Molecular and morphological discrimination of stipitate hydnoids in the genera Hydnellum and Phellodon

mycological research 111 (2007) 761–777

journal homepage: www.elsevier.com/locate/mycres

Molecular and morphological discrimination of stipitate hydnoids in the genera Hydnellum and Phellodon David PARFITTa, A. MARTYN AINSWORTHb, Deborah SIMPSONa, Hilary J. ROGERSa, Lynne BODDYa,* a

Cardiff School of Biosciences, Cardiff University, Cardiff CF10 3TL, UK 53 Elm Road, Windsor, Berkshire SL4 3NB, UK

b

article info

abstract

Article history:

Hydnellum and Phellodon species, generally considered ectomycorrhizal partners of a range

Received 31 March 2006

of woody angiosperms and gymnosperms particularly within Fagaceae and Pinaceae, appear

Received in revised form

to be declining in continental Europe. They are listed as priority species in the UK Bio-

28 March 2007

diversity Action Plan, but their UK conservation status remains uncertain. Interpretation of

Accepted 9 May 2007

species distribution data is hampered by a lack of consensus regarding some key discrimi-

Published online 18 May 2007

natory morphological characters and difficulties with their interpretation. DNA sequencing

Corresponding Editor:

of the ITS1 region of the ribosomal gene cluster discriminated between the known British

Karl-Henrik Larsson

species of Phellodon but revealed more terminal clusters than currently recognised taxa. Although the main focus within Hydnellum was on the very similar species pair H. concrescens

Keywords:

and H. scrobiculatum, a few samples of H. caeruleum, H. ferrugineum, H. peckii, and H. spongio-

BAP species

sipes were included in the study for reference. DNA sequencing of material identified on

Conservation

spore-based criteria as H. concrescens yielded two main groups, but samples received as

PCR specific primers

H. scrobiculatum were generally more variable. Of these, two were reassigned and the remaining group, with very similar spores (although shorter than in published descriptions of H. scrobiculatum), had highly variable sequence data. The results and conservation importance of these fungi highlight the need for a taxonomic reassessment of P. melaleucus, P. niger, H. concrescens, and H. scrobiculatum collections from Britain and continental Europe using a combined molecular and morphological approach. Specific PCR primers were constructed to discriminate fruit bodies, mycelium, and mycorrhizal roots of P. niger and P. confluens from each other and from other stipitate hydnoids. ª 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction Distribution and ecology The stipitate hydnoids are an informal grouping of basidiomycetes whose fruit bodies consist of a stipe and pileus with spore-producing spines underneath. However, throughout this paper the phrase is reserved for species of Bankera,

Hydnellum, Phellodon, and Sarcodon, all of which are classified in the thelephoroid clade (Binder et al. 2005). These fungi are generally regarded as ectomycorrhizal partners of a range of woody angiosperms and gymnosperms, particularly within Fagaceae and Pinaceae, and have a predominantly temperate distribution (Stalpers 1993; Pegler et al. 1997). Although of widespread distribution in the UK, stipitate hydnoids show markedly geographically polarised strongholds

* Corresponding author. E-mail address: [email protected] 0953-7562/$ – see front matter ª 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.mycres.2007.05.003

762

of species diversity. In the north, these cluster around the remnants of Caledonian pine forest, although Scottish conifer plantations are also important (Newton et al. 2002a). By contrast, the southern strongholds are broadleaved woodlands lying on a curve across the English counties of Hampshire, Berkshire, Buckinghamshire, Surrey, and Kent, where the soils range from acidic sands and gravels to alkaline clay (Marren 2000). Although the suites of hydnoid species differ in these two woodland types, the microhabitats supporting fruiting are remarkably similar. Different species characteristically fruit in close proximity on exposed or sparsely vegetated patches of soil, usually with low organic content, and on sloping ground. Some habitats are entirely natural such as hillsides, animal burrows, glacial moraines, and river banks. Most are much less so and include ancient earthworks, woodbanks, canal embankments, railway cuttings, pond dams, mounds, quarries, pits, ditches, and track or road margins (Ainsworth 2004).

Conservation status Stipitate hydnoids are of European conservation concern because they appear to have declined (based on fruit body records) in several European countries including the Netherlands (Arnolds 1989), Czech Republic (Hrouda 1999), and Denmark (Vesterholt et al. 2000). This trend has been correlated with increasing airborne nitrogenous eutrophication. In Denmark, for example, five stipitate hydnoid species have largely ceased to be recorded from all areas receiving in excess of about 15 kg nitrogen ha1 y1 (Vesterholt et al. 2000). Indeed, stipitate hydnoids are now becoming generally regarded as ‘‘nitrogen sensitive’’ organisms (Ga¨rdenfors 2005). Furthermore, a more recent apparent resurgence of continental European stipitate hydnoid fruiting has accompanied more stringent air pollution control. However, in Flanders at least, the more conifer-dependent species seem slower to resume fruiting (Fraiture & Walleyn 2005). Stipitate hydnoids are also of conservation concern in the UK and well-represented in the provisional red data list of British fungi (Ing 1992). Almost all the British stipitate hydnoids (14 species) were listed as priority species in the UK Biodiversity Action Plan (Anon 1998). The ensuing conservation-driven publicity (Marren & Dickson 2000; Marren 2002), field surveys and collation of records (Ewald 2000; Marren 2000; Green 2001; Ewald 2002; Turner 2002; Newton et al. 2002a, 2002b) generated an unprecedented surge in UK hydnoid records. Not only does this obscure any evidence of stipitate hydnoid decline and challenge their continued national red listing, it also emphasizes the more general requirement for adequate fungal baseline data and appropriate monitoring to improve conservation assessments of species status and its fluctuation.

Taxonomic and identification issues Spore deposit colour is traditionally used to distinguish the genera Hydnellum (brown) and Phellodon (white). However, there are a number of taxonomic and identification issues within the two genera, which make it difficult to determine their true distribution. Within Hydnellum, distinguishing between the very similar species pair H. concrescens and H. scrobiculatum is particularly problematic (Fig 1). Although they have

D. Parfitt et al.

been accepted as species for over 30 y (Maas Geesteranus 1975), there has been a series of taxonomic alternations between their recognition at varietal and specific rank, and various permutations of proposed names. Early emphasis was on the distinctive presence of concentric colour zonation on the cap of H. concrescens (reviewed by Baird 1986a). Subsequently, the importance of spore size and ornamentation was advocated, with special emphasis on the morphology of the wart apices (Maas Geesteranus 1975). Spore warts of H. scrobiculatum were described with predominantly rounded apices whereas those of H. concrescens terminate in flattened and bifurcate ridges (exsculpate ornamentation). However, ‘intermediates’ exist (Maas Geesteranus 1975; Baird 1986a; Marren 2000) that may represent undescribed cryptic taxa. More recently, Pegler et al. (1997) eschewed spore wart morphology, but emphasized the discriminatory importance of dark green to blue–green staining when fruit body flesh or spines of H. concrescens are placed in alkali solution. However, this is contradicted by other studies where both species produced olive green to brown pigments (Maas Geesteranus 1975; Baird 1986b; Stalpers 1993; Hansen & Knudsen 1997). Four species of Phellodon are traditionally recorded in the UK: P. confluens, P. melaleucus, P. niger, and P. tomentosus (Maas Geesteranus 1975; Pegler et al. 1997; Dickson 2000; Phillips 2006) (Figs 2–3). Their fruit bodies change colour and darken dramatically with age and upon wetting (Figs 2–3). This can hinder recognition of diagnostically important tissue types (tomentum and duplex flesh) and lead to misidentifications. Recently, specimens with unusually blue fruit bodies have been reported from Scotland (Newton et al. 2002b), resembling those of P. atratus d hitherto considered to be a western North American endemic (Harrison 1964; Castellano et al. 2003). Discriminating P. atratus from P. niger is problematic, the use of potassium hydroxide (KOH) staining and tissue types in the stipe being contradictory. A bluish precipitate and stain was reported to leach from P. atratus tissue in KOH (Harrison 1964), though dried isotype material yielded a dark greenish pigment (Baird 1986b), whereas that of P. niger was green or blue–green (Maas Geesteranus 1975; Hansen & Knudsen 1997; Pegler et al. 1997; Dickson 2000). The two species have also been separated on the basis of P. atratus having a single tissue type in the stipe in contrast to the two types seen in P. niger (Stalpers 1993). However, opinions differ on the stipe construction in P. atratus, some authors reporting one tissue type (Baird 1986b), others two (Bessette et al. 1995), and yet others one or two (Hall & Stuntz 1971; Castellano et al. 2003). Scottish specimens were included in the present study, and regarded as unidentified members of the P. niger complex, using the terminology of Stalpers (1993), pending further taxonomic clarification. Clearly, understanding the ecology and determining the population trends and hence conservation status of these fungi is hampered by difficulties in discriminating some species. This paper combines morphological approaches with DNA sequencing of the ITS1 region to discriminate between putative H. concrescens and H. scrobiculatum and between the British species of Phellodon. Specific PCR primers to identify fruit bodies, mycelia, or mycorrhizal roots of P. niger and P. confluens were designed and tested. PCR-based methods have been employed successfully for identifying ectomycorrhizal

Discrimination of stipitate hydnoids

763

Fig 1 – Sequenced Hydnellum fruit bodies from (A–E) Scotland and (F–H) England. Species and codes (fruit body; sequence) are: (A) H. caeruleum Rynettin 3; HCA1. (B) H. ferrugineum Loch an Eilein 3; HF2. (C) H. scrobiculatum re-determined as H. peckii Loch an Eilein 1; HS10. (D) H. peckii Slugan 2; HP1. (E–H) H. concrescens (E) Glen Einich 1; HC21. (F) Buttersteep 9; HC15. (G) Mark Ash 5; HC3. (H) Fruit body cluster previously identified as H. scrobiculatum in BMS ‘Fungus 2000’ event sampled as Buttersteep 10 and 11; HC16 and 17.

764

basidiomycetes (e.g. Gardes & Bruns 1993; Horton & Bruns 2001; Wurzburger et al. 2001; Burke et al. 2005). Moreover, they have been used with British stipitate hydnoids in the genus Sarcodon: sequencing the complete ITS region showed that

D. Parfitt et al.

two Scottish collections previously referred to Sarcodon imbricatus did not belong to that species but to S. squamosus (Watling & Milne 2005). Preliminary molecular taxonomic studies of British specimens of Hydnellum and Phellodon

Fig 2 – Phellodon confluens in (A–H) England and (I) Scotland showing (B, D–I) fruit bodies immediately before collection for sequencing. (A,B) The same location showing the darkening effects of rain on (A) which was photographed one year after the collection of sequenced fruit body (B). (B) Shows a well-developed confluent woolly stipe tomentum, which in transverse section (inset) is continuous with the softer, paler outer layer of stipe tissue and contrasts with the underlying darker central core (duplex flesh). (C,D) The same location showing (C) dry photographed two years before and (D) rain-soaked, which were collected and sequenced. Codes (fruit body; sequence) for all sequenced samples: (B) BB1a; PC10. (D) Wormstall Wood 1a; PC4. (E) Vinney Ridge A12; PC3. (F) Pembury 1; PC6. (G) Buttersteep 1; PC8. (H) Hosey 5; PC5. (I) Craigellachie 1; PC11.

Discrimination of stipitate hydnoids

765

Fig 3 – English (A–C) Phellodon melaleucus, (E–I) P. niger and (D) Scottish material referable to the P. niger complex showing (A, C, and E–I) fruit bodies immediately before collection for sequencing. (B) Showing the distinctive narrow smooth dark stipe of P. melaleucus, which has no woolly tomentum. Codes (fruit body; sequence) for all sequenced samples: (A) Vinney Ridge A13; PM5. (C) Knightwood 8a; PM2. (E) Rapley 4; PN9. (F) Rapley 5; PN10. (G) Buttersteep 3; PN7. (H) Mark Ash 3; PN3. (I) Knightwood 1; PN2.

766

successfully separated some taxa but were inconclusive for others (Bridge & Panchal 2004).

Materials and methods Collection details This study involved 113 stipitate hydnoid fruit body samples, collected mainly in 2004 and 2005, from England and Scotland. A total of 67 collections (see Supplementary Material) provided sequence data suitable for analysis and a range of corresponding fruit bodies is shown in Figs 1–3. All samples for DNA extraction had been dried except for one each of P. niger (Knightwood 11; PN1) and H. concrescens (Stubbs 1; HC7). Following DNA extraction, the remaining voucher material was deposited in the herbarium of the Royal Botanic Gardens, Kew. For sample GCD2025, which was found to contain material of two stipitate hydnoids, the deposited voucher specimen consisted of the H. peckii element only, thus matching the derived sequence HS7.

Morphological identification and reaction of flesh to KOH Phellodon fruit bodies were identified (by A.M.A.) based on the overall fruit body pigmentation and stipe morphology (Maas Geesteranus 1975; Pegler et al. 1997). Slivers of stipe tissue from nine samples of P. niger (all except Knightwood 11) and the two Scottish samples referred to the P. niger complex (Rynettin 1 and 2), were covered with a coverslip on a glass

D. Parfitt et al.

slide and then flooded and squashed in 5 % KOH. Release of any stains from the tissue was observed on a white tile under a dissecting microscope. Hydnellum fruit bodies were identified (by A.M.A.) using Maas Geesteranus (1975) and, with the exception of material assigned to H. scrobiculatum and H. concrescens, Pegler et al. (1997). The collectors’ provisional identifications were retained for material received as H. scrobiculatum pending molecular investigation. Fruit bodies macroscopically referable to H. aurantiacum or H. caeruleum (Slugan 3 and Rynettin 3; Fig 1A) were old and discriminated microscopically by presence of scattered clamp connections in H. caeruleum. One sample (Slugan 3) was re-checked and re-identified as H. caeruleum after molecular analysis of derived sequence HA1. Fresh samples identified as H. ferrugineum and as H. peckii were discriminated on taste and the presence of scattered clamp connections, which are only found in H. peckii. After molecular analysis, two samples received as H. scrobiculatum (GCD2025 and Loch an Eilein 1; Fig 1C) were microscopically examined for clamps and re-identified: the latter as H. peckii and the former as a mixture of this species and the presumed target. Mature spores of Hydnellum samples thought to be H. scrobiculatum or H. concrescens were microscopically examined in Melzer’s reagent (for clarity) using a 100 oil-immersion objective (Fig 4). Samples with spores bearing warts with flattened and bifurcate apices were assigned to H. concrescens. After molecular analysis, ten mature spores per sample (for all samples except Buttersteep 9; HC15) were examined in water under the same magnification. Wart height and spore dimensions (warts included) were recorded. Mature spores of sample H6 (Bridge & Panchal

Fig 4 – Mature spores deposited by Hydnellum fruit bodies from (A, B) England and (C, D) Scotland in Melzer’s reagent. Spore wart with double-bumped (exsculpate) apex is arrowed in (A). Species and codes (fruit body; sequence) are: (A–C) H. concrescens. (A) Buttersteep 11 (from fruit body cluster previously identified as H. scrobiculatum in BMS ‘Fungus 2000’ event); HC17. (B) Kings Hat 1; HC2. (C) Glen Einich 1; HC21. (D) Putative H. scrobiculatum GCD2003. Bar [ 5 mm.

Discrimination of stipitate hydnoids

767

2004) were included in this study. The KOH test was applied as outlined for Phellodon (above).

In an earlier study (Bridge & Panchal 2004), the rDNA region of extracted DNA was PCR amplified using combinations of PN3 (Mugnier 1994), ITS4 (White et al. 1990), ITS1F, and ITS4B (Gardes & Bruns 1993) primers (Table 1), but this failed to work consistently with our samples even after method optimisation. Thus a new primer, HYDR was designed for the 5.8S region (Table 1). Hydnellum and Phellodon DNA extracts were successfully amplified consistently using the PN3/ HYDR primer pair. PCR amplification reactions (25 ml) contained 50 mM of each primer, 0.625 U QIAGEN HotStar Taq, QIAGEN buffer (containing 2.5 mM MgCl2), 0.2 mM dNTPs, and 1 ml of a 10 dilution of the DNA extract. The reactions were carried out in a GeneAmp

Extraction and amplification of DNA from fruit bodies DNA extraction from fruit bodies initially assigned to Hydnellum scrobiculatum and H. concrescens was adapted from Parfitt et al. (2005) by increasing the volume of extraction buffer to 600 ml and repeated centrifugation (three times at 17,000 g in a microcentrifuge). Extracts were purified using a QIAquick PCR purification kit (Qiagen, Crawley) except that material on the spin-column was repeatedly washed with buffer PE until the flow-through was colourless.

66

A

PC9 P. confluens VC22 (C) PC2 P. confluens VC11 (Q)

PC12 P. confluens VC96 (B) PC11 P. confluens VC96 (B) PC1 P. confluens VC11 (Q) 87

PC4 P. confluens VC11 (Q) PC8 P. confluens VC22 (C,P) PC10 P. confluens VC24 (Q,F) PC3 P. confluens VC11 (Q,F)

100

PC6 P. confluens VC16 (C) PM4 P. confluens VC11 (Q,C,F,P) PC5 P. confluens VC16 (Q,F)

70

PC7P. confluens VC16 (C) PM7 P. melaleucus VC17 (F,C) PM9 P. melaleucus VC22 (C) 98

PM8 P. melaleucus VC22 (C) PM2 P. melaleucus VC11 (Q, Ps) PM1 P. melaleucus VC11 (Ps, Q, B, Pi) PM5 P. melaleucus VC11 (Q,F) 100 PM3 P. melaleucus VC11 (Q, Ps)

47

PM6 P. melaleucus VC16 (F, P) PT1 P. tomentosus VC92 (P) 91

59

PNC2 P. niger complex VC96 (P) PNC1 P. niger complex VC96 (P) PN3 P. niger VC11 (Q,C,F,P) PN1 P. niger VC11 (Q,F,Ps)

92

PN6 P. niger VC22 (C) PN2 P. niger VC11 (C,Q)

99

PN7 P. niger VC22 (C) 63

PN5 P. niger VC16 (C) PN9 P. niger VC22 (C) PN4 P. niger VC11 (Q,C,F,P) PN8 P. niger VC22 (C) PN10 P. niger VC22 (C)

0.02

Fig 5 – NJ tree derived from ITS1 sequences from (A) Phellodon and (B) Hydnellum (Supplementary Data Tables 1 and 3). Sequence code (Tables 3 and 4), final species determination, vice county (VC) and trees growing near to where the fruit body was collected are indicated: B, Betula sp.; C, Castanea sativa; F, Fagus sylvatica; P, Pinus sylvestris; Pi, Picea sp.; Ps, Pseudotsuga menziesii; Q, Quercus sp. Sequences for H6, H25, H26, and H67 from Bridge & Panchal (2004). BS values are indicated above branches.

768

D. Parfitt et al.

HC16 H. concrescens VC22 (C)

B

HC12 H. concrescens VC16 (C) 40

H26 H. concrescens VC11 (Q) HC13 H. concrescens VC16 (C)

41

HC9 H. concrescens VC15 (C) H25 H. concrescens VC11 (Q)

62

HC2 H. concrescens VC11 (Q) HC17 H. concrescens VC22 (C)

39

HC19 H. concrescens VC22 (C) HC3 H. concrescens VC11 (Q,C,F,P) HC15 H. concrescens VC22 (C)

45 46

H6 H. concrescens VC17 (C)

42

HC7 H. concrescens VC11 (Q,F) HC4 H. concrescens VC11 (Q,C,F,P)

30

HC10 H. concrescens VC15 (C) 97

HC11 H. concrescens VC16 (C) HC20 H. concrescens VC89 (?)

67

HC21 H. concrescens VC96 (P) HS3 H. cf. scrobiculatum VC96 (P)

51

H67 H. cf. scrobiculatum VC96 (P)

98

HS1 H. cf. scrobiculatum VC96 (P) HC8 H. concrescens VC11 (Q,F) 99

HC1 H. concrescens VC11 (Q) HS9 H. cf. scrobiculatum VC96 (P)

85

HS8 H. cf. scrobiculatum VC96 (P) 75 69

31

HF2 H. ferrugineum VC96 (P) HF3 H.ferrugineum VC96 (P) HF1 H. ferrugineum VC96 (P) HSP1 H. spongiosipes VC22 (C) HS7 H. peckii VC96 (P)

40

HP2 H. peckii VC96 (P) 99

HP3 H. peckii VC96 (P) HP1 H. peckii VC96 (P) HS10 H. peckii VC96 (P) HS6 H. cf. scrobiculatum VC96 (P)

HA1 H. caeruleum VC96 (P)

66 95

HCA1 H. caeruleum VC96 (P)

0.05

Fig 5 – (continued)

PCR System 2700 (Applied Biosystems, Foster City, CA) thermal cycler. The PN3/HYDR primer pair was used with the following parameters: 96  C for 15 min; 35 cycles of 94  C for 1 min, 53  C for 1 min, 72  C for 1 min; and 72  C for 10 min when used with samples from all species except P. melaleucus, where the cycle number was increased to 40 and the annealing temperature reduced to 50  C. A negative control without the DNA template was used in each amplification.

Gel isolation, extraction, sequencing, and analysis PCR products were isolated using gel electrophoresis on a 1.5 % (w/v) agarose gel with ethidium bromide. Bands were

visualised using UV, and extracted from gel and purified using a QIAquick Gel Extraction Kit (Qiagen). Purified PCR products were sequenced on an ABI 3100 (Applied Biosystems, Warrington). All PCR products were sequenced in both orientations and Phellodon and Hydnellum DNA sequences, together with four sequences from Bridge & Panchal (2004), were aligned separately using Clustal W within BioEdit version 7.0.1 (Hall 1999) and MEGA software version 3.1 (Kumar et al. 2004). Trees were obtained using NJ analysis with the Kimura two-parameter correction. BS values (1 K replicates) were calculated to enable an assessment of the branch support. Trees were generated from all of the good quality sequences obtained, plus four Hydnellum sequences (H6, H25, H26, and H67) from

Discrimination of stipitate hydnoids

769

Table 1 – PCR primers Primer PN3 ITS4 ITS1F ITS4B HYDR PnigF PnigR PconF PconR EF4 fung5

Sequence

Reference

CCGTTGGTGAACCAGCGGAGGGATC TCCTCCGCTTATTGATATGC CTTGGTCATTTAGAGGAAGTAA CAGGAGACTTGTACACGGTCCAG GCATTTCGCTGCGTTCTTC TTGCTTGGCACGTGCACG CGCTTCTACGCGCTGTGA. CCAGGGGTGGCATGTGCA CTTTTACACGCTACTGCAGTT GGAAGGG[G/A]TGTATTTATTAG GTAAAAGTCCTGGTTCCCC

Mugnier (1994) White et al. (1990) Gardes & Bruns (1993) Gardes & Bruns (1993)

Results Morphological identification and reaction of flesh to KOH Smit et al. (1999) Smit et al. (1999)

Bridge & Panchal (2004) (Fig 5). We used unrooted NJ rather than parsimony or Bayesian analysis as our aim was to establish whether ITS1 sequences were sufficient to discriminate between the target species. For a full phylogenetic analysis, inferring evolutionary relationships between species, more samples would have been required and representation of all the species.

Construction and testing of primers specific to Phellodon niger and P. confluens ITS1 sequences were aligned using BioEdit. Those that were identical for all Phellodon niger samples but different for all other species listed (Supplementary Material) were used to design the PnigF primer and the PnigR primer (Table 1). Similarly, forward and reverse primers were designed for P. confluens: PconF primer and PconR primer (Table 1). It was not possible to design specific primers that would amplify all samples of P. melaleucus, Hydnellum concrescens or H. scrobiculatum but no other samples. Primers were tested to determine whether the primer pairs were specific within the stipitate hydnoids studied. The two primer pairs were tested against DNA extracted from fruit bodies of Hydnellum and Phellodon species (Tables 2, 3 and 4). The following conditions were used for PCR amplification:

Table 2 – Specificity of primers for Phellodon niger and P. confluens against other stipitate hydnoids Taxa against which primers were tested Hydnellum caeruleum H. concrescens H. ferrugineum H. peckii H. spongiosipes H. cf. scrobiculatum P.hellodon confluens P. melaleucus P. niger P. niger complex P. tomentosus

94  C for 5 min; 30 cycles of 94  C for 30 s, 50  C for 30 s, 74  C for 1 min; and 74  C for 10 min. The general fungal primer pair EF4/fung5 (Smit et al. 1999) was used to demonstrate successful DNA extraction in samples, which tested negative for Phellodon species.

Primers specific for Phellodon niger

Primers specific for Phellodon confluens

2 13 3 3 1 5 12 12 þ 10 þ 1, 1 1

2 7 3 3 1 þ4 10 2 2 2

Figures indicate number of fruit body samples that tested positive (þ) or negative ().

All Phellodon samples bar two (Rynettin 1 and 2, Table 3) were assigned to species based on morphology. The unidentified samples had an unusual cobalt blue colour when young, and were referred to the P. niger complex. P. niger fruit body flesh produced a blue–green to brownish olive stain when KOH was added but this was variable, even between different samples of a single fruit body. The reaction of the samples assigned to the P. niger complex was within the same range. Hydnellum samples were all assigned to species using available morphology-based keys (Table 4), except those of putative H. scrobiculatum for which the collectors’ identifications were provisionally accepted but not confirmed. Samples assigned to H. scrobiculatum or H. concrescens had spores with one of two predominant morphological types: those with warts (1–1.3 mm high) with flattened and bifurcate apices were assigned to H. concrescens (e.g. Figs 1E–H, 4A–C); those with single apices, were assigned to H. cf. scrobiculatum. There was variation in the degree of wart bifurcation. Bifurcation was poorly developed in the Scottish samples of H. concrescens (Glen Einich 1, Figs 1E, 4C and Faskally 1). In the Scottish samples of H. cf. scrobiculatum sequenced, and from others not sequenced, spores had a less congested, smoother outline with less prominent ornamentation (e.g. Fig 4D), consisting predominantly of low rounded warts rather than ridges and multiple peaks. Furthermore, this group differed in having smaller spores than those of samples assigned to H. concrescens (Table 5). Fruit body tissue from 18 H. concrescens (including H6) and four putative H. scrobiculatum samples reacted similarly with KOH, producing a green stain of varying intensity in the solution. This was sometimes preceded by a purple flash of colour and was always slowly succeeded by a change to a more brownish shade.

Grouping of Phellodon samples based on ITS1 sequences Amplification of the ITS1 region resulted in fragments of approximately 300 bp and good quality sequence from 34 fruit body samples. The aligned data set for Phellodon consisted of 248 sites of which 92 were invariant (Supplementary Material Table 1). Within two of the currently recognised Phellodon species, P. confluens and P. niger, and between the two samples assigned to the P. niger complex, the pairwise similarities were >97 % (Supplementary Material Table 2). However, pairwise similarities within morphologically recognisable P. melaleucus were only >82 %. Five of the sequences within this species (PM1, PM2, PM7, PM8, and PM9) grouped with >97 % similarity and two of the remaining sequences (PM3 and PM6) were identical;

770

Table 3 – Phellodon sample details Fruit body sample code

Kew accession DNA Genbank numbera code accession number

Crockford Br. 1

K(M)137685

PC1

AM263396

Holidays Hill 1 Vinney Ridge A 12 Wormstall Wood 1a Hosey 5 Pembury 1 Pembury 8 Buttersteep 1

K(M)137684 K(M)137683 K(M)137682 K(M)137681 K(M)137680 K(M)137679 K(M)137678

PC2 PC3 PC4 PC5 PC6 PC7 PC8

Rapley 3 BB 1a Craigellachie 1 Craigellachie 2 Brock Hill Warwickslade 1 Knightwood 8a

K(M)137677 K(M)137676 K(M)137675 K(M)137674 K(M)137673

Speciesb

Vice county

Site details

Nat. grid ref.

Trees nearby

Date collected

Collector

New Forest, Crockford Br., marl pit

SZ 35 99 et al

Q

6 Sep. 2004

A.M.A.

S. Hants VC11 S. Hants VC11 S. Hants VC11 W. Kent VC16 W. Kent VC16 W. Kent VC16 Berks VC22

SU 261 074 SU 261 053 SZ 35 98 TQ 4566 5297 TQ 622 427 TQ 6198 4311 SU 911 665

Q Q, F Q Q, F C C C, P

16 Sep. 2004 22 Sep. 2004 21 Oct. 1999 15 Sep. 2004 15 Sep. 2004 9 Sep. 2004 16 Sep. 2004

A.L. A.M.A. A.M.A. A.M.A. A.M.A. J.P., J.W. A.M.A.

PC9 PC10 PC11 PC12 PM1

AM263394 AM263397 AM263359 AM263360 AM263412

P. P. P. P. P.

Berks VC22 Bucks VC24 Easterness VC96 Easterness VC96 S. Hants VC11

SU 882 652 SU 949 853 NH 8889 1234 NH 88 12 SU 272 056

A.M.A. P.C. A.M.A. J. & S.W. A.L.

PM2

AM263411

P. melaleucus

S. Hants VC11

SU 254 062

C Q, F B B Ps, Q, B, Pi Q, Ps

9 Oct. 2004 30 Oct. 2000 21 Sep. 2005 21 Sep. 2005 16 Sep. 2004

K(M)137672

22 Sep. 2004

A.M.A.

Knightwood 8b

K(M)137671

PM3

AM263361

P. melaleucus

S. Hants VC11

SU 254 062

Q, Ps

16 Sep. 2004

A.L.

Mark Ash 4b

X

PM4

AM263410

S. Hants VC11

SU 248 067

A.L.

K(M)137670 K(M)137669

PM5 PM6

AM263414 AM263362

SU 261 053 TQ 472 523

22 Sep. 2004 23 Oct. 2004

A.M.A. J.P.

Esher 1 Rapley 2 WGP 2 Knightwood 11 Knightwood 1

K(M)137668 K(M)137667 K(M)137666 X K(M)137665

PM7 PM8 PM9 PN1 PN2

AM263363 AM263413 AM263364 AM263405 AM263409

P. P. P. P. P.

Surrey VC17 Berks VC22 Berks VC22 S. Hants VC11 S. Hants VC11

TQ 137 625 SU 882 652 SU 966 695 SU 264 061 SU 249 067

F, C C C Q, F, Ps C, Q

30 Oct. 2004 9 Oct. 2004 11 Sep. 2005 12 Oct. 2004 22 Sep. 2004

A.M.A. A.M.A. A.M.A. A.M.A. A.M.A.

Mark Ash 3

K(M)137664

PN3

AM263408

P. niger

S. Hants VC11

New Forest, Vinney Ridge A, ditch bank Emmetts Lane, nr Ide Hill, Westerham, bank Esher Common, bank Windsor Forest, Rapley, trackside bank Windsor Great Park, Johnson’s Pond, mound New Forest, Knightwood East, ditch bank New Forest, Knightwood West A, ditch bank New Forest, Mark Ash, woodbank

Q, C, F, P Q, F F, P

16 Sep. 2004

Vinney Ridge A 13 Emmetts Lane 1

P. melaleucus (P. confluens) P. melaleucus P. melaleucus

New Forest, Holidays Hill, ditch bank New Forest, Vinney Ridge A, ditch bank New Forest, Wormstall Wood, marl pit Hosey Common, roadside bank Pembury Walks, roadside verge Pembury Walks water tank site, coppice Windsor Forest, Buttersteep Allotment, plantation ridge Windsor Forest, Rapley, trackside bank Burnham Beeches, roadside bank Craigellachie NNR, Aviemore, hillside Craigellachie NNR, Aviemore, hillside New Forest, Brock Hill, nr. Warwickslade, ditch bank New Forest, Knightwood West B, ditch bank New Forest, Knightwood West B, ditch bank New Forest, Mark Ash, woodbank

SU 248 067

22 Sep. 2004

A.M.A.

Mark Ash 6

K(M)137663

PN4

AM263400

P. niger

S. Hants VC11

New Forest, Mark Ash, woodbank

SU 248 067

22 Sep. 2004

A.M.A.

Pembury 6 Buttersteep 2 Buttersteep 3 Buttersteep 7 Rapley 4 Rapley 5 Rynettin 1

K(M)137662 K(M)137661 K(M)137660 K(M)137659 K(M)137658 K(M)137657 K(M)137656

PN5 PN6 PN7 PN8 PN9 PN10 PNC1

AM263406 AM263407 AM263403 AM263402 AM263401 AM263404 AM263366

P. niger P. niger P. niger P. niger P. niger P. niger P. niger complex

W. Kent VC16 Berks VC22 Berks VC22 Berks VC22 Berks VC22 Berks VC22 Easterness VC96

Pembury Walks water tank site, coppice Windsor Forest, Buttersteep Hill, hillside Windsor Forest, Buttersteep Hill, hillside Windsor Forest, Buttersteep Hill. hillside Windsor Forest, Rapley, ditch bank Windsor Forest, Rapley, ditch bank Abernethy Forest, Rynettin Track, trackside bank

TQ 6198 4311 SU 910 665 SU 910 665 SU 910 665 SU 883 655 SU 883 655 NJ 01 15

Q, C, F, P Q, C, F, P C C C C C C P

15 Sep. 2004 16 Sep. 2004 16 Sep. 2004 6 Oct. 2001 9 Oct. 2004 9 Oct. 2004 2000

A.M.A. A.M.A. A.M.A. A.M.A. A.M.A. A.M.A. G.D.

confluens confluens confluens confluens melaleucus

melaleucus melaleucus melaleucus niger niger

S. Hants VC11 W. Kent VC16

D. Parfitt et al.

S. Hants VC11

AM263395 AM263392 AM263391 AM263399 AM263390 AM263393 AM263398

Phellodon confluens P. confluens P. confluens P. confluens P. confluens P. confluens P. confluens P. confluens

S. Aberdeen VC92 AM263367 PT1 K(M)137654 Quoich 1

Trees: B, Betula sp.; C, Castanea sativa; F, Fagus sylvatica; P, Pinus sylvestris; Pi, Picea sp.; Ps, Pseudotsuga menziesii; Q, Quercus sp. Collectors: A.L., Alan Lucas; A.M.A., Martyn Ainsworth; E.H., Liz Holden; G.D., Gordon Dickson; J.P., Joyce Pitt; J. & S.W., John & Sheila Weir; J.W., Jo Weightman; P.C., Penny Cullington; S.T., Stewart Taylor. a X signifies specimens with no material to deposit (because all was used in sequencing). b Species identification based on fruit body characters assessed before DNA extraction with amendments following molecular analysis shown in brackets.

E.H. P NO 118 911

21 Sep. 1997

P K(M)137655 Rynettin 2

PNC2

AM263365

P. niger complex P. tomentosus

Easterness VC96

Abernethy Forest, Rynettin Track, trackside bank Quoich Bridge, Mar Lodge Estate

NJ 016 157

xx xx 2004

S.T.

Discrimination of stipitate hydnoids

771

however, PM5 was clearly divergent from all the other P. melaleucus sequences. PM4 (Mark Ash 4b) was originally identified as P. melaleucus but this sequence was > 99 % similar to P. confluens sequences, strongly suggesting mis-identification from morphological data. Unfortunately the dried material was consumed in the production of sequence PM4 and so could not be morphologically re-investigated. Therefore the identification was corrected on the basis of the molecular data alone. P. confluens and P. niger sequences were clearly separated into distinct groups with strong branch support (100 % and 99 %, respectively) (Fig 5A). There was also strong branch support (87 %) for separating PC7 from the other P. confluens sequences. Two P. confluens sequences, PC9 and PC2, were grouped separately albeit with moderate BS support. The two P. niger complex sequences PNC2 and PNC1 also formed a separate group from the P. niger sequences (branch support 91 %). However, P. melaleucus was more complex. Five sequences formed a clear group with 98 % branch support. However, the remaining three P. melaleucus sequences were more divergent as mentioned above. The sequence from the single P. tomentosus sample grouped most closely with P. melaleucus sequences from PM3 and PM6, although the BS support for this was poor.

Grouping of Hydnellum samples based on ITS1 sequences ITS1 amplified fragments were approximately 300 bp, with good quality sequences from 33 fruit body samples. Four sequences from Bridge & Panchal (2004) were also included in the analysis. Of the 269 sites in the Hydnellum alignment only 17 were invariant across all the sequences, although 78 % of sites were invariant across two thirds or more of the sequences (Supplementary Material Table 3). Sequences within H. peckii, H.caeruleum and H. ferrugineum were identical. However, the pairwise similarities within H. concrescens, and H. cf. scrobiculatum revealed more divergence (Supplementary Material Table 4). Nine of the 20 H. concrescens sequences were >97 % similar to each other, and a further eight were >95 % similar. However, three of the sequences (HC1, HC2, and HC8) were more divergent, although HC1 and HC8 were identical to each other. Within H. cf. scrobiculatum there were two groups and a singleton, one group (comprising H67, HS1, and HS3) having identical sequences, whereas the remaining three sequences (HS6, HS8, and HS9) were divergent from all other sequences. Three of the sequences (HS7, HS10, and HA1) provided strong evidence for mis-identification of the samples (see above). The H. peckii and the H.caeruleum sequences formed distinct groups with 99 % and 95 % branch support, respectively (Fig 5B). The H. ferrugineum sequences also formed a distinct group although branch support was considerably lower (75 %), and the BS support for differentiating H. spongiosipes from the H. ferrugineum sequences was even lower (69 %). The majority (18 out of 20) of the H. concrescens sequences, including those from Bridge & Panchal (2004), formed a group with a branch support of 97 %. Although there was some further structuring within this group, branch lengths had poor BS support. Two H. concrescens sequences (HC1 and HC8) were identical and separated from the main group with strong BS support (99 %). Three (of six) H. cf. scrobiculatum sequences, including

772

Table 4 – Hydnellum sample details Fruit body sample code

Kew accession DNA Genbank numbera codeb accession number

Slugan 3

K(M)139307

HA1

AM263347

Rynettin 3

K(M)139308

HCA1

Crockford Br. 3 King’s Hat 1 Mark Ash 5 Mark Ash 7 Site C Site D Stubbs 1

K(M)139309 K(M)139310 K(M)139311 X

Speciesc

Vice county

Site details

Nat. grid ref.

Trees nearby

Date collected

Collector

Glenmore Forest Park, trackside

NH 95 10

P

24 Aug. 2005

A.M.A.

Easterness VC96

NJ 0173 1440

P

25 Aug. 2005

A.M.A.

X

HC1 HC2 HC3 HC4 H25b H26b HC7

AM263377 AM263381 AM263384 AM263380 AM263388 AM263389 AM263386

H. H. H. H. H. H. H.

S. Hants S. Hants S. Hants S. Hants S. Hants S. Hants S. Hants

SZ 35 99 et al. SU 390 055 SU 248 067 SU 248 067 SU 269 081 SU 269 081 SU 36 02/3

Q Q Q, C, F, P Q, C, F, P Q Q Q, F

6 Sep. 2004 18 Oct. 1998 22 Sep. 2004 22 Sep. 2004 2001 2001 12 Oct. 2004

A.M.A. A.M.A. A.M.A. A.M.A. N.E. N.E. A.M.A.

Vinney Ridge A 11 Perry Wood 2

K(M)139312 K(M)139313

HC8 HC9

AM263376 AM263349

H. concrescens H. concrescens

S. Hants VC11 E. Kent VC15

SU 261 053 TR 04 55

Q, F C

22 Sep. 2004 18 Oct. 2004

A.M.A. J.P.

Church Wood 1 Pembury 2 Pembury 5 Pembury 7 Clockcase 6

K(M)139314 K(M)139315 K(M)139316 K(M)139317

HC10 HC11 HC12 HC13 H6b

AM263383 AM263351 AM263378 AM263382 AM263387

H. H. H. H. H.

concrescens concrescens concrescens concrescens concrescens

E. Kent VC15 W. Kent VC16 W. Kent VC16 W. Kent VC16 Surrey VC17

TR 10 59 et al. TQ 6198 4311 TQ 6198 4311 TQ 61 43 et al. SU 984 687

C C C C C

10 Sep. 2004 15 Sep. 2004 15 Sep. 2004 9 Sep. 2004 28 Oct. 2001

J.P., J.W. A.M.A. A.M.A. J.P., J.W. A.M.A.

Buttersteep 9 Buttersteep 10 Buttersteep 11 Buttersteep 15 Faskally 1 Glen Einich 1 Loch an Eilein 2

K(M)139318 K(M)139319 X K(M)139320 K(M)139321 K(M)139322 K(M)139339

HC15 HC16 HC17 HC19 HC20 HC21 HF1

AM263385 AM263350 AM263379 AM263369 AM263368 AM263375 AM263354

H. H. H. H. H. H. H.

concrescens concrescens concrescens concrescens concrescens concrescens ferrugineum

Berks VC22 Berks VC22 Berks VC22 Berks VC22 E. Perth VC89 Easterness VC96 Easterness VC96

SU 910 665 SU 910 665 SU 910 665 SU 910 665 NN 9 5 NH 9179 0798 NH 901 078

C C C C ? P P

3 Sep. 1996 4 Nov. 2000 4 Nov. 2000 2 Sep. 2005 23 Aug. 2005 17 Sep. 2004 22 Aug. 2005

A.M.A. A.M.A. A.M.A. A.M.A. J.D. E.H. A.M.A.

Loch an Eilein 3

K(M)139340

HF2

AM263352

H. ferrugineum

Easterness VC96

NH9028 0782

P

22 Aug. 2005

A.M.A.

Loch an Eilein 5

K(M)139341

HF3

AM263353

H. ferrugineum

Easterness VC96

NH 9030 0795

P

22 Aug. 2005

D.J.

Slugan 2 Lairig Ghru 1

K(M)139343 K(M)139349

HP1 HP2

AM263356 AM263355

H. peckii H. peckii

Easterness VC96 Easterness VC96

NH 9522 1132 NH 9167 1042

P P

20 Aug. 2005 24 Aug. 2005

A.M.A. A.M.A.

Loch an Eilein 4 GCD0105

K(M)139342 K(M)139344

HP3 HS1

AM263357 AM263372

Easterness VC96 Easterness VC96

NH 8953 0720 ?

P P

22 Aug. 2005 3 Sep. 2001

D.J. G.D.

GCD2014

X

HS3

AM263416

NJ 014 181

P

30 Aug. 2000

G.D.

H67b

AM263370

H. peckii H. scrobiculatum (cf. scrobiculatum) H. scrobiculatum (cf. scrobiculatum) H. scrobiculatum (cf. scrobiculatum)

Abernethy Forest, nr Rynettin, trackside bank New Forest, Crockford Br., marl pit New Forest, King’s Hat Incl., woodbank New Forest, Mark Ash, woodbank New Forest, Mark Ash, woodbank New Forest, Millyford Green, bank New Forest, Millyford Green, bank New Forest, Stubbs & Frame Woods, pathsides New Forest, Vinney Ridge A, ditch bank Perry Wood, nr Selling, Faversham, woodbank Church Wood, Blean, bank Pembury Walks water tank site, coppice Pembury Walks water tank site, coppice Pembury Walks, coppice Windsor Forest, Virginia Water, Clockcase, bank Windsor Forest, Buttersteep Hill, hillside Windsor Forest, Buttersteep Hill, hillside Windsor Forest, Buttersteep Hill, hillside Windsor Forest, Buttersteep Hill, hillside Faskally, nr Pitlochry Rothiemurchus Estate, Lr. Glen Einich, Rothiemurchus Estate, Loch an Eilein, moraine Rothiemurchus Estate, Loch an Eilein, moraine Rothiemurchus Estate, Loch an Eilein, moraine Glenmore Forest Park, trackside bank Rothiemurchus Estate, N. approach to Lairig Ghru, riverbank Rothiemurchus Estate, Loch an Eilein Abernethy Forest, Compt 16

NJ 024 160

P

2001 or 2002

E.H.

H67

concrescens concrescens concrescens concrescens concrescens concrescens concrescens

VC11 VC11 VC11 VC11 VC11 VC11 VC11

Easterness VC96 Easterness VC96

Abernethy Forest, Dell Track, trackside quarry Abernethy Forest, Forest Lodge area

D. Parfitt et al.

Easterness VC96

AM263348

Hydnellum aurantiacum (H. caeruleum) H. caeruleum

A.M.A.

Specificity of new primers for Phellodon niger and P. confluens

Trees: C Castanea sativa, F Fagus sylvatica, Q Quercus sp., P Pinus sylvestris. Collectors:A.M.A., Martyn Ainsworth; DJ, David Jardine; EH, Liz Holden; GD, Gordon Dickson; JD, Jacqui Darby; J.P., Joyce Pitt; J.W., Jo Weightman; NE, Naomi Ewald. a X signifies specimens with no material to deposit (because all was used in sequencing). b Not sequenced in this study; sequences taken from Bridge & Panchal (2004). c Species identification based on spore and fruit body characters assessed before DNA extraction with amendments following molecular analysis shown in brackets.

C SU 910 665 Berks VC22 AM263358 K(M)139350 Buttersteep 14

HSP1

AM263415 K(M)139348 Loch an Eilein 1

HS10

AM263371 K(M)139347 GCD0102

HS9

AM263373 K(M)139346 GCD0108

HS8

AM263417 HS7 K(M)139345 GCD2025

773

one from Bridge & Panchal (2004), formed a distinct group with 98 % BS support, whereas the other sequences (HS6, HS8 and HS9) did not group closely with any of the others.

2 Sep. 2005

E.H. 2 Oct. 2004 P NH 8993 0824

Rothiemurchus Estate, Loch an Eilein, moraine Windsor Forest, Buttersteep Hill, hillside Easterness VC96

G.D. P NJ 017 156

2 Sep. 2001

G.D. 6 Sep. 2001 P NH 97 17

Abernethy Forest, Loch Garten area, Compt 13 Abernethy Forest, Rynettin Track Easterness VC96

Easterness VC96

Easterness VC96

G.D. P NH 953 188

5 Sep. 2000

P X GCD2005

HS6

AM263374

H. scrobiculatum (cf. scrobiculatum) H. scrobiculatum (cf. scrobiculatum þ H. peckii) H. scrobiculatum (cf. scrobiculatum) H. scrobiculatum (cf. scrobiculatum) H. scrobiculatum (H. peckii) H. spongiosipes

Easterness VC96

Abernethy Forest, Garten Wood, disused quarry Abernethy Forest, Garten Wood, disused quarry

NH 953 188

Aug. 2000

G.D.

Discrimination of stipitate hydnoids

All DNA extracts from Hydnellum species tested were negative with the specific primers designed for both Phellodon niger (Pnig) and P. confluens (Pcon), indicating that the primers are specific for the Phellodon genus based on the samples tested. P. confluens primers were entirely specific for P. confluens when tested against a total of 36 stipitate hydnoid samples (Table 2). All controls were PCR positive with the general fungal primers EF4/FUNG5. Primers designed to be specific for P. niger were negative for all samples except the ten P. niger samples tested and one sample assigned to the P. niger complex. Again all controls were PCR positive with the general fungal primers EF4/FUNG5. Thus, the P niger primers are able to differentiate between P. niger samples and the three other Phellodon species tested.

Discussion Overall there was good congruence between molecular and morphological clustering of Phellodon and Hydnellum samples, despite the limited length of the ITS1 region. Although there were more ITS1 terminal clusters than currently recognised British species, each terminal cluster contained samples from a single morphologically recognisable taxon, albeit with indications that four samples were initially incorrectly or incompletely identified. This suggests the possibility of cryptic speciation. Cryptic speciation is not uncommon in fungi, including basidiomycetes, e.g. Serpula himantioides, and the Pleurotus ostreatus and Heterobasidion annosum complexes (Vilgalys & Sun 1994; Johannesson & Stenlid 2003; Nilsson et al. 2003; Kauserud et al. 2006). It would be interesting in the context of a more extended study, focussing specifically on the phylogenetics of these species, to see if the addition of more sequence data confirms the clusters identified here within some of the morphological taxa. Unfortunately, only limited numbers of sequences for the species of interest here, covering the ITS1 region, are available from the databases. However, the nine sequences present (six Hydnellum, and three Phellodon) were compared with sequences presented here (data not shown) and most showed good agreement with our data. Of the six Hydnellum sequences, five (two H. peckii, AY569030, DQ367901; one H. caeruleum, AY569023; one H. ferrugineum, AY569028; one H. spongiosipes, AY569021) grouped with other sequences from the same species in our NJ tree, while one (H. scrobiculatum, AY569032) was divergent and grouped with H. concrescens sequences. Of the three Phellodon sequences, two (one P. niger, AJ783971; one P. melaleucus, AY228355) also grouped with their cognate species on the NJ tree, whereas a further P. niger sequence (DQ099899) was divergent and did not group with any of the other sequences. Because of the difficulties in identification of these taxa, and in the absence of the fruit body material to check identities, little weight should be attached to these anomalies at this stage.

774

D. Parfitt et al.

Table 5 – Mature spore size ranges (measured in water and including ornamentation but excluding apiculus) from samples initially assigned to Hydnellum concrescens and H. scrobiculatum Fruit body sample code or literature sourcea Crockford Br. 3 King’s Hat 1 Mark Ash 5 Mark Ash 7 Stubbs 1 Vinney Ridge A 11 Perry Wood 2 Church Wood 1 Pembury 2 Pembury 5 Pembury 7 Clockcase 6 Buttersteep 9 Buttersteep 10 Buttersteep 11 Buttersteep 15 Faskally 1 Glen Einich 1 GCD0105 GCD2014 GCD2005 GCD0108 GCD0108b GCD0102 Maas Geesteranus (1975) Phillips (2006) Breitenbach & Kra¨nzlin (1986)c Stalpers (1993) Hansen & Knudsen (1997) Pegler et al. (1997)d Dickson (2000) Arnolds (2003) Arnolds (2003) key

DNA code HC1 HC2 HC3 HC4 HC7 HC8 HC9 HC10 HC11 HC12 HC13 H6 HC15 HC16 HC17 HC19 HC20 HC21 HS1 HS3 HS6 HS8

Hydnellum concrescens (mm)

Hydnellum scrobiculatum (mm)

4.5–6  4–4.5 4.5–6  4–5 4.5–5.5  3.5–5 4.5–5.5  4–5 4–6  3.5–4.5 4.5–6  4–5 4–5.5  4–5 4.5–5.5  4–5 4.5–5.5  3.5–5 5–6  4.5–5 4.5–6  3.5–5 4.5–5.5  4–5 No spore deposit 4.5–5  4–5 4.5–5  4–5 4.5–6  4–5 3.5–5  3.5–5 4–5.5  4–5

HS9 5.5–6.1  (3.5–)4–4.5 5.5–6  4–4.5 4.5–6  3.5–4.5 4.5–6(–6.5)  3.5–4.5(–5) 4.5–6  4–4.5 4.5–5.5  3–3.5 4.5–5.5  3–3.5 4.5–6  3.5–4.5

3.5–5  3–4.5 4–5  3–4.5 3.5–5  3–4.5 3.5–4.5  3–4.5 3.5–4.5 diam 3.5–5  3.5–4 5.5–7  4.5–5 5.5–7  4.5–5 5.5–6.5  4.5–5.5 (4.5–)5–7  4–5(–6) 5.5–7  4.5–5 5–6.5  4–5.5 5–6.5  4–5 5–6.5  4.5–5.5 5.5–7  4.5–5

Values from literature sources are shown for comparison. a See Table 4. b Previous measurements supplied by G. Dickson (pers. comm., 27 Oct. 2001). c Spore measurements exclude ornamentation. d Spore measurements include ornamentation (B. Spooner, pers. comm., 25 Jan. 2006).

Phellodon The strong pairwise similarities within Phellodon confluens and P. niger, and within the samples assigned to the P. niger complex, indicate that the region sequenced defines these as species in accordance with other studies (Tedersoo et al. 2003; O’Brien et al. 2005). P. niger was represented by a single ITS1 cluster derived from three English counties from woodland with Fagaceae dominating or present in close proximity to plantation conifers. Interestingly, these samples were distinct from those temporarily classified as belonging to the P. niger complex. It would be useful to sequence further material referable to P. niger s. str. and the P. niger complex from Scottish conifer woodland to see whether further clusters emerge. In the meantime, in the absence of any authentic P. atratus sequence data (preferably including sequenced type material), and considering its variously interpreted stipe tissue types and KOH response, the application of the name P. atratus to British material remains unconfirmed.

The remaining samples identified on morphological criteria as P. melaleucus were from England and dispersed among two ITS1 clusters and one singleton, each of which had at least one representative collected from the New Forest (VC11). The largest cluster was derived from three counties and from sites with Fagaceae dominating or present in close proximity to plantation conifers. The smaller cluster and singleton comprised three samples in total, one of which (Knightwood 8b; PM3) was collected from a fruiting patch adjacent to that used to provide another sample (Knightwood 8a; PM2) whose ITS1 sequence clustered within the main group of P. melaleucus. Further sampling of morphologically recognisable P. melaleucus is required, including samples from Scottish conifer woodland, to investigate the range of diversity within these and possibly other ITS1 clusters. Such clusters might represent cryptic biological species and with sufficient supporting character differences might become formally recognised, however, their taxonomic status is less clear if ITS1 sequences provide the only distinguishing character. The elucidation of stipitate hydnoid breeding systems would be very helpful in this regard but

Discrimination of stipitate hydnoids

has been hindered by the failure to obtain single sporederived cultures and hence of routine mating tests. The single sample of P. tomentosus grouped near the more variable P. melaleucus sequences, but further isolates of P. tomentosus would be needed to determine its position within the phylogeny.

Hydnellum Within Hydnellum, the main focus of this study was to distinguish between H. concrescens and H. scrobiculatum. This species pair is steeped in identification difficulties, historic and ongoing shifts in taxonomic opinion, and nomenclatural confusion. This has undermined confidence in the interpretation of past and current records and raised doubts about the true distribution of these fungi in England and Scotland (Marren 2000; Newton et al. 2002a). In turn, this has engendered some uncertainties in the relevant species status assessments, which are essential components of the ongoing reviews of the UK BAP and British fungal red data lists. The morphologically recognisable H. concrescens group comprised samples from five English vice counties and included sample H6 previously used by Bridge & Panchal (2004). The fruit bodies were mainly from Quercus and Castanea woods, although Pinus plantations could be nearby. Two members of the group were collected from Scottish vice counties (VC89 and 96), one of which (Glen Einich 1) was from an area of native Pinus. The ITS1 clustering produced a similar result, differing in that two sequences (HC1 and HC8) formed a separate cluster that diverged substantially without any apparent corresponding morphological differences. The divergent pair were not geographically isolated but obtained from the New Forest, similar to several samples from the main group, such as H25 and H26 previously used by Bridge & Panchal (2004). Possibly this represents a biologically distinct grouping that might become taxonomically recognised after further study. Interestingly, the main morphologically recognisable group of H. concrescens also included two samples (Buttersteep 10 and 11) from the group of fruit bodies identified as H. scrobiculatum in the BMS ‘Fungus 2000’ event (http://194.203.77.76/fieldmycology/Pictures/pics.asp?intPicNum ¼ 169). The derived ITS1 sequences (HC16 and HC17) also clustered within the main grouping of H. concrescens. One of these samples (Buttersteep 10) was also tested with KOH and the results were indistinguishable from those of the main group. Hence, on spore morphology and ITS1 clustering, the ‘Fungus 2000’ samples are re-determined as H. concrescens. The remaining putative H. scrobiculatum samples formed the second group recognised on the basis of spore morphology. The spores had many single-peaked spore wart apices but a less prominent and more rounded ornament than shown for the neotype of H. scrobiculatum (Maas Geesteranus 1975). Furthermore, even when the ornament was included in the measurement, the spores were consistently slightly smaller than those of the H. concrescens group and of literature references to that species (Table 5). According to the literature, H. scrobiculatum has slightly larger spores than H. concrescens. Therefore, these groups seem to be morphologically distinct,

775

but further research is required to test whether this degree of variation can be accommodated within H. scrobiculatum as understood by Maas Geesteranus (1975). It would be useful to compare the current results with the corresponding neotype sequences and with those of modern representative collections of H. scrobiculatum from elsewhere in Europe. The ITS1 sequences of the H. scrobiculatum group seemed to be relatively variable and several divergent clusters resulted. Indeed, in this region of the genome there is much greater diversity amongst this group than amongst samples from any other Hydnellum species analysed. The group may therefore comprise several divergent biological units and work on their breeding system(s) is needed to evaluate their significance. Further molecular work is also required, using additional sequences, to test whether this morphologically recognisable taxon is restricted to areas with Caledonian Pinus woodland.

Specific primers Species specific primers for P. confluens, and primers that could discriminate between P. niger and almost all of the other samples, were successfully designed and tested. An attempt was also made to design primers specific for P. melaleucus, however, due to the greater diversity within this group this was not possible. Clearly species-specific primers would be of value for the rapid typing of samples, especially where the material is in a poor condition and thus morphological analysis is compromised. Further sequence data from the ITS region or from other regions of the genome might be useful for designing species specific primers to differentiate between all the Hydnellum and Phellodon species. However, the greater diversity within some groups may reflect distinct genetic groupings and primers might be more appropriately and easily designed to differentiate between these subgroups.

Conclusions Discrimination of stipitate hydnoid taxa on morphological criteria is fraught with difficulties. For example, identification of old wet Phellodon fruit bodies in cold weather at the end of the season demands considerable care and experience, because developmental differences are blurred by rain and cessation of marginal extension. Preliminary indications are that most of these difficulties could be overcome by adopting an integrated morphological and molecular taxonomic approach. There are also difficulties in recognition of Hydnellum taxa using morphological criteria, particularly within the H. concrescens/scrobiculatum complex. One priority is to investigate the relationship of the Abernethy Forest H. cf. scrobiculatum group(s) to authentic H. scrobiculatum, and to authenticate the material identified as H. scrobiculatum using the KOH test advocated by Pegler et al. (1997). KOH, as used in the present study, was found to be an unsatisfactory and unreliable discriminator of taxa. The specific primers designed and tested in this study are recommended as a valuable tool to help in the re-assessment of Phellodon determinations in the national collections of dried reference materials in Kew and Edinburgh. Furthermore, it is

776

recommended that all material in the national reference collections currently labelled H. concrescens and H. scrobiculatum should be investigated by sequencing and/or PCR amplification with specific primers and comparisons made with putatively conspecific material from continental Europe. The synthesis of molecular and morphological approaches would help to provide a more solid basis on which to determine their current and historical distributions, population trends, and conservation status with regard to the UK BAP and British red list.

Acknowledgements Thanks to Penny Cullington, Jacqui Darby, Gordon Dickson, Ern Emmett, Naomi Ewald, Ted Green, John Holden, Liz Holden, David Jardine, Alan Lucas, Joyce Pitt, Stewart Taylor, Jo Weightman, and John and Sheila Weir for locating and/or collecting fruit bodies; to Liz Holden for providing images of fruit body samples Loch an Eilein 1 and Glen Einich 1 (all other images by A.M.A.); to Gordon Dickson for much helpful discussion and correspondence; to all who supplied GPS data; to the Mycology Section of the Royal Botanic Gardens, Kew, for access to their library and herbaria; to Catherine Eyre for extracting DNA and sequencing HC16; to Mike Bruford for help with interpretation and use of Mega software; and to English Nature, Plantlife International, and Cardiff School of Biosciences for funding.

Appendix Supplementary material Supplementary data associated with this article can be found, in the online version, at 10.1016/j.mycres.2007.05.003

references

Ainsworth AM, 2004. BAP fungi handbook. English Nature Research Reports 600: 1–115. Anon, 1998. UK Biodiversity Group Tranche 2 Action Plans. In: Plants and Fungi, vol. III. English Nature, Peterborough. Arnolds E, 1989. Former and present distribution of stipitate hydnaceous fungi (basidiomycetes) in The Netherlands. Nova Hedwigia 48: 107–142. Arnolds E, 2003. Stekelzwammen en Pruikzwammen van Nederland en Belgie¨. Coolia 46 (Suppl.): 1–96. Baird RE, 1986a. Study of the stipitate hydnums from the Southern Appalachian Mountains d genera: Bankera, Hydnellum, Phellodon, Sarcodon. Bibliotheca Mycologica 104: 1–156. Baird RE, 1986b. Type studies of North American and other related taxa of stipitate hydnums: genera Bankera, Hydnellum, Phellodon, Sarcodon. Bibliotheca Mycologica 103: 1–89. Bessette AE, Miller OK, Bessette AR, Miller HH, 1995. Mushrooms of North America in Color: a field guide companion to seldom– illustrated fungi. Syracuse University Press, Syracuse. Binder M, Hibbett DS, Larsson K-H, Larsson E, Langer E, Langer G, 2005. The phylogenetic distribution of resupinate forms across the major clades of mushroom-forming fungi (Homobasidiomycetes). Systematics and Biodiversity 3: 113–157.

D. Parfitt et al.

Breitenbach J, Kra¨nzlin F, 1986. Fungi of Switzerland, Vol. 2, Verlag Mykologia, Lucerne. Bridge PD, Panchal G, 2004. Population diversity and speciation in Hydnellum and Phellodon species. English Nature Research Reports 557: 1–44. Burke DJ, Kendall JM, Rygiewicz PT, Topa MA, 2005. Ectomycorrhizal fungi identification in single and pooled root samples: terminal restriction fragment length polymorphism (TRFLP) and morphotyping compared. Soil Biology and Biochemistry 37: 1683–1694. Castellano MA, Ca´zares E, Fondrick B, Dreisbach T, 2003. Handbook to Additional Fungal Species of Special Concern in the Northwest Forest Plan, General Technical Report PNW-GTR-572. US Department of Agriculture Forest Service, Portland. Dickson G, 2000. A field key to British non-resupinate hydnoid fungi. Field Mycology 1: 99–104. Ewald N, 2000. Survey of the New Forest for Stipitate Hydnoid Fungi. Hampshire and Isle of Wight Wildlife Trust, Eastleigh. Ewald N, 2002. Stipitate Hydnoid Fungi in the New Forest 1999–2001. Hampshire and Isle of Wight Wildlife Trust, Eastleigh. Fraiture A, Walleyn R, 2005. Distributiones fungorum Belgii et Luxemburgi. Fasc. 3. Scripta Botanica Belgica 38: 1–79. Ga¨rdenfors U (ed.), 2005. Ro¨dlistade arter i Sverige 2005. Swedish Species Information Centre, Uppsala. Gardes M, Bruns TD, 1993. ITS primers with enhanced specificity for basidiomycetes: application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118. Green EE, 2001. Survey of Stipitate Hydnoid Fungi in Berkshire. English Nature, Peterborough. Hall TA, 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. Hall D, Stuntz DE, 1971. Pileate Hydnaceae of the Puget Sound area: I. White-spored genera: Auriscalpium, Hericium, Dentinum and Phellodon. Mycologia 63: 1099–1128. Hansen L, Knudsen H, 1997. Nordic Macromycetes, Vol. 3, Nordsvamp, Copenhagen. Harrison KA, 1964. New or little known North American stipitate hydnums. Canadian Journal of Botany 42: 1205–1233. Horton TR, Bruns TD, 2001. The molecular revolution in ectomycorrhizal ecology: peeking into the black-box. Molecular Ecology 10: 1855–1871. Hrouda P, 1999. Hydnaceous fungi of the Czech Republic and Slovakia. Czech Mycology 51: 99–155. Ing B, 1992. A provisional red data list of British fungi. Mycologist 6: 124–128. Johannesson H, Stenlid J, 2003. Molecular markers reveal genetic isolation and phylogeography of the S and F intersterility groups of the wood-decay fungus Heterobasidion annosum. Molecular Phylogenetics and Evolution 29: 94–101. Kauserud H, Stensrud Ø, Decock C, Shalchian-Tabrizi K, Schumacher T, 2006. Multiple gene genealogies and AFLPs suggest cryptic speciation and long-distance dispersal in the basidiomycetes Serpula himantioides (Boletales). Molecular Ecology 15: 421–431. Kumar S, Tamura K, Nei M, 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics 5: 150–163. Maas Geesteranus RA, 1975. Die Terrestrischen Stachelpilze Europas (The terrestrial hydnums of Europe). North-Holland Publishing, Amsterdam. Marren P, 2000. Stipitate hydnoid fungi in England. English Nature Research Reports 420: 1–51. Marren P, 2002. Stipitate hydnoid fungi in England. Field Mycology 3: 120–123. Marren P, Dickson G, 2000. British tooth-fungi and their conservation. British Wildlife 11: 401–409. Mugnier J, 1994. PCR Catalogue: Fungi. Rhoˆne-Poulenc Agro, Lyon.

Discrimination of stipitate hydnoids

Newton AC, Holden E, Davy LM, Ward SD, Fleming LV, Watling R, 2002a. Status and distribution of stipitate hydnoid fungi in Scottish coniferous forests. Biological Conservation 107: 181–192. Newton AC, Watling R, Davy LM, Holden E, Ward SD, 2002b. Progress towards implementing the Biodiversity Action Plan for stipitate hydnoid fungi in Scotland. Botanical Journal of Scotland 54: 89–110. Nilsson RH, Hallenberg N, Norde´n B, Maekawa N, Wu S-H, 2003. Phylogeography of Hyphoderma setigerum (Basidiomycota) in the Northern Hemisphere. Mycological Research 107: 645–652. O’Brien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R, 2005. Fungal community analysis by large-scale sequencing of environmental samples. Applied and Environmental Microbiology 71: 5544–5550. Parfitt D, Hynes J, Rogers HJ, Boddy L, 2005. Polymerase chain reaction (PCR) assay detects rare tooth fungi in wood where traditional approaches fail. Mycological Research 109: 1187–1194. Pegler DN, Roberts PJ, Spooner BM, 1997. British Chanterelles and Tooth Fungi. Royal Botanic Gardens, Kew. Phillips R, 2006. Mushrooms. Macmillan, London. Smit E, Leeflang P, Glandorf B, van Elsas JD, Wernars K, 1999. Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis. Applied and Environmental Microbiology 65: 2614–2621.

777

Stalpers JA, 1993. The aphyllophoraceous fungi I. Keys to the species of the Thelephorales. Studies in Mycology 35: 1–168. Tedersoo L, Ko˜ljalg U, Hallenberg N, Larsson K-H, 2003. Fine scale distribution of ectomycorrhizal fungi and roots across substrate layers including coarse woody debris in a mixed forest. New Phytologist 159: 153–165. Turner J, 2002. Stipitate hydnoid fungi in Wales. Plantlife Report 208: 1–18. Vesterholt J, Asman WAH, Christensen M, 2000. Kvælstofnedfald og tilbagegang for svampe pa˚ mager bund. Svampe 42: 53–60. Vilgalys R, Sun BL, 1994. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences. Proceedings of the National Academy of Sciences, USA 91: 4599–4603. Watling R, Milne J, 2005. Scottish Sarcodon imbricatus under scrutiny. Botanical Journal of Scotland 56: 175–181. White TJ, Bruns TD, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal DNA genes for phylogenetics. In: Innis MA, Sninsky DH, White TJ (eds), PCR Protocols: methods and applications. Academic Press, San Diego, pp. 315–322. Wurzburger N, Bidartondo MI, Bledsoe CS, 2001. Characterization of Pinus ectomycorrhizas from mixed conifer and pygmy forests using morphotyping and molecular methods. Canadian Journal of Botany 79: 1211–1216.