- Email: [email protected]
Molecular basis of 1-methylcyclopropene regulating organic acid metabolism in apple fruit during storage
Postharvest Biology and Technology 117 (2016) 57–63
Contents lists available at ScienceDirect
Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio
Molecular basis of 1-methylcyclopropene regulating organic acid metabolism in apple fruit during storage Ruiling Liua,b , Yuying Wanga , Guozheng Qina , Shiping Tiana,b,* a b
Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China University of Chinese Academy of Sciences, Beijing 100049, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 6 October 2015 Received in revised form 30 January 2016 Accepted 1 February 2016 Available online xxx
Organic acids play a critical role in flavor and overall organoleptic quality of fruit. Malate has been considered to be the major organic acid determining apple fruit acidity. Here, we found that 1-methylcyclopropene (1-MCP) delayed the loss of malate and citrate during storage. 1-MCP-treated fruit showed higher level of phosphoenol pyruvate carboxylase (PEPC) and cytosolic NAD-dependent malate dehydrogenase (cyNAD-MDH) activities, but lower or similar phosphoenolpyruvate carboxylase kinase (PEPCK) and cytosolic NAD-dependent malate dehydrogenase (cyNADP-ME) activities compared to the control. Moreover, the expression of acid transport genes, including MdVHA-A,MdVHP and Ma1, was upregulated in 1-MCP-treated fruit, resulting in retention of malate in the vacuole, and eventual higher malate content. Hence, 1-MCP maintained fruit acidity by regulating the balance between malate biosynthesis and degradation. These findings provide molecular evidence for understanding the mode of action of 1-MCP regulating organic acid metabolism in apple fruit during storage. ã 2016 Elsevier B.V. All rights reserved.
Keywords: 1-MCP Organic acid metabolism Molecular basis Apple fruit Postharvest storage
1. Introduction Fruit acidity greatly affects the taste and organoleptic quality, in combination with sugars and flavor volatiles. The predominant organic acid in ripe fruit varies among species: citric acid is dominant in citrus (Sadka et al., 2000) and mango (Gil et al., 2000); while malic acid is dominant in pome fruits, such as peach (Moing et al., 1998), pear (Chen et al., 2007), and loquat (Chen et al., 2009). In apple fruit, the major organic acid is malic acid, accounting for 80–90% of the total organic acids (Yamaki, 1984). The salts and esters of malic acid are known as malate, which is the main form of malic acid in many flesh fruit (Yao et al., 2011). Malate plays an important role in plant physiology. It has been proposed as an intermediate of the tricarboxylic acid (TCA) cycle, an essential storage carbon molecule, and a pH regulator (Fernie and Martinoia, 2009). The final malate content of fruit is generally determined by the net balance of acid synthesis, degradation, and compartmentation (Laval-Martin et al., 1977; Yamaki, 1984). Malate biosynthesis occurs primarily in the cytosol and is catalyzed by phosphoenolpyruvate carboxylase (PEPC, EC 4.1.1.31) and NAD-dependent
* Corresponding author at: Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China. Fax: +86 10 82594675. E-mail address: [email protected] (S. Tian). http://dx.doi.org/10.1016/j.postharvbio.2016.02.001 0925-5214/ ã 2016 Elsevier B.V. All rights reserved.
malate dehydrogenase (cyNAD-MDH, EC 1.1.1.37) (Miller et al., 1998; Moing et al., 2000). The rapid decrease in malate content during fruit ripening has usually been attributed to its degradation by cytosolic NADP-dependent malic enzyme (cyNADP-ME, EC 1.1.1.40) (Berüter, 2004; Chen et al., 2009). In addition, malate serves as a substrate for gluconeogenesis, and phosphoenolpyruvate carboxylase kinase (PEPCK, EC 4.1.1.49) play crucial roles in the process (Sweetman et al., 2009). The malate content increases as fruit develops and the excess malate is compartmentalized in the vacuole (Etienne et al., 2013) and vacuolar transporters play critical roles in determining fruit acidity as they can regulate the malate transport into and out of the vacuole (Sweetman et al., 2009). In Arabidopsis, the transport of malate between vacuole and cytoplasm is mediated by AtTDT, a tonoplast-localized malate transporter (Emmerlich et al., 2003) and AtALMT9, a tonoplast-localized malate channel (Kovermann et al., 2007). Recent advances suggested that an aluminumactivated malate transporter (ALMT) gene, called Ma1, is largely responsible for fruit acidity variations in apple (Bai et al., 2015; Khan et al., 2013). Ma1 shows high homology to AtALMT9, and a single nucleotide mutation that leads to a premature stop codon in Ma1 is attributed to the low acidity phenotype in apple (Bai et al., 2015). Two primary proton pumps, vacuolar H+-ATPase (V-ATPase; EC 3.6.1.3) and vacuolar inorganic pyrophosphatase (V-PPase; EC 3.6.1.1), transport protons into the vacuole and generate a proton electrochemical gradient, which provides the driving force for
58
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
malate transport across the tonoplast (Neuhaus, 2007; Terrier et al., 2001). In recent, several papers have shown the genes encoding V-ATPase and V-PPase as well as their expression profiles during development of apple fruit (Dong et al., 2011; Yao et al., 2009). Fruit postharvest quality is greatly related to ripening and senescence, which are regulated by internal and exogenous factors (Qin et al., 2009; Qin et al., 2012; Tian et al., 2013). 1-MCP, as an inhibitor of ethylene perception, is capable of blocking ethylene receptors to delay ethylene-dependent responses (Sisler and Serek, 1997), and has been widely used to maintain postharvest quality of various horticultural products, particularly climactic fruit (Liu et al., 2015; Zhang et al., 2012). The application of 1-MCP extends shelf-life because of delaying fruit ripening (Watkins, 2006). However, most studies of 1-MCP are mainly focused on its effects on physiological changes (Koukounaras and Sfakiotakis, 2007; Liu et al., 2015) and disease resistance against fungal pathogens (Jiang et al., 2001; Zhang et al., 2012), the effect of 1-MCP on organic acid metabolism and its mode of action remains to be learned. In this study, we investigated the effects of 1-MCP on organic acid content and quality properties of apple fruit during storage periods at 20 C, then analyzed the activity of crucial enzymes in organic acid metabolism and the expression of the related genes. Our results provide molecular evidence for understanding of 1-MCP regulating organic acid metabolism in apple fruit during storage periods. 2. Materials and methods 2.1. Fruit and treatment Apple fruit (Malus domestica Borkh. cv ‘Fuji’) were harvested at commercial ripening stage (based on starch index) from an orchard located in Beijing, P.R. China (latitude 40 2107.5600 N, longitude 115 550 31.8900 E) and immediately transported to the Institute of Botany, Chinese Academy of Sciences. Fruit of similar size and appearance, and free of any physical injuries or infections were selected, and then divided into two groups at random. One group was exposed to 1 mL L1 of 1-MCP (AgroFresh Inc., Dow AgroSciences, Spring House, PA, USA) in sealed airtight plastic tent fitted with a circulation fan at 20 C for 24 h. The other group was kept in a similar tent at 20 C for 24 h without 1-MCP treatment, serving as control. After treatment, all fruits were packed in plastic boxes with perforated polyliners and stored in air at 20 C serving as shelf-life temperature. Each treatment contained three replications, and 100 fruits were used in each replicate. At each sampling time, 10 fruits were randomly selected from each replication used for determination of firmness, soluble solids content (SSC), and titratable acidity (TA) at 14-d intervals. After evaluation of fruit quality, fruit were peeled, cut into small pieces, and immediately frozen in liquid nitrogen and stored at 80 C further use. 2.2. Fruit quality evaluation Fruit firmness was measured on opposite peeled sides of each fruit using a hand-held fruit firmness tester (FT-327; Effegi, Alfonsine, Italy) fitted with an 8-mm diameter plunger. SSC of fruit juice was determined using a hand-held refractometer (PAL-1; Atago, Tokyo, Japan) and the results were expressed as %. To measure the TA of the juice, 20 g of frozen flesh tissue was homogenized in 10 mL of distilled water, then centrifuged at 4 C and 12,000 g for 30 min. The supernatant was titrated to the point of pH 8.2 with 0.01 N NaOH. The volume of titrant was recorded and percent TA was calculated. The results were expressed as percentage of malic acid.
2.3. Extraction and determination of organic acids Organic acids were extracted and determined according to the method of Wu et al. (2002), with some modifications. Frozen tissue (3 g) was homogenized with 10 mL of ultrapure water and then centrifuged at 15,000 g for 15 min at 4 C. The supernatant was filtered through SEP-C18 cartridge (Supelclean ENVI C18 SPE), then through a 0.45 mm membrane filter (Millipore, Milford, MA, USA). A 20 mL sample was injected into an ODS-3C18 column (5 mm, 250 mm 4.6 mm, GL science, Tokyo, Japan) for HPLC analysis (Waters Alliance 2695 system, Waters Corporation, USA). The flow rate was 0.8 mL min1 using 0.02 M KH2PO4 (pH 2.4) as the mobile phase. The eluted peaks were detected with a Waters 2998 photodiode array detector (Waters Corporation, USA) at a wavelength of 210 nm. Quantification of individual organic acid was made using peak areas of standard samples and expressed in mg per g fresh weight (mg g1 FW). All the standard organic acids were obtained from Sigma-Aldrich (St. Louis, MO, USA). Each treatment contained three replications, and 10 fruit were used in each replicate. 2.4. Enzyme extraction and activity assays Enzyme extractions were performed as described by Saradhuldhat and Paull (2007), Terrier et al. (2001) and Yao et al. (2009) with some modifications. All procedures were conducted at 4 C. Frozen flesh tissue (10 g) was ground with a mortar and pestle and homogenized in 10 mL of extraction buffer (50 mM Hepes-Tris (pH 7.6), 250 mM sorbitol, 125 mM KCl, 5 mM EGTA, 10 mM MgSO4, 2 mM PMSF, 1.5% (w/v) PVP, 0.1% (w/v) BSA and 1 mM DTT). The mixture was filtered through a four layer of cheesecloth and centrifuged at 1000 g, and re-centrifuged at 50,000 g for 1 h (the supernatant and pellet for cytosolic and tonoplast isolation, respectively). The supernatant was then desalted on a Sephadex G25 column (PD-10, Pharmacia, Sweden). Aliquots of the extracts were then stored at 80 C for enzyme activity assay of cyNADMDH, cyNAD-ME, PEPC and PEPCK. The pellets were further purified on a 0% (w/v)/30% (w/v) discontinuous sucrose gradient sucrose gradient containing 5 mM DTT and 5 mM BTP-Mes (pH 7.5) for 2 h at 100,000 g as described by Terrier et al. (2001). The interface was collected and used for V-ATPase and V-PPase assays. The activities of cyNAD-MDH, cyNADP-ME, PEPC and PEPCK were assayed according to Merlo et al. (1993), with some modifications. cyNAD-MDH activity was measured in 1 mL reaction mixture containing 50 mM Tris–HCl (pH 7.8), 2 mM MgCl2, 0.5 mM EDTA, 0.2 mM NADH, 2 mM oxaloacetate, 2 mM oxaloacetate (OAA) and 30 mL of extract. The reaction was initiated by adding OAA. cyNADP-ME activity was measured in 1 mL reaction mixture containing 80 mM Tris–HCl (pH 7.5), 0.1 mM EDTA, 1 mM DTT, 0.2 mM NADP, 0.4 mM MnSO4, 3 mM malate, and 100 mL of extract. The reaction was initiated by adding malate. PEPC activity was measured in 1 mL reaction mixture containing 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 2 mM dithiothreitol (DTT), 2.5 mM phosphoenolpyruvate (PEP), 10 mM NaHCO3, 0.2 mM NADH, 5 units of NAD-MDH, and 30 mL of extract. The reaction was started by adding PEP. PEPCK activity was assayed according to Walker et al. (1999), with some modifications. The enzyme activity was measured in 1 mL reaction buffer, containing 100 mM HepesKOH (pH 6.8), 100 mM KCl, 0.14 mM NADH, 25 mM DTT, 6 mM MnCl2, 6 mM PEP, 1 mM ADP, 90 mM KHCO3 and 6 U malate dehydrogenase. All the enzyme activities were expressed in U mg1 protein. One unit of enzyme activity was defined as the amount of enzyme that catalyzed the oxidation of 1 mM NADH (or NADPH) per minute at 25 C. Determination of V-ATPase and V-PPase activity was conducted according to the procedure described by Liu et al. (2004), with minor modifications. Briefly, 20 mg tonoplast vesicles were added
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
59
Table 1 Primer sequences used for quantitative real-time PCR. Gene
Accession no.
Forward primer (50 ! 30 )
Reverse primer (50 ! 30 )
Ma1 MdcyME MdcyMDH MdPEPC MdPEPCK MdVHA-A MdVHP MdActin
MDP0000252114 EF128033 DQ221207 EU315246 GO530483 EF128033 DQ989335 AB638619
GACTTGGGCTTCAACAGCTC TCTTCAAGCCCGTCCTCTCA GTTGCTGATGATGCATGGTTGA TGTTTTCCAAGAACCCCGATTT TCATGCCTAAGCGTCAAATCC TGGCTGAAATGCCTGCAGAT CTGGTGCTGCAACGAACGT CTCCCAGGGCTGTGTTTCCTA
TTTTCGAGGATCCGAATGAC GTCCGGGCTTTTGGGATCA TTACGGGCCTTGATGATTGC GCCAATGTTCATCCGACCAT CCAAAGAAAAGGGCAACATC TTTACCCGCCCGTTCGTAA AAACGCAATGGCGAACACA GGCATCCTTCTGACCCATACC
into 400 mL of the reaction medium, containing 30 mM Hepes-Tris (pH 7.0 for V-ATPase, pH 8.5 for V-PPase), 3 mM MgSO4, 50 mM KCl, 0.5 mM NaN3, 0.2 mM Na3VO4, 0.2 mM ammonium molybdate, and 3 mM ATP-Na2 or 2 mM Na4PPi. The reaction was stated by addition of ATPNa2 (or Na4PPi). After 30 min of reaction at 37 C, trichloroacetic acid was added to stop the reaction. Inorganic phosphate released from ATP (or PPi) hydrolysis was determined by the method of Ohnishi et al. (1975). Protein concentration of the vesicle preparations was determined by the method of Bradford (1976), using BSA as a standard. 2.5. RNA isolation and quantitative real-time PCR Total RNA was isolated from frozen flesh tissue using the RNA plant Plus reagent (TianGen Biotech, Beijing, P.R. China) according to manufacturer’s instructions. Any contaminating genomic DNA was digested using RQ1 RNase-free DNase (Promega Corp., Madison, WI, USA). The total RNA was quantified using NanoDrop N-1000 spectrophotometer (NanoDrop technologies, Wilmington, DE, USA) and the RNA quality was tested by agarose gel electrophoresis. An aliquot (2 mg) of total RNA was used for first-strand cDNA synthesis with the TransScript First-Strand cDNA Synthesis kit (TransGen Biotech, Beijing, P.R. China). Quantitative real-time PCR (qRT-PCR) was then performed using the SYBR Premix Ex Taq (TaKaRa Corp., Dalian, P.R. China) and the StepOne Plus Real-time PCR system (Applied Biosystems, Foster City, CA, USA). All PCR primers (Table 1) were designed using Primer Express 3.0 (Applied Biosystems) and primer specificity was determined by melting curve analysis. The relative levels of expression of each target gene were estimated using the 2DDCt method (Livak and Schmittgen, 2001), using the b-Actin (AB638619) as a reference gene. Three independent biological replicates were analysed for each sample.
28th day in 1-MCP-treated fruit, respectively (Fig. 1B). This indicates that 1-MCP effectively inhibits the decrease of SSC and is beneficial for maintaining fruit postharvest quality. 3.2. Effect of 1-MCP on the content of organic acid and TA As shown in Fig. 2, the changes in TA displayed an overall slowly decreasing trend throughout the entire storage period, because organic acids, as respiratory substrates, are usually degraded in the TCA cycle. In apple fruit, malate was the main organic acid, citrate and succinate were also detected at low levels. In parallel to changes in TA, the three individual organic acids decreased during fruit storage. 1-MCP treatment effectively inhibited the decrease in malate and citrate content, resulting in higher acidity in apple fruit (Fig. 2A–C), demonstrating that 1-MCP was able to mediate organic acid metabolism.
2.6. Statistical analysis Statistical analysis was performed using SPSS software version 16.0 (SPSS-IBM Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) was applied between 1-MCP-treated and control fruit for each storage period. Significant differences between storage times were not tested. Mean differences at P 0.05 were considered to be significant using Duncan’s multiple range test. Values shown are means SD for three replicates. 3. Results 3.1. Effect of 1-MCP on fruit quality Fruit firmness generally exhibited a declining trend during storage at ambient temperature, while 1-MCP treatment effectively delayed the decline of firmness (Fig. 1A). SSC increased slowly and thereafter declined in all treatments during storage. The highest SSC values occurred at the 14th days in control fruit, and at
Fig. 1. Changes in firmness (A), soluble solids content (SSC) (B) of apple fruit during storage at 20 C. Each treatment contained three replications. Vertical bars represent standard deviations of the means.
60
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
Fig. 2. Changes in titratable acid (A), contents of malate (B), citrate (C) and succinate (D) of apple fruit during storage at 20 C. Each treatment contained three replications. Vertical bars represent standard deviations of the means. Asterisks indicate significant differences between control and 1-MCP treated fruit (P < 0.05).
3.3. Effect of 1-MCP on activities of malate metabolizing enzymes
4. Discussion
Fig. 3 shows the patterns of PEPC, cyNAD-MDH, PEPCK, V-ATPase and V-PPase in control and 1-MCP treated apple fruit during storage. A decline in PEPC activity was observed at the late stage (from 28 to 56 days) (Fig. 3A). The cyNAD-MDH activity showed an overall decreasing trend during storage in control fruit (Fig. 3B). The activity of PEPC and cyNAD-MDH in 1-MCP-treated fruit was significantly higher than that in control fruit at the late stage of storage. The cyNADP-ME activity increased during the early stages and decreased later (Fig. 3C). 1-MCP-treated fruit maintained higher PEPCK activity as compared to control (Fig. 3D). The activity of V-ATPase and V-PPase exhibited a similar pattern, increasing from 0 to 28 days of storage, then gradually declined in the end of storage period. 1-MCP-treated fruit showed lower activity levels of V-ATPase and V-PPase at the late stage of storage compared to the control (Fig. 3E and F). These results indicate that 1-MCP mediates organic acid metabolism via regulating malate metabolizing enzymes.
Organic acid usually accumulates at the early stages of fruit development, and decreases in the late stage of fruit ripening (Sweetman et al., 2009). Our results showed that TA, malate and citrate contents gradually decreased in apple fruit with increasing storage time. As malate is the major organic acid in apple fruit, its content is directly related to fruit TA. 1-MCP treatment effectively inhibited the decrease in TA, malate and citrate contents in apple fruit, indicating that 1-MCP contributes to the regulation of organic acid metabolism. A similar result was reported by Kolniak-Ostek et al. (2014), who found that the use of 1-MCP could keep TA level of apple fruit in long-term storage. Malate has been considered to be an intermediate of the TCA cycle, and its synthesis and degradation is tightly linked to the TCA cycle (Fernie and Martinoia, 2009). Malate accumulates during fruit growth process, and is consumed as respiratory substrates in TCA cycle and utilized as gluconeogenesis substrates during fruit ripening process (Berüter, 2004; Etienne et al., 2013). PEPC was reported to contribute positively to malate accumulation in apple fruit, while NADP-ME did negatively (Yao et al., 2009). Here, we found that 1-MCP treatment could maintain higher activities of cyNAD-MDH and PEPC along with higher malate content, suggesting that 1-MCP may enhance malate biosynthesis via regulating cyNAD-MDH and PEPC activity. By contrast, cyNADP-ME activity was lower in 1-MCP-treated fruit at 14 and 28 days of storage. PEPCK activity, which was correlated with gluconeogenesis (Sweetman et al., 2009), was down-regulated by 1-MCP treatment. Therefore, we infer that 1-MCP slows malate degradation and the malate conversion to sugar through gluconeogenesis during fruit storage.
3.4. Effect of 1-MCP on transcript levels of malate metabolizing genes Expression profiles of the crucial genes related to acid metabolizing enzymes in apple fruit were determined by qRTPCR analysis. As presented in Fig. 4, 1-MCP-treated fruit showed higher expression levels of MdcyMDH, MdPEPC, MdVHA-A, MdVHP and Ma1, but lower transcript levels of MdPEPCK as compared to the control fruit. However, 1-MCP treatment slightly affected the transcript level of MdcyME (Fig. 4C). These results indicate that 1-MCP is capable of regulating these crucial genes involved in organic acid metabolism of apple fruit.
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
61
Fig. 3. Changes in activities of malate metabolizing enzymes in apple fruit during storage at 20 C. Each treatment contained three replications. Vertical bars represent standard deviations of the means.
The results of qRT-PCR confirmed that 1-MCP-treated fruit showed higher expression levels of MdPEPC and MdcyMDH, along with higher activity of PEPC and cyNAD-MDH and higher malate content, compared with control fruit. But transcript-level of MdcyME was not different in all treatments, expression of MdPEPCK displayed a quite different trend with PEPCK activity during fruit storage. Inconsistent patterns between gene transcript levels and enzymatic activity may be due to PEPCK activity is mediated by multiple genes controlling or post-translational regulation. Several papers have shown that NADP-ME is regulated at the posttranslational level by cytosolic pH and malate concentration (Yang et al., 2011; Yao et al., 2009). The electrochemical gradient established by V-ATPase and V-PPase plays important role in facilitating secondary transport of organic acid across the tonoplast (Etienne et al., 2002). The abundance of MdVHA-A and MdVHP transcript levels along with the corresponding enzyme activities increased from 0 to 28 days, then declined. This may be necessary to compensate for the proton leakage of tonoplast, which was reported in grape berry during ripening (Terrier et al., 2001). We found that activity of V-ATPase and V-PPase and transcript expression of the genes were
up-regulated after 1-MCP treatment, indicating that 1-MCP is capable for retaining malate level. Ma1, an ALMT gene, is largely responsible for malate accumulation in apple fruit (Bai et al., 2015; Khan et al., 2013). The transcript expression of Ma1 declined during apple fruit storage, however, 1-MCP treatment maintained higher expression of Ma1 at transcript level, leading to higher malate content in the vacuole due to Ma1 controlling malate transportation, as compared to control. These data suggest that the up-regulated expression of acid transport genes by 1-MCP treatment may contribute to maintain organic acid content, especially malate content. Given the results presented herein, we conclude that 1-MCP treatment is effective in maintaining acidity and malate content of harvested apple fruit during storage periods. The mode of action of 1-MCP regulating organic acid metabolism in apple fruit could be the increased malate biosynthesis via up-regulating MdPEPC and MdcyMDH expression with higher activity of PEPC and cyNADMDH, and the decreased malate degradation via limiting MdPEPCK expression with lower activity of PEPCK. Moreover, 1-MCP treatment up-regulates acid transport genes, including MdVHA-A, MdVHP and Ma1, resulting in higher malate content
62
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
Fig. 4. Changes in transcript levels of malate metabolizing genes in apple fruit during storage at 20 C. Relative expression was normalized using b-actin as an internal control and the harvest day control sample defined as 1. Each treatment contained three replications. Vertical bars represent standard deviations of the means. Asterisks indicate significant differences between control and 1-MCP treated fruit (P < 0.05).
in the vacuole. Our results provide novel evidence for understanding molecular mechanism by which 1-MCP regulates organic acid metabolism in apple fruit during storage periods.
Acknowledgements This research was supported by the National Basic Research Program of China (973 Program, 2011CB100604) and National Natural Science Foundation of China (31030051).
References Bai, Y., Dougherty, L., Cheng, L., Xu, K., 2015. A co-expression gene network associated with developmental regulation of apple fruit acidity. Mol. Genet. Genom. 290, 1247–1263. Berüter, J., 2004. Carbohydrate metabolism in two apple genotypes that differ in malate accumulation. J. Plant Physiol. 161, 1011–1029. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Chen, J.L., Wang, Z.F., Wu, J.H., Wang, Q., Hu, X.S., 2007. Chemical compositional characterization of eight pear cultivars grown in China. Food Chem. 104, 268–275.
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63 Chen, F.X., Liu, X.H., Chen, L.S., 2009. Developmental changes in pulp organic acid concentration and activities of acid-metabolising enzymes during the fruit development of two loquat (Eriobotrya japonica Lindl.) cultivars differing in fruit acidity. Food Chem. 114, 657–664. Dong, Q.L., Liu, D.D., An, X.H., Hu, D.G., Yao, Y.X., Hao, Y.J., 2011. MdVHP1 encodes an apple vacuolar H+-PPase and enhances stress tolerance in transgenic apple callus and tomato. J. Plant Physiol. 168, 2124–2133. Emmerlich, V., Linka, N., Reinhold, T., Hurth, M.A., Traub, M., Martinoia, E., Neuhaus, H.E., 2003. The plant homolog to the human sodium/dicarboxylic cotransporter is the vacuolar malate carrier. Proc. Natl. Acad. Sci. U. S. A. 100, 11122–11126. Etienne, C., Moing, A., Dirlewanger, E., Raymond, P., Monet, R., Rothan, C., 2002. Isolation and characterization of six peach cDNAs encoding key proteins in organic acid metabolism and solute accumulation: involvement in regulating peach fruit acidity. Physiol. Plant. 114, 259–270. Etienne, A., Génard, M., Lobit, P., Mbeguié-A-Mbéguié, D., Bugaud, C., 2013. What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 64, 1451–1469. Fernie, A.R., Martinoia, E., 2009. Malate. Jack of all trades or master of a few? Phytochemistry 70, 828–832. Gil, A.M., Duarte, I.F., Delgadillo, I., Colquhoun, I.J., Casuscelli, F., Humpfer, E., Spraul, M., 2000. Study of the compositional changes of mango during ripening by use of nuclear magnetic resonance spectroscopy. J. Agric. Food Chem. 48, 1524–1536. Jiang, Y., Joyce, D.C., Terry, L.A., 2001. 1-Mehtylcyclopronpene treatment affects strawberry fruit decay. Postharvest Biol. Technol. 23, 227–232. Khan, S., Beekwilder, J., Schaart, J., Mumm, R., Soriano, J., Jacobsen, E., Schouten, H.J., 2013. Differences in acidity of apples are probably mainly caused by a malic acid transporter gene on LG16. Tree Genet. Genomes 9, 475–487. ska, K., 2014. 1Kolniak-Ostek, J., Wojdyło, A., Markowski, J., Siucin Methylcyclopropene postharvest treatment and their effect on apple quality during long-term storage time. Eur. Food Res. Technol. 239, 603–612. Koukounaras, A., Sfakiotakis, E., 2007. Effect of 1-MCP prestorage treatment on ethylene and CO2 production and quality of ‘Hayward’ kiwifruit during shelf-life after short, medium and long term cold storage. Postharvest Biol. Technol. 46, 174–180. Kovermann, P., Meyer, S., Hörtensteiner, S., Picco, C., Scholz-Starke, J., Ravera, S., Lee, Y., Martinoia, E., 2007. The Arabidopsis vacuolar malate channel is a member of the ALMT family. Plant J. 52, 1169–1180. Laval-Martin, D., Farineau, J., Diamond, J., 1977. Light versus dark carbon metabolism in cherry tomato fruits. Plant Physiol. 60, 872–876. Liu, H., Liu, Y., Yu, B., Liu, Z., Zhang, W., 2004. Increased polyamines conjugated to tonoplast vesicles correlate with maintenance of the H+-ATPase and H+-PPase activities and enhanced osmotic stress tolerance in wheat. J. Plant Growth Regul. 23, 156–165. Liu, R.L., Xu, Y., Li, B.Q., Qin, G.Z., Tian, S.P., 2015. The role of 1-methylcyclopropene in lipid peroxidation anti-oxidant enzyme activities, and ethylene biosynthesis in ‘Laiyang’ pear (Pyrus bretschneideri Rehd.) during fruit ripening. J. Hortic. Sci. Biotechnol. 90, 210–216. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402–408. Merlo, L., Ferretti, M., Ghisi, R., Passera, C., 1993. Developmental changes of enzymes of malate metabolism in relation to respiration, photosynthesis and nitrate assimilation in peach leaves. Physiol. Plant. 89, 71–76. Miller, S.S., Driscoll, B.T., Gregerson, R.G., Gantt, J.S., Vance, C.P., 1998. Alfalfa malate dehydrogenase MDH: molecular cloning and characterization of five different forms reveals a unique nodule-enhanced MDH. Plant J. 15, 173–184.
63
Moing, A., Svanella, L., Rolin, D., Gaudillere, M., Gaudillère, J.P., Monet, R., 1998. Compositional changes during the fruit development of two peach cultivars differing in juice acidity. J. Am. Soc. Hortic. Sci. 123, 770–775. Moing, A., Rothan, C., Svanella, L., Just, D., Diakou, P., Raymond Gaudillère, J.P., Monet, R., 2000. Role of phosphoenolpyruvate carboxylase in organic acid accumulation during peach fruit development. Physiol. Plant. 108, 1–10. Neuhaus, H.E., 2007. Transport of primary metabolites across the plant vacuolar membrane. FEBS Lett. 581, 2223–2226. Ohnishi, T., Gall, R.G., Mayer, M.L., 1975. An improved assay of inorganic phosphate in the presence of extralabile phosphate compounds: application to the ATPase assay in the presence of phosphocreatine. Anal. Biochem. 689, 261–267. Qin, G.Z., Wang, Q., Liu, J., Li, B.Q., Tian, S.P., 2009. Proteomic analysis of changes in mitochondrial protein expression during fruit senescence. Proteomics 9, 4241–4253. Qin, G.Z., Wang, Y.Y., Cao, B.H., Wang, W.H., Tian, S.P., 2012. Unraveling the regulatory network of MADS-box transcription factor RIN in fruit ripening. Plant J. 70, 243–255. Sadka, A., Dahan, E., Cohen, L., Marsh, K.B., 2000. Aconitase activity and expression during the development of lemon fruit. Physiol. Plant. 108, 255–262. Saradhuldhat, P., Paull, R.E., 2007. Pineapple organic acid metabolism and accumulation during fruit development. Sci. Hortic. 112, 297–303. Sisler, E.C., Serek, M., 1997. Inhibitors of ethylene responses in plants at the receptor level: recent developments. Physiol. Plant. 100, 577–582. Sweetman, C., Deluc, L.G., Cramer, G.R., Ford, C.M., Soole, K.L., 2009. Regulation of malate metabolism in grape berry and other developing fruits. Phytochemistry 70, 1329–1344. Terrier, N., Sauvage, F.X., Ageorges, A., Romieu, C., 2001. Changes in acidity and in proton transport at the tonoplast of grape berries during development. Planta 213, 20–28. Tian, S.P., Qin, G.Z., Li, B.Q., 2013. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. Plant Mol. Biol. 82, 593–602. Walker, R.P., Chen, Z.H., Técsi, L., Famiani, F., Lea, P.J., Leegood, R.C., 1999. Phosphoenolpyruvate carboxykinase plays a role in interaction of carbon and nitrogen metabolism during grape seed development. Planta 210, 9–18. Watkins, C.B., 2006. The use of 1-methylcyclopropene 1-MCP on fruits and vegetables. Biotechnol. Adv. 24, 389–409. Wu, B.H., Génard, M., Lescourret, F., Gomez, L., Li, S.H., 2002. Influence of assimilate and water supply on seasonal variation of acids in peach (cv Suncrest.). J. Sci. Food Agric. 82, 1829–1836. Yamaki, S., 1984. Isolation of vacuoles from immature apple fruit flesh and compartmentation of sugars organic acids, phenolic compounds and amino acids. Plant Cell Physiol. 25, 151–166. Yang, L.T., Xie, C.Y., Jiang, H.X., Chen, L.S., 2011. Expression of six malate-related genes in pulp during the fruit development of two loquat (Eriobotrya japonica) cultivars differing in fruit acidity. Afr. J. Biotechnol. 10, 2414–2422. Yao, Y.X., Li, M., Liu, Z., You, C.X., Wang, D.M., Zhai, H., Hao, Y.J., 2009. Molecular cloning of three malic acid related genes MdPEPC, MdVHA-A, MdcyME and their expression analysis in apple fruits. Sci. Hortic. 122, 404–408. Yao, Y.X., Li, M., Zhai, H., You, C.X., Hao, Y.J., 2011. Isolation and characterization of an apple cytosolic malate dehydrogenase gene reveal its function in malate synthesis. J. Plant Physiol. 168, 474–480. Zhang, Z.Q., Tian, S.P., Zhu, Z., Xu, Y., Qin, G.Z., 2012. Effects of 1-methylcyclopropene 1-MCP on ripening and resistance of jujube (Zizyphus jujube cv. Huping) fruit against postharvest disease. LWT Food Sci. Technol. 45, 13–19.
Contents lists available at ScienceDirect
Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio
Molecular basis of 1-methylcyclopropene regulating organic acid metabolism in apple fruit during storage Ruiling Liua,b , Yuying Wanga , Guozheng Qina , Shiping Tiana,b,* a b
Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China University of Chinese Academy of Sciences, Beijing 100049, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 6 October 2015 Received in revised form 30 January 2016 Accepted 1 February 2016 Available online xxx
Organic acids play a critical role in flavor and overall organoleptic quality of fruit. Malate has been considered to be the major organic acid determining apple fruit acidity. Here, we found that 1-methylcyclopropene (1-MCP) delayed the loss of malate and citrate during storage. 1-MCP-treated fruit showed higher level of phosphoenol pyruvate carboxylase (PEPC) and cytosolic NAD-dependent malate dehydrogenase (cyNAD-MDH) activities, but lower or similar phosphoenolpyruvate carboxylase kinase (PEPCK) and cytosolic NAD-dependent malate dehydrogenase (cyNADP-ME) activities compared to the control. Moreover, the expression of acid transport genes, including MdVHA-A,MdVHP and Ma1, was upregulated in 1-MCP-treated fruit, resulting in retention of malate in the vacuole, and eventual higher malate content. Hence, 1-MCP maintained fruit acidity by regulating the balance between malate biosynthesis and degradation. These findings provide molecular evidence for understanding the mode of action of 1-MCP regulating organic acid metabolism in apple fruit during storage. ã 2016 Elsevier B.V. All rights reserved.
Keywords: 1-MCP Organic acid metabolism Molecular basis Apple fruit Postharvest storage
1. Introduction Fruit acidity greatly affects the taste and organoleptic quality, in combination with sugars and flavor volatiles. The predominant organic acid in ripe fruit varies among species: citric acid is dominant in citrus (Sadka et al., 2000) and mango (Gil et al., 2000); while malic acid is dominant in pome fruits, such as peach (Moing et al., 1998), pear (Chen et al., 2007), and loquat (Chen et al., 2009). In apple fruit, the major organic acid is malic acid, accounting for 80–90% of the total organic acids (Yamaki, 1984). The salts and esters of malic acid are known as malate, which is the main form of malic acid in many flesh fruit (Yao et al., 2011). Malate plays an important role in plant physiology. It has been proposed as an intermediate of the tricarboxylic acid (TCA) cycle, an essential storage carbon molecule, and a pH regulator (Fernie and Martinoia, 2009). The final malate content of fruit is generally determined by the net balance of acid synthesis, degradation, and compartmentation (Laval-Martin et al., 1977; Yamaki, 1984). Malate biosynthesis occurs primarily in the cytosol and is catalyzed by phosphoenolpyruvate carboxylase (PEPC, EC 4.1.1.31) and NAD-dependent
* Corresponding author at: Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China. Fax: +86 10 82594675. E-mail address: [email protected] (S. Tian). http://dx.doi.org/10.1016/j.postharvbio.2016.02.001 0925-5214/ ã 2016 Elsevier B.V. All rights reserved.
malate dehydrogenase (cyNAD-MDH, EC 1.1.1.37) (Miller et al., 1998; Moing et al., 2000). The rapid decrease in malate content during fruit ripening has usually been attributed to its degradation by cytosolic NADP-dependent malic enzyme (cyNADP-ME, EC 1.1.1.40) (Berüter, 2004; Chen et al., 2009). In addition, malate serves as a substrate for gluconeogenesis, and phosphoenolpyruvate carboxylase kinase (PEPCK, EC 4.1.1.49) play crucial roles in the process (Sweetman et al., 2009). The malate content increases as fruit develops and the excess malate is compartmentalized in the vacuole (Etienne et al., 2013) and vacuolar transporters play critical roles in determining fruit acidity as they can regulate the malate transport into and out of the vacuole (Sweetman et al., 2009). In Arabidopsis, the transport of malate between vacuole and cytoplasm is mediated by AtTDT, a tonoplast-localized malate transporter (Emmerlich et al., 2003) and AtALMT9, a tonoplast-localized malate channel (Kovermann et al., 2007). Recent advances suggested that an aluminumactivated malate transporter (ALMT) gene, called Ma1, is largely responsible for fruit acidity variations in apple (Bai et al., 2015; Khan et al., 2013). Ma1 shows high homology to AtALMT9, and a single nucleotide mutation that leads to a premature stop codon in Ma1 is attributed to the low acidity phenotype in apple (Bai et al., 2015). Two primary proton pumps, vacuolar H+-ATPase (V-ATPase; EC 3.6.1.3) and vacuolar inorganic pyrophosphatase (V-PPase; EC 3.6.1.1), transport protons into the vacuole and generate a proton electrochemical gradient, which provides the driving force for
58
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
malate transport across the tonoplast (Neuhaus, 2007; Terrier et al., 2001). In recent, several papers have shown the genes encoding V-ATPase and V-PPase as well as their expression profiles during development of apple fruit (Dong et al., 2011; Yao et al., 2009). Fruit postharvest quality is greatly related to ripening and senescence, which are regulated by internal and exogenous factors (Qin et al., 2009; Qin et al., 2012; Tian et al., 2013). 1-MCP, as an inhibitor of ethylene perception, is capable of blocking ethylene receptors to delay ethylene-dependent responses (Sisler and Serek, 1997), and has been widely used to maintain postharvest quality of various horticultural products, particularly climactic fruit (Liu et al., 2015; Zhang et al., 2012). The application of 1-MCP extends shelf-life because of delaying fruit ripening (Watkins, 2006). However, most studies of 1-MCP are mainly focused on its effects on physiological changes (Koukounaras and Sfakiotakis, 2007; Liu et al., 2015) and disease resistance against fungal pathogens (Jiang et al., 2001; Zhang et al., 2012), the effect of 1-MCP on organic acid metabolism and its mode of action remains to be learned. In this study, we investigated the effects of 1-MCP on organic acid content and quality properties of apple fruit during storage periods at 20 C, then analyzed the activity of crucial enzymes in organic acid metabolism and the expression of the related genes. Our results provide molecular evidence for understanding of 1-MCP regulating organic acid metabolism in apple fruit during storage periods. 2. Materials and methods 2.1. Fruit and treatment Apple fruit (Malus domestica Borkh. cv ‘Fuji’) were harvested at commercial ripening stage (based on starch index) from an orchard located in Beijing, P.R. China (latitude 40 2107.5600 N, longitude 115 550 31.8900 E) and immediately transported to the Institute of Botany, Chinese Academy of Sciences. Fruit of similar size and appearance, and free of any physical injuries or infections were selected, and then divided into two groups at random. One group was exposed to 1 mL L1 of 1-MCP (AgroFresh Inc., Dow AgroSciences, Spring House, PA, USA) in sealed airtight plastic tent fitted with a circulation fan at 20 C for 24 h. The other group was kept in a similar tent at 20 C for 24 h without 1-MCP treatment, serving as control. After treatment, all fruits were packed in plastic boxes with perforated polyliners and stored in air at 20 C serving as shelf-life temperature. Each treatment contained three replications, and 100 fruits were used in each replicate. At each sampling time, 10 fruits were randomly selected from each replication used for determination of firmness, soluble solids content (SSC), and titratable acidity (TA) at 14-d intervals. After evaluation of fruit quality, fruit were peeled, cut into small pieces, and immediately frozen in liquid nitrogen and stored at 80 C further use. 2.2. Fruit quality evaluation Fruit firmness was measured on opposite peeled sides of each fruit using a hand-held fruit firmness tester (FT-327; Effegi, Alfonsine, Italy) fitted with an 8-mm diameter plunger. SSC of fruit juice was determined using a hand-held refractometer (PAL-1; Atago, Tokyo, Japan) and the results were expressed as %. To measure the TA of the juice, 20 g of frozen flesh tissue was homogenized in 10 mL of distilled water, then centrifuged at 4 C and 12,000 g for 30 min. The supernatant was titrated to the point of pH 8.2 with 0.01 N NaOH. The volume of titrant was recorded and percent TA was calculated. The results were expressed as percentage of malic acid.
2.3. Extraction and determination of organic acids Organic acids were extracted and determined according to the method of Wu et al. (2002), with some modifications. Frozen tissue (3 g) was homogenized with 10 mL of ultrapure water and then centrifuged at 15,000 g for 15 min at 4 C. The supernatant was filtered through SEP-C18 cartridge (Supelclean ENVI C18 SPE), then through a 0.45 mm membrane filter (Millipore, Milford, MA, USA). A 20 mL sample was injected into an ODS-3C18 column (5 mm, 250 mm 4.6 mm, GL science, Tokyo, Japan) for HPLC analysis (Waters Alliance 2695 system, Waters Corporation, USA). The flow rate was 0.8 mL min1 using 0.02 M KH2PO4 (pH 2.4) as the mobile phase. The eluted peaks were detected with a Waters 2998 photodiode array detector (Waters Corporation, USA) at a wavelength of 210 nm. Quantification of individual organic acid was made using peak areas of standard samples and expressed in mg per g fresh weight (mg g1 FW). All the standard organic acids were obtained from Sigma-Aldrich (St. Louis, MO, USA). Each treatment contained three replications, and 10 fruit were used in each replicate. 2.4. Enzyme extraction and activity assays Enzyme extractions were performed as described by Saradhuldhat and Paull (2007), Terrier et al. (2001) and Yao et al. (2009) with some modifications. All procedures were conducted at 4 C. Frozen flesh tissue (10 g) was ground with a mortar and pestle and homogenized in 10 mL of extraction buffer (50 mM Hepes-Tris (pH 7.6), 250 mM sorbitol, 125 mM KCl, 5 mM EGTA, 10 mM MgSO4, 2 mM PMSF, 1.5% (w/v) PVP, 0.1% (w/v) BSA and 1 mM DTT). The mixture was filtered through a four layer of cheesecloth and centrifuged at 1000 g, and re-centrifuged at 50,000 g for 1 h (the supernatant and pellet for cytosolic and tonoplast isolation, respectively). The supernatant was then desalted on a Sephadex G25 column (PD-10, Pharmacia, Sweden). Aliquots of the extracts were then stored at 80 C for enzyme activity assay of cyNADMDH, cyNAD-ME, PEPC and PEPCK. The pellets were further purified on a 0% (w/v)/30% (w/v) discontinuous sucrose gradient sucrose gradient containing 5 mM DTT and 5 mM BTP-Mes (pH 7.5) for 2 h at 100,000 g as described by Terrier et al. (2001). The interface was collected and used for V-ATPase and V-PPase assays. The activities of cyNAD-MDH, cyNADP-ME, PEPC and PEPCK were assayed according to Merlo et al. (1993), with some modifications. cyNAD-MDH activity was measured in 1 mL reaction mixture containing 50 mM Tris–HCl (pH 7.8), 2 mM MgCl2, 0.5 mM EDTA, 0.2 mM NADH, 2 mM oxaloacetate, 2 mM oxaloacetate (OAA) and 30 mL of extract. The reaction was initiated by adding OAA. cyNADP-ME activity was measured in 1 mL reaction mixture containing 80 mM Tris–HCl (pH 7.5), 0.1 mM EDTA, 1 mM DTT, 0.2 mM NADP, 0.4 mM MnSO4, 3 mM malate, and 100 mL of extract. The reaction was initiated by adding malate. PEPC activity was measured in 1 mL reaction mixture containing 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 2 mM dithiothreitol (DTT), 2.5 mM phosphoenolpyruvate (PEP), 10 mM NaHCO3, 0.2 mM NADH, 5 units of NAD-MDH, and 30 mL of extract. The reaction was started by adding PEP. PEPCK activity was assayed according to Walker et al. (1999), with some modifications. The enzyme activity was measured in 1 mL reaction buffer, containing 100 mM HepesKOH (pH 6.8), 100 mM KCl, 0.14 mM NADH, 25 mM DTT, 6 mM MnCl2, 6 mM PEP, 1 mM ADP, 90 mM KHCO3 and 6 U malate dehydrogenase. All the enzyme activities were expressed in U mg1 protein. One unit of enzyme activity was defined as the amount of enzyme that catalyzed the oxidation of 1 mM NADH (or NADPH) per minute at 25 C. Determination of V-ATPase and V-PPase activity was conducted according to the procedure described by Liu et al. (2004), with minor modifications. Briefly, 20 mg tonoplast vesicles were added
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
59
Table 1 Primer sequences used for quantitative real-time PCR. Gene
Accession no.
Forward primer (50 ! 30 )
Reverse primer (50 ! 30 )
Ma1 MdcyME MdcyMDH MdPEPC MdPEPCK MdVHA-A MdVHP MdActin
MDP0000252114 EF128033 DQ221207 EU315246 GO530483 EF128033 DQ989335 AB638619
GACTTGGGCTTCAACAGCTC TCTTCAAGCCCGTCCTCTCA GTTGCTGATGATGCATGGTTGA TGTTTTCCAAGAACCCCGATTT TCATGCCTAAGCGTCAAATCC TGGCTGAAATGCCTGCAGAT CTGGTGCTGCAACGAACGT CTCCCAGGGCTGTGTTTCCTA
TTTTCGAGGATCCGAATGAC GTCCGGGCTTTTGGGATCA TTACGGGCCTTGATGATTGC GCCAATGTTCATCCGACCAT CCAAAGAAAAGGGCAACATC TTTACCCGCCCGTTCGTAA AAACGCAATGGCGAACACA GGCATCCTTCTGACCCATACC
into 400 mL of the reaction medium, containing 30 mM Hepes-Tris (pH 7.0 for V-ATPase, pH 8.5 for V-PPase), 3 mM MgSO4, 50 mM KCl, 0.5 mM NaN3, 0.2 mM Na3VO4, 0.2 mM ammonium molybdate, and 3 mM ATP-Na2 or 2 mM Na4PPi. The reaction was stated by addition of ATPNa2 (or Na4PPi). After 30 min of reaction at 37 C, trichloroacetic acid was added to stop the reaction. Inorganic phosphate released from ATP (or PPi) hydrolysis was determined by the method of Ohnishi et al. (1975). Protein concentration of the vesicle preparations was determined by the method of Bradford (1976), using BSA as a standard. 2.5. RNA isolation and quantitative real-time PCR Total RNA was isolated from frozen flesh tissue using the RNA plant Plus reagent (TianGen Biotech, Beijing, P.R. China) according to manufacturer’s instructions. Any contaminating genomic DNA was digested using RQ1 RNase-free DNase (Promega Corp., Madison, WI, USA). The total RNA was quantified using NanoDrop N-1000 spectrophotometer (NanoDrop technologies, Wilmington, DE, USA) and the RNA quality was tested by agarose gel electrophoresis. An aliquot (2 mg) of total RNA was used for first-strand cDNA synthesis with the TransScript First-Strand cDNA Synthesis kit (TransGen Biotech, Beijing, P.R. China). Quantitative real-time PCR (qRT-PCR) was then performed using the SYBR Premix Ex Taq (TaKaRa Corp., Dalian, P.R. China) and the StepOne Plus Real-time PCR system (Applied Biosystems, Foster City, CA, USA). All PCR primers (Table 1) were designed using Primer Express 3.0 (Applied Biosystems) and primer specificity was determined by melting curve analysis. The relative levels of expression of each target gene were estimated using the 2DDCt method (Livak and Schmittgen, 2001), using the b-Actin (AB638619) as a reference gene. Three independent biological replicates were analysed for each sample.
28th day in 1-MCP-treated fruit, respectively (Fig. 1B). This indicates that 1-MCP effectively inhibits the decrease of SSC and is beneficial for maintaining fruit postharvest quality. 3.2. Effect of 1-MCP on the content of organic acid and TA As shown in Fig. 2, the changes in TA displayed an overall slowly decreasing trend throughout the entire storage period, because organic acids, as respiratory substrates, are usually degraded in the TCA cycle. In apple fruit, malate was the main organic acid, citrate and succinate were also detected at low levels. In parallel to changes in TA, the three individual organic acids decreased during fruit storage. 1-MCP treatment effectively inhibited the decrease in malate and citrate content, resulting in higher acidity in apple fruit (Fig. 2A–C), demonstrating that 1-MCP was able to mediate organic acid metabolism.
2.6. Statistical analysis Statistical analysis was performed using SPSS software version 16.0 (SPSS-IBM Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) was applied between 1-MCP-treated and control fruit for each storage period. Significant differences between storage times were not tested. Mean differences at P 0.05 were considered to be significant using Duncan’s multiple range test. Values shown are means SD for three replicates. 3. Results 3.1. Effect of 1-MCP on fruit quality Fruit firmness generally exhibited a declining trend during storage at ambient temperature, while 1-MCP treatment effectively delayed the decline of firmness (Fig. 1A). SSC increased slowly and thereafter declined in all treatments during storage. The highest SSC values occurred at the 14th days in control fruit, and at
Fig. 1. Changes in firmness (A), soluble solids content (SSC) (B) of apple fruit during storage at 20 C. Each treatment contained three replications. Vertical bars represent standard deviations of the means.
60
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
Fig. 2. Changes in titratable acid (A), contents of malate (B), citrate (C) and succinate (D) of apple fruit during storage at 20 C. Each treatment contained three replications. Vertical bars represent standard deviations of the means. Asterisks indicate significant differences between control and 1-MCP treated fruit (P < 0.05).
3.3. Effect of 1-MCP on activities of malate metabolizing enzymes
4. Discussion
Fig. 3 shows the patterns of PEPC, cyNAD-MDH, PEPCK, V-ATPase and V-PPase in control and 1-MCP treated apple fruit during storage. A decline in PEPC activity was observed at the late stage (from 28 to 56 days) (Fig. 3A). The cyNAD-MDH activity showed an overall decreasing trend during storage in control fruit (Fig. 3B). The activity of PEPC and cyNAD-MDH in 1-MCP-treated fruit was significantly higher than that in control fruit at the late stage of storage. The cyNADP-ME activity increased during the early stages and decreased later (Fig. 3C). 1-MCP-treated fruit maintained higher PEPCK activity as compared to control (Fig. 3D). The activity of V-ATPase and V-PPase exhibited a similar pattern, increasing from 0 to 28 days of storage, then gradually declined in the end of storage period. 1-MCP-treated fruit showed lower activity levels of V-ATPase and V-PPase at the late stage of storage compared to the control (Fig. 3E and F). These results indicate that 1-MCP mediates organic acid metabolism via regulating malate metabolizing enzymes.
Organic acid usually accumulates at the early stages of fruit development, and decreases in the late stage of fruit ripening (Sweetman et al., 2009). Our results showed that TA, malate and citrate contents gradually decreased in apple fruit with increasing storage time. As malate is the major organic acid in apple fruit, its content is directly related to fruit TA. 1-MCP treatment effectively inhibited the decrease in TA, malate and citrate contents in apple fruit, indicating that 1-MCP contributes to the regulation of organic acid metabolism. A similar result was reported by Kolniak-Ostek et al. (2014), who found that the use of 1-MCP could keep TA level of apple fruit in long-term storage. Malate has been considered to be an intermediate of the TCA cycle, and its synthesis and degradation is tightly linked to the TCA cycle (Fernie and Martinoia, 2009). Malate accumulates during fruit growth process, and is consumed as respiratory substrates in TCA cycle and utilized as gluconeogenesis substrates during fruit ripening process (Berüter, 2004; Etienne et al., 2013). PEPC was reported to contribute positively to malate accumulation in apple fruit, while NADP-ME did negatively (Yao et al., 2009). Here, we found that 1-MCP treatment could maintain higher activities of cyNAD-MDH and PEPC along with higher malate content, suggesting that 1-MCP may enhance malate biosynthesis via regulating cyNAD-MDH and PEPC activity. By contrast, cyNADP-ME activity was lower in 1-MCP-treated fruit at 14 and 28 days of storage. PEPCK activity, which was correlated with gluconeogenesis (Sweetman et al., 2009), was down-regulated by 1-MCP treatment. Therefore, we infer that 1-MCP slows malate degradation and the malate conversion to sugar through gluconeogenesis during fruit storage.
3.4. Effect of 1-MCP on transcript levels of malate metabolizing genes Expression profiles of the crucial genes related to acid metabolizing enzymes in apple fruit were determined by qRTPCR analysis. As presented in Fig. 4, 1-MCP-treated fruit showed higher expression levels of MdcyMDH, MdPEPC, MdVHA-A, MdVHP and Ma1, but lower transcript levels of MdPEPCK as compared to the control fruit. However, 1-MCP treatment slightly affected the transcript level of MdcyME (Fig. 4C). These results indicate that 1-MCP is capable of regulating these crucial genes involved in organic acid metabolism of apple fruit.
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
61
Fig. 3. Changes in activities of malate metabolizing enzymes in apple fruit during storage at 20 C. Each treatment contained three replications. Vertical bars represent standard deviations of the means.
The results of qRT-PCR confirmed that 1-MCP-treated fruit showed higher expression levels of MdPEPC and MdcyMDH, along with higher activity of PEPC and cyNAD-MDH and higher malate content, compared with control fruit. But transcript-level of MdcyME was not different in all treatments, expression of MdPEPCK displayed a quite different trend with PEPCK activity during fruit storage. Inconsistent patterns between gene transcript levels and enzymatic activity may be due to PEPCK activity is mediated by multiple genes controlling or post-translational regulation. Several papers have shown that NADP-ME is regulated at the posttranslational level by cytosolic pH and malate concentration (Yang et al., 2011; Yao et al., 2009). The electrochemical gradient established by V-ATPase and V-PPase plays important role in facilitating secondary transport of organic acid across the tonoplast (Etienne et al., 2002). The abundance of MdVHA-A and MdVHP transcript levels along with the corresponding enzyme activities increased from 0 to 28 days, then declined. This may be necessary to compensate for the proton leakage of tonoplast, which was reported in grape berry during ripening (Terrier et al., 2001). We found that activity of V-ATPase and V-PPase and transcript expression of the genes were
up-regulated after 1-MCP treatment, indicating that 1-MCP is capable for retaining malate level. Ma1, an ALMT gene, is largely responsible for malate accumulation in apple fruit (Bai et al., 2015; Khan et al., 2013). The transcript expression of Ma1 declined during apple fruit storage, however, 1-MCP treatment maintained higher expression of Ma1 at transcript level, leading to higher malate content in the vacuole due to Ma1 controlling malate transportation, as compared to control. These data suggest that the up-regulated expression of acid transport genes by 1-MCP treatment may contribute to maintain organic acid content, especially malate content. Given the results presented herein, we conclude that 1-MCP treatment is effective in maintaining acidity and malate content of harvested apple fruit during storage periods. The mode of action of 1-MCP regulating organic acid metabolism in apple fruit could be the increased malate biosynthesis via up-regulating MdPEPC and MdcyMDH expression with higher activity of PEPC and cyNADMDH, and the decreased malate degradation via limiting MdPEPCK expression with lower activity of PEPCK. Moreover, 1-MCP treatment up-regulates acid transport genes, including MdVHA-A, MdVHP and Ma1, resulting in higher malate content
62
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63
Fig. 4. Changes in transcript levels of malate metabolizing genes in apple fruit during storage at 20 C. Relative expression was normalized using b-actin as an internal control and the harvest day control sample defined as 1. Each treatment contained three replications. Vertical bars represent standard deviations of the means. Asterisks indicate significant differences between control and 1-MCP treated fruit (P < 0.05).
in the vacuole. Our results provide novel evidence for understanding molecular mechanism by which 1-MCP regulates organic acid metabolism in apple fruit during storage periods.
Acknowledgements This research was supported by the National Basic Research Program of China (973 Program, 2011CB100604) and National Natural Science Foundation of China (31030051).
References Bai, Y., Dougherty, L., Cheng, L., Xu, K., 2015. A co-expression gene network associated with developmental regulation of apple fruit acidity. Mol. Genet. Genom. 290, 1247–1263. Berüter, J., 2004. Carbohydrate metabolism in two apple genotypes that differ in malate accumulation. J. Plant Physiol. 161, 1011–1029. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Chen, J.L., Wang, Z.F., Wu, J.H., Wang, Q., Hu, X.S., 2007. Chemical compositional characterization of eight pear cultivars grown in China. Food Chem. 104, 268–275.
R. Liu et al. / Postharvest Biology and Technology 117 (2016) 57–63 Chen, F.X., Liu, X.H., Chen, L.S., 2009. Developmental changes in pulp organic acid concentration and activities of acid-metabolising enzymes during the fruit development of two loquat (Eriobotrya japonica Lindl.) cultivars differing in fruit acidity. Food Chem. 114, 657–664. Dong, Q.L., Liu, D.D., An, X.H., Hu, D.G., Yao, Y.X., Hao, Y.J., 2011. MdVHP1 encodes an apple vacuolar H+-PPase and enhances stress tolerance in transgenic apple callus and tomato. J. Plant Physiol. 168, 2124–2133. Emmerlich, V., Linka, N., Reinhold, T., Hurth, M.A., Traub, M., Martinoia, E., Neuhaus, H.E., 2003. The plant homolog to the human sodium/dicarboxylic cotransporter is the vacuolar malate carrier. Proc. Natl. Acad. Sci. U. S. A. 100, 11122–11126. Etienne, C., Moing, A., Dirlewanger, E., Raymond, P., Monet, R., Rothan, C., 2002. Isolation and characterization of six peach cDNAs encoding key proteins in organic acid metabolism and solute accumulation: involvement in regulating peach fruit acidity. Physiol. Plant. 114, 259–270. Etienne, A., Génard, M., Lobit, P., Mbeguié-A-Mbéguié, D., Bugaud, C., 2013. What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 64, 1451–1469. Fernie, A.R., Martinoia, E., 2009. Malate. Jack of all trades or master of a few? Phytochemistry 70, 828–832. Gil, A.M., Duarte, I.F., Delgadillo, I., Colquhoun, I.J., Casuscelli, F., Humpfer, E., Spraul, M., 2000. Study of the compositional changes of mango during ripening by use of nuclear magnetic resonance spectroscopy. J. Agric. Food Chem. 48, 1524–1536. Jiang, Y., Joyce, D.C., Terry, L.A., 2001. 1-Mehtylcyclopronpene treatment affects strawberry fruit decay. Postharvest Biol. Technol. 23, 227–232. Khan, S., Beekwilder, J., Schaart, J., Mumm, R., Soriano, J., Jacobsen, E., Schouten, H.J., 2013. Differences in acidity of apples are probably mainly caused by a malic acid transporter gene on LG16. Tree Genet. Genomes 9, 475–487. ska, K., 2014. 1Kolniak-Ostek, J., Wojdyło, A., Markowski, J., Siucin Methylcyclopropene postharvest treatment and their effect on apple quality during long-term storage time. Eur. Food Res. Technol. 239, 603–612. Koukounaras, A., Sfakiotakis, E., 2007. Effect of 1-MCP prestorage treatment on ethylene and CO2 production and quality of ‘Hayward’ kiwifruit during shelf-life after short, medium and long term cold storage. Postharvest Biol. Technol. 46, 174–180. Kovermann, P., Meyer, S., Hörtensteiner, S., Picco, C., Scholz-Starke, J., Ravera, S., Lee, Y., Martinoia, E., 2007. The Arabidopsis vacuolar malate channel is a member of the ALMT family. Plant J. 52, 1169–1180. Laval-Martin, D., Farineau, J., Diamond, J., 1977. Light versus dark carbon metabolism in cherry tomato fruits. Plant Physiol. 60, 872–876. Liu, H., Liu, Y., Yu, B., Liu, Z., Zhang, W., 2004. Increased polyamines conjugated to tonoplast vesicles correlate with maintenance of the H+-ATPase and H+-PPase activities and enhanced osmotic stress tolerance in wheat. J. Plant Growth Regul. 23, 156–165. Liu, R.L., Xu, Y., Li, B.Q., Qin, G.Z., Tian, S.P., 2015. The role of 1-methylcyclopropene in lipid peroxidation anti-oxidant enzyme activities, and ethylene biosynthesis in ‘Laiyang’ pear (Pyrus bretschneideri Rehd.) during fruit ripening. J. Hortic. Sci. Biotechnol. 90, 210–216. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402–408. Merlo, L., Ferretti, M., Ghisi, R., Passera, C., 1993. Developmental changes of enzymes of malate metabolism in relation to respiration, photosynthesis and nitrate assimilation in peach leaves. Physiol. Plant. 89, 71–76. Miller, S.S., Driscoll, B.T., Gregerson, R.G., Gantt, J.S., Vance, C.P., 1998. Alfalfa malate dehydrogenase MDH: molecular cloning and characterization of five different forms reveals a unique nodule-enhanced MDH. Plant J. 15, 173–184.
63
Moing, A., Svanella, L., Rolin, D., Gaudillere, M., Gaudillère, J.P., Monet, R., 1998. Compositional changes during the fruit development of two peach cultivars differing in juice acidity. J. Am. Soc. Hortic. Sci. 123, 770–775. Moing, A., Rothan, C., Svanella, L., Just, D., Diakou, P., Raymond Gaudillère, J.P., Monet, R., 2000. Role of phosphoenolpyruvate carboxylase in organic acid accumulation during peach fruit development. Physiol. Plant. 108, 1–10. Neuhaus, H.E., 2007. Transport of primary metabolites across the plant vacuolar membrane. FEBS Lett. 581, 2223–2226. Ohnishi, T., Gall, R.G., Mayer, M.L., 1975. An improved assay of inorganic phosphate in the presence of extralabile phosphate compounds: application to the ATPase assay in the presence of phosphocreatine. Anal. Biochem. 689, 261–267. Qin, G.Z., Wang, Q., Liu, J., Li, B.Q., Tian, S.P., 2009. Proteomic analysis of changes in mitochondrial protein expression during fruit senescence. Proteomics 9, 4241–4253. Qin, G.Z., Wang, Y.Y., Cao, B.H., Wang, W.H., Tian, S.P., 2012. Unraveling the regulatory network of MADS-box transcription factor RIN in fruit ripening. Plant J. 70, 243–255. Sadka, A., Dahan, E., Cohen, L., Marsh, K.B., 2000. Aconitase activity and expression during the development of lemon fruit. Physiol. Plant. 108, 255–262. Saradhuldhat, P., Paull, R.E., 2007. Pineapple organic acid metabolism and accumulation during fruit development. Sci. Hortic. 112, 297–303. Sisler, E.C., Serek, M., 1997. Inhibitors of ethylene responses in plants at the receptor level: recent developments. Physiol. Plant. 100, 577–582. Sweetman, C., Deluc, L.G., Cramer, G.R., Ford, C.M., Soole, K.L., 2009. Regulation of malate metabolism in grape berry and other developing fruits. Phytochemistry 70, 1329–1344. Terrier, N., Sauvage, F.X., Ageorges, A., Romieu, C., 2001. Changes in acidity and in proton transport at the tonoplast of grape berries during development. Planta 213, 20–28. Tian, S.P., Qin, G.Z., Li, B.Q., 2013. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. Plant Mol. Biol. 82, 593–602. Walker, R.P., Chen, Z.H., Técsi, L., Famiani, F., Lea, P.J., Leegood, R.C., 1999. Phosphoenolpyruvate carboxykinase plays a role in interaction of carbon and nitrogen metabolism during grape seed development. Planta 210, 9–18. Watkins, C.B., 2006. The use of 1-methylcyclopropene 1-MCP on fruits and vegetables. Biotechnol. Adv. 24, 389–409. Wu, B.H., Génard, M., Lescourret, F., Gomez, L., Li, S.H., 2002. Influence of assimilate and water supply on seasonal variation of acids in peach (cv Suncrest.). J. Sci. Food Agric. 82, 1829–1836. Yamaki, S., 1984. Isolation of vacuoles from immature apple fruit flesh and compartmentation of sugars organic acids, phenolic compounds and amino acids. Plant Cell Physiol. 25, 151–166. Yang, L.T., Xie, C.Y., Jiang, H.X., Chen, L.S., 2011. Expression of six malate-related genes in pulp during the fruit development of two loquat (Eriobotrya japonica) cultivars differing in fruit acidity. Afr. J. Biotechnol. 10, 2414–2422. Yao, Y.X., Li, M., Liu, Z., You, C.X., Wang, D.M., Zhai, H., Hao, Y.J., 2009. Molecular cloning of three malic acid related genes MdPEPC, MdVHA-A, MdcyME and their expression analysis in apple fruits. Sci. Hortic. 122, 404–408. Yao, Y.X., Li, M., Zhai, H., You, C.X., Hao, Y.J., 2011. Isolation and characterization of an apple cytosolic malate dehydrogenase gene reveal its function in malate synthesis. J. Plant Physiol. 168, 474–480. Zhang, Z.Q., Tian, S.P., Zhu, Z., Xu, Y., Qin, G.Z., 2012. Effects of 1-methylcyclopropene 1-MCP on ripening and resistance of jujube (Zizyphus jujube cv. Huping) fruit against postharvest disease. LWT Food Sci. Technol. 45, 13–19.