- Email: [email protected]
Molecular characteristics, antibiogram and prevalence of multi-drug resistant Staphylococcus aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis
694
Asian Pac J Trop Biomed 2017; 7(8): 694–697
Contents lists available at ScienceDirect
Asian Pacific Journal of Tropical Biomedicine journal homepage: www.elsevier.com/locate/apjtb
Original article
http://dx.doi.org/10.1016/j.apjtb.2017.07.005
Molecular characteristics, antibiogram and prevalence of multi-drug resistant Staphylococcus aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis Zuhair Bani Ismail* Department of Veterinary Clinical Sciences, Faculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, 22110, Jordan
A R TI C L E I N F O
ABSTRACT
Article history: Received 30 Jun 2017 Received in revised form 12 Jul 2017 Accepted 26 Jul 2017 Available online 2 Aug 2017
Objectives: To study the molecular characteristics, antibiogram and prevalence of multidrug resistant Staphylococcus aureus (S. aureus) (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis. Methods: Bacteria were cultured from 188 quarter milk samples obtained from cows before culling (n = 139) and from cows affected with acute mastitis (n = 49) belonging to 10 dairy farms. The bacteria were identified using colony morphology, Gram staining and biochemical characteristics. S. aureus isolates were then subjected to molecular characterization using PCR targeting 16S rRNA and mecA gene to identify Methicillin resistant S. aureus (MRSA). The antibiogram of all isolates was performed using the Kirby–Bauer disk diffusion method against 10 commonly used antibiotics in dairy farms. Results: S. aureus was isolated from 19 (13.7%) samples obtained from culled cows and 11 (22.4%) samples obtained from cows with acute mastitis. In both culled cows and cows with acute mastitis, in vitro antibiogram revealed that 100% of S. aureus isolates were resistant to erythromycin, penicillin G, streptomycin, doxycyclin, and trimethoprim/ sulpha. The prevalence of MRSA in milk of culled cows and cows with acute mastitis was 26.3% and 18.2%, respectively, with an overall prevalence of 3.7% among all samples. All MRSA isolates were completely resistant to all tested antibiotics. All MRSA isolates were positive for the presence of the mecA gene. Conclusions: MRSA carrying the mecA gene were isolated from mastitic milk from dairy cows in Jordan for the first time. MRSA may pose a potential health risk to the public, farm workers and veterinarians.
Keywords: Antibiogram Mastitis pathogens Dairy cows Multi-drug resistance
1. Introduction Mastitis is one of the most clinically and economically important diseases in dairy cows [1–6]. The prevalence and causative agents of mastitis in dairy cows in Jordan have been reported previously [5–7]. In one study, the prevalence of clinical mastitis in pre-calving secretions, colostrum and milk in Jordan was reported at about 57% (89 of 156), 22% (40 of *Corresponding author: Zuhair Bani Ismail, Department of Veterinary Clinical Sciences, Faculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, 22110, Jordan. Tel: +962 79 6654331 Fax: +962 2 7095123 E-mail: [email protected] Peer review under responsibility of Hainan Medical University. The journal implements double-blind peer review practiced by specially invited international editorial board members.
180) and 19% (56 of 298), respectively [5]. The prevalence of subclinical mastitis was 94% (239 of 254 milk samples) [5]. In Jordan, Staphylococcus aureus (S. aureus) is considered the most common cause of clinical, subclinical and chronic mastitis in dairy cows with a prevalence rate ranging from 40% to 60% [5–7]. Other bacteria that have been isolated from clinical and subclinical mastitis cases include Escherichia coli (E. coli), Streptococcus non-agalactiea and coagulase negative Staphylococci [8]. Systemic and intramammary antibiotic administration is a common practice used to treat mastitis worldwide [9]. Long history of using common antibacterial agents in dairy farms to combat infectious diseases including mastitis has resulted in the emergence of resistant bacterial strains. In one study in Jordan, 87.4% and 84.5% of isolates were resistant to sulfa/ trimethoprim and penicillin G, respectively [8]. Similar results
2221-1691/Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Zuhair Bani Ismail/Asian Pac J Trop Biomed 2017; 7(8): 694–697
were reported against ciprofloxacin, gentamicin, lincomycin, streptomycin and penicillin G [5,6]. Resistant S. aureus strains to Methicillin or (MRSA) have been characterized by the presence of mecA gene that carries resistance to b-lactam antibiotics [10]. However, the resistance patterns of isolated S. aureus from cases of mastitis in recent years indicate the emergence of multi-drug resistance S. aureus (MDRSA) strains which may impose a significant threat to human health in Jordan [5–8]. Therefore, the aims of this research were to study the molecular characteristics, antibiogram and prevalence of multidrug resistant S. aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis.
2. Materials and methods 2.1. Collection of milk samples Quarter milk samples were collected aseptically from cows before culling from 10 dairy farms located in Northern Jordan. Milk samples were also collected from cases of acute mastitis in these farms during the period between January and December 2016. Samples were placed in sterile plain blood tubes and transported to the laboratory on ice within 2–4 h after collection for analysis.
2.2. Bacterial culture and identification Blood and MacConkey agar plates were used to initially culture the bacteria from milk samples as described previously [11]. After inoculation, plates were incubated aerobically at 37 C for 24 h [11]. Initial identification of bacteria was based on colony morphology and Gram's staining characteristics. Further classification of bacteria was carried out using catalase and coagulase reactions. Bacteria with large hemolytic zone and catalase and coagulase positive were considered S. aureus. Staphylococcus colonies with negative coagulase activity were considered coagulase-negative staphylococci (CNS). All staphylococci isolates were then confirmed using the API ID 32 Staph (Bio Merieux, France). Gram-negative, lactose fermenter on MacConkey agar and oxidase negative bacteria were identified as E. coli.
2.3. Antibiogram To determine the antibiogram of isolated bacteria, the Kirby– Bauer disk diffusion method was used with modification [12]. Ten commonly used antibiotics in dairy farms were used namely: ampicillin (10 mg), penicillin G (10 IU), streptomycin (10 mg), gentamycin (10 mg), erythromycin (15 mg), ciprofloxacin (5 mg), oxytetracycline (30 mg), trimethoprim/sulphamethoxazole (25 mg), enrofloxacin (5 mg), and doxycyclin (30 mg). Sensitivity results were classified as susceptible or resistant. In this study, we modified the classification of the sensitivity results from susceptible, intermediate, or resistant to only susceptible or resistant. We considered the result ‘intermediate’ as resistant because of our field clinical observation of the widespread resistance of bacteria against antibacterial therapy.
2.4. Determination of methicillin-resistant S. aureus Isolated strains of S. aureus were further examined to identify methicillin-resistant S. aureus (MRSA) [13]. Bacteria were
695
inoculated on Tryptone soya broth (TSB) with 10% sodium chloride salt (TSB-S) (Hi-media) and incubated at 37 C for 24–48 h. Samples with turbid appearance were subcultured on mannitol salt agar (Hi-media) with 6 mg/L oxacillin (O-MS agar) and incubated for 24–48 h at 37 C. Bacterial growth on mannitol salt agar with round-shaped, golden-yellow, or palecolored colonies were considered oxacillin-resistant staphylococci. Grown bacteria on mannitol salt agar were further confirmed using Gram's staining and catalase test. Gram-positive bacteria that was oxacillin resistant and mannitol fermenter were considered as MRSA isolates.
2.5. Identification of S. aureus using PCR targeting 16S rRNA Isolated strains that were classified as MRSA were further confirmed by S. aureus-specific polymerase chain reaction (PCR) targeting 16S rRNA using the primer sequences: F-50 GTAGGTGGCCAAGCGTTATCC 30 and R-50 CGCACATCAGCGTCAG 30 [13]. The PCR reaction was performed with 1× PCR buffer (pH-8.3; 15 mM MgCl2), 5 mM of deoxynucleotide triphosphates (dNTPs), 20 pmol of forward and reverse primers, 1 U Taq DNA polymerase, 2 mL of DNA template per reaction in a final volume of 25 mL. The PCR cycling conditions were optimized with initial denaturation at 94 C for 5 min, followed by 35 cycles of denaturation at 94 C for 1 min, annealing at 50 C for 1 min, and extension at 72 C for 1 min with the final extension at 72 C for 10 min.
2.6. Detection of mecA gene in isolated S. aureus The presence of mecA gene in S. aureus isolates was also evaluated as previously described [13]. Briefly, a 25.0 mL volume of PCR reaction mixture contained 1.0 mL of genomic DNA, 12.5 mL of PCR master mix, 7.5 mL PCR H2O and 2 mL each of mecA primers. The following primers were used: F-50 TCCAGATTACAACTTCACCAGG 30 and R-50 CCACTTC ATATCTTGTAACG 30 with the amplicon size of 162 bp. The PCR cycling conditions were: denaturation at 94 C for 30 s, annealing at 55 C for 30 s, extension at 72 C for 1 min, final extension at 72 C for 5 min, and cooling to 4 C. The products of PCR amplification were analyzed using agarose gel electrophoresis (Hi media, India) on tris acetateethylene diamine tetra acetic acid buffer containing ethidium bromide (0.5 mg/mL). Gels were visualized and photographed under gel documentation system (Biorad).
3. Results In total, 188 quarter milk samples were collected from culled dairy cows (139) and from clinical mastitis cases (49). Culled cows were removed from the herd because of different reasons but not necessarily because of mastitis. S. aureus was revealed from 19 (13.7%) milk samples obtained from culled cows and 11 (22.4%) milk samples obtained from acute mastitis cases. Coagulasenegative staphylococci (CNS) were revealed from 6 samples obtained from culled cows and 5 samples obtained from cows with acute mastitis. E. coli was revealed from 1 sample obtained from culled cows and 18 samples obtained from cows with mastitis. No growth was reported in 113 samples obtained from culled cows and 15 samples obtained from cows with acute mastitis.
696
Zuhair Bani Ismail/Asian Pac J Trop Biomed 2017; 7(8): 694–697
Table 1 Number and percentages of S. aureus isolates from milk obtained from culled dairy cows and from acute mastitis cases that are resistant to different antibiotic in vitro. Antibiotic Enrofluxacin Ciprofluxacin Gentamicin Ampicillin Oxytetracycline Erythromycin Penicillin G Streptomycin Doxycycline Trimethoprin/ Sulpha
Culled cows (n = 19) 2 5 7 14 17 19 19 19 19 19
(10.5) (26.3) (37) (73.6) (89.4) (100) (100) (100) (100) (100)
Acute mastitis cows (n = 11) 3 3 7 9 8 11 11 11 11 11
(27) (27) (63.6) (82) (72.7) (100) (100) (100) (100) (100)
The in vitro antibiogram of S. aureus isolates is shown in Table 1. In culled dairy cows and acute mastitis cases, 100% of S. aureus isolates were resistant to erythromycin, penicillin G, streptomycin, doxycyclin, and trimethoprim/sulpha. In culled cows, the most sensitive antibiotic was enrofluxacin followed by ciprofloxacin, gentamicin, ampicillin, and oxytetracycline. In cases of acute mastitis, the most sensitive antibiotics were enrofluxacin and ciprofloxacin followed by gentamicin, ampicillin and oxytetracycline. The prevalence of MRSA in milk of culled cows and cows with acute mastitis was 26.3% and 18.2%, respectively, with an overall prevalence of 3.7% among all samples. In total, there were 5 S. aureus isolates from culled cows and 2 isolates from acute mastitis cases that were classified as MRSA according to the mannitol fermentation and 16S rRNA amplification tests. All MRSA classified isolates were positive for the presence of the mecA gene. MRSA isolates from milk of both culled cows and acute mastitis cases were completely resistant to all tested antibiotics.
world [23]. MRSA has been isolated from pigs and pigassociated farmers in many countries around the world [24–26]. Severe illness caused by animal associated MRSA has been reported in both humans and animals [27−29]. As it has been reported previously, all MRSA isolates in this study were multidrug resistant (MDR) [30]. MDR S. aureus infections have been associated with higher morbidly and cost and longer hospitalization times in human patients [30]. In Jordan, this is the first time that MRSA is being isolated from milk of dairy cows. This was confirmed by the detection of mecA gene which encodes a protein responsible for b-lactam resistance in Staphylococci [17]. There were a total of 7 (3.7%) MRSA isolates in this study, all carrying the mecA gene from milk of both culled cows and cows with acute mastitis. Other studies have reported MRSA in 0.3% and 1% in cattle and calves [18]. There are a variety of mecA gene homologies that may account for the variability in the rates of mecA gene detection in isolated S. aureus strains using PCR in different studies [19]. In conclusion, MRSA carrying the mecA gene was isolated from milk of dairy cows in Jordan for the first time. The antibiogram of the isolated MRSA strains revealed multi-drug resistance which may pose a serious threat to public health, farm-associated workers and veterinarians.
Conflict of interest statement We declare that we have no conflict of interest.
Acknowledgments This research was sponsored by the Deanship of Research at Jordan University of Science and Technology (Grant Number 195/2016).
References 4. Discussion The most interesting finding in this study was that the rate of S. aureus isolated from milk of culled cows was double the rate of which it was isolated from cows with acute mastitis. At the same time, E. coli was far more frequently isolated in acute cases than from milk of culled cows. These results reflect on the pathogenesis of each organism and the current dairy farm management practices. Acute mastitis due to environmental pathogens has been dominating in recent years due to better understanding of pathogenesis and improved practices that used to prevent contagious pathogens such as S. aureus in dairy farms [14]. S. aureus is considered one of the most common reasons for antibacterial use in dairy farms. This has lead to the emergence and widespread of pathogens with multi-drug resistance patterns [15–18]. The antibiogram of different bacterial isolates including S. aureus from mastitic milk in Jordan have shown an alarmingly increasing resistance patterns against a wide range of antibacterial agents [5–7]. Similarly in this study, S. aureus isolates were resistance to most of the antibiotics tested. The presence of MRSA in bovine milk poses a serious threat to public health, farm-associated workers and veterinarians [19– 22]. Although S. aureus is a common cause of mastitis in dairy cows, Methicillin-resistant S. aureus (MRSA) has only been isolated from bovine milk in a sporadic pattern throughout the
[1] Cha E, Hertl JA, Schukken YH, Tauer LW, Welcome FL, Grohn YT. The effect of repeated episodes of bacteria-specific clinical mastitis on mortality and culling in Holstein dairy cows. J Dairy Sci 2013; 96: 4993-5007. [2] Unnerstad HE, Lindberg A, Waller KP, Ekman T, Artursson K, Nilsson-Ost M, et al. Microbial etiology of acute clinical mastitis and agent-specific risk factors. Vet Microbiol 2009; 137: 90-7. [3] De Vliegher S, Fox LK, Piepers S, McDougall S, Barkema HW. Invited review: mastitis in dairy heifers: nature of the disease, potential impact, prevention, and control. J Dairy Sci 2012; 95: 1025-40. [4] Persson Y, Nyman AK, Gr¨onlund-Andersson U. Etiology and antimicrobial susceptibility of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Vet Scand 2011; 53: 36. [5] Al-Tarazi YH, Chakiso AY, Lafi SQ. Prevalence and distribution of bovine mastitis pathogens and their antimicrobial resistance in primiparous dairy heifers in Northern Jordan. Jordan J Agric Sci 2011; 7: 529-39. [6] Alekish MO. The association between the somatic cell count and isolated microorganisms during subclinical mastitis in heifers in Jordan. Vet Med (Praha) 2015; 60: 71-6. [7] Alekish MO, Al-Qudah K, Al-Saleh A. Prevalence of antimicrobial resistance among bacterial pathogens isolated from bovine mastitis in northern Jordan. Rev M´ed V´et 2013; 164: 319-26. [8] Oliveira L, Ruegg PL. Treatments of clinical mastitis occurring in cows on 51 large dairy herds in Wisconsin. J Dairy Sci 2014; 97: 5426-36.
Zuhair Bani Ismail/Asian Pac J Trop Biomed 2017; 7(8): 694–697
[9] Vishnupriya S, Anthony PX, Mukhopadhyay HK, Pillai RM, Thanislass J, Vivek SVM, et al. Methicillin-resistant staphylococci associated with bovine mastitis and their zoonotic importance. Vet World 2014; 7: 422-7. [10] Jahan M, Rahman M, Parvej S, Chowdhury ZH, Haque E, Talukder AK, et al. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. J Adv Vet Anim Res 2015; 2: 49-55. [11] Alekish MO. The association between the somatic cell count and isolated microorganisms during subclinical mastitis in heifers in Jordan. Vet Med 2015; 60: 71-6. [12] Hendriksen R, Mevius D, Schroeter A, Teale C, Meunier D, Butaue P. Prevalence of antimicrobial resistance among bacterial pathogens isolated from cattle in different European countries: 2002-2004. Acta Vet Scand 2008; 50: 28. [13] Ahmed BO, Elmekki AM, Omer EE, Elhassan M. Molecular detection of methicillin-resistant Staphylococcus aureus in patients with urinary tract infections in Khartoum State. J Sci Technol 2014; 15: 1-8. [14] Makovec JA, Ruegg PL. Results of milk samples submitted for microbiological examination in Wisconsin from 1994 to 2001. J Dairy Sci 2003; 86: 3466-72. [15] Koch R, Schaumburg F, Mellmann A, Koksal M, Jurke A, Becker K, et al. Livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) as causes of human infection and colonization in Germany. PLoS One 2013; 8: e55040. [16] Fessler A, Scott C, Kadlec K, Ehricht R, Monecke S, Schwarz S. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. J Antimicrob Chemother 2010; 65: 619-25. [17] Huber H, Koller S, Giezendanner N, Stephan R, Zweifel C. Prevalence and characteristics of meticillin-resistant Staphylococcus aureus in humans in contact with farm animals, in livestock, and in food of animal origin, Switzerland. Euro Surveill 2009; 15: 1-4. [18] Ruegg PL. Dairy production medicine. New Jersey, US: John Wiley & Sons Inc.; 2011. p. 207-32. [19] Cosgrove SE. The relationship between antimicrobial resistance and patient outcomes: mortality, length of hospital stay, and health care costs. Clin Infect Dis 2006; 42: S82-9.
697
[20] Juh´asz-Kaszanyitzky E, J´anosi S, Somogyi P, D´an A, van der Graaf-van Bloois L, van Duijkeren E, et al. MRSA transmission between cows and humans. Emerg Infect Dis 2007; 13: 630-2. [21] Febler AT, Billerbeck C, Kadlec K, Schwarz S. Identification and characterization of methicillin resistant coagulase-negative staphylococci from bovine mastitis. Antimicrob Chemother 2010; 65: 1576-82. [22] Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005. Emerg Infect Dis 2007; 13: 1840-6. [23] Hata E. Bovine mastitis outbreak in Japan caused by methicillinresistant Staphylococcus aureus New York/Japan clone. J Vet Diagn Invest 2016; 28: 291-8. [24] de Neeling AJ, van den Broek MJ, Spalburg EC, van SantenVerheuvel MG, Dam-Deisz WD, Boshuizen HC, et al. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol 2007; 122: 366-72. [25] Denis O, Suetens C, Hallin M, Catry B, Ramboer I, Dispas M, et al. Methicillin-resistant Staphylococcus aureus ST398 in swine farm personnel, Belgium. Emerg Infect Dis 2009; 15: 1098-101. [26] Khanna T, Friendship R, Dewey C, Weese JS. Methicillin resistant Staphylococcus aureus colonization in pigs and pig farmers. Vet Microbiol 2008; 128: 298-303. [27] Declercq P, Petre D, Gordts B, Voss A. Complicated community acquired soft tissue infection by MRSA from porcine origin. Infection 2008; 36: 590-2. [28] Lewis HC, Mølbak K, Reese C, Aarestrup FM, Selchau M, Sørum M, et al. Pigs as source of methicillin-resistant Staphylococcus aureus CC398 infections in humans, Denmark. Emerg Infect Dis 2008; 14: 1383-9. [29] Witte W, Strommenger B, Stanek C, Cuny C. Methicillin-resistant Staphylococcus aureus ST398 in humans and animals, central Europe. Emerg Infect Dis 2007; 13: 255-8. [30] Noskin GA, Rubin RJ, Schentag JJ, Kluytmans J, Hedblom EC, Smulders M, et al. The burden of Staphylococcus aureus infections on hospitals in the United States: an analysis of the 2000 and 2001 Nationwide Inpatient Sample Database. Arch Intern Med 2005; 165: 1756-61.
Asian Pac J Trop Biomed 2017; 7(8): 694–697
Contents lists available at ScienceDirect
Asian Pacific Journal of Tropical Biomedicine journal homepage: www.elsevier.com/locate/apjtb
Original article
http://dx.doi.org/10.1016/j.apjtb.2017.07.005
Molecular characteristics, antibiogram and prevalence of multi-drug resistant Staphylococcus aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis Zuhair Bani Ismail* Department of Veterinary Clinical Sciences, Faculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, 22110, Jordan
A R TI C L E I N F O
ABSTRACT
Article history: Received 30 Jun 2017 Received in revised form 12 Jul 2017 Accepted 26 Jul 2017 Available online 2 Aug 2017
Objectives: To study the molecular characteristics, antibiogram and prevalence of multidrug resistant Staphylococcus aureus (S. aureus) (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis. Methods: Bacteria were cultured from 188 quarter milk samples obtained from cows before culling (n = 139) and from cows affected with acute mastitis (n = 49) belonging to 10 dairy farms. The bacteria were identified using colony morphology, Gram staining and biochemical characteristics. S. aureus isolates were then subjected to molecular characterization using PCR targeting 16S rRNA and mecA gene to identify Methicillin resistant S. aureus (MRSA). The antibiogram of all isolates was performed using the Kirby–Bauer disk diffusion method against 10 commonly used antibiotics in dairy farms. Results: S. aureus was isolated from 19 (13.7%) samples obtained from culled cows and 11 (22.4%) samples obtained from cows with acute mastitis. In both culled cows and cows with acute mastitis, in vitro antibiogram revealed that 100% of S. aureus isolates were resistant to erythromycin, penicillin G, streptomycin, doxycyclin, and trimethoprim/ sulpha. The prevalence of MRSA in milk of culled cows and cows with acute mastitis was 26.3% and 18.2%, respectively, with an overall prevalence of 3.7% among all samples. All MRSA isolates were completely resistant to all tested antibiotics. All MRSA isolates were positive for the presence of the mecA gene. Conclusions: MRSA carrying the mecA gene were isolated from mastitic milk from dairy cows in Jordan for the first time. MRSA may pose a potential health risk to the public, farm workers and veterinarians.
Keywords: Antibiogram Mastitis pathogens Dairy cows Multi-drug resistance
1. Introduction Mastitis is one of the most clinically and economically important diseases in dairy cows [1–6]. The prevalence and causative agents of mastitis in dairy cows in Jordan have been reported previously [5–7]. In one study, the prevalence of clinical mastitis in pre-calving secretions, colostrum and milk in Jordan was reported at about 57% (89 of 156), 22% (40 of *Corresponding author: Zuhair Bani Ismail, Department of Veterinary Clinical Sciences, Faculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, 22110, Jordan. Tel: +962 79 6654331 Fax: +962 2 7095123 E-mail: [email protected] Peer review under responsibility of Hainan Medical University. The journal implements double-blind peer review practiced by specially invited international editorial board members.
180) and 19% (56 of 298), respectively [5]. The prevalence of subclinical mastitis was 94% (239 of 254 milk samples) [5]. In Jordan, Staphylococcus aureus (S. aureus) is considered the most common cause of clinical, subclinical and chronic mastitis in dairy cows with a prevalence rate ranging from 40% to 60% [5–7]. Other bacteria that have been isolated from clinical and subclinical mastitis cases include Escherichia coli (E. coli), Streptococcus non-agalactiea and coagulase negative Staphylococci [8]. Systemic and intramammary antibiotic administration is a common practice used to treat mastitis worldwide [9]. Long history of using common antibacterial agents in dairy farms to combat infectious diseases including mastitis has resulted in the emergence of resistant bacterial strains. In one study in Jordan, 87.4% and 84.5% of isolates were resistant to sulfa/ trimethoprim and penicillin G, respectively [8]. Similar results
2221-1691/Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Zuhair Bani Ismail/Asian Pac J Trop Biomed 2017; 7(8): 694–697
were reported against ciprofloxacin, gentamicin, lincomycin, streptomycin and penicillin G [5,6]. Resistant S. aureus strains to Methicillin or (MRSA) have been characterized by the presence of mecA gene that carries resistance to b-lactam antibiotics [10]. However, the resistance patterns of isolated S. aureus from cases of mastitis in recent years indicate the emergence of multi-drug resistance S. aureus (MDRSA) strains which may impose a significant threat to human health in Jordan [5–8]. Therefore, the aims of this research were to study the molecular characteristics, antibiogram and prevalence of multidrug resistant S. aureus (MDRSA) isolated from milk obtained from culled dairy cows and from cows with acute clinical mastitis.
2. Materials and methods 2.1. Collection of milk samples Quarter milk samples were collected aseptically from cows before culling from 10 dairy farms located in Northern Jordan. Milk samples were also collected from cases of acute mastitis in these farms during the period between January and December 2016. Samples were placed in sterile plain blood tubes and transported to the laboratory on ice within 2–4 h after collection for analysis.
2.2. Bacterial culture and identification Blood and MacConkey agar plates were used to initially culture the bacteria from milk samples as described previously [11]. After inoculation, plates were incubated aerobically at 37 C for 24 h [11]. Initial identification of bacteria was based on colony morphology and Gram's staining characteristics. Further classification of bacteria was carried out using catalase and coagulase reactions. Bacteria with large hemolytic zone and catalase and coagulase positive were considered S. aureus. Staphylococcus colonies with negative coagulase activity were considered coagulase-negative staphylococci (CNS). All staphylococci isolates were then confirmed using the API ID 32 Staph (Bio Merieux, France). Gram-negative, lactose fermenter on MacConkey agar and oxidase negative bacteria were identified as E. coli.
2.3. Antibiogram To determine the antibiogram of isolated bacteria, the Kirby– Bauer disk diffusion method was used with modification [12]. Ten commonly used antibiotics in dairy farms were used namely: ampicillin (10 mg), penicillin G (10 IU), streptomycin (10 mg), gentamycin (10 mg), erythromycin (15 mg), ciprofloxacin (5 mg), oxytetracycline (30 mg), trimethoprim/sulphamethoxazole (25 mg), enrofloxacin (5 mg), and doxycyclin (30 mg). Sensitivity results were classified as susceptible or resistant. In this study, we modified the classification of the sensitivity results from susceptible, intermediate, or resistant to only susceptible or resistant. We considered the result ‘intermediate’ as resistant because of our field clinical observation of the widespread resistance of bacteria against antibacterial therapy.
2.4. Determination of methicillin-resistant S. aureus Isolated strains of S. aureus were further examined to identify methicillin-resistant S. aureus (MRSA) [13]. Bacteria were
695
inoculated on Tryptone soya broth (TSB) with 10% sodium chloride salt (TSB-S) (Hi-media) and incubated at 37 C for 24–48 h. Samples with turbid appearance were subcultured on mannitol salt agar (Hi-media) with 6 mg/L oxacillin (O-MS agar) and incubated for 24–48 h at 37 C. Bacterial growth on mannitol salt agar with round-shaped, golden-yellow, or palecolored colonies were considered oxacillin-resistant staphylococci. Grown bacteria on mannitol salt agar were further confirmed using Gram's staining and catalase test. Gram-positive bacteria that was oxacillin resistant and mannitol fermenter were considered as MRSA isolates.
2.5. Identification of S. aureus using PCR targeting 16S rRNA Isolated strains that were classified as MRSA were further confirmed by S. aureus-specific polymerase chain reaction (PCR) targeting 16S rRNA using the primer sequences: F-50 GTAGGTGGCCAAGCGTTATCC 30 and R-50 CGCACATCAGCGTCAG 30 [13]. The PCR reaction was performed with 1× PCR buffer (pH-8.3; 15 mM MgCl2), 5 mM of deoxynucleotide triphosphates (dNTPs), 20 pmol of forward and reverse primers, 1 U Taq DNA polymerase, 2 mL of DNA template per reaction in a final volume of 25 mL. The PCR cycling conditions were optimized with initial denaturation at 94 C for 5 min, followed by 35 cycles of denaturation at 94 C for 1 min, annealing at 50 C for 1 min, and extension at 72 C for 1 min with the final extension at 72 C for 10 min.
2.6. Detection of mecA gene in isolated S. aureus The presence of mecA gene in S. aureus isolates was also evaluated as previously described [13]. Briefly, a 25.0 mL volume of PCR reaction mixture contained 1.0 mL of genomic DNA, 12.5 mL of PCR master mix, 7.5 mL PCR H2O and 2 mL each of mecA primers. The following primers were used: F-50 TCCAGATTACAACTTCACCAGG 30 and R-50 CCACTTC ATATCTTGTAACG 30 with the amplicon size of 162 bp. The PCR cycling conditions were: denaturation at 94 C for 30 s, annealing at 55 C for 30 s, extension at 72 C for 1 min, final extension at 72 C for 5 min, and cooling to 4 C. The products of PCR amplification were analyzed using agarose gel electrophoresis (Hi media, India) on tris acetateethylene diamine tetra acetic acid buffer containing ethidium bromide (0.5 mg/mL). Gels were visualized and photographed under gel documentation system (Biorad).
3. Results In total, 188 quarter milk samples were collected from culled dairy cows (139) and from clinical mastitis cases (49). Culled cows were removed from the herd because of different reasons but not necessarily because of mastitis. S. aureus was revealed from 19 (13.7%) milk samples obtained from culled cows and 11 (22.4%) milk samples obtained from acute mastitis cases. Coagulasenegative staphylococci (CNS) were revealed from 6 samples obtained from culled cows and 5 samples obtained from cows with acute mastitis. E. coli was revealed from 1 sample obtained from culled cows and 18 samples obtained from cows with mastitis. No growth was reported in 113 samples obtained from culled cows and 15 samples obtained from cows with acute mastitis.
696
Zuhair Bani Ismail/Asian Pac J Trop Biomed 2017; 7(8): 694–697
Table 1 Number and percentages of S. aureus isolates from milk obtained from culled dairy cows and from acute mastitis cases that are resistant to different antibiotic in vitro. Antibiotic Enrofluxacin Ciprofluxacin Gentamicin Ampicillin Oxytetracycline Erythromycin Penicillin G Streptomycin Doxycycline Trimethoprin/ Sulpha
Culled cows (n = 19) 2 5 7 14 17 19 19 19 19 19
(10.5) (26.3) (37) (73.6) (89.4) (100) (100) (100) (100) (100)
Acute mastitis cows (n = 11) 3 3 7 9 8 11 11 11 11 11
(27) (27) (63.6) (82) (72.7) (100) (100) (100) (100) (100)
The in vitro antibiogram of S. aureus isolates is shown in Table 1. In culled dairy cows and acute mastitis cases, 100% of S. aureus isolates were resistant to erythromycin, penicillin G, streptomycin, doxycyclin, and trimethoprim/sulpha. In culled cows, the most sensitive antibiotic was enrofluxacin followed by ciprofloxacin, gentamicin, ampicillin, and oxytetracycline. In cases of acute mastitis, the most sensitive antibiotics were enrofluxacin and ciprofloxacin followed by gentamicin, ampicillin and oxytetracycline. The prevalence of MRSA in milk of culled cows and cows with acute mastitis was 26.3% and 18.2%, respectively, with an overall prevalence of 3.7% among all samples. In total, there were 5 S. aureus isolates from culled cows and 2 isolates from acute mastitis cases that were classified as MRSA according to the mannitol fermentation and 16S rRNA amplification tests. All MRSA classified isolates were positive for the presence of the mecA gene. MRSA isolates from milk of both culled cows and acute mastitis cases were completely resistant to all tested antibiotics.
world [23]. MRSA has been isolated from pigs and pigassociated farmers in many countries around the world [24–26]. Severe illness caused by animal associated MRSA has been reported in both humans and animals [27−29]. As it has been reported previously, all MRSA isolates in this study were multidrug resistant (MDR) [30]. MDR S. aureus infections have been associated with higher morbidly and cost and longer hospitalization times in human patients [30]. In Jordan, this is the first time that MRSA is being isolated from milk of dairy cows. This was confirmed by the detection of mecA gene which encodes a protein responsible for b-lactam resistance in Staphylococci [17]. There were a total of 7 (3.7%) MRSA isolates in this study, all carrying the mecA gene from milk of both culled cows and cows with acute mastitis. Other studies have reported MRSA in 0.3% and 1% in cattle and calves [18]. There are a variety of mecA gene homologies that may account for the variability in the rates of mecA gene detection in isolated S. aureus strains using PCR in different studies [19]. In conclusion, MRSA carrying the mecA gene was isolated from milk of dairy cows in Jordan for the first time. The antibiogram of the isolated MRSA strains revealed multi-drug resistance which may pose a serious threat to public health, farm-associated workers and veterinarians.
Conflict of interest statement We declare that we have no conflict of interest.
Acknowledgments This research was sponsored by the Deanship of Research at Jordan University of Science and Technology (Grant Number 195/2016).
References 4. Discussion The most interesting finding in this study was that the rate of S. aureus isolated from milk of culled cows was double the rate of which it was isolated from cows with acute mastitis. At the same time, E. coli was far more frequently isolated in acute cases than from milk of culled cows. These results reflect on the pathogenesis of each organism and the current dairy farm management practices. Acute mastitis due to environmental pathogens has been dominating in recent years due to better understanding of pathogenesis and improved practices that used to prevent contagious pathogens such as S. aureus in dairy farms [14]. S. aureus is considered one of the most common reasons for antibacterial use in dairy farms. This has lead to the emergence and widespread of pathogens with multi-drug resistance patterns [15–18]. The antibiogram of different bacterial isolates including S. aureus from mastitic milk in Jordan have shown an alarmingly increasing resistance patterns against a wide range of antibacterial agents [5–7]. Similarly in this study, S. aureus isolates were resistance to most of the antibiotics tested. The presence of MRSA in bovine milk poses a serious threat to public health, farm-associated workers and veterinarians [19– 22]. Although S. aureus is a common cause of mastitis in dairy cows, Methicillin-resistant S. aureus (MRSA) has only been isolated from bovine milk in a sporadic pattern throughout the
[1] Cha E, Hertl JA, Schukken YH, Tauer LW, Welcome FL, Grohn YT. The effect of repeated episodes of bacteria-specific clinical mastitis on mortality and culling in Holstein dairy cows. J Dairy Sci 2013; 96: 4993-5007. [2] Unnerstad HE, Lindberg A, Waller KP, Ekman T, Artursson K, Nilsson-Ost M, et al. Microbial etiology of acute clinical mastitis and agent-specific risk factors. Vet Microbiol 2009; 137: 90-7. [3] De Vliegher S, Fox LK, Piepers S, McDougall S, Barkema HW. Invited review: mastitis in dairy heifers: nature of the disease, potential impact, prevention, and control. J Dairy Sci 2012; 95: 1025-40. [4] Persson Y, Nyman AK, Gr¨onlund-Andersson U. Etiology and antimicrobial susceptibility of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Vet Scand 2011; 53: 36. [5] Al-Tarazi YH, Chakiso AY, Lafi SQ. Prevalence and distribution of bovine mastitis pathogens and their antimicrobial resistance in primiparous dairy heifers in Northern Jordan. Jordan J Agric Sci 2011; 7: 529-39. [6] Alekish MO. The association between the somatic cell count and isolated microorganisms during subclinical mastitis in heifers in Jordan. Vet Med (Praha) 2015; 60: 71-6. [7] Alekish MO, Al-Qudah K, Al-Saleh A. Prevalence of antimicrobial resistance among bacterial pathogens isolated from bovine mastitis in northern Jordan. Rev M´ed V´et 2013; 164: 319-26. [8] Oliveira L, Ruegg PL. Treatments of clinical mastitis occurring in cows on 51 large dairy herds in Wisconsin. J Dairy Sci 2014; 97: 5426-36.
Zuhair Bani Ismail/Asian Pac J Trop Biomed 2017; 7(8): 694–697
[9] Vishnupriya S, Anthony PX, Mukhopadhyay HK, Pillai RM, Thanislass J, Vivek SVM, et al. Methicillin-resistant staphylococci associated with bovine mastitis and their zoonotic importance. Vet World 2014; 7: 422-7. [10] Jahan M, Rahman M, Parvej S, Chowdhury ZH, Haque E, Talukder AK, et al. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. J Adv Vet Anim Res 2015; 2: 49-55. [11] Alekish MO. The association between the somatic cell count and isolated microorganisms during subclinical mastitis in heifers in Jordan. Vet Med 2015; 60: 71-6. [12] Hendriksen R, Mevius D, Schroeter A, Teale C, Meunier D, Butaue P. Prevalence of antimicrobial resistance among bacterial pathogens isolated from cattle in different European countries: 2002-2004. Acta Vet Scand 2008; 50: 28. [13] Ahmed BO, Elmekki AM, Omer EE, Elhassan M. Molecular detection of methicillin-resistant Staphylococcus aureus in patients with urinary tract infections in Khartoum State. J Sci Technol 2014; 15: 1-8. [14] Makovec JA, Ruegg PL. Results of milk samples submitted for microbiological examination in Wisconsin from 1994 to 2001. J Dairy Sci 2003; 86: 3466-72. [15] Koch R, Schaumburg F, Mellmann A, Koksal M, Jurke A, Becker K, et al. Livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) as causes of human infection and colonization in Germany. PLoS One 2013; 8: e55040. [16] Fessler A, Scott C, Kadlec K, Ehricht R, Monecke S, Schwarz S. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. J Antimicrob Chemother 2010; 65: 619-25. [17] Huber H, Koller S, Giezendanner N, Stephan R, Zweifel C. Prevalence and characteristics of meticillin-resistant Staphylococcus aureus in humans in contact with farm animals, in livestock, and in food of animal origin, Switzerland. Euro Surveill 2009; 15: 1-4. [18] Ruegg PL. Dairy production medicine. New Jersey, US: John Wiley & Sons Inc.; 2011. p. 207-32. [19] Cosgrove SE. The relationship between antimicrobial resistance and patient outcomes: mortality, length of hospital stay, and health care costs. Clin Infect Dis 2006; 42: S82-9.
697
[20] Juh´asz-Kaszanyitzky E, J´anosi S, Somogyi P, D´an A, van der Graaf-van Bloois L, van Duijkeren E, et al. MRSA transmission between cows and humans. Emerg Infect Dis 2007; 13: 630-2. [21] Febler AT, Billerbeck C, Kadlec K, Schwarz S. Identification and characterization of methicillin resistant coagulase-negative staphylococci from bovine mastitis. Antimicrob Chemother 2010; 65: 1576-82. [22] Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005. Emerg Infect Dis 2007; 13: 1840-6. [23] Hata E. Bovine mastitis outbreak in Japan caused by methicillinresistant Staphylococcus aureus New York/Japan clone. J Vet Diagn Invest 2016; 28: 291-8. [24] de Neeling AJ, van den Broek MJ, Spalburg EC, van SantenVerheuvel MG, Dam-Deisz WD, Boshuizen HC, et al. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol 2007; 122: 366-72. [25] Denis O, Suetens C, Hallin M, Catry B, Ramboer I, Dispas M, et al. Methicillin-resistant Staphylococcus aureus ST398 in swine farm personnel, Belgium. Emerg Infect Dis 2009; 15: 1098-101. [26] Khanna T, Friendship R, Dewey C, Weese JS. Methicillin resistant Staphylococcus aureus colonization in pigs and pig farmers. Vet Microbiol 2008; 128: 298-303. [27] Declercq P, Petre D, Gordts B, Voss A. Complicated community acquired soft tissue infection by MRSA from porcine origin. Infection 2008; 36: 590-2. [28] Lewis HC, Mølbak K, Reese C, Aarestrup FM, Selchau M, Sørum M, et al. Pigs as source of methicillin-resistant Staphylococcus aureus CC398 infections in humans, Denmark. Emerg Infect Dis 2008; 14: 1383-9. [29] Witte W, Strommenger B, Stanek C, Cuny C. Methicillin-resistant Staphylococcus aureus ST398 in humans and animals, central Europe. Emerg Infect Dis 2007; 13: 255-8. [30] Noskin GA, Rubin RJ, Schentag JJ, Kluytmans J, Hedblom EC, Smulders M, et al. The burden of Staphylococcus aureus infections on hospitals in the United States: an analysis of the 2000 and 2001 Nationwide Inpatient Sample Database. Arch Intern Med 2005; 165: 1756-61.