjan W. Phenylcoumaran benzylic ether reductase, a prominent poplar xylem protein, is strongly associated with phenylpropanoid biosynthesis in lignifying cells. Planta 2000;211:502–9. [57] Kawaoka A, Kaothien P, Yoshida K, Endo S, Yamada K, Ebinuma H. Functional analysis of tobacco LIM protein Ntlim1 involved in lignin biosynthesis. Plant J 2000;22:289–301. [58] Lavid N, Wang J, Shalit M, Guterman I, Bar E, Beuerle T, et al. Orcinol-methyltransferases involved in the biosynthesis of volatile phenolic derivatives in rose petals. Plant Physiol 2002;129:1899–907. [59] Dudareva N, Pichersky E, Gershenzon J. Biochemistry of plant volatiles. Plant Physiol 2004;135:1893–902. [60] Sasaki Y, Asamizu E, Shibata D, Nakamura Y, Kaneko T, Awai K, et al. Monitoring of methyl jasmonate-responsive genes in Arabidopsis by cDNA macroarray: self-activation of jasmonic acid biosynthesis and crosstalk with other phytohormone signaling pathways. DNA Res 2001;8:153–61. [61] Kirsch C, Hahlbrock K, Somssich IE. Rapid and transient induction of a parsley microsomal delta12 fatty acid desaturase mRNA by fungal elicitor. Plant Physiol 1997;115:283–9. [62] Gomi K, Yamamato H, Akimitsu K. Epoxide hydrolase: a mRNA induced by the fungal pathogen Alternaria alternata on rough lemon (Citrus jambhiri Lush). Plant Mol Biol 2003;53:189–99. [63] Lapointe G, Luckevich MD, Cloutier M, Seguin A. 14-3-3 gene family in hybrid poplar and its involvement in tree defense against pathogens. J Exp Bot 2001; 52:1331–8. [64] Guilleroux M, Osbourn A. Gene expression during infection of wheat roots by the ‘take-all’ fungus Gaeumannomyces graminis. Mol Plant Pathol 2004;5: 203–16. [65] Coram TE, Pang ECK. Isolation and analysis of candidate ascochyta blight defense genes in chickpea. Part I. Generation and analysis of an expressed sequence tag (EST) library. Physiol Mol Plant Pathol 2005;66: 192–200. [66] Coram TE, Pang ECK. Isolation and analysis of candidate ascochyta blight defence genes in chickpea. Part II. Microarray expression analysis of putative defence-related ESTs. Physiol Mol Plant Pathol 2005;66:201–10. [67] Morse AM, Nelson CD, Covert SF, Holliday AG, Smith KE, Davis JM. Pine genes regulated by the necrotrophic pathogen Fusarium circinatum. Theor Appl Genet 2004;109:922–32.