- Email: [email protected]
Molecular and functional evolution of Tetrahymena metallothioneins: New insights into the gene family of Tetrahymena thermophila
Comparative Biochemistry and Physiology, Part C 144 (2007) 391 – 397 www.elsevier.com/locate/cbpc
Molecular and functional evolution of Tetrahymena metallothioneins: New insights into the gene family of Tetrahymena thermophila Gianfranco Santovito ⁎, Alessia Formigari, Francesco Boldrin, Ester Piccinni Department of Biology, University of Padova, Via U. Bassi 58/B, 35131 Padova, Italy Received 24 June 2006; received in revised form 23 November 2006; accepted 23 November 2006 Available online 29 November 2006
Abstract A new metallothionein (MTT-5) gene isoform has been cloned and characterized from the ciliate Tetrahymena thermophila. Its amino acid sequence shows only limited similarity with other Tetrahymena MTs. To investigate the transcriptional activity of this gene toward heavy metals (Cd, Cu, Zn), mRNA levels were evaluated by real-time quantitative PCR. Results show that the three metals induce different MTT-5-mRNA levels, Cd treatment eliciting the most effective induction in the first 30 min. Phylogenetic analyses of all Tetrahymena MT protein sequences revealed that MTT-5 is closely related to Cd-induced isoforms and quite separate from Cu-induced ones. Our results indicate that Cd and Cu MTs diverged early in evolution, before the speciation event which separated the Tetrahymena borealis group from the Tetrahymena australis group. The mutation rate in the Tetrahymena MT group is heterogeneous, being very low for MT-1 and MTT-1 and higher for the other isoforms, particularly for MTT-5, which shows the maximum divergence among the Cd-induced MTs. This observation, together with the evidence of its inducibility by Zn – a unique condition among T. thermophila MTs – indicates that MTT-5 underwent a particular evolutionary history, independent of other MT isoforms. © 2006 Elsevier Inc. All rights reserved. Keywords: cDNA; Gene expression; Metallothioneins; Molecular evolution; Tetrahymena thermophila
1. Introduction Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich metallo-proteins, which act as biological chelators of heavy metals. Biosynthesis of MTs is regulated primarily at the transcription level by many different stimuli, the most effective being heavy metals (Miles et al., 2000). MTs are known to occur in many animal phyla, plants, eukaryotic microorganisms and cyanobacteria (Kojima et al., 1999). Multiple isoforms which may be expressed at different levels in response to varying stimuli are usually also present in one organism, clearly suggesting that these proteins have different functions (Miles et al., 2000). Until now, among protozoa, MTs have only been described in the genus Tetrahymena. In Tetrahymena pyriformis, two Cd-induced MT isoforms, MT-1 and TpMT-2 (Piccinni et al., 1994, 1999; Fu and Miao, ⁎ Corresponding author. Tel.: +39 049 8276310; fax: +39 049 8276300. E-mail address: [email protected] (G. Santovito). 1532-0456/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2006.11.010
2006) and the Cu-induced MT-2 (GenBank accession no. DQ518910) have been identified, whereas in Tetrahymena pigmentosa only MT-1 and MT-2 have been described, induced by Cd and Cu respectively (Santovito et al., 2001; Boldrin et al., 2003). In Tetrahymena thermophila, four isoforms have been described so far: MTT-1 (Shang et al., 2002) and MTT-3 (GenBank accession no. AY740525) that are mainly induced by Cd, MTT-2 (Boldrin et al., 2003) and MTT-4 (GenBank accession no. AY660008), mainly induced by Cu. This paper presents the characterization and expression of a novel MT gene in T. thermophila, provisionally called MTT-5. Evolutionary relationships with other Tetrahymena MTs are also proposed. 2. Materials and methods 2.1. Blast search Genome Sequencing Project database at TIGR web site http://tigrblast.tigr.org/er-blast/index.cgi?project=ttg.
392
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
Table 1 PCR primers
2.4. RNA isolation, cDNA synthesis and RT-PCR
Name
Sequence (5′–3′)
Oligo-dT adaptor primer Anchor primer MTT-5-FW MTT-5-RE MTT-5 5′-RACE MTT-5 3′-RACE 17S r-RNA-RE 17S r-RNA
GTTTTCCCAGTCACGACT18 GTTTTCCCAGTCACGAC CCCTAGTGAGACCCAAAATTGC CTACCTCCAGGGCAGCATTC CTCCAGGGCAGCATTCTTTA TGCTGCAAGTGTTTGTAAGGT CCTGAGAAACGGCTACTACAACTAC AAATGTTTACTCCCTAAGTCGAACC
2.2. Strains and culture conditions T. thermophila wild-type strain CU428.1 was grown routinely in SPP medium (1% proteose peptone, 0.2% glucose, 0.1% yeast extract, 0.003% EDTA ferric sodium salt) (Gorovsky et al., 1975) axenically with shaking at 30 °C. All Tetrahymena cultures were maintained in 1 × PSF (penicillin 100 U/mL, streptomycin 100 μg/mL and fungizone 0.25 μg/ mL) to prevent bacterial and fungal growth. Treated cells were grown in the same medium supplemented with Cd, Cu or Zn at appropriate concentrations for various times. 2.3. Quantification of Cd, Cu and Zn in cell-free extracts Cells were harvested by centrifugation at 2000 ×g for 15 min at the indicated times, then homogenized as previously described (Piccinni et al., 1990). Homogenates were centrifuged at 48,000 ×g for 50 min at 4 °C, and the resulting supernatants were used for metal quantification. Analyses of metal contents were performed by atomic absorption spectrophotometer (Perkin-Elmer mod. 4000). Data refer to total protein concentrations, assayed by the Folin phenol reagent method (Lowry et al., 1951). All results are reported as means ± standard deviations (SD).
Total RNA was isolated from mid-log cells (3–5 × 106 cells/ mL) by TRIzol reagent (Invitrogen) and its purity was determined by the A260/280 ratio. RNA integrity was determined by visualization of rRNAs in ethidium bromide-stained gels. The first strand of cDNA was reverse-transcribed at 42 °C for 1 h from 1 μg of total RNA in a 20-μL reaction mixture containing 1 μL of ImProm II Reverse Transcriptase (Promega) and 0.5 μg oligodT Anchor primer. The coding region of MTT-5 gene from T. thermophila was amplified with primers MTT-5FW and MTT-5-RE (Table 1) designed on the basis of the coding sequence obtained with a BLAST search in the Tetrahymena genome database (http://tigrblast.tigr.org/er-blast/ index.cgi?project=ttg). PCR reactions were performed with 50 ng of cDNA. The PCR program was the following: 94 °C for 2 min and 25 × (94 °C for 30 s, 57 °C for 30 s, 72 °C for 1 min). 2.5. 5′RACE Amplification of the 5′ cDNA end of T. thermophila MTT-5 was performed with the 5′RACE System for Rapid Amplification of cDNA Ends Version 2.0 (Invitrogen), following the manufacturer's instructions. From 2 μg of total RNA the MTT5-RE primer (Table 1) was used to generate the first strand of cDNA, which was subsequently oligo-dC-tailed. The 5′ end of the MTT-5 cDNA was amplified from the oligo-dC-tailed single-strand cDNA using the primer MTT-5-5RACE (Table 1) and an Abridged Anchor primer, following the manufacturer's procedure. The amplified products were cloned and sequenced. 2.6. 3′RACE For 3′ end analysis (3′RACE) of T. thermophila MTT-5mRNA, cDNA was primed with the oligodT Anchor and MTT5-3RACE primers (Table 1). The PCR reaction was performed as follows: 94 °C for 2 min, 11 × (94 °C for 30 s, 51 °C for 30 s,
Fig. 1. Full-length cDNA sequence of T. thermophila MTT-5 and deduced amino acid sequence, the deduced latter in bold type below coding region. 5′- and 3′-UTR regions are underlined. Polyadenylation and putative mRNA destabilization signals: plus signs (+++) and asterisks (⁎⁎⁎).
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
Fig. 2. Kinetics of metal accumulation in T. thermophila exposed to 44 μM Cd (○), 630 μM Cu (♦) and 229 μM Zn (□). Cells harvested at 30 min, 1, 2, 4 h.
72 °C for 90 s) and then 25 × (94 °C for 30 s, 44 °C for 30 s, 72 °C for 90 s). 2.7. DNA sequence analysis All the PCR amplified products were gel-purified in NucleoSpin Extract 2 in 1 (Macherey-Nagel), ligated into the pGEM®-T Easy Vector (Promega) and cloned in XL1-Blue E. coli cells (Tang et al., 1994). Positively screened clones were sequenced at the CRIBI Biotechnology Center (University of Padova) on an ABI PRISM 3700 DNA Analyzer (Applied Biosystems). 2.8. Quantitative real-time PCR analysis Quantitative real-time PCR analysis was performed in a final volume of 20 μL, with 1 to 10 ng of cDNA, 1× SYBR Green PCR Master mix (Finnzymes), 0.5 μM for each MTT-5 primer (MTT-5 sense, MTT-5 antisense) (Table 1) or 0.5 μM for each ribosomal 17S primer (17S r-RNA sense, 17S r-RNA antisense) (Table 1). Thermal parameters in a 7500 real-time PCR system cycler (Applied Biosystems) were as follows: 15 min at 95 °C, followed by 40 cycles: 95 °C for 30 s, 60 °C for 30 s and 72 °C for 35 s. A melting curve of PCR products (60–90 °C) was also performed to ensure the absence of artifacts. The relative expression level of the MTT-5 gene was normalized against the ciliate 17S ribosomal RNA gene. Data were analyzed by the method of Pfaffl (2001), in which the
393
Fig. 4. Time course of MTT-5-mRNA accumulation, determined by real-time PCR analysis, in T. thermophila exposed to 44 μM Cd (○), 630 μM Cu (♦) and 229 μM Zn (□). Values, expressed as arbitrary units (a.u.), are normalized against those of T. thermophila 17S-rRNA. Cells harvested at 30 min, 1, 2, 4 h.
mathematical model used is based on mean threshold cycle differences between treated sample and control group. For each analyzed target, the median PCR efficiency value obtained from at least three different experiments was used. 2.9. Sequence alignment and phylogenetic reconstruction The following sequences from Tetrahymena MTs were used: T. pyriformis MT-1 (Piccinni et al., 1994, 1999), TpMT-2 (Fu and Miao, 2006) and MT-2 (GenBank accession no. DQ518910); T. pigmentosa MT-1 (Boldrin et al., 2003) and MT-2 (Santovito et al., 2001); T. thermophila MTT-1 (Shang et al., 2002), MTT-2 (Boldrin et al., 2003), MTT-3 (GenBank accession no. AY740525), MTT-4 (GenBank accession no. AY660008) and MTT-5. Full-length protein sequences were aligned by the Clustal W program (Thompson et al., 1994). The alignments were later improved manually. DNA alignments were finally analyzed with the MEGA 2.1 program (Kumar et al., 2001) to infer evolutionary relationships existing between full proteins/ portions of MTs. Trees were constructed with the methods of UPGMA (Sneath and Sokal, 1973), neighbor-joining (Saitou and Nei, 1987), minimum evolution (Rzhetsky and Nei, 1992) and maximum parsimony (Fitch, 1971). In preliminary analyses, several models of molecular evolution were used to calculate phylogenetic distances, but no significant differences were observed in tree topologies. The distances used to build the final trees are shown in the figures. The robustness of tree topologies was tested by the non-parametric bootstrap test Table 2 Amino acid comparison of T. thermophila MTT-5 with other Tetrahymena MTs
Fig. 3. MTT-5-mRNA accumulation determined by RT-PCR analysis in T. thermophila exposed to Cd, Zn and Cu for 1 h. Values, expressed as arbitrary units (a.u.), are normalized against those of T. thermophila 17S-rRNA.
Species
MT isoform
Identity (%)
Similarity (%)
Global score
T. pyriformis T. pigmentosa T. thermophila T. thermophila T. thermophila T. thermophila T. pigmentosa T. pyriformis T. pyriformis
MT-1 MT-1 MTT-1 MTT-3 MTT-2 MTT-4 MT-2 MT-2 TpMT-2
46.7 46.7 37.0 32.1 28.2 28.2 24.3 24.3 29.3
65.4 65.4 47.5 44.4 46.3 46.3 42.4 42.4 39.2
366 366 224 122 103 103 64 64 34
394
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
Table 3 Pairwise amino acid divergence between MT sequences for all substitutions (lower triangle) and standard errors (upper triangle), according to Poisson's correction Species and isoforms 1 2 3 4 5 6 7 8 9 10
T. T. T. T. T. T. T. T. T. T.
pyriformis MT-1 pigmentosa MT-1 pigmentosa MT-2 pyriformis MT-2 pyriformis Tp-MT-2 thermophila MTT-1 thermophila MTT-2 thermophila MTT-3 thermophila MTT-4 thermophila MTT-5
1 0.00 1.32 1.32 0.44 0.18 1.37 0.38 1.37 0.68
2
3
4
5
6
7
8
9
10
0.00
0.18 0.18
0.18 0.18 0.00
0.07 0.07 0.19 0.19
0.04 0.04 0.19 0.19 0.07
0.17 0.17 0.07 0.07 0.18 0.18
0.06 0.06 0.21 0.21 0.08 0.05 0.21
0.17 0.17 0.07 0.07 0.18 0.18 0.00 0.21
0.10 0.10 0.22 0.22 0.11 0.10 0.18 0.11 0.18
1.32 1.32 0.44 0.18 1.37 0.38 1.37 0.68
0.00 1.47 1.38 0.36 1.57 0.36 1.55
(Felsenstein, 1985). Five thousand replicates were performed in all analyses. 3. Results 3.1. Identification of T. thermophila MTT-5 and cDNA sequence In the T. thermophila genome (sequence no 1173228), we found a portion potentially codifying for a protein similar to MTT-1. To test if this nucleotide sequence could be transcribed
1.47 1.38 0.36 1.57 0.36 1.55
0.60 1.55 0.72 1.55 0.83
1.50 0.29 1.50 0.70
1.69 0.00 1.46
1.69 0.83
1.46
as mRNA, RT-PCR analysis was performed on mRNA from cells treated with 44 μM Cd for 1 h. The PCR amplification product resulted in a sequence of about 250 bp. This fragment was sequenced and found to contain 228 bp, corresponding to the expected coding sequence. The MTT-5 full-length cDNA sequence (GenBank accession no. AY884209), obtained by 3′- and 5′-RACE, is 597 bp long and contains a 300-bp coding region with a 57-bp 5′ UTR region and a 240-bp 3′ UTR region (Fig. 1). The coding region contains 100 codons, terminating with the typical Tetrahymena TGA translational termination codon. The 3′UTR region contains two
Fig. 5. Amino acid alignments of (A) Cd-induced and (B) Cu-induced Tetrahymena MTs, produced by Clustal W. Amino acid residues: (⁎) identical; (.) very similar; (:) similar.
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
putative polyadenylation signals: ATTAAA at nt 485–490 and nt 573–578. This region also contains two ATTTA sequences, at nt 445–449 and nt 475–479, probably cis-acting elements for AUrich binding proteins, which promote mammalian mRNA decay in response to a variety of specific intra- and extra-cellular signals (Mignone and Pesole, 2002). The coding region encodes a protein of 99 amino acid residues, with a calculated molecular weight of 10,597 Da. The deduced MTT-5 sequence contains 24 cysteine residues (24% of total amino acids) arranged in the MT typical motifs. Besides the CysX-Cys and Cys-Cys motifs characteristic of vertebrate MTs, it also exhibits a Cys-Cys-Cys context, which is typical of Tetrahymena Cd-induced MTs (Piccinni et al., 1999; Boldrin et al., 2003). 3.2. Metal accumulation and MTT-5-mRNA expression Basic Cu and Zn concentrations are very low, 0.05 μg/mg of total proteins (Fig. 2). As expected, accumulation was low for
395
all metals during the course of the experiment, i.e. 4 h. However, a high rate of uptake was observed in all treatments during the first 30 min of metal exposure. The slope of the curves was similar for Cd and Cu (m = 0.86 and 0.80, respectively) and lower for Zn (m = 0.54). In the following 2 h, the rate of accumulation decreased for all metals, the slope being 0.06 for Zn, 0.12 for Cu, and 0.22 for Cd. This rate was maintained up to the end of the experiment for Cu and Zn, but Cd accumulation reached a plateau phase after 2 h of exposure. To test metal inducibility, we exposed T. thermophila to Cd, Cu and Zn for 1 h. MTT-5 gene expression was investigated using the semi-quantitative RT-PCR method (Fig. 3). The three metals induced differing MTT-5-mRNA levels. Cd treatment especially elicited the most effective induction, the mRNA level being about 58 times higher than in control cells. Cu and Zn induced mRNA levels of 41 and 24 times higher respectively. Because all tested metals produced good MTT-5 gene induction, time course analyses of MTT-5-mRNA levels were
Fig. 6. Phylogenetic relationships between Tetrahymena MTs. UPGMA (A), neighbor-joining (B), minimum evolution (C) and maximum parsimony (D) unrooted trees obtained with MEGA 3.1. Evolutionary distance was calculated by Poisson's method. Numbers close to nodes: bootstrap values (expressed in percentages) after 5000 replicates.
396
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
performed by real time quantitative PCR. The results, normalized against 17S-rRNA, are shown in Fig. 4, which indicates that the maximum level, about 600-fold, occurred within 30 min of Cd exposure. This maximum induction was then followed by a down-regulation to 200-fold over the next 90 min. A further increase, up to 300-fold, occurred over the following 2 h. Cu exposure induced MTT-5-mRNA transcription less quickly than Cd, but the increment was nearly constant up to 4 h, when the level was about 500-fold higher than in control cells. Expression induced by Zn exposure was low for all times considered. 3.3. Phylogenetic relationships The amino acid sequence of T. thermophila MTT-5 shows only limited similarity with other Tetrahymena MTs, identity values varying from 24.3 to 46.7% (Table 2). The highest identity seen in with Cd-induced MTs, particularly in T. pyriformis MT-1 (46.7% identity). Amino acid divergence obtained by Poisson's correction (Table 3) and the gamma model (unpublished results) based on amino acid sequence multiple alignment (Fig. 5), produced very similar distance patterns. Poisson's distances were used to reconstruct phylogenetic relationships among the MT isoforms so far isolated from the three species of Tetrahymena. T. pyriformis, T. pigmentosa and T. thermophila. The UPGMA, neighbor-joining (NJ), minimum evolution (ME) and maximum parsimony (MP) methods were applied and results are shown in Fig. 6. Cd-induced MT isoforms (MT-1, MTT-2, MTT-3, MTT5) are very closely related and clearly separate from Cu-induced MTs. The node values, indicating the relationships between these two groups, are supported by a high bootstrap value (99% Fig. 6D, 100% Fig. 6A–C). 4. Discussion We report the cloning and expression analyses of a new MT gene, provisionally called MTT-5. Comparative analysis of the coding region of the full-length cDNA and gene sequence confirms that the MTT-5 gene too is intronless, like other Tetrahymena MTs (Piccinni et al., 1999; Santovito et al., 2001; Shang et al., 2002; Boldrin et al., 2003) and many other genes isolated from the Tetrahymena complex (Prescott, 1994; Schmidt, 1997). The features of Tetrahymena MTs may indicate genetic adaptation, allowing prompt gene transcription in response to a rapid metal level increase in the cell, as hypothesized for some intronless MT genes in mussel (Leignel et al., 2005). Cd, Cu and Zn, at maximum tolerable concentrations, were able to stimulate MTT-5-mRNA synthesis. Nevertheless, the induction patterns differed according to inducer. Cd induced quick gene transcription in the first 30 minutes, followed by down-regulation, whereas the effect of Cu was delayed by about 4 h (Fig. 4). Zn elicited only very poor induction during the time considered. Initial transient activation by metals also occurs in other unicellular organisms (Münger et al., 1987; Peña et al.,
1998) and is similar to results reported for other Tetrahymena MTs such as T. pyriformis and T. pigmentosa MT-1 and MT-2 (Santovito et al., 2000, 2001) and T. thermophila MTT-2 (Boldrin et al., 2006). The mechanism by which MT expression is reduced, even in the continued presence of Cd ions, may reflect fluctuation in the availability of metal ions. This has been suggested for T. pyriformis and T. pigmentosa MT-1 (Santovito et al., 2000), and it was recently demonstrated in Drosophila that metallothioneins can inhibit their own expression by inhibiting their transcription factors via binding of the free metal, thus generating negative feedback (Egli et al., 2006). The expression of MTT-5 activated by Cu appeared to be time-dependent, gradually increasing with Cu accumulation. This pattern is quite different from that observed for the Cuinducible MTT-2 gene, in which quick expression takes place in the first 30 min of treatment and is then followed by downregulation (Boldrin et al., 2006). We suggest that MTT-5 plays a role in Cu homeostasis, whereas MTT-2 is involved in Cu detoxification, and represents a rapid, robust cell defense against toxic Cu levels. Thus, we propose MTT-5 as a “doubleacting” protein, playing a dynamic role regulating Cu ion homeostasis appropriately, and also contributing toward protecting the cell against Cd. Among transition metals, Zn, generally one of the most common and best inducers of metallothionein transcription in mammals (Kägi, 1993), elicited only very poor induction of MTT-5-mRNA. However, this finding is of some interest, in that no other Tetrahymena MTs were found to be induced by this metal (Boldrin et al., 2002; Dondero et al., 2004) and Zn appears to be more toxic than Cd for this ciliate (unpublished data). It is well-known that several metallothionein isoforms are generally present in pluricellular organisms, and that the highest genetic polymorphism is found in mammals. The functional significance of these multiple isoforms must be clearly defined, as their functions may partially overlap. The fact that differing isoforms can be induced differentially as well as preferentially by varying metals, and that specific isoforms perform specific functions in those tissues in which they are expressed (Kramer et al., 1996; Syring et al., 2000; Miles et al., 2000) suggests that iso-metallothioneins have multiple biological functions. The presence of a number of functional isoforms even in unicellular organisms raises the question of whether they play different biological roles or if they simply reflect a duplication of function. In particular, the high genetic polymorphism in T. thermophila, because of the presence of five different metallothioneins (MTT-1, MTT-2, MTT-3, MTT-4, MTT-5, the latter described here), indicates a more complex situation than in other species of the Tetrahymena complex, in which interactions between various metallothioneins, acting differently according to stimulus, must be considered. The identification of a new MT in Tetrahymena allows more thorough phylogenetic study of the MT gene family in this protozoan. The data of Fig. 6 confirm that Cd- and Cu-MTs fall in separate phylogenetic clades, suggesting that one major duplication and diversification event gave rise to these protein subfamilies (Boldrin et al., 2003).
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
As clearly shown in all T. thermophila trees, MTT-5 emerges as the earliest branch of this cluster and is always represented as a sister group of the other Cd-induced MTs. The bootstrap values are significant (81–97%), with the only exception of the MP tree, in which the value is 64% (Fig. 6D). The other two T. thermophila Cd-MTs (MTT-1, MTT-3) emerge together, and later. In this case too the bootstrap values are significant. The Cd-MT cluster is resolved in the UPGMA, NJ and ME trees (Fig. 6A–C), favoring an orthologous relationship between MT-1 proteins and a paralogous relationship between MTT-1 and MTT-3 of T. thermophila. The Cu-MT cluster is also always resolved, favoring an orthologous relationship between MTT-2, MTT-4 and MT-2 proteins and a paralogous relationship between MTT-2 and MTT-4. These observations, together with the evidence of the inducibility by Zn, which is a unique condition among T. thermophila MTs, may indicate that MTT-5 underwent a particular evolutionary history, independent of other MT isoforms. Acknowledgment This research was partly supported by the Italian Ministero Istruzione Università Ricerca (MIUR). References Boldrin, F., Santovito, G., Irato, P., Piccinni, E., 2002. Metal interaction and regulation of Tetrahymena pigmentosa metallothionein genes. Protist 153, 283–291. Boldrin, F., Santovito, G., Negrisolo, E., Piccinni, E., 2003. Cloning and sequencing of four new metallothionein genes from Tetrahymena thermophila and Tetrahymena pigmentosa: evolutionary relationships in Tetrahymena MT family. Protist 154, 431–442. Boldrin, F., Santovito, G., Gaertig, J., Wloga, D., Cassidy-Hanley, D., Clark, T.G., Piccinni, E., 2006. Metallothionein gene from Tetrahymena thermophila with a copper-inducible–repressible promoter. Eukaryot. Cell 5, 422–425. Dondero, F., Cavaletto, M., Grezzi, A.R., La Terza, A., Banni, M., Viarengo, A., 2004. Biochemical characterization and quantitative gene expression analysis of the multi-stress inducible metallothionein from Tetrahymena thermophila. Protist 155, 157–168. Egli, D., Yepiskoposyan, H., Selvaraj, A., Balamurugan, K., Rajaram, R., Simons, A., Multhaup, G., Mettler, S., Vardanyan, A., Georgiev, O., Schaffner, W., 2006. A family knockout of all four Drosophila metallothioneins reveals a central role in copper homeostasis and detoxification. Mol. Cell. Biol. 26, 2286–2296. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fitch, W.M., 1971. Towards defining the course of evolution: minimum change for a specific tree topology. Syst. Zool. 20, 406–416. Fu, C., Miao, W., 2006. Cloning and characterization of a new multi-stress inducible metallothionein gene in Tetrahymena pyriformis. Protist 157, 193–203. Gorovsky, M.A., Yao, M.C., Keevert, J.B., Pleger, G.L., 1975. Isolation of micro and macronuclei of Tetrahymena pyriformis. Methods Cell Biol. 9, 311–327. Kägi, J.H.R., 1993. Evolution, structure and chemical activity of class I metallothioneins: an overview. In: Suzuki, K.T., Imura, N., Kimura, M. (Eds.), Metallothionein III. Birkhäuser Verlag, Basel, pp. 29–55. Kojima, Y., Binz, P.A., Kägi, J.H.R., 1999. Nomenclature of metallothionein: proposal for a revision. In: Klaassen, C.D. (Ed.), Metallothionein IV. Birkhäuser Verlag, Basel, pp. 3–6.
397
Kramer, K.K., Liu, J., Choudhuri, S., Klaassen, C.D., 1996. Induction of metallothionein mRNA and protein in murine astrocyte cultures. Toxicol. Appl. Pharmacol. 136, 94–100. Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17, 1244–1245. Leignel, V., Hardivillier, Y., Laulier, M., 2005. Small metallothionein MT-10 genes in coastal and hydrothermal mussels. Mar. Biotechnol. 7, 236–244. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Mignone, F., Pesole, 2002. rRNA-like sequences in human mRNAs. Appl. Bioinformatics 1, 145–154. Miles, A.T., Hawksworth, G.M., Beattie, J.H., Rodilla, V., 2000. Induction, regulation, degradation, and biological significance of mammalian metallothioneins. Crit. Rev. Biochem. Mol. Biol. 35, 35–70. Münger, K., German, U.A., Lerch, K., 1987. The Neurospora crassa metallothionein gene. Regulation of expression and chromosomal location. J. Biol. Chem. 25, 7363–7367. Peña, M.M., Koch, K.A., Thiele, D.J., 1998. Dynamic regulation of copper uptake and detoxification genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 2514–2523. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Piccinni, E., Irato, P., Guidolin, L., 1990. Cadmium-thionein in Tetrahymena thermophila and Tetrahymena pyriformis. Eur. J. Protistol. 26, 176–181. Piccinni, E., Staudenmann, W., Albergoni, V., De Gabriel, I.R., James, P., 1994. Purification and primary structure of metallothioneins induced by cadmium in the protists Tetrahymena pigmentosa and Tetrahymena pyriformis. Eur. J. Biochem. 226, 853–859. Piccinni, E., Bertaggia, D., Santovito, G., Miceli, C., Kraev, A., 1999. Cadmium metallothionein gene of Tetrahymena pyriformis. Gene 234, 51–59. Prescott, D.M., 1994. The DNA of ciliated protozoa. Microbiol. Rev. 58, 233–267. Rzhetsky, A., Nei, M., 1992. A simple method for estimating and testing minimum-evolution trees. Mol. Biol. Evol. 9, 945–967. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Santovito, G., Irato, P., Piccinni, E., 2000. Regulation of metallothionein in Tetrahymena: induction of MT mRNA and protein by cadmium exposure. Eur. J. Protistol. 36, 437–442. Santovito, G., Irato, P., Palermo, S., Boldrin, F., Sack, R., Hunziker, P., Piccinni, E., 2001. Identification, cloning and characterisation of a novel coppermetallothionein in Tetrahymena pigmentosa. Sequencing of cDNA and expression. Protist 152, 219–229. Schmidt, H.J., 1997. Molecular biology of ciliates. In: Hausmann, K., Bradbury, P.C. (Eds.), Cialiates: Cells as Organisms. Gustav Fischer, pp. 325–353. Shang, Y., Song, X., Bowen, J., Corstanje, R., Gao, Y., Gaertig, J., Gorovsky, M.A., 2002. A robust inducible–repressible promoter greatly facilitates gene knockouts, conditional expression, and overexpression of homologous and heterologous genes in Tetrahymena thermophila. Proc. Natl. Acad. Sci. U. S. A. 99, 3734–3739. Sneath, P.H.A., Sokal, R.R., 1973. Numerical Taxonomy. Freeman, San Francisco. Syring, R.A., Brouwer, T.H., Brouwer, M., 2000. Cloning and sequencing of cDNAs encoding for a novel copper-specific metallothionein and two cadmium-inducible metallothioneins from the blue crab Callinectes sapidus. Comp. Biochem. Physiol. C, Comp. Pharmacol. Toxicol. 125, 325–332. Tang, X., Nakata, Y., Li, H.O., Zhang, M., Gao, H., Fujita, A., Sakatsume, O., Ohta, T., Yokoyama, K., 1994. The optimization of preparations of competent cells for transformation of E. coli. Nucleic Acids Res. 22, 2857–2858. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
Molecular and functional evolution of Tetrahymena metallothioneins: New insights into the gene family of Tetrahymena thermophila Gianfranco Santovito ⁎, Alessia Formigari, Francesco Boldrin, Ester Piccinni Department of Biology, University of Padova, Via U. Bassi 58/B, 35131 Padova, Italy Received 24 June 2006; received in revised form 23 November 2006; accepted 23 November 2006 Available online 29 November 2006
Abstract A new metallothionein (MTT-5) gene isoform has been cloned and characterized from the ciliate Tetrahymena thermophila. Its amino acid sequence shows only limited similarity with other Tetrahymena MTs. To investigate the transcriptional activity of this gene toward heavy metals (Cd, Cu, Zn), mRNA levels were evaluated by real-time quantitative PCR. Results show that the three metals induce different MTT-5-mRNA levels, Cd treatment eliciting the most effective induction in the first 30 min. Phylogenetic analyses of all Tetrahymena MT protein sequences revealed that MTT-5 is closely related to Cd-induced isoforms and quite separate from Cu-induced ones. Our results indicate that Cd and Cu MTs diverged early in evolution, before the speciation event which separated the Tetrahymena borealis group from the Tetrahymena australis group. The mutation rate in the Tetrahymena MT group is heterogeneous, being very low for MT-1 and MTT-1 and higher for the other isoforms, particularly for MTT-5, which shows the maximum divergence among the Cd-induced MTs. This observation, together with the evidence of its inducibility by Zn – a unique condition among T. thermophila MTs – indicates that MTT-5 underwent a particular evolutionary history, independent of other MT isoforms. © 2006 Elsevier Inc. All rights reserved. Keywords: cDNA; Gene expression; Metallothioneins; Molecular evolution; Tetrahymena thermophila
1. Introduction Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich metallo-proteins, which act as biological chelators of heavy metals. Biosynthesis of MTs is regulated primarily at the transcription level by many different stimuli, the most effective being heavy metals (Miles et al., 2000). MTs are known to occur in many animal phyla, plants, eukaryotic microorganisms and cyanobacteria (Kojima et al., 1999). Multiple isoforms which may be expressed at different levels in response to varying stimuli are usually also present in one organism, clearly suggesting that these proteins have different functions (Miles et al., 2000). Until now, among protozoa, MTs have only been described in the genus Tetrahymena. In Tetrahymena pyriformis, two Cd-induced MT isoforms, MT-1 and TpMT-2 (Piccinni et al., 1994, 1999; Fu and Miao, ⁎ Corresponding author. Tel.: +39 049 8276310; fax: +39 049 8276300. E-mail address: [email protected] (G. Santovito). 1532-0456/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2006.11.010
2006) and the Cu-induced MT-2 (GenBank accession no. DQ518910) have been identified, whereas in Tetrahymena pigmentosa only MT-1 and MT-2 have been described, induced by Cd and Cu respectively (Santovito et al., 2001; Boldrin et al., 2003). In Tetrahymena thermophila, four isoforms have been described so far: MTT-1 (Shang et al., 2002) and MTT-3 (GenBank accession no. AY740525) that are mainly induced by Cd, MTT-2 (Boldrin et al., 2003) and MTT-4 (GenBank accession no. AY660008), mainly induced by Cu. This paper presents the characterization and expression of a novel MT gene in T. thermophila, provisionally called MTT-5. Evolutionary relationships with other Tetrahymena MTs are also proposed. 2. Materials and methods 2.1. Blast search Genome Sequencing Project database at TIGR web site http://tigrblast.tigr.org/er-blast/index.cgi?project=ttg.
392
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
Table 1 PCR primers
2.4. RNA isolation, cDNA synthesis and RT-PCR
Name
Sequence (5′–3′)
Oligo-dT adaptor primer Anchor primer MTT-5-FW MTT-5-RE MTT-5 5′-RACE MTT-5 3′-RACE 17S r-RNA-RE 17S r-RNA
GTTTTCCCAGTCACGACT18 GTTTTCCCAGTCACGAC CCCTAGTGAGACCCAAAATTGC CTACCTCCAGGGCAGCATTC CTCCAGGGCAGCATTCTTTA TGCTGCAAGTGTTTGTAAGGT CCTGAGAAACGGCTACTACAACTAC AAATGTTTACTCCCTAAGTCGAACC
2.2. Strains and culture conditions T. thermophila wild-type strain CU428.1 was grown routinely in SPP medium (1% proteose peptone, 0.2% glucose, 0.1% yeast extract, 0.003% EDTA ferric sodium salt) (Gorovsky et al., 1975) axenically with shaking at 30 °C. All Tetrahymena cultures were maintained in 1 × PSF (penicillin 100 U/mL, streptomycin 100 μg/mL and fungizone 0.25 μg/ mL) to prevent bacterial and fungal growth. Treated cells were grown in the same medium supplemented with Cd, Cu or Zn at appropriate concentrations for various times. 2.3. Quantification of Cd, Cu and Zn in cell-free extracts Cells were harvested by centrifugation at 2000 ×g for 15 min at the indicated times, then homogenized as previously described (Piccinni et al., 1990). Homogenates were centrifuged at 48,000 ×g for 50 min at 4 °C, and the resulting supernatants were used for metal quantification. Analyses of metal contents were performed by atomic absorption spectrophotometer (Perkin-Elmer mod. 4000). Data refer to total protein concentrations, assayed by the Folin phenol reagent method (Lowry et al., 1951). All results are reported as means ± standard deviations (SD).
Total RNA was isolated from mid-log cells (3–5 × 106 cells/ mL) by TRIzol reagent (Invitrogen) and its purity was determined by the A260/280 ratio. RNA integrity was determined by visualization of rRNAs in ethidium bromide-stained gels. The first strand of cDNA was reverse-transcribed at 42 °C for 1 h from 1 μg of total RNA in a 20-μL reaction mixture containing 1 μL of ImProm II Reverse Transcriptase (Promega) and 0.5 μg oligodT Anchor primer. The coding region of MTT-5 gene from T. thermophila was amplified with primers MTT-5FW and MTT-5-RE (Table 1) designed on the basis of the coding sequence obtained with a BLAST search in the Tetrahymena genome database (http://tigrblast.tigr.org/er-blast/ index.cgi?project=ttg). PCR reactions were performed with 50 ng of cDNA. The PCR program was the following: 94 °C for 2 min and 25 × (94 °C for 30 s, 57 °C for 30 s, 72 °C for 1 min). 2.5. 5′RACE Amplification of the 5′ cDNA end of T. thermophila MTT-5 was performed with the 5′RACE System for Rapid Amplification of cDNA Ends Version 2.0 (Invitrogen), following the manufacturer's instructions. From 2 μg of total RNA the MTT5-RE primer (Table 1) was used to generate the first strand of cDNA, which was subsequently oligo-dC-tailed. The 5′ end of the MTT-5 cDNA was amplified from the oligo-dC-tailed single-strand cDNA using the primer MTT-5-5RACE (Table 1) and an Abridged Anchor primer, following the manufacturer's procedure. The amplified products were cloned and sequenced. 2.6. 3′RACE For 3′ end analysis (3′RACE) of T. thermophila MTT-5mRNA, cDNA was primed with the oligodT Anchor and MTT5-3RACE primers (Table 1). The PCR reaction was performed as follows: 94 °C for 2 min, 11 × (94 °C for 30 s, 51 °C for 30 s,
Fig. 1. Full-length cDNA sequence of T. thermophila MTT-5 and deduced amino acid sequence, the deduced latter in bold type below coding region. 5′- and 3′-UTR regions are underlined. Polyadenylation and putative mRNA destabilization signals: plus signs (+++) and asterisks (⁎⁎⁎).
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
Fig. 2. Kinetics of metal accumulation in T. thermophila exposed to 44 μM Cd (○), 630 μM Cu (♦) and 229 μM Zn (□). Cells harvested at 30 min, 1, 2, 4 h.
72 °C for 90 s) and then 25 × (94 °C for 30 s, 44 °C for 30 s, 72 °C for 90 s). 2.7. DNA sequence analysis All the PCR amplified products were gel-purified in NucleoSpin Extract 2 in 1 (Macherey-Nagel), ligated into the pGEM®-T Easy Vector (Promega) and cloned in XL1-Blue E. coli cells (Tang et al., 1994). Positively screened clones were sequenced at the CRIBI Biotechnology Center (University of Padova) on an ABI PRISM 3700 DNA Analyzer (Applied Biosystems). 2.8. Quantitative real-time PCR analysis Quantitative real-time PCR analysis was performed in a final volume of 20 μL, with 1 to 10 ng of cDNA, 1× SYBR Green PCR Master mix (Finnzymes), 0.5 μM for each MTT-5 primer (MTT-5 sense, MTT-5 antisense) (Table 1) or 0.5 μM for each ribosomal 17S primer (17S r-RNA sense, 17S r-RNA antisense) (Table 1). Thermal parameters in a 7500 real-time PCR system cycler (Applied Biosystems) were as follows: 15 min at 95 °C, followed by 40 cycles: 95 °C for 30 s, 60 °C for 30 s and 72 °C for 35 s. A melting curve of PCR products (60–90 °C) was also performed to ensure the absence of artifacts. The relative expression level of the MTT-5 gene was normalized against the ciliate 17S ribosomal RNA gene. Data were analyzed by the method of Pfaffl (2001), in which the
393
Fig. 4. Time course of MTT-5-mRNA accumulation, determined by real-time PCR analysis, in T. thermophila exposed to 44 μM Cd (○), 630 μM Cu (♦) and 229 μM Zn (□). Values, expressed as arbitrary units (a.u.), are normalized against those of T. thermophila 17S-rRNA. Cells harvested at 30 min, 1, 2, 4 h.
mathematical model used is based on mean threshold cycle differences between treated sample and control group. For each analyzed target, the median PCR efficiency value obtained from at least three different experiments was used. 2.9. Sequence alignment and phylogenetic reconstruction The following sequences from Tetrahymena MTs were used: T. pyriformis MT-1 (Piccinni et al., 1994, 1999), TpMT-2 (Fu and Miao, 2006) and MT-2 (GenBank accession no. DQ518910); T. pigmentosa MT-1 (Boldrin et al., 2003) and MT-2 (Santovito et al., 2001); T. thermophila MTT-1 (Shang et al., 2002), MTT-2 (Boldrin et al., 2003), MTT-3 (GenBank accession no. AY740525), MTT-4 (GenBank accession no. AY660008) and MTT-5. Full-length protein sequences were aligned by the Clustal W program (Thompson et al., 1994). The alignments were later improved manually. DNA alignments were finally analyzed with the MEGA 2.1 program (Kumar et al., 2001) to infer evolutionary relationships existing between full proteins/ portions of MTs. Trees were constructed with the methods of UPGMA (Sneath and Sokal, 1973), neighbor-joining (Saitou and Nei, 1987), minimum evolution (Rzhetsky and Nei, 1992) and maximum parsimony (Fitch, 1971). In preliminary analyses, several models of molecular evolution were used to calculate phylogenetic distances, but no significant differences were observed in tree topologies. The distances used to build the final trees are shown in the figures. The robustness of tree topologies was tested by the non-parametric bootstrap test Table 2 Amino acid comparison of T. thermophila MTT-5 with other Tetrahymena MTs
Fig. 3. MTT-5-mRNA accumulation determined by RT-PCR analysis in T. thermophila exposed to Cd, Zn and Cu for 1 h. Values, expressed as arbitrary units (a.u.), are normalized against those of T. thermophila 17S-rRNA.
Species
MT isoform
Identity (%)
Similarity (%)
Global score
T. pyriformis T. pigmentosa T. thermophila T. thermophila T. thermophila T. thermophila T. pigmentosa T. pyriformis T. pyriformis
MT-1 MT-1 MTT-1 MTT-3 MTT-2 MTT-4 MT-2 MT-2 TpMT-2
46.7 46.7 37.0 32.1 28.2 28.2 24.3 24.3 29.3
65.4 65.4 47.5 44.4 46.3 46.3 42.4 42.4 39.2
366 366 224 122 103 103 64 64 34
394
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
Table 3 Pairwise amino acid divergence between MT sequences for all substitutions (lower triangle) and standard errors (upper triangle), according to Poisson's correction Species and isoforms 1 2 3 4 5 6 7 8 9 10
T. T. T. T. T. T. T. T. T. T.
pyriformis MT-1 pigmentosa MT-1 pigmentosa MT-2 pyriformis MT-2 pyriformis Tp-MT-2 thermophila MTT-1 thermophila MTT-2 thermophila MTT-3 thermophila MTT-4 thermophila MTT-5
1 0.00 1.32 1.32 0.44 0.18 1.37 0.38 1.37 0.68
2
3
4
5
6
7
8
9
10
0.00
0.18 0.18
0.18 0.18 0.00
0.07 0.07 0.19 0.19
0.04 0.04 0.19 0.19 0.07
0.17 0.17 0.07 0.07 0.18 0.18
0.06 0.06 0.21 0.21 0.08 0.05 0.21
0.17 0.17 0.07 0.07 0.18 0.18 0.00 0.21
0.10 0.10 0.22 0.22 0.11 0.10 0.18 0.11 0.18
1.32 1.32 0.44 0.18 1.37 0.38 1.37 0.68
0.00 1.47 1.38 0.36 1.57 0.36 1.55
(Felsenstein, 1985). Five thousand replicates were performed in all analyses. 3. Results 3.1. Identification of T. thermophila MTT-5 and cDNA sequence In the T. thermophila genome (sequence no 1173228), we found a portion potentially codifying for a protein similar to MTT-1. To test if this nucleotide sequence could be transcribed
1.47 1.38 0.36 1.57 0.36 1.55
0.60 1.55 0.72 1.55 0.83
1.50 0.29 1.50 0.70
1.69 0.00 1.46
1.69 0.83
1.46
as mRNA, RT-PCR analysis was performed on mRNA from cells treated with 44 μM Cd for 1 h. The PCR amplification product resulted in a sequence of about 250 bp. This fragment was sequenced and found to contain 228 bp, corresponding to the expected coding sequence. The MTT-5 full-length cDNA sequence (GenBank accession no. AY884209), obtained by 3′- and 5′-RACE, is 597 bp long and contains a 300-bp coding region with a 57-bp 5′ UTR region and a 240-bp 3′ UTR region (Fig. 1). The coding region contains 100 codons, terminating with the typical Tetrahymena TGA translational termination codon. The 3′UTR region contains two
Fig. 5. Amino acid alignments of (A) Cd-induced and (B) Cu-induced Tetrahymena MTs, produced by Clustal W. Amino acid residues: (⁎) identical; (.) very similar; (:) similar.
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
putative polyadenylation signals: ATTAAA at nt 485–490 and nt 573–578. This region also contains two ATTTA sequences, at nt 445–449 and nt 475–479, probably cis-acting elements for AUrich binding proteins, which promote mammalian mRNA decay in response to a variety of specific intra- and extra-cellular signals (Mignone and Pesole, 2002). The coding region encodes a protein of 99 amino acid residues, with a calculated molecular weight of 10,597 Da. The deduced MTT-5 sequence contains 24 cysteine residues (24% of total amino acids) arranged in the MT typical motifs. Besides the CysX-Cys and Cys-Cys motifs characteristic of vertebrate MTs, it also exhibits a Cys-Cys-Cys context, which is typical of Tetrahymena Cd-induced MTs (Piccinni et al., 1999; Boldrin et al., 2003). 3.2. Metal accumulation and MTT-5-mRNA expression Basic Cu and Zn concentrations are very low, 0.05 μg/mg of total proteins (Fig. 2). As expected, accumulation was low for
395
all metals during the course of the experiment, i.e. 4 h. However, a high rate of uptake was observed in all treatments during the first 30 min of metal exposure. The slope of the curves was similar for Cd and Cu (m = 0.86 and 0.80, respectively) and lower for Zn (m = 0.54). In the following 2 h, the rate of accumulation decreased for all metals, the slope being 0.06 for Zn, 0.12 for Cu, and 0.22 for Cd. This rate was maintained up to the end of the experiment for Cu and Zn, but Cd accumulation reached a plateau phase after 2 h of exposure. To test metal inducibility, we exposed T. thermophila to Cd, Cu and Zn for 1 h. MTT-5 gene expression was investigated using the semi-quantitative RT-PCR method (Fig. 3). The three metals induced differing MTT-5-mRNA levels. Cd treatment especially elicited the most effective induction, the mRNA level being about 58 times higher than in control cells. Cu and Zn induced mRNA levels of 41 and 24 times higher respectively. Because all tested metals produced good MTT-5 gene induction, time course analyses of MTT-5-mRNA levels were
Fig. 6. Phylogenetic relationships between Tetrahymena MTs. UPGMA (A), neighbor-joining (B), minimum evolution (C) and maximum parsimony (D) unrooted trees obtained with MEGA 3.1. Evolutionary distance was calculated by Poisson's method. Numbers close to nodes: bootstrap values (expressed in percentages) after 5000 replicates.
396
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
performed by real time quantitative PCR. The results, normalized against 17S-rRNA, are shown in Fig. 4, which indicates that the maximum level, about 600-fold, occurred within 30 min of Cd exposure. This maximum induction was then followed by a down-regulation to 200-fold over the next 90 min. A further increase, up to 300-fold, occurred over the following 2 h. Cu exposure induced MTT-5-mRNA transcription less quickly than Cd, but the increment was nearly constant up to 4 h, when the level was about 500-fold higher than in control cells. Expression induced by Zn exposure was low for all times considered. 3.3. Phylogenetic relationships The amino acid sequence of T. thermophila MTT-5 shows only limited similarity with other Tetrahymena MTs, identity values varying from 24.3 to 46.7% (Table 2). The highest identity seen in with Cd-induced MTs, particularly in T. pyriformis MT-1 (46.7% identity). Amino acid divergence obtained by Poisson's correction (Table 3) and the gamma model (unpublished results) based on amino acid sequence multiple alignment (Fig. 5), produced very similar distance patterns. Poisson's distances were used to reconstruct phylogenetic relationships among the MT isoforms so far isolated from the three species of Tetrahymena. T. pyriformis, T. pigmentosa and T. thermophila. The UPGMA, neighbor-joining (NJ), minimum evolution (ME) and maximum parsimony (MP) methods were applied and results are shown in Fig. 6. Cd-induced MT isoforms (MT-1, MTT-2, MTT-3, MTT5) are very closely related and clearly separate from Cu-induced MTs. The node values, indicating the relationships between these two groups, are supported by a high bootstrap value (99% Fig. 6D, 100% Fig. 6A–C). 4. Discussion We report the cloning and expression analyses of a new MT gene, provisionally called MTT-5. Comparative analysis of the coding region of the full-length cDNA and gene sequence confirms that the MTT-5 gene too is intronless, like other Tetrahymena MTs (Piccinni et al., 1999; Santovito et al., 2001; Shang et al., 2002; Boldrin et al., 2003) and many other genes isolated from the Tetrahymena complex (Prescott, 1994; Schmidt, 1997). The features of Tetrahymena MTs may indicate genetic adaptation, allowing prompt gene transcription in response to a rapid metal level increase in the cell, as hypothesized for some intronless MT genes in mussel (Leignel et al., 2005). Cd, Cu and Zn, at maximum tolerable concentrations, were able to stimulate MTT-5-mRNA synthesis. Nevertheless, the induction patterns differed according to inducer. Cd induced quick gene transcription in the first 30 minutes, followed by down-regulation, whereas the effect of Cu was delayed by about 4 h (Fig. 4). Zn elicited only very poor induction during the time considered. Initial transient activation by metals also occurs in other unicellular organisms (Münger et al., 1987; Peña et al.,
1998) and is similar to results reported for other Tetrahymena MTs such as T. pyriformis and T. pigmentosa MT-1 and MT-2 (Santovito et al., 2000, 2001) and T. thermophila MTT-2 (Boldrin et al., 2006). The mechanism by which MT expression is reduced, even in the continued presence of Cd ions, may reflect fluctuation in the availability of metal ions. This has been suggested for T. pyriformis and T. pigmentosa MT-1 (Santovito et al., 2000), and it was recently demonstrated in Drosophila that metallothioneins can inhibit their own expression by inhibiting their transcription factors via binding of the free metal, thus generating negative feedback (Egli et al., 2006). The expression of MTT-5 activated by Cu appeared to be time-dependent, gradually increasing with Cu accumulation. This pattern is quite different from that observed for the Cuinducible MTT-2 gene, in which quick expression takes place in the first 30 min of treatment and is then followed by downregulation (Boldrin et al., 2006). We suggest that MTT-5 plays a role in Cu homeostasis, whereas MTT-2 is involved in Cu detoxification, and represents a rapid, robust cell defense against toxic Cu levels. Thus, we propose MTT-5 as a “doubleacting” protein, playing a dynamic role regulating Cu ion homeostasis appropriately, and also contributing toward protecting the cell against Cd. Among transition metals, Zn, generally one of the most common and best inducers of metallothionein transcription in mammals (Kägi, 1993), elicited only very poor induction of MTT-5-mRNA. However, this finding is of some interest, in that no other Tetrahymena MTs were found to be induced by this metal (Boldrin et al., 2002; Dondero et al., 2004) and Zn appears to be more toxic than Cd for this ciliate (unpublished data). It is well-known that several metallothionein isoforms are generally present in pluricellular organisms, and that the highest genetic polymorphism is found in mammals. The functional significance of these multiple isoforms must be clearly defined, as their functions may partially overlap. The fact that differing isoforms can be induced differentially as well as preferentially by varying metals, and that specific isoforms perform specific functions in those tissues in which they are expressed (Kramer et al., 1996; Syring et al., 2000; Miles et al., 2000) suggests that iso-metallothioneins have multiple biological functions. The presence of a number of functional isoforms even in unicellular organisms raises the question of whether they play different biological roles or if they simply reflect a duplication of function. In particular, the high genetic polymorphism in T. thermophila, because of the presence of five different metallothioneins (MTT-1, MTT-2, MTT-3, MTT-4, MTT-5, the latter described here), indicates a more complex situation than in other species of the Tetrahymena complex, in which interactions between various metallothioneins, acting differently according to stimulus, must be considered. The identification of a new MT in Tetrahymena allows more thorough phylogenetic study of the MT gene family in this protozoan. The data of Fig. 6 confirm that Cd- and Cu-MTs fall in separate phylogenetic clades, suggesting that one major duplication and diversification event gave rise to these protein subfamilies (Boldrin et al., 2003).
G. Santovito et al. / Comparative Biochemistry and Physiology, Part C 144 (2007) 391–397
As clearly shown in all T. thermophila trees, MTT-5 emerges as the earliest branch of this cluster and is always represented as a sister group of the other Cd-induced MTs. The bootstrap values are significant (81–97%), with the only exception of the MP tree, in which the value is 64% (Fig. 6D). The other two T. thermophila Cd-MTs (MTT-1, MTT-3) emerge together, and later. In this case too the bootstrap values are significant. The Cd-MT cluster is resolved in the UPGMA, NJ and ME trees (Fig. 6A–C), favoring an orthologous relationship between MT-1 proteins and a paralogous relationship between MTT-1 and MTT-3 of T. thermophila. The Cu-MT cluster is also always resolved, favoring an orthologous relationship between MTT-2, MTT-4 and MT-2 proteins and a paralogous relationship between MTT-2 and MTT-4. These observations, together with the evidence of the inducibility by Zn, which is a unique condition among T. thermophila MTs, may indicate that MTT-5 underwent a particular evolutionary history, independent of other MT isoforms. Acknowledgment This research was partly supported by the Italian Ministero Istruzione Università Ricerca (MIUR). References Boldrin, F., Santovito, G., Irato, P., Piccinni, E., 2002. Metal interaction and regulation of Tetrahymena pigmentosa metallothionein genes. Protist 153, 283–291. Boldrin, F., Santovito, G., Negrisolo, E., Piccinni, E., 2003. Cloning and sequencing of four new metallothionein genes from Tetrahymena thermophila and Tetrahymena pigmentosa: evolutionary relationships in Tetrahymena MT family. Protist 154, 431–442. Boldrin, F., Santovito, G., Gaertig, J., Wloga, D., Cassidy-Hanley, D., Clark, T.G., Piccinni, E., 2006. Metallothionein gene from Tetrahymena thermophila with a copper-inducible–repressible promoter. Eukaryot. Cell 5, 422–425. Dondero, F., Cavaletto, M., Grezzi, A.R., La Terza, A., Banni, M., Viarengo, A., 2004. Biochemical characterization and quantitative gene expression analysis of the multi-stress inducible metallothionein from Tetrahymena thermophila. Protist 155, 157–168. Egli, D., Yepiskoposyan, H., Selvaraj, A., Balamurugan, K., Rajaram, R., Simons, A., Multhaup, G., Mettler, S., Vardanyan, A., Georgiev, O., Schaffner, W., 2006. A family knockout of all four Drosophila metallothioneins reveals a central role in copper homeostasis and detoxification. Mol. Cell. Biol. 26, 2286–2296. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fitch, W.M., 1971. Towards defining the course of evolution: minimum change for a specific tree topology. Syst. Zool. 20, 406–416. Fu, C., Miao, W., 2006. Cloning and characterization of a new multi-stress inducible metallothionein gene in Tetrahymena pyriformis. Protist 157, 193–203. Gorovsky, M.A., Yao, M.C., Keevert, J.B., Pleger, G.L., 1975. Isolation of micro and macronuclei of Tetrahymena pyriformis. Methods Cell Biol. 9, 311–327. Kägi, J.H.R., 1993. Evolution, structure and chemical activity of class I metallothioneins: an overview. In: Suzuki, K.T., Imura, N., Kimura, M. (Eds.), Metallothionein III. Birkhäuser Verlag, Basel, pp. 29–55. Kojima, Y., Binz, P.A., Kägi, J.H.R., 1999. Nomenclature of metallothionein: proposal for a revision. In: Klaassen, C.D. (Ed.), Metallothionein IV. Birkhäuser Verlag, Basel, pp. 3–6.
397
Kramer, K.K., Liu, J., Choudhuri, S., Klaassen, C.D., 1996. Induction of metallothionein mRNA and protein in murine astrocyte cultures. Toxicol. Appl. Pharmacol. 136, 94–100. Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17, 1244–1245. Leignel, V., Hardivillier, Y., Laulier, M., 2005. Small metallothionein MT-10 genes in coastal and hydrothermal mussels. Mar. Biotechnol. 7, 236–244. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Mignone, F., Pesole, 2002. rRNA-like sequences in human mRNAs. Appl. Bioinformatics 1, 145–154. Miles, A.T., Hawksworth, G.M., Beattie, J.H., Rodilla, V., 2000. Induction, regulation, degradation, and biological significance of mammalian metallothioneins. Crit. Rev. Biochem. Mol. Biol. 35, 35–70. Münger, K., German, U.A., Lerch, K., 1987. The Neurospora crassa metallothionein gene. Regulation of expression and chromosomal location. J. Biol. Chem. 25, 7363–7367. Peña, M.M., Koch, K.A., Thiele, D.J., 1998. Dynamic regulation of copper uptake and detoxification genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 2514–2523. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Piccinni, E., Irato, P., Guidolin, L., 1990. Cadmium-thionein in Tetrahymena thermophila and Tetrahymena pyriformis. Eur. J. Protistol. 26, 176–181. Piccinni, E., Staudenmann, W., Albergoni, V., De Gabriel, I.R., James, P., 1994. Purification and primary structure of metallothioneins induced by cadmium in the protists Tetrahymena pigmentosa and Tetrahymena pyriformis. Eur. J. Biochem. 226, 853–859. Piccinni, E., Bertaggia, D., Santovito, G., Miceli, C., Kraev, A., 1999. Cadmium metallothionein gene of Tetrahymena pyriformis. Gene 234, 51–59. Prescott, D.M., 1994. The DNA of ciliated protozoa. Microbiol. Rev. 58, 233–267. Rzhetsky, A., Nei, M., 1992. A simple method for estimating and testing minimum-evolution trees. Mol. Biol. Evol. 9, 945–967. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Santovito, G., Irato, P., Piccinni, E., 2000. Regulation of metallothionein in Tetrahymena: induction of MT mRNA and protein by cadmium exposure. Eur. J. Protistol. 36, 437–442. Santovito, G., Irato, P., Palermo, S., Boldrin, F., Sack, R., Hunziker, P., Piccinni, E., 2001. Identification, cloning and characterisation of a novel coppermetallothionein in Tetrahymena pigmentosa. Sequencing of cDNA and expression. Protist 152, 219–229. Schmidt, H.J., 1997. Molecular biology of ciliates. In: Hausmann, K., Bradbury, P.C. (Eds.), Cialiates: Cells as Organisms. Gustav Fischer, pp. 325–353. Shang, Y., Song, X., Bowen, J., Corstanje, R., Gao, Y., Gaertig, J., Gorovsky, M.A., 2002. A robust inducible–repressible promoter greatly facilitates gene knockouts, conditional expression, and overexpression of homologous and heterologous genes in Tetrahymena thermophila. Proc. Natl. Acad. Sci. U. S. A. 99, 3734–3739. Sneath, P.H.A., Sokal, R.R., 1973. Numerical Taxonomy. Freeman, San Francisco. Syring, R.A., Brouwer, T.H., Brouwer, M., 2000. Cloning and sequencing of cDNAs encoding for a novel copper-specific metallothionein and two cadmium-inducible metallothioneins from the blue crab Callinectes sapidus. Comp. Biochem. Physiol. C, Comp. Pharmacol. Toxicol. 125, 325–332. Tang, X., Nakata, Y., Li, H.O., Zhang, M., Gao, H., Fujita, A., Sakatsume, O., Ohta, T., Yokoyama, K., 1994. The optimization of preparations of competent cells for transformation of E. coli. Nucleic Acids Res. 22, 2857–2858. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.