Molecular and metabolic strategies for postharvest detection of heat-resistant fungus Neosartorya fischeri and its discrimination from Aspergillus fumigatus

Postharvest Biology and Technology 161 (2020) 111082

Contents lists available at ScienceDirect

Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio

Molecular and metabolic strategies for postharvest detection of heatresistant fungus Neosartorya fischeri and its discrimination from Aspergillus fumigatus

T

Giorgia Pertilea, Magdalena Frąca,*, Emilia Fornalb, Karolina Oszusta, Agata Grytaa, Takaski Yaguchic a b c

Institute of Agrophysics, Polish Academy of Sciences, ul. Doświadczalna 4, 20-290, Lublin, Poland Department of Pathophysiology, Medical University of Lublin, ul. Jaczewskiego 8b, 20-090, Lublin, Poland Medical Mycology Research Center, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba, 260-8673, Japan

A R T I C LE I N FO

A B S T R A C T

Keywords: Neosartorya fischer Detection method Strawberry fruit Strawberry juice Mycotoxins

Heat Resistant Fungi (HRF) and toxigenic fungi are considered as a serious problem both in the agricultural field and for human health, due to ascospores and mycotoxins production, which can contaminate fruit and, as a consequence, adversely affect the agricultural food chain. One strategy to identify these fungi is the use of modern molecular method, which include the analysis of DNA target regions for differentiation of the fungal species. However, previously developed methods included only the identification of pure strains but not the detection of Neosartorya fischeri in artificially contaminated food samples, such as fruit or juices. Therefore, the aim of presented study was to develop a detection method of Neosartorya fischeri in contaminated strawberry fruit and juice. The other strategy is the use of phenotypic assays to determine the metabolic profile of the fungi in order to facilitate a qualitative and quantitative detection of microorganisms based on specific substrates utilization and mycotoxins production. Accordingly, the study included an evaluation of the differences in phenotype profile between N. fischeri and the phylogenetically close fungus Aspergillus fumigatus, as a strategy of their differentiation and identification. PCR detection assay was developed that revealed the presence of N. fischeri DNA in all tested contaminated samples of fruit and juice. Therefore, it can be concluded that this rapid molecular method is an important tool for the evaluation of the postharvest quality of agricultural raw materials. Moreover, the results suggest that specific metabolic and mycotoxin patterns may be used as N. fischeri detection markers and strategy in discrimination of this fungus from A. fumigatus. The results indicated that N. fischeri and A. fumigatus had a different time period of carbon sources utilization, and particularly N. fischeri presented a more efficient carbon metabolism. Mycotoxins, verruculogen and fumitremorgin C, were detected after 4 days incubation of N. fischeri. Although metabolic assays are not such fast as molecular detection approach, they allow to deeper insight into the pathways activated by heat-resistant and toxigenic fungi. Therefore, both molecular and metabolic strategies of heat-resistant fungus detection and identification are complementary and can be used to measure postharvest quality of fruit and their products.

1. Introduction Heat Resistant Fungi (HRF) are an urgent problem of the last century especially since this fungal category produces ascospores that can survive at more than 75 °C for 10 min (Yaguchi et al., 2012), for example, Neosartorya fischeri can resist 85 °C for more than 10 min (Wyatt et al., 2015a). These fungi produce mycotoxins that can damage fruit

quality, fruit safety, and human health (Fornal et al., 2017). For these reasons, in the agricultural field, it is important to find a method of agricultural product monitoring to identify heat resistant fungi, including Neosartorya fischeri in real food samples of postharvest agricultural raw materials. To date, HRF have been discovered in a variety of fruit and fruit products such as strawberry, blueberry, lemon and apple juices (Dos Santos et al., 2018). Besides Neosartorya, the main

⁎

Corresponding author. E-mail addresses: [email protected] (G. Pertile), [email protected] (M. Frąc), [email protected] (E. Fornal), [email protected] (K. Oszust), [email protected] (A. Gryta), [email protected] (T. Yaguchi). https://doi.org/10.1016/j.postharvbio.2019.111082 Received 4 June 2019; Received in revised form 13 November 2019; Accepted 26 November 2019 0925-5214/ © 2019 Elsevier B.V. All rights reserved.

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

mycotoxins) to survive this condition. Mycotoxins are also produced by Neosartorya fischeri and Aspergillus fumigatus. These two fungal species are very close phylogenetically and morphologically, and it is difficult to discriminate them each other (Yaguchi et al., 2012), however differences in metabolic patterns and mycotoxins production between these fungi could help in their distinction. Fumitremorgins and verruculogen are toxins specific among other for N. fischeri. The fumitremorgins are produced at a lower concentration of oxygen and the increase in its production is connected with the presence of carboxylic acids, such as citric, malic, or tartaric (Fornal et al., 2017; Frąc et al., 2015). Furthermore, the fumitremorgins in N. fischeri are not directly connected with the production of conidia (Frąc et al., 2015). However, metabolic responses that occur during fungal life can cause changes in substrates in pivotal pathways and thereby trigger, decrease or increase mycotoxins production (Heidtmann-Bemvenuti et al., 2011; Kotowicz et al., 2014). Therefore, the phenotypic approaches including metabolic profile evaluation and mycotoxins production are useful in discrimination of fungal strains and complement molecular detection strategies, thereby can be useful during postharvest quality evaluation of fruit and their products. The aim of the presented work is to extend a method for the detection of Neosartorya fischeri in contaminated strawberry fruit and juice samples, on the basis of the primers previously designed for pure strain identification by Yaguchi et al. (2012). Additionally, the study included the evaluation of phenotype profile differences between N. fischeri and Aspergillus fumigatus, as a strategy of their discrimination and identification on the basis of specific substrates utilization and mycotoxins production. The part of manuscript concerning pure strains was designed to confirm and reproduce the primers specificity. However, the other part of test method concerning strawberry and juice samples was designed to develop and broaden the possibility of using the method of fungal detection in completely new way – for postharvest quality monitoring of agricultural raw materials (such as strawberry fruit) and food (like strawberry juice).

fungal genera that belong to the HRF are Byssochlamys, Eupenicillium, Hamigera, and Talaromyces (Berni et al., 2017; Dos Santos et al., 2018; Frąc et al., 2015; Yaguchi et al., 2012). In the last decade, few research has been focused on elaborating methods for the rapid detection and identification of HRF, especially for fungi belonging to genera Byssochlamys and Hamigera (Nakayama et al., 2010), Byssochlamys (Hosoya et al., 2012), Neosartorya (Yaguchi et al., 2012), and Talaromyces (Panek and Frąc, 2018). However, most methods were developed only for the identification of pure strains, not for the detection of fungi in contaminated agricultural raw materials and food samples. Therefore, strategy to identify heat-resistant fungi with using molecular methods useful for fast detection and differentiation of the fungal species should be supported and extended also for real samples, artificially contaminated by fungi in order to find out if food or juice sample matrix will not bother the assay. This is important for the future method development to detect real contamination of agricultural raw materials and food. A knowledge of fungal physiology is important strategy in order to detect metabolic pathways involved in the development of heat-resistance or mycotoxins production and to obtain deeper insight into tracts activated by heat-resistant and toxigenic fungi. Heat resistance capacity is acquired in two phases during ascospore maturation. In the first phase the accumulation of compatible solutes occurs as well as a reduction in water presence and a low rate of metabolic reactions. Successively, in the second phase, a decrease in the concentration of mannitol and an increase in the concentration of trehalose and trehalose-based oligosaccharides (TOS) occur (Wyatt, 2014). The compatible solutes are substances that have the task of protecting the cell from high temperatures, drought, and other stresses. These substances, both at normal and high concentration, do not interfere with the metabolic and development phase of the fungus. The best known compatible solutes are trehalose sugar, polyols, betaine, amino acids, glycerol, i-erythritol, arabitol and mannitol (Wyatt, 2014; Wyatt et al., 2015b). The concentration of the compatible solutes inside the ascospore change during the growing phase (Wyatt, 2014). In particular, the more important compatible solutes are trehalose and mannitol and the absence of these compounds may lead to a reduction in the heat resistance of Aspergillus niger and A. nidulans (Wyatt, 2014). Furthermore, Botrytis cinerea uses trehalose to protect itself from stress and as an essential source of carbon for the ascospore germination when the nutrient availability is lower (Doehlemann et al., 2006). In addition, Doehlemann et al. (2006) found that trehalose 6-phosphate is involved in glycolysis during germination. Hult and Gatenbeck (1978) proposed the mechanism of fungal metabolism of mannitol and trehalose in Ascomycota. In brief, the mannitol cycle is composed of two paths to convert fructose-6phosphate to mannitol, whereas the trehalose cycle is composed of more paths to obtain trehalose from α-D-glucose. Mannitol, trehalose, and oligosaccharides are involved in the protection of the cell against oxidative stress; furthermore, trehalose has a role in preventing cell lysis (Wyatt et al., 2015a). The knowledge of secondary metabolites is also important tool for detection of mycological food contamination, what in turn, has the potential to benefit human health, the agricultural field, and the food production chain. HRF produce mycotoxins, which are not essential for any important step in the fungal life cycle. During a stressful situation, the fungi produce secondary metabolites (i.e.

2. Material and methods 2.1. Fungal strains and culture conditions Isolates of heat resistant fungi Neosartorya fischeri were obtained from the Medical Mycology Research Center, Chiba University (Japan) (Table 1). All strains were grown on Potato Dextrose Agar (PDA, Biocorp, Warsaw, Poland) in Petri dishes at 30 °C for 30 d in the dark until good growth and ascospores were obtained. Then ascospores were collected from the surface of the agar plates using a sterile swab by gently rubbing it across the surface, these spores were then used for the experiments described below. 2.2. Strawberry fruit and juice preparation and inoculation Strawberry fruit were purchased from a local supermarket and some of them were used for juice production. In this case, 500 g of fresh strawberry fruit were crushed, pressed, and filtered on a double layer cloth to remove seeds and strawberry pulp and then briefly centrifuged to obtain the juice. The strawberry juice was sterilized in an autoclave

Table 1 List, isolation source and origin of fungal strains used in the study of their detection on fruit and juice of strawberry. Fungi

Reference paper

Strain number

Accession number

Izolation source/origin

Neosartorya fischeri Neosartorya fischeri Neosartorya fischeri Aspergillus fumigatus Aspergillus fumigatus Aspergillus fumigatus

NF1 NF2 NF3 AF1 AF2 AF3

G79/14 G78/14 G77/14 G74/14 G75/14 G76/14

IFM IFM IFM IFM IFM IFM

Canned apples – – Japan Sputum / Japan –

2

60671 46945 57324 54729 55548 54307

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

mycelium of the three different strains of N. fischeri and A. fumigatus growing on Potato Dextrose Agar medium (PDA, Biocorp, Warsaw, Poland) at 30 °C for 30 d. The transmittance of the mycelium with ascospores homogenized suspension in inoculating fluid was adjusted to 75 % using a turbidimeter. Then, 100 μL of the fungal inoculum was added to each well and the microplates were incubated at 26 °C for 10 d. The experiment was performed in three replications. Functional diversity was determined by the Average Well Density Development (AWDD) index and it was measured from the optical density (OD) at 750 nm for each well, corrected by the blank (water) and divided by 95 indicating the total number of tested substrates. Furthermore, the metabolic rate was analysed through the ratio of the substrate used (respiration, OD 490 nm) and mycelium growth (biomass production, OD 750 nm). This ratio compares the metabolic activity and biomass development (Pinzari et al., 2016, 2014) divided into 15 carbon source groups: water, monosaccharides (heptose, hexoses, pentoses), monosaccharides-related compounds (sugar acids, hexosamines, polyols), other sugars (polysaccharides, oligosaccharides), N-containing compounds (peptides, L-amino acids, biogene and heterocyclic amines, TCAcycle intermediates, aliphatic organic acids) and others (Table S1; Pinzari et al., 2016).

for 20 min at 121 °C. The strawberry fruit (1 g) or juice (1 mL) were mixed with N. fischeri or A. fumigatus inoculum (100 μg of mycelium with ascospores) and then the fungal DNA was extracted through the protocol described by Zhu et al (1993) with modifications described below. The specificity of the primers previously designed by Yaguchi et al (2012) were tested in food samples contaminated by N. fischeri and A. fumigatus at different concentrations of fruit pulp (10 X and 20 X of pulp concentration) and juice (0.5 μL of juice +2 μL DNA concentrated at 2 mg L−1 and 1 μL of juice +2 μL DNA concentrated at 2 mg L−1). 2.3. DNA extraction and PCR amplification Fungal genomic DNA was extracted according to the method of Zhu et al (1993) with modifications. In brief, 10 μL of sample (fungal mycelium, contaminated strawberry fruit or juice) was collected using a small inoculation loop and it was then mixed with 500 μL of extraction buffer (0.1 M TRIS-HCl, 40 mM EDTA, pH 9.0), 100 μL of 10 % sodium dodecyl sulfate (SDS) and 300 μL of benzyl chloride. The mixture was vortexed and incubated at 65 °C for 25 min and then cooled with ice for 2 min. Then, after vortexing and centrifugation (4 °C, 12 396 g, 10 min), 400 μL of the supernatant was transferred into a new 1.5 mL tube and mixed with 40 μL of 3 M CH3COONa and 500 μL of isopropanol. Subsequently, the solution was mixed and centrifuged at 12 396 g for 10 min at 4 °C. The supernatant was discarded and 500 μL of 70 % ethanol was added to the tube with DNA. The mixture was centrifuged in the above-mentioned conditions and the supernatant was discarded. The obtained DNA pellet was placed in a vacuum centrifuge where it was dried at 5 °C for 15−30 min. After drying 50 μL of deionized nuclease-free water was added to the DNA and the solution was vortexed. Finally, the DNA concentration was measured using a spectrophotometer NanoDrop (Thermo Fisher Scientific). The PCR reaction was prepared using two different sets of primers. Primers N2F and N2R were used for the detection of the Neosartorya genera and A. fumigatus, whereas the second set Nfi3F and Nfi3R was applied for the detection of only N. fischeri (Table 2; Yaguchi et al., 2012). The amplifications were performed in a thermal cycler DICE (TaKaRa BIO) using illustra™ puReTag Ready-To-Go PCR Beads (GE Healthcare) according to the manufacturer’s protocol. All reactions were performed using optimized conditions as follows: initial heat activation at 95 °C for 10 min, 35 cycles of denaturation at 95 °C for 1 min, annealing at 59 °C for 1 min, extension at 72 °C for 1 min; and a final extension at 72 °C for 10 min. Three biological replicates were carried out for these analyses. After amplification 2 μL of the reaction solution was applied to a 1.5 % agarose gel and separated at 100 V 25 min−1 with a 40 mM TRIS-acetate and 1 mM EDTA (pH 8.0) buffer. The gels were stained with ethidium bromide for 15 min prior to visualization.

2.5. Mycotoxin extraction and analysis The mycotoxins (verruculogen and fumitremorgin C) were extracted from Potato Dextrose Broth medium (PDB, Biocorp, Warsaw, Poland) from the culture of Neosartorya fischeri (grown for 4 d at room temperature). The mycotoxins extraction from PDB was performed using the QuEChERS method following EN method 15662. After the mycotoxin extractions, the compounds were analysed through the LC/MS/ MS methods. The details of the methodology were described by Fornal et al. (2017). In brief, the PDB medium was spiked with the internal standard (triphenyl phosphate) before being extracted with 10 mL of acetonitrile and shaken for 1 min. The separation phase was made by adding 4 g magnesium sulfate anhydrous, 1 g sodium chloride, 1 g trisodium citrate dihydrate, 0.5 g disodium hydrogen citrate and shaking for 1 min. Then, the samples were centrifuged for 5 min and each liquid-extract was cleaned through Dispersive Solid Phase Extraction (DSPE). Successively, each cleaned-up sample was centrifuged for 5 min and analysed with LC/MS/MS, using two biological replications for each sample. 2.6. Statistical analysis All dendrogram graphs were created using STATISTICA 10 software (StatSoft, Inc., Tulsa, OK, USA) and the results obtained are shown with the Ward method and cluster analysis applied using Sneath's dissimilarity criterion (Sneath and Sokal, 1973). To illustrate the BIOLOG results, the similarities of the carbon utilization patterns between the two different fungi were presented using heatmap graphs. The phenotype results (Richness and AWDD indices) were analysed through the application of a two-way ANOVA regarding the effect of the incubation time and the type of strain. Successively, the significant differences were calculated by a post hoc analysis using the Tukey test. All of the statistical analyses, which are described above, were performed with the use of STATISTICA 10 software (StatSoft, Inc.,

2.4. Phenotype profiles of Neosartorya fischeri and Aspergillus fumigatus strains The phenotype profiles were analysed through the density of the fungal growth on 95 different substrates located on the BIOLOG FF microplate (Biolog Inc., USA). The inoculation of the fungal mycelium was based on the BIOLOG™ manufacturer’s protocol modified by Frąc (2012). The inoculum was obtained through the cultivation of the Table 2 The list of the primers used in the study. Primer

Sequence

Organism

Reference

N2F N2R Nfi3F Nfi3R

5′5′5′5′-

Neosartorya genera and A. fumigatus

(Yaguchi et al., 2012)

GGCTCTGGCCAGTAAGTTCG -3′ TTGTCACCGTTGGCCTAGTA -3′ AGTCGTTGCATAGGAGGGATCTA -3′ TCCCTCCCGAGGTCATACCAAAT -3′

N. fischeri

3

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

Fig. 1. The PCR-product using Neosartorya fischeri and Aspergillus fumigatus specific primers N2F/N2R (A) and Neosartorya fischeri specific primers NFI3F/Nfi3R (B) in pure culture. Gel agarose 1.5 %, the first line is a 100 bp ladder; NC means negative control; NF1, NF2, NF3, and AF are the acronyms of the analysed strains (Table 1).

analysed pulp concentrations (10 X and 20 X) of fungi inside the contaminated materials (Fig. 2A and B), indicates that the method is sufficiently sensitive. The method may be very useful for monitoring the postharvest quality of strawberries. The detection of the tested fungi in the juice was inhibited by juice components, however, the appropriate dilution of these materials allowed for the detection of the tested fungi in the strawberry juice. The results indicated that N. fischeri was detected with very good sensitivity in strawberry juice mixed with the DNA of fungi at the following proportions 2 μL of NF1, NF2 or NF3 DNA and 0.5 μL of juice. The detection became less sensitive when fungal DNA was mixed with a higher volume of juice (1 μL) indicating the presence of inhibitors of amplification in the juice, that interfere with detection (Fig. 3A and B). Similar results, with a very good fungal detection, were obtained for A. fumigatus, for 0.5 μL of juice the DNA bands were better visible and clear compared to 1 μL, indicating interference in fungal detection by juice matrix samples (Fig. 3A and B). Therefore, both for the specific and sensitive detection of Neosartorya fischeri and Aspergillus fumigatus DNA in strawberry juice, it is necessary to prepare appropriate serial dilutions of the fungal contaminated juice to dilute also contaminants/inhibitors present in this material, what allow to decrease the disturbance of DNA amplification and improve the detection quality of fungi.

Tulsa, OK, USA).

3. Results 3.1. Specificity and sensitivity for the molecular detection of N. fischeri and A. fumigatus The specificity of primers previously designed by Yaguchi et al. (2012) was tested on genomic DNA from 3 strains of N. fischeri and 1 strain of A. fumigatus extracted from strawberry fruit pulp and juice contaminated by these strains. The primers N2F and N2R successfully detected all four strains through a PCR assay (Figs. 1 Fig. 1A–3 A), obtaining a PCR-product of 220 bp, specific to the Neosartorya genus and A. fumigatus species. Analysing the primers Nfi3F/Nfi3R, we could confirm the specificity of this primer to amplify only the Neosartorya fischeri DNA (Figs. 1B–3 B). The results confirmed the possibility of the detection and identification of these fungi as DNA was isolated from pure strains (Figs. 1A and B). The completely innovative results of this paper relate to the detection of Neosartorya fischeri and Aspergillus fumigatus in agricultural raw materials and food samples (strawberry pulp and juice) contaminated by these fungi. This is the first report indicating that previously designed primers (Yaguchi et al., 2012) are not only capable of detecting and identifying pure fungus strains but they also enable the detection of fungi in contaminated real agricultural raw materials and food samples. The same primers were used for the detection of these fungi in contaminated strawberry fruit pulp (Fig. 2A and B) and juice (Fig. 3A and B). The detected presence of Aspergillus fumigatus and Neosartorya fischeri in strawberry pulp for both of the

3.2. Metabolic approach based on phenotype profile and mycotoxins production The results from the BIOLOG analysis, using optical density (OD) determined for each plate at both mitochondrial activity (490 nm) and

Fig. 2. The PCR-product using Neosartorya fischeri and Aspergillus fumigatus specific primers N2F/N2R (A) and Neosartorya fischeri specific primers NFI3F/Nfi3R (B) in strawberry fruit. Gel agarose 1.5 %, the first line is a 100 bp ladder; NC means negative control; NF1, NF2, NF3, and AF are the acronyms of the analysed strains (Table 1). The presence of these two fungal pathogens at two different concentrations of fruit (10 X and 20 X of pulp concentration). 4

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

Fig. 3. The PCR-product using Neosartorya fischeri and Aspergillus fumigatus specific primers N2F/N2R (A) and Neosartorya fischeri specific primers NFI3F/Nfi3R (B) in strawberry juice. Gel agarose 1.5 %, first line is 100 bp ladder; NC means negative control; NF1, NF2, NF3, and AF are the acronyms of the analysed strains (Table 1). The presence of these two fungal pathogens at two different volumes of juice (0.5 μL and 1 μL).

Fig. 4. The dendrogram of Neosartorya fischeri and Aspergillus fumigatus. This analysis arises from an analysis of the OD 750 nm (A) and ratio 490/750 nm (B).

analysis presented at the dendrogram (Fig. 4A) and that is divided into two groups: the first NF1 and NF2, and the second NF3, AF1, AF3, and AF3 (Fig. 6). Through an analysis of the 490/750 nm ratio, it was observed that the metabolic efficiency of Aspergillus fumigatus and Neosartorya fischeri were completely different (Tables S3 and S4). For A. fumigatus, a lower 490/750 nm ratio was found for the following carbon guilds: polysaccharides, sugar acids, heptose, oligosaccharides, hexosamines, and hexose; whereas N. fischeri utilized different groups of compounds more effectively. These were the following: polysaccharides, sugar acids, pentoses and “others” group. By analysing the values of mitochondrial respiration (OD 490 nm) and fungal growth (OD 750 nm) calculated for the different groups of substrates shown, it was observed that A. fumigatus demonstrated a preference for polysaccharides, glucosides, polyols, L-amino, TCA-cycle intermediates, sugar acids, oligosaccharides hexosamines, hexoses, pentoses, and peptides after 24 h of incubation for the initial phases of development (Table S3). Whereas the remaining three groups (biogene, aliphatic, heptose) were used after 96 h and 144 h of incubation, respectively (Table S3). Different results were noted for N. fischeri, which indicated that all of the carbon sources were used later in comparison with their utilization by A. fumigatus. Most carbon sources were used after 96 h until 168 h of incubation. There are two exceptions: biogene was used at 0 h of incubation but the growth of the mycelium occurred at 120 h; whereas heptose was used after 48 h of incubation (Table S4). These observations allowed for the development of an understanding that for the initial phase of development A. fumigatus used all of the carbon sources analysed, in contrast N. fischeri used them for the later phases of its development. The same result was obtained based on the 490/750 nm ratio (Tables S3 and S4). In fact, this ratio was far lower for all carbon sources for Neosartorya

mycelial growth (750 nm) indicated two different metabolic clusters (Fig. 4). Analysing the OD at 750 nm, the phenotypes relationship between the fungal strains was demonstrated by the dendrogram (Fig. 4A); the subdivision of all strains is in accordance with the less restrictive Sneath criterion (66 %). The isolates AF2, AF3, AF1, and NF3 exhibited a 58 % similar metabolic profile, whereas NF2 and NF1 exhibited a 46 % similar metabolic profile. In turn, at 33 % of Sneath’s criterion, approximately five clusters were observed, however, the only cluster found was AF3 and AF1 at 75 % similarity in metabolic profile (Fig. 4A). For the ratio 490/750 nm, in function of the less restrictive Sneath criterion (66 %), two clusters divided in function of the fungal genera (into 50 % and 40 % of similar metabolic profile, respectively) were observed, whereas at 33 % of Sneath’s criterion, five clusters with the complete separation of the three strains of N. fischeri were detected (Fig. 4B). The same results were obtained through a heatmap at 750 nm (Fig. 5). The results indicate usefulness of phenotype pattern, especially presented as the ratio of mitochondrial activity and mycelial growth as well as biomass production for discrimination of these two fungi N. fischeri and A. fumigatus. There is a difference in the utilization of the carbon source between Aspergillus fumigatus and Neosartorya fischeri, especially with regard to the source of the carbohydrates. Neosartorya fischeri has achieved a high degree of biomass growth (high OD 750 nm) in the following carbon sources: sucrose, D-fructose, D-mannose, gentiobiose, D-raffinose, D-sorbitol, sucrose, maltose, D-trehalose, turanose, dextrin, D-cellobiose, and D-mannitol. The carbon sources listen above may be involved in trehalose and mannitol metabolism (Wyatt et al., 2014). Through an analysis of the AWDD index and the substrates Richness (R index), through the ANOVA analysis, it was observed that only the OD 750 nm was affected by the strain (Table S2; Fig. 6). The ANOVA result of OD 750 nm confirmed the results obtained by cluster

5

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

Fig. 5. Phenotype profile of Neosartorya fischeri and Aspergillus fumigatus strains. The colour scale of the heatmap indicates the growth intensity of the organism (developed biomass measured at OD 750 nm) in carbon substrates for each analysed strain during the experiment.

6

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

Fig. 6. Average Well Density Development (AWDD) index (A) and the Substrate Richness (R) (B) values of Neosartorya fischeri and Aspergillus fumigatus strains. The vertical bars indicate the confidence intervals at 0.95 and the lowercase letters indicate the significant difference (p < 0.05) between each strain calculated through the post hoc Tukey test.

fischeri compared to Aspergillus fumigatus. This means that N. fischeri had a more efficient metabolism because a low ratio indicates that the fungi grow very well and that they have the ability to increase their mycelium density without consuming too much of the growth substrate (Pinzari et al., 2016). Through the performance of an analysis of compatible solutes, we observed that polyols, trehalose, malic acid, fructose, and oligosaccharides increased their OD 490 nm during the experiment (Figs. S1S9). In particular, malic acid, which is connected to mycotoxin production (Fornal et al., 2017) and other sources of carbon described above are involved in two phases of maturation and in the increase in resistance to stress in the spore (Wyatt, 2014).Two examined mycotoxins were detected in all the strains of Neosartorya fischeri after 4 d of incubation with an average concentration of 8.50 mg L−1 for verruculogen and of 0.14 mg L−1 for fumitremorgin C (Table 3). This study confirms that Neosartorya fischeri in PDB medium was able to produce these mycotoxins. It was observed that the production of these two mycotoxins was different between strains. The strain NF2 produced more verruculogen than fumitremorgin C, whereas NF1 and NF3 produced approximatively the same amount of both mycotoxins. These results corresponded with the phenotype profile of N. fischeri strains presented at Figures 4A and 5, indicating intraspecific differences in metabolic pattern between tested fungal strains. The strain NF2, with higher mycotoxins production, had also significantly more intensive growth on tested compounds and utilized the highest number of carbon sources compared to the other two strains NF1 and NF3 with low content of produced mycotoxins. Higher mycotoxins production by NF2 strain was connected with utilization of specific substrates such as sugars and sugar acids (α-D-lactose, arbutin, D-glucuronic acid, D-galacturonic acid, D-gluconic acid, 2-keto-D-gluconic acid), tricarboxylic acid cycle (TCA cycle) intermediates: (fumaric acid, D-malic acid), Lamino acids (γ-amino-butyric acid, L-glutamic acid, L-proline, L-ornityne, L-serine, L-phenylalanine, L-pyroglutamic acid, L-aspartic acid),

polysaccharides (glycogen), amines (putrescine, D-glucosamine), and others (alaninamide, succinamic acid), which were not utilized by the other two strains of N. fischeri NF1 and NF3, that produced low amount of verruculogen and fumitremorgin C. Therefore, it may be concluded that heat-resistant N. fischeri during production of mycotoxins such as verruculogen and fumitremorgin C intensify utilization of oligosaccharides, sugar acids and amino acids and activate metabolic pathways such as the tricarboxylic acid cycle. 4. Discussion The postharvest detection of fungal growth is necessary for agricultural raw materials such as fruit and vegetables, especially those used to produce non-pasteurized juices, instant food, and ready-to-eat food. The biological quality of the agricultural raw materials and the hygienic conditions used during the production and storage processes are critical for final food product quality and safety. The previous study which discriminated between Neosartorya fischeri and Aspergillus fumigatus (Yaguchi et al., 2012) was focused only on pure cultures and not on real contaminated agricultural raw materials and food samples. Our study confirmed that the specificity of the primer for N. fischeri and Neosartorya sp. plus A. fumigatus (Yaguchi et al., 2012) worked very well not only for pure cultures (Yaguchi et al., 2012), but also when the fungal DNA was extracted from strawberry fruit and juice. The specificity and robustness of these primers was proved for real food samples indicating that their use in the agricultural field, especially for the rapid diagnosis of the presence of these fungi in the agricultural environment, is feasible for the postharvest monitoring of collective fruit quality. However, it is important to purify the extracted DNA, because the fruit and juices can be rich in different types of interferences, such as mucilage, carbohydrates, proteins and polyphenols. The presence of these compounds may act as inhibitors of amplification or even may hamper the DNA extraction process (Ramos et al., 2014). The detection threshold may be limited especially in case of monitoring of strawberry juice contamination by N. fischeri, because the DNA extraction or amplification can be interfered with juice components such as sugars (glucose, fructose, sucrose) and organic acids (citric acid, malic acid), which content is often higher in juice than in fresh fruit (Paparozzi et al., 2018). Therefore, in case of strong amplification interference, it is reasonable to prepare serial dilutions of samples, which will also dilute the contaminants and will allow to detect the presence of fungal contamination. Fungi can utilize a variety of substrates such as sugars, amino acids, organic acids, polymers and furthermore, they are relatively tolerant of low pH, low water activity, low/high temperatures and various preservatives (Frąc et al., 2015). Therefore, an important technological

Table 3 Concentration of fumitremorgin C and verruculogen for Neosartorya fischeri. Fumitremorgin C Sample N. fischeri NF3 N. fischeri NF2 N. fischeri NF1

Verruculogen Concentration (mg L−1) 0.0741 0.0706 0.2424 0.2546 0.0921 0.0920

Sample N. fischeri NF3 N. fischeri NF2 N. fischeri NF1

Concentration (mg L−1) 0.0642 0.0535 21.9621 28.7211 0.0993 0.1106

7

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

Fig. 4A, Table S4) in specific carbon sources, especially in sucrose, Dfructose, D-mannose, gentiobiose, D-raffinose, D-sorbitol, maltose, Dtrehalose, dextrin, D-cellobiose, and D-mannitol. In contact with these carbon sources, Neosartorya fischeri grew without any stress effect, which was demonstrated through a ratio of 490/750 nm, which was lower than that produced by Aspergillus fumigatus (Pinzari et al., 2016, 2014). A higher utilization of these carbon sources could be involved with the metabolism of trehalose and mannitol (Wyatt et al., 2014). In order to obtain trehalose, the fungus requires α-D-glucose; whereas to obtain mannitol the fungus requires D-fructose, α-D-glucose and Dfructose, which may be obtained from the carbon sources mentioned above. For all of these reasons, the strains of Neosartorya fischeri used all available carbon sources to accumulate energies to be dispensed in variable activities, such as the formation and development of mycelium and ascospore or the production of secondary metabolites. Moreover, the separation of one N. fischeri strain (NF2) from the other two strains (NF1 and NF3) based on metabolic pattern correspond with significantly higher mycotoxins production by NF2 in comparison to NF1 and NF3, indicating that it is possible to consider intensively metabolized compounds such as oligosaccharides, sugar acids and amino acids as carbon sources utilization related to mycotoxins production.

method in postharvest monitoring and the food industry is the biotechnological growth inhibition of microorganisms dangerous to production, which is specific to certain physiological groups of microbes, genus, species, and even strains. From the point of view of the phenotype, the results indicated that the carbon utilization by N. fischeri and A. fumigatus was different. In fact, the two dendrograms demonstrated it by dividing the fungi into two clusters (Fig. 4). When OD 750 nm was considered, one of the strains of N. fischeri (called NF3) was included inside the cluster of A. fumigatus (Fig. 4A), but when the ratio (490 nm/ 750 nm) was considered, a perfect separation in the function of the species (Fig. 4B) was found. This phenomenon could be explained by the early growth inside each carbon source. In fact, NF3 grows fast in 93.33 % of the analysed carbon groups (the only exception was the glucosides group) at zero hours of incubation time. The same behaviour was observed for all of the analysed strains of A. fumigatus. This activity is designed to obtain immediate biomass production (fungal biomass) until the initial phase of fungal development, and could lead to a situation in which these fungi use all of their resources for mycelium growth and not for other metabolism (i.e. mycotoxin and ascospores production). The different value of OD 750 nm between the NF3 strain and the other two (NF1 and NF2) could be connected with stress conditions and for this reason, NF3 fungus immediately utilizes the carbon substrate for a pathway other than mycelium growth. This explanation is also supported by the ratio of 490/750 nm because if we compare this ratio between the three Neosartorya fischeri strains, the strain NF3 exhibits higher values (11 out of a total 15 groups) and as reported by Pinzari et al. (2016), a high ratio (namely high OD 490 nm and low OD 750 nm values) which indicates that the fungus is in a stressful situation and that it could respond to this condition by concentrating all of its energy resources not on growth but on ascospores or secondary metabolites productions. Overall, N. fischeri and A. fumigatus had different carbon source utilization patterns during the incubation period. Aspergillus fumigatus isolates utilized carbon in the initial phase of their development, whereas Neosartorya fischeri utilized it during the final phase (Table S3 and S4). This may be related to ascospores production and an increase in the use of maltose, α-D-glucose, and trehalose to increase ascospore heat resistance. Furthermore, all carbon sources in the case of Neosartorya fischeri were used in the final phase of its development and this could be justified by the fact that the fungus stores energy resources for the germination of ascospores, as the previous study reported (Kikoku et al., 2009). Other research indicated that specific proteins are involved in central carbon metabolism, heat stress responses, reactive oxygen intermediates elimination and translation events (Chen et al., 2016). Through analysing compatible solutes (polyols, oligosaccharides, trehalose, malic acid, and fructose; Figs. S1-S9) it may be concluded that the utilization of these carbon sources changes during the incubation period. For polyols, Neosartorya fischeri utilized D-sorbitol for the entire incubation period and at 96 h the utilization of i-erythritol commenced and at 168 h the utilization of i-erythritol, xylitol, and Dmannitol was initiated. The same behaviour was observed for oligosaccharides; for this group, D-raffinose was utilized for the entire incubation period and at 96 h the utilization of palatinose, D-melibiose, gentiobiose, and D-melezitose commenced and at 168 h the utilization of D-melibiose, D-melezitose, palatinose, and gentiobiose was initiated. The utilization of these last elements (trehalose, L-malic acid, and fructose) was increased for the entire incubation time. The accumulation of these specific carbon sources during the incubation period may change during the maturation phase of the ascospore (Wyatt et al., 2015a). In fact, in our experiment, we observed that these elements increased during the incubation time because during the first phase of the ascospore’s development there is an accumulation of compatible solutes and in the second phase there is a decrease in mannitol and an increase in trehalose (Wyatt, 2014). As previously mentioned, Neosartorya fischeri presented a higher activity of growth (high OD 750 nm,

5. Conclusion Through this work, two strategies (molecular and metabolic) for postharvest detection of heat-resistant fungus Neosartorya fischeri and its discrimination from Aspergillus fumigatus were developed and tested. Because of previously developed molecular methods included only the identification of pure strains and not the detection of Neosartorya fischeri in artificially contaminated food samples, extended method for the rapid detection of heat-resistant Neosartorya fischeri and toxigenic Aspergillus fumigatus in strawberry fruit and juice is completely innovative by using different kind of samples and is useful for postharvest fruit quality evaluation. This is the first report concerning the specificity of the tested primers for the rapid discrimination and identification of heat-resistant N. fischeri in strawberry fruit and juice. The results also suggest that a specific metabolic and mycotoxin patterns may be used as N. fischeri detection markers and strategy in discrimination of this fungus from A. fumigatus. The results indicated that these two fungal species had a different time period of carbon sources utilization. Furthermore, a phenotypic analysis showed that although N. fischeri and A. fumigatus are phylogenetically close (Trichocomaceae family) they have different carbon sources metabolism use. In particular, it was observed that N. fischeri utilized almost all of the analysed carbon sources and that their usage change was more effective in comparison to A. fumigatus, which was connected with the different life cycles of this fungus, especially concerning ascospores formation and mycotoxins (verruculogen and fumitremorgin C) production by N. fischeri. Although metabolic approaches are not such fast as molecular detection methods, they allow to deeper insight into the pathways activated by heat-resistant and toxigenic fungi. Therefore, both molecular and metabolic strategies of heat-resistant N. fischeri fungus detection and identification are complementary and can be used to measure postharvest quality of fruit and their products. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This research was supported by National Science Centre (Poland), project No.: DEC-2012/07/D/NZ9/03357. The authors gratefully 8

Postharvest Biology and Technology 161 (2020) 111082

G. Pertile, et al.

acknowledge use of the mass spectrometry facilities of the Center for Interdisciplinary Research of The John Paul II Catholic University of Lublin, Lublin, Poland, funded by POPW.01.03.00-06-003/09-00.

Kikoku, Y., Tagashira, N., Gabriel, A.A., Nakano, H., 2009. Heat activation of Neosartorya and Talaromyces ascospores and enhacement by organic acids. Biocontrol Sci. 14, 87–95. https://doi.org/10.4265/bio.14.87. Kotowicz, N., Frąc, M., Lipiec, J., 2014. The importance of Fusarium fungi in wheat cultivation – pathogenicity and mycotoxins production: a review. J. Anim. Plant Sci. 21 (2), 3326–3343. Nakayama, M., Hosoya, K., Matsuzawa, T., Hiro, Y., Sako, A., Tokuda, H., Yaguchi, T., 2010. A rapid method for identifying Byssochlamys and Hamigera. J. Food Prot. 73, 1486–1492. https://doi.org/10.4315/0362-028X-73.8.1486. Panek, J., Frąc, M., 2018. Development of a qPCR assay for the detection of heat-resistant Talaromyces flavus. Int. J. Food Microbiol. 270, 44–51. https://doi.org/10.1016/j. ijfoodmicro.2018.02.010. Paparozzi, E.T., Meyer, G.E., Schlegel, V., Blankenship, E.E., Adams, S.A., Conley, M.E., Loseke, B., Read, P.E., 2018. Strawberry cultivars vary in productivity, sugars and phytonutrient content when grown in a greenhouse during the winter. Sci. Hortic. 227, 1–9. https://doi.org/10.1016/j.scienta.2017.07.048. Pinzari, F., Ceci, A., Abu-Samra, N., Canfora, L., Maggi, O., Persiani, A., 2016. Phenotype MicroArray ™ system in the study of fungal functional diversity and catabolic versatility. Res. Microbiol. 167, 710–722. https://doi.org/10.1016/j.resmic.2016.05. 008. Pinzari, F., Reverberi, M., Piñar, G., Maggi, O., Persiani, A.M., 2014. Metabolic profiling of Minimedusa polyspora (Hotson) Weresub & P. M. LeClair, a cellulolytic fungus isolated from Mediterranean maquis, in southern Italy. Plant Biosyst. https://doi.org/ 10.1080/11263504.2013.877536. Ramos, S.N.M., Salazar, M.M., Pereira, G.A.G., Efraim, P., 2014. Plant and metagenomic DNA extraction of mucilaginous seeds. MethodsX 1, 225–228. https://doi.org/10. 1016/j.mex.2014.09.005. Sneath, P.H.A., Sokal, R.R., 1973. Numerical taxonomy. The Principles and Practice of Numerical Classification, 2nd ed. . Wyatt, T.T., 2014. Mechanisms Underlying Extreme Heat Resistance of Ascospores of Neosartorya fischeri. Utrecht University. Wyatt, T.T., Golovina, E.A., Van Leeuwen, R., Hallsworth, J.E., Wösten, H.A.B., Dijksterhuis, J., 2015a. A decrease in bulk water and mannitol and accumulation of trehalose and trehalose-based oligosaccharides define a two-stage maturation process towards extreme stress resistance in ascospores of Neosartorya fischeri (Aspergillus fischeri). Environ. Microbiol. 17, 383–394. https://doi.org/10.1111/1462-2920. 12557. Wyatt, T.T., Van Leeuwen, M.R., Golovina, E.A., Hoekstra, F.A., Kuenstner, E.J., Palumbo, E.A., Snyder, N.L., Visagie, C., Verkennis, A., Hallsworth, J.E., Wösten, H.A.B., Dijksterhuis, J., 2015b. Functionality and prevalence of trehalose-based oligosaccharides as novel compatible solutes in ascospores of Neosartorya fischeri (Aspergillus fischeri) and other fungi. Environ. Microbiol. 17, 395–411. https://doi. org/10.1111/1462-2920.12558. Wyatt, T.T., Van Leeuwen, M.R., Wösten, H.A.B., Dijksterhuis, J., 2014. Mannitol is essential for the development of stress-resistant ascospores in Neosartorya fischeri (Aspergillus fischeri). Fungal Genet. Biol. https://doi.org/10.1016/j.fgb.2013.12.010. Yaguchi, T., Imanishi, Y., Matsuzawa, T., Hosoya, K., Hitomi, J., Nakayama, M., 2012. Method for identifying heat-resistant fungi of the genus Neosartorya. J. Food Protect. 75, 1806–1813. https://doi.org/10.4315/0362-028X.JFP-12-060. Zhu, H., Qu, F., Zhu, L.-H., 1993. Isolation of genomic DNAs from plants, fungi and bacteria using benzyl chloride. Nucleic Acids Res. 21, 5279–5280.

Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.postharvbio.2019. 111082. References Berni, E., Tranquillini, R., Scaramuzza, N., Brutti, A., Bernini, V., 2017. Aspergilli with Neosartorya-type ascospores: heat resistance and effect of sugar concentration on growth and spoilage incidence in berry products. Int. J. Food Microbiol. 258, 81–88. https://doi.org/10.1016/j.ijfoodmicro.2017.07.008. Chen, S., Fan, L., Song, J., Zhang, H., Doucette, C., Hughes, T., Campbell, L., 2016. Quantitative analysis of protein profile of ascospores of Neosartorya pseudofischeri subjected to heat treatment. In: Poster Presentation at the ISEKI Food Conference. July 5-8th. Vienna, Austria. Doehlemann, G., Berndt, P., Hahn, M., 2006. Trehalose metabolism is important for heat stress tolerance and spore germination of Botrytis cinerea. Microbiology 152, 2625–2634. https://doi.org/10.1099/mic.0.29044-0. Dos Santos, J.L.P., Samapundo, S., Biyikli, A., Van Impe, J., Akkermans, S., Höfte, M., Abatih, E.N., Sant’Ana, A.S., Devlieghere, F., 2018. Occurrence, distribution and contamination levels of heat-resistant moulds throughout the processing of pasteurized high-acid fruit products. Int. J. Food Microbiol. 281, 72–81. https://doi.org/10. 1016/j.ijfoodmicro.2018.05.019. Fornal, E., Parfieniuk, E., Czeczko, R., Bilinska-Wielgus, N., Frąc, M., 2017. Fast and easy liquid chromatography – mass spectrometry method for evaluation of postharvest fruit safety by determination of mycotoxins: Fumitremorgin C and verruculogen. Postharvest Biol. Technol. 131, 46–54. https://doi.org/10.1016/j.postharvbio.2017. 05.004. Frąc, M., 2012. Mycological Evaluation of Dairy Sewage Sludge and Its Influence on Functional Diversity of Soil Microorganisms, Acta Agrophysica Monographiae. Institute of Agrophysics Polish Academy of Sciences, Lublin, PL. Frąc, M., Jezierska-Tys, S., Yaguchi, T., 2015. Occurrence, detection, and molecular and metabolic characterization of heat-resistant fungi in soils and plants and their risk to human health. Advances in Agronomy. Elsevier Inc., pp. 161–204. https://doi.org/ 10.1016/bs.agron.2015.02.003. Heidtmann-Bemvenuti, R., Mendes, G.L., Scaglioni, P.T., Badiale-Furlong, E., SouzaSoares, L.A., 2011. Biochemistry and metabolism of mycotoxins: a review. Afr. J. Food Sci. 5 (16), 861–869. Hosoya, K., Nakayama, M., Matsuzawa, T., Imanishi, Y., Hitomi, J., Yaguchi, T., 2012. Risk analysis and development of a rapid method for identifying four species of Byssochlamys. Food Control 26, 169–173. https://doi.org/10.1016/j.foodcont.2012. 01.024. Hult, K., Gatenbeck, S., 1978. Production of NAPDH in the mannitol cycle and its relation to polyketide formation in Alternaria alternata. Eur. J. Soil Biol. 88, 607–612.

9