Molecular characteristics, expression, and antimicrobial activities of i-type lysozyme from the razor clam Sinonovacula constricta

Fish and Shellfish Immunology 79 (2018) 321–326

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short communication

Molecular characteristics, expression, and antimicrobial activities of i-type lysozyme from the razor clam Sinonovacula constricta

T

Fan Chen, Zhixin Wei, Xuelin Zhao, Yina Shao∗, Weiwei Zhang School of Marine Sciences, Ningbo University, Ningbo 315211, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Sinonovacula constricta I-type lysozyme Immune response Gene expression Antimicrobial activity

Lysozyme is a key component of the innate immune system, which plays a pivotal role in early defense against pathogen infection. In this study, an i-type lysozyme homology was identified from the razor clam Sinonovacula constricta (designated as ScLYZ) through RACE approaches. The full-length cDNA of ScLYZ was 768 bp and encoded a polypeptide of 140 amino acid residues. SMART analysis revealed that ScLYZ processed a signal peptide (1–18 aa) and a destabilase domain from 25 to 133 aa. Two catalytic residues (Glu36 and Asp47) and two specific motifs [“CL(E/L/R/H)C(I/M)C” and “MDVGSLSCG(P/Y) (F/Y)QIK”] of the i-type lysozyme were highly conserved in the ScLYZ sequence. Multiple sequence alignments and phylogenetic analysis indicated that ScLYZ could be a new member of the i-type lysozyme subfamily. Tissue distribution analysis revealed that ScLYZ was constitutively expressed in all examined tissues, and the highest expression was found in the hepatopancreas. After the razor clams were challenged by Vibrio parahaemolyticus, the mRNA levels of ScLYZ increased in the gill and hepatopancreas. Moreover, the recombinant protein was expressed in Escherichia coli, and the refolded ScLYZ showed highly antimicrobial activities against V. parahaemolyticus and Vibrio splendidus. The minimal inhibitory concentration toward V. parahaemolyticus was 8.2 μmol/mL. All our results supported that ScLYZ was involved in the innate immune defense of razor clam by inhibiting the growth of invasive pathogens.

1. Introduction Lysozyme (EC 3.2.1.17) is an ubiquitous enzyme and is widely distributed in a range of phylogenetically diverse organisms from bacteriophage to humans [1]. Lysozyme is mainly involved in the innate immune system and protection of host against microbial infection [2,3]. The mechanism of lysozyme in killing bacteria is by hydrolyzing the β1, 4-glycosidic linkages between N-acetylmuramicacid (NAM) and Nacetylglucosamine (NAG) of peptidoglycan, which is a layer in the bacterial cell wall [4]. Lysozyme is also regarded as an important digestive enzyme in animals, particularly in ruminant artiodactyls [5] and filter-feeding organisms [6]. Based on differences in amino acid sequences, catalytic characteristic, and original sources, lysozymes are classified into six types: chicken-type (c-type) [7], goose-type (g-type) [8], invertebrate-type (itype) [9], plant [10], bacteria [11], and T4 phage (phage-type) [12]. Both c-type and g-type lysozymes are found in many organisms, such as fish, birds, and mammals [13]. Meanwhile, i-type lysozymes are only found uniquely in invertebrates. Since the first i-type lysozyme was identified from the starfish Asterias rubens by Jollès et al [14], approximately 30 kinds of i-type lysozymes have been cloned from

∗

invertebrates, such as nematodes [15], molluscs [16], arthropods [17], and echinoderms [18]. I-type lysozymes exert multiple activities, such as muramidase, isopeptidase, chitinase, and non-enzymatic antibacterial activities [17,19]. Zavalova et al [20] indicated that Hirudo medicinalis lysozyme possess muramidase and isopeptidase activities conferred by independent active sites. Moreover, lysozymes of aquatic invertebrates exhibit more extensive activities than those of terrestrial invertebrates to handle various bacteria in the water environment [21]. Cong et al [18] reported that recombinant lysozyme from the sea cucumber Stichopus japonicus possess both glycosidase and isopeptidase activities and exert strong antimicrobial activity against Gram-positive and -negative bacteria; results indicate that S. japonicus lysozyme possesses both enzymatic and nonenzymatic antibacterial action. Nowadays, many lysozyme genes have been identified from bivalves, such as Crassostrea virginica [22], Meretrix meretrix [23], and Venerupis philippinarum [24]. These lysozymes were expressed in multiple tissues, and the expression levels could be significantly induced by bacterial challenges; as such, invertebrate lysozymes play important roles in host defense [25]. Wu et al [26] demonstrated that the purified protein of CpLYZ1 from Cristaria plicata exhibits highly bacteriolytic activities

Corresponding author. 818 Fenghua Road, Ningbo University, Ningbo, Zhejiang Province 315211, PR China. E-mail address: [email protected] (Y. Shao).

https://doi.org/10.1016/j.fsi.2018.05.037 Received 13 March 2018; Received in revised form 18 May 2018; Accepted 23 May 2018 Available online 25 May 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.

Fish and Shellfish Immunology 79 (2018) 321–326

F. Chen et al.

Table 1 Primers used in this study Primer Name

Primer Sequence (5′-3′)

Used for

amplified fragments

ScLYZ 3-1 ScLYZ 3-2 ScLYZ 5-1 ScLYZ 5-2 ScLYZ qF ScLYZ qR ScLYZ F ScLYZ R ScLYZ BamH I F ScLYZ Xho I R Scβ-actin qF Scβ-actin qR

AACTATTGGCTGGACTGTGGCTC CCCAGCCAGGATGTTCTAATGTC GAGCCACAGTCCAGCCAATAGTT CAAACCAAGAACCGCTGACACTA AACTATTGGCTGGACTGTGGCTC GACATTAGAACATCCTGGCTGGG TTTGCGACCGGCATGGTCTCTCA CTAATGGACATTAGAACATCCTG GGATCCTTTGCGACCGGCATGGTCTCTCA CTCGAGCTAATGGACATTAGAACATCCTG AAGAGCCGTGTTTCCATCC AGCCTCATCTCCCACATAGC

3′ RACE

206 bp

5′ RACE

213 bp

Real-time PCR Code mature peptide

237 bp

Vector construction Real-time PCR

381 bp

369 bp

89 bp

at the backside of the razor clam and centrifuged at 1000 g and 4 °C for 10 min to harvest hemocytes. Other tissues were ground in liquid nitrogen by mortar and pestle. We performed three replicates in the experimental and control groups. All samples were frozen immediately in liquid nitrogen and stored at −80 °C for further analysis.

against all tested bacteria, particularly pathogens of aquatic animals belonging to Vibrio spp. The lysozyme transcript was also highly expressed in the digestive glands of many bivalve species [23,27], which can use bacteria as nutrient source [28,29]; hence, lysozymes possess digestive capability and might function as digestive enzymes. To our knowledge, i-type lysozymes have not been studied yet in razor clams. Sinonovacula constricta is an important economic razor clam species belonging to the Phylum Mollusca and is widely distributed in intertidal zones and estuarine waters along the coast of the West Pacific Ocean [30]. At present, the natural resources of S. constrictais have declined drastically due to disease outbreaks caused by Vibrio spp., particularly V. parahaemolyticus [31]. Thus far, the innate immune system of razor clams under pathogen infection or disease outbreaks remains poorly understood. Understanding the host–pathogen interactions and host immune-related genes involved in immune responses is a critical step for disease control in razor clam farming. The present study mainly aims to (1) clone the full-length cDNA of lysozyme from S. constrictais (designated as ScLYZ); (2) investigate gene distribution in tissues and determine responses to V. parahaemolyticus challenge; and (3) elucidate the antibacterial activity of the matured protein. Results would provide basic information for understanding the antibacterial roles of ScLYZ under pathogen infection.

2.3. RNA extraction and cDNA synthesis Total RNA was extracted from hemocytes, water pipes, abdominal foot, hepatopancreas, and gill by using Trizol (Invitrogen) and according to relative reference [33,34]. The obtained RNA was treated with RNase-free DNase I (TaKaRa) to remove genomic DNA. Firststrand cDNA was synthesized using a Primescript™ II 1st cDNA Synthesis Kit (TaKaRa). 2.4. Rapid application of cDNA ends (RACE) Full-length cDNA of ScLYZ was obtained by RACE-PCR analysis with the 3′, 5′-Full RACE Kit (TaKaRa) following the manufacturer’s instructions. Specific primers for RACE (Table 1) were designed based on the acquired unigenes [35]. The PCR products were purified and cloned into the pMD19-T simple vector (TaKaRa). Three positive clones for each product were sequenced at Sangon (Shanghai, China).

2. Materials and methods 2.5. Sequence analysis 2.1. Animals Sequences homology were obtained using BLAST program at National Centre for Biotechnology Information (http://www.ncbi.nlm. nih.gov/blast) and the deduced amino acid sequence of ScLYZ was analyzed with the expert protein analysis system (http://www.expasy. org/). Multiple alignments analysis of each protein were performed using the ClustalW2 Multiple Alignment program (http://www.ebi.ac. uk/clustalw/). The molecular mass (MM) and theoretical isoelectric point (pI) of the protein were calculated based upon their deduced amino acids by the ProtParam tool (http://www.expasy.ch/tools/ protparam.html). The signal peptide and protein domain features were predicted by Simple Modular Architecture Research Tool (http:// smart.embl-heidelberg.de/). Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 6.0 program.

One hundred live healthy S. constricta razor clams (average weight of 10 g ± 1.4 g) were purchased from a commercial clam fishery (Ningbo, Zhejiang, China) in June 2017. The clams were cultured in 30 L aerated natural seawater (salinity 20, temperature 16 °C) 3 days before analysis. 2.2. Bacterial challenge and samples preparation V. parahaemolyticus was cultured in liquid 2216E broth (5 g/L tryptone and 1 g/L yeast extract at pH 7.6) at 28 °C and 140 rpm overnight. The bacteria were collected by centrifugation at 3000 rpm for 5 min and resuspended in filtered seawater. For immune challenge experiment, the razor clams were randomly divided into five tanks, each containing 10 individuals. One tank was served as control, and the four other tanks were immersed with high density of V. parahaemolyticus with final concentration of 107 CFU mL−1. After exposure for 6, 12, 24, and 48 h, hepatopancreas and gill were collected from three individuals by using sterilized scissors and tweezers. Sampling time points and infection dose were selected according to references [24,30-32]. The control group was collected at 0 h. Moreover, hemocytes, water pipes, abdominal foot, hepatopancreas, and gill were collected from control individuals for spatial expression analysis. Hemolymphs from the control group were collected using 1 mL sterile syringe

2.6. Quantification of mRNA expression Tissue distribution and time-course expression of ScLYZ were analyzed by quantitative PCR (qPCR). cDNA synthesis was conducted using the method described in Section 2.3. Real-time PCR amplification was performed using the Applied Biosystem 7500 Real-time PCR System in a 20 μL reaction volume containing 8 μL of 1:50 diluted cDNA, 1 μL of each primer (Table 1), and 10 μL of SYBR Green Mix (TaKaRa). The reaction mixture was incubated for 5 min at 95 °C, followed by 40 amplification cycles of 15 s at 95 °C, 20 s at 60 °C, and 30 s at 72 °C. Scβ322

Fish and Shellfish Immunology 79 (2018) 321–326

F. Chen et al.

performed in triplicate.

actin was served as internal control to verify successful reverse transcription and calibrate the cDNA template. For consistency, the baseline was set automatically by the software. The qPCR primer efficiencies were 98.2% for ScLYZ and 104.4% for Scβ-actin, as determined using the standard curve drawn using the dilution series, and the qPCR single products were verified by agarose gel electrophoresis; hence, the primers were workable. The relative expression of ScLYZ was determined by 2−ΔΔCT method [36]. The obtained value denoted n-fold difference relative to the calibrator. Quantitative data were expressed as mean ± standard deviation (SD) of three biologically replicates. Oneway ANOVA was conducted to determine significant differences between control and experimental groups. P values less than 0.05 were considered significantly different.

3. Results and discussion I-type lysozymes play an important role in immunity and digestion in invertebrates and are usually regarded as the first barrier against pathogens [24]. In the present study, full-length cDNA encoding an itype lysozyme was identified from S. constricta by RACE techniques. The spatial expression, temporal expression profiles, and antimicrobial activities of the lysozyme were investigated. 3.1. Characterization of S. constricta lysozyme sequence The full-length cDNA of ScLYZ (GenBank accession number MG544119) had length of 768 bp and included a 5′-UTR of 168 bp, a 3′UTR of 177 bp with a polyadenylation signal (AATAAA) and an RNA instability sequence (ATTTA), and an ORF of 423 bp encoding 140 amino acid residues (Fig. S1). The predicted molecular weight of ScLYZ protein was 15.204 kDa, and its theoretical pI was 6.47. A typical signal peptide was detected in the first 18 amino acid residues in the deduced amino acids of ScLYZ, indicating that the putative protein was secreted. SMART program analysis revealed that ScLYZ contained a typical destabilase domain located from 25 to 133 amino acids. These domains were also found in other i-type lysozymes from bivalves [2,9]. The ScLYZ protein contained a high amount (10%) of cysteine residues (14 of 140 residues), suggesting that harboring more cysteine residues might render it more stable in seawater with high osmolality [22,39,40]. All these sequence signatures indicated that ScLYZ is a new member of the i-type lysozyme subfamily.

2.7. Generation and purification of inclusion body ScLYZ The cDNA fragment encoding the predicted mature peptide was amplified by PCR using primers with specific restriction sites (Table 1) to produce recombinant ScLYZ. The PCR products were cloned into the pMD19-T simple vector (TaKaRa), digested with BamH I (Thermo) and Xho I (Thermo), and inserted into BamH I and Xho I digested pET-28a (+) expression vector (Novagen) (termed pET-28a-ScLYZ). The recombinant plasmid was transformed into Escherichia coli Rosetta (Novagen) and subjected to DNA sequencing. The positive clones were incubated in LB medium containing 50 μg mL−1 kanamycin at 37 °C and 180 rpm. The bacteria were grown to appropriate density of OD600 = 0.6, and the protein was induced by incubation with 1 mM IPTG. After additional 3 h of induction, the bacteria were harvested through centrifugation at 8000 g and 4 °C. The obtained cell pellet was used for protein purification. Given its expression in inclusion bodies, the recombinant protein was solubilized in 8 M urea solution containing 20 mM Tris-HCl, 150 mM NaCl, 0.1% β-mercaptoethanol, 0.2% Triton100, 30 mM imidazole (pH = 7.9) by using previously reported method with minor modifications [37]. The solubilized protein was partially purified using Ni-NTA Seflnose™ Resin following the manufacture’s instruction (Sangon, China). The purified recombinant protein was dialyzed in sequential order against 6, 4, 2, 1, and 0 M urea in 1 M TrisHCl buffer (pH 7.9). Each operation was conducted for 12 h at 4 °C to ensure the removal of urea and other contaminants. The refolded protein was subjected to 12% SDS-PAGE for analysis.

3.2. Multiple sequence alignment and phylogenetic analysis Multiple sequence alignment of ScLYZ with different lysozymes from other species showed that the region A of 31–65 amino acid residues of ScLYZ was responsible for lysozyme activity, and the region B of 76–117 amino acid residues was involved in isopeptidase activity (Fig. 1). Most studies reported that several i-type lysozymes exert isopeptidase and chitinase activities [6,41]. In our case, the ScLYZ protein whether contain isopeptidase activity should be analyzed in future studies. Moreover, we found the lysozyme catalytic residues (Glu36 and Asp47) were conserved in ScLYZ, which played a critical role in hydrolysis of β-1,4-glycosidic bonds in the peptidoglycan of the bacterial cell wall [4,42]. The specific motifs of “CL(E/L/R/H)C(I/M)C” and “MDVGSLSCG(P/Y) (F/Y)QIK” in the i-type lysozyme were also highly conserved in the ScLYZ sequence (Fig. 1), although the random amino acid residue of E/L/R/H was instead by Q. Pairwise sequence alignment showed that ScLYZ exhibited higher homology to other invertebrate counterparts. For example, ScLYZ exhibited similarities of 62.2% to lysozyme from Ruditapes philippinarum (ACU83237.1), 53.4% to lysozyme from Strongylocentrotus intermedius (AEW10548.1), and 51.6% to lysozyme from Apostichopus japonicus (ABK34500.2). A phylogenetic tree was constructed using neighbor-joining method to analyze the evolutionary relationship of ScLYZ with other lysozymes (Fig. S2). The tree was clustered into two distinct branches separating the orthologs from vertebrates and invertebrates. ScLYZ was positioned within the invertebrate group and showed a close relationship to the counterpart of S. intermedius.

2.8. Antimicrobial activity assays Antimicrobial activity of the recombinant ScLYZ was assessed with the disc diffusion assay, as described in our previous study [38]. The following three bacterial strains were used as substrates: Gram-negative bacteria, namely, V. parahaemolyticus and Vibrio splendidus, and Grampositive bacteria Micrococcus luteus. The 2216E medium containing the two Gram-negative bacterial species (107 CFU mL−1) and the nutrient agar medium (10 g/L tryptone, 3 g/L beef extract, 5 g/L NaCl, 15 g/L agarose, pH = 7.3 ± 0.1) containing M. luteus were poured onto 90 mm plates. After culture solidification, Oxford cups (8 mm diameter) were placed on the surface of the agar. The cups were soaked in 100, 50, and 20 μg of the purified ScLYZ solutions with equal volume. Vibrio spp. and M. luteus were cultured at 28 °C and 35 °C, respectively, for 24 h. The final dialyzed buffer and sterile liquid medium were used as control. After incubation, the diameter of the transparent circle around each Oxford cup was measured. The minimal inhibitory concentrations (MIC) of the purified ScLYZ against V. parahaemolyticus were determined by using the method described by Yang et al [32]. The gradient ScLYZ protein (32.8 μmol/L) was double diluted in sterile 96-well microtiter plate. Each column was added with 50 μL of V. parahaemolyticus suspension at the concentration of 0.5 × 104 CFU mL−1. The column without the purified ScLYZ served as control. After the bacteria were incubated at 28 °C for 24 h, the absorbance of the plate was recorded at OD600. The assays were

3.3. Tissue-specific expression of ScLYZ The mRNA expression levels of ScLYZ in different tissues were investigated by qPCR analysis to understand its biological roles in S. constricta. The mRNA expression level of ScLYZ in hemocytes served as reference (Fig. 2A). The ScLYZ gene was ubiquitously expressed at different levels in all examined tissues, indicating the involvements of this gene in versatile biological processes [24]. The ScLYZ transcript 323

Fish and Shellfish Immunology 79 (2018) 321–326

F. Chen et al.

Fig. 1. Alignment of the predicted amino acid sequence of ScLYZ with other lysozymes by using the ClustalW2 Multiple Alignment program. The consensus residues were shaded with a threshold of more than 80% identity by using the Multiple Align Show program. Identical residues are indicated in black, and similar residues are presented in light gray. The two highly conserved regions of all i-type lysozymes are marked with red box. The two active acidic residues, namely, glutamate (E) and aspartate (D), are indicated directly below the alignments. Region A was identified to be related to lysozyme activity. Region B was identified to be related to isopeptidase activity. The protein sequences accession numbers: Homo species lysozyme (ACO37637.1), Rattus norvegicus lysozyme (AAA41551.1), Sus scrofa lysozyme (AAB16862.1), Danio rerio lysozyme (AAI62644.1), Larimichthys crocea lysozyme (KKF29955.1), Oncorhynchus mykiss lysozyme (CAA42084.1), Ruditapes philippinarum lysozyme (ACU83237.1), Crassostrea gigas lysozyme (BAF48045.1), Apostichopus japonicus lysozyme (ABK34500.2), Strongylocentrotus intermedius lysozyme (AEW10548.1), Sinonovacula constrict lysozyme (MG544119).

shellfish. In the marine environment with abundant microorganisms, particularly Gram-negative bacteria, the extremely high expression level of lysozymes in the hepatopancreas indicated that they probably served as a digestive enzyme, which might digest various bacteria in their living environment [26,43,48]. Moreover, the hepatopancreas is usually considered an immune organ that eliminates invasive pathogens [24]. The gill, which contains a single layer and covered with protective mucus, was constantly flushed with water containing pathogens [24]. The high ScLYZ transcript in the gill indicated its significant contribution in prevention of microbial invasion.

was mainly detected in the hepatopancreas (172.5-fold, p < 0.01), followed by abdominal foot (5.8-fold, p < 0.05) and gill (2.7-fold, p < 0.05). Similar tissue distribution was also reported in C. plicata itype lysozyme [43]. Yue et al [23] found that MmeLys from Meretrix meretrix was mainly produced in the hepatopancreas and gill. Hemocytes, which are immune cells, play pivotal roles in immune defenses [44] and also participate in tissues repair [45] and detoxication [46,47]. However, in the present study, the ScLYZ transcript showed the lowest expression in hemocytes, which was similar to Xue et al. [22] study, indicating lysozyme might express less degree in hemocytes of

Fig. 2. Tissue distribution and time-course expression of ScLYZ detected through quantitative PCR analysis. A: Transcript levels in water pipes, abdominal foot, hepatopancreas, and gill were normalized to that in hemocytes; B: V. parahaemolyticus infection in the gill; and C: V. parahaemolyticus infection in the hepatopancreas. Values are presented as mean ± SD, n = 3. Asterisks indicate significant differences: *P < 0.05, **P < 0.01. 324

Fish and Shellfish Immunology 79 (2018) 321–326

F. Chen et al.

(20–22 kDa) [51]. However, the induced protein inclusions aggregated to form inclusion bodies. The inclusion bodies were refolded by urea gradient dialysis to obtain a soluble protein. The recovered protein was further applied to SDS-PAGE analysis (Fig. 3A-2). The results were in good agreement with the calculated molecular weight of 15.204 kDa.

3.4. Transcriptional responses of ScLYZ in hepatopancreas and gill upon V. parahaemolyticus challenge Given that the hepatopancreas and gill represent important portals of entry of pathogens in bivalves, these tissues are commonly used to investigate the fluctuation of immune-related genes [37,49]. Therefore, the expression patterns of ScLYZ in the hepatopancreas and gill of razor clams must be investigated after V. parahaemolyticus challenge. After the stimulation of V. parahaemolyticus, the temporal mRNA expression levels of ScLYZ in the hepatopancreas and gill are shown in Fig. 2. In the gills, the mRNA expression level of ScLYZ slowly decreased 6 h post infection and then sharply increased and reached the peak at 12 h; the expression increased by 13.8-fold (p < 0.01) compared with that in the control group. The expression of ScLYZ remained high after 24 h (3.0fold, p < 0.05) and then gradually decreased and recovered to the control level until 48 h (Fig. 2B). In the hepatopancreas, the expression of the ScLYZ transcript gradually increased and peaked at 12 h; the expression increased by 4.88-fold (p < 0.01) compared with that in the control. Moreover, the expression level of ScLYZ was slightly suppressed but remained higher than that in the control group, with 3.54fold (p < 0.05) and 3.59-fold (p < 0.05) increases at 24 and 48 h, respectively (Fig. 2C). These results showed that the expression levels of the ScLYZ transcripts in the hepatopancreas and gill were significantly induced upon V. parahaemolyticus challenge and reached the highest levels at 12 h. The expression in the gill was higher than that in the hepatopancreas. The mRNA expression of VpLYZ in hemocytes from V. philippinarum differed from the present results; that is, the expression was downregulated sharply from 6 h to 12 h after V. anguillarum infection, then gradually increased and reached the peak at 72 h [24]. In the present study, the upregulation of ScLYZ expression was in agreement with previous works on other bivalve species [26,48,50]. Hence, ScLYZ participates in immune responses and might act as an important immune effector for eliminating invading pathogens.

3.6. Antimicrobial activity of the recombinant ScLYZ I-type lysozymes exert antimicrobial activities against various Gram-negative or -positive bacteria, particularly marine bacteria [18,32]. In the present work, the antimicrobial activities of ScLYZ were investigated against two Gram-negative bacterial species and one Gram-positive bacterial species (Fig. 3B). ScLYZ administered at the highest dose (100 μg) exhibited strong antimicrobial activities against V. parahaemolyticus (2.09 ± 0.25 cm) and V splendidus (2.31 ± 0.42 cm). After treatment with 50 μg of ScLYZ, the diameters of the antimicrobial zone were 1.27 ± 0.12 cm in V. parahaemolyticus and 1.20 ± 0.09 cm in Vibrio splendidus. Treatment with 20 μg of ScLYZ was less effective against V. parahaemolyticus (0.93 ± 0.02 cm), and no inhibition zone of V. splendidus was detected after the treatment. However, the ScLYZ protein did not affect the growth of M. luteus. Zhang et al [52] revealed that the two i-type lysozymes from red swamp did not affect the growth of M. luteus. By contrast, Xue et al [6] indicated that the two types of i-type lysozymes from eastern oyster significantly inhibited the growth of E. coli and Vibrio vulnificus and the Gram-positive bacteria Pediococcus cerevisiae. Also, the present results differed from those obtained from the analysis of c-type lysozymes from V. philippinarum [32] and Penaeus monodon [53]; these lysozymes effectively inhibited the growth of Gram-positive bacteria. The ScLYZ protein from razor clams whether uniquely against negative pathogens should be analyzed in our further study. Because of V. parahaemolyticus acting as a most important pathogen for razor clams, furthermore, the MIC of ScLYZ against V. parahaemolyticus was determined using the 96well plate. The results showed that the MIC significantly inhibited the growth of V. parahaemolyticus at a concentration of 8.2 μmol/mL (Fig. 3C). In summary, we cloned the full-length cDNA of the ScLYZ gene in razor clams. The gene shares similar features to other i-type counterparts in invertebrates and functions in innate immunity. To better understand its roles in immunity further study will needed.

3.5. Over-expression and purification of ScLYZ The recombinant plasmid pET-28a-ScLYZ was transformed into E. coli Rosetta cells to produce histidine-fusion protein in vitro. SDS-PAGE analysis revealed an induced band with a molecular size of approximately 15 kDa after IPTG treatment (Fig. 3A-1). I-type lysozymes typically have a size of 11–15 kDa and are smaller than g-type lysozymes

Fig. 3. Antibacterial activities of recombinant ScLYZ. A-1: SDS-PAGE analysis of the recombinant ScLYZ protein, line M: protein marker, line 1: before IPTG induction; line 2: after IPTG induction; line 3: after IPTG induction with soluble proteins; line 4: after IPTG induction with inclusion body proteins; A-2: refolded recombinant ScLYZ, line M: protein marker, line 1: the refolded recombinant ScLYZ. B-1: V. parahaemolyticus; B-2: V. splendidus; B-3: M. luteus; (1): 100 μg of ScLYZ; (2): 50 μg of ScLYZ; (3): 20 μg of ScLYZ; (4): dialyzed buffer without ScLYZ; (5): 2216E or nutrient agar medium without ScLYZ; C: results of V. parahaemolyticus growth (OD600) at different concentrations of ScLYZ.

325

Fish and Shellfish Immunology 79 (2018) 321–326

F. Chen et al.

Notes [25]

The authors declare no competing financial interest.

[26]

Acknowledgments [27]

This work was financially supported by Zhejiang Major Program of Science and Technology (2016C02055-9), Natural Science Foundation of Ningbo (2015C10009), Fund from Ningbo University for Xuelin Zhao (XYL17010), and the K.C. Wong Magna Fund in Ningbo University.

[28] [29] [30]

Appendix A. Supplementary data [31]

Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.fsi.2018.05.037.

[32]

References [33]

[1] P. Jollès, J. Jollès, What's new in lysozyme research, Mol. Cell Biochem 63 (1984) 165–189. [2] P. Jollès, Lysozymes: Model Enzymes in Biochemistry and Biology, Birkhäuser Verlag, 1996. [3] S. Saurabh, P.K. Sahoo, Lysozyme: an important defence molecule of fish innate immune system, Aquacult. Res. 39 (2008) 223–239. [4] D.M. Chipman, N. Sharon, Mechanism of lysozyme action, Science 165 (1969) 454–465. [5] D.E. Dobson, E.M. Prager, A.C. Wilson, Stomach lysozymes of ruminants. I. Distribution and catalytic proper-ties, J. Biol. Chem. 259 (1984) 11607–11616. [6] Q. Xue, N. Itoh, K.L. Schey, Y. Li, R.K. Cooper, J.F. La Peyre, A new lysozyme from the eastern oyster (Crassostrea virginica) indicates adaptive evolution of i-type lysozymes, Cell Mol. Life Sci. 64 (2007) 82–95. [7] K. Koiwai, R.R.R. Alenton, H. Kondo, I. Hirono, Extracellular trap formation in kuruma shrimp (Marsupenaeus japonicus) hemocytes is coupled with c-type lysozyme, Fish. Shellfish Immunol 52 (2016) 206–209. [8] L. Zhao, J. Sun, L. Sun, The g-type lysozyme of Scophthalmus maximus has a broad substrate spectrum and is involved in the immune response against bacterial infection, Fish. Shellfish Immunol 30 (2011) 630–637. [9] S. Bachali, M. Jager, A. Hassanin, F. Schoentgen, P. Jollès, A. Fiala-Medioni, J.S. Deutsch, Phylogenetic analysis of invertebrate lysozymes and the evolution of lysozyme function, J. Mol. Evol. 54 (2002) 652–664. [10] J.J. Beintema, A.C. Terwisscha van Scheltinga, Plant lysozymes, in: P. Jollès (Ed.), Lysozymes: Model Enzymes in Biochemistry and Biology, Birkhäuser Verlag, Basel, 1996, pp. 75–86. [11] J.V. Holtje, Bacterial lysozymes, in: P. Jollès (Ed.), Lysozymes: Model Enzymes in Biochemistry and Biology, Birkhäuser Verlag, Basel, 1996, pp. 65–74. [12] J. Fastrez, Phage lysozymes, in: P. Jollès (Ed.), Lysozymes: Model Enzymes in Biochemistry and Biology, Birkhäauser Verlag, Basel, 1996, pp. 35–64. [13] R.M. Jiménez-Cantizano, C. Infante, B. Martin-Antonio, et al., Molecular characterization, phylogeny, and expression of c-type and g-type lysozymes in brill (Scophthalmus rhombus), Fish. Shellfish Immunol 25 (1-2) (2008) 57–65. [14] J. Jollès, P. Jollès, The lysozyme from Asterias rubens, Eur. J. Biochem 54 (1975) 19–23. [15] S.M. Paskewitz, B. Li, M.K. Kajla, Cloning and molecular characterization of two invertebrate-type lysozymes from Anopheles gambiae, Insect Mol. Biol. 17 (3) (2008) 217–225. [16] T. Matsumoto, A.M. Nakamura, K.G. Takahashi, Cloning of cDNAs and hybridization analysis of lysozymes from two oyster species, Crassostrea gigas and Ostrea edulis, Comp. Biochem. Physiol. B 145 (2006) 325–330. [17] H. Zhang, C. Sun, S. Sun, X. Zhao, J. Wang, Functional analysis of two invertebratetype lysozymes from red swamp crayfish, Procambarus clarkii, Fish. Shellfish Immunol 29 (6) (2010) 1066–1072. [18] L. Cong, X. Yang, X. Wang, Characterization of an i-type lysozyme gene from the sea cucumber Stichopus japonicus, and enzymatic and nonenzymatic antimicrobial activities of its recombinant protein, J. Biosci. Bioeng 107 (6) (2009) 583–588. [19] I.P. Baskova, L.L. Zavalova, Polyfunctionality of destabilase, a lysozyme from a medicinal leech, Bioorg. Khim 34 (2008) 337–343. [20] L. Zavalova, V. Lazarev, S. Levitsky, T. Yudina, I. Baskova, Destabilase-lysozyme of medicinal leech. Multifunctionality of recombinant protein, Biochemistry 75 (2010) 1173–1181. [21] Y. Tian, Y. Jiang, Y. Shang, Establishment of lysozyme gene RNA interference system and its involvement in salinity tolerance in sea cucumber (Apostichopus japonicus), Fish. Shellfish Immunol 65 (2017) 71–79. [22] Q.G. Xue, M.E. Hellberg, K.L. Schey, N. Itoh, R.I. Eytan, et al., A new lysozyme from the eastern oyster, Crassostrea virginica, and a possible evolutionary pathway for itype lysozymes in bivalves from host defense to digestion, BMC Evol. Biol. 10 (2010) 213. [23] X. Yue, B. Liu, Q. Xue, An i-type lysozyme from the Asiatic hard clam Meretrix meretrix potentially functioning in host immunity, Fish. Shellfish Immunol 30 (2011) 550–558. [24] J. Zhao, L. Qiu, X. Ning, A. Chen, H. Wu, C. Li, Cloning and characterization of an

[34]

[35]

[36] [37]

[38]

[39]

[40]

[41]

[42] [43] [44]

[45] [46]

[47] [48]

[49]

[50]

[51] [52]

[53]

326

invertebrate type lysozyme from Venerupis philippinarum, Comp. Biochem. Physiol. B 156 (2010) 56–60. B. Masschalck, C.W. Michiels, Antimicrobial properties of lysozyme in relation to foodborne vegetative bacteria, Crit. Rev. Microbiol. 29 (2003) 191–214. D. Wu, B. Hu, C. Wen, G. Lin, Z. Tao, X. Hu, Y. Xie, Gene identification and recombinant protein of a lysozyme from freshwater mussel Cristaria plicata, Fish. Shellfish Immunol 34 (2013) 1033–1041. J.G. McHenery, J.A. Allen, T.H. Birkbeck, Distribution of lysozyme-like activity in 30 bivalve species, Comp. Biochem. Physiol. B 85 (1986) 581–584. J.G. McHenery, T.H. Birkbeck, Uptake and processing of cultured microorganisms by bivalves, J. Exp. Mar. Biol. Ecol 90 (1985) 145–163. Q.M. Olsen, I.W. Nilsen, K. Sletten, B. Myrnes, Multiple invertebrate lysozymes in blue mussel (Mytilus edulis), Comp. Biochem. Physiol. B 136 (2003) 107–115. X. Zhao, X. Duan, Z. Wang, et al., Comparative transcriptome analysis of Sinonovacula constricta in gills and hepatopancreas in response to Vibrio parahaemolyticus infection, Fish. Shellfish Immunol 67 (2017) 523–535. Y. Cui, Z. Wei, Y. Shen, et al., A novel C1q-domain-containing protein from razor clam Sinonovacula constricta mediates G-bacterial agglutination as a pattern recognition receptor, Dev. Comp. Immunol 79 (2018) 166–174. D. Yang, Q. Wang, R. Cao, L. Chen, Y. Liu, M. Cong, H. Wu, F. Li, C. Ji, J. Zhao, Molecular characterization, expression and antimicrobial activities of two c-type lysozymes from manila clam Venerupis philippinarum, Dev. Comp. Immunol 73 (2017) 109–118. Y. Lu, A. Zhang, C. Li, et al., The link between selenium binding protein from Sinonovacula constricta and environmental pollution exposure, Fish. Shellfish Immunol 35 (2013) 271–277. L. Zhu, C. Li, X. Su, et al., Identification and assessment of differentially expressed genes involved in growth regulation in Apostichopus japonicus, Genet. Mol. Res. 12 (2013) 3028–3037. Z. Wang, Y. Shao, C. Li, W. Zhang, X. Duan, Q. Qiu, C. Jin, RNA-seq analysis revealed ROS-mediated related genes involved in cadmium detoxification in the razor clam Sinonovacula constricta, Fish. Shellfish Immunol 57 (2016) 350–361. K.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Realtime Quantitative PCR and the 2-ΔΔCT Method 25 (2001), pp. 402–408. R. Josková, M. šilerová, P. Procházková, et al., Identification and cloning of an invertebrate-type lysozyme from Eisenia andrei, Dev. Comp. Immunol 33 (2009) 932–938. Y. Shao, Z. Lv, C. Li, W. Zhang, X. Duan, Q. Qiu, C. Jin, X. Zhao, Molecular cloning and functional characterization of theta class glutathione S-transferase from Apostichopus japonicus, Fish. Shellfish Immunol 63 (2017) 31–39. K. Takeshita, Y. Hashimoto, Y. Thujihata, T. So, T. Ueda, T. Iomoto, Determination of the complete cDNA sequence, construction of expression systems, and elucidation of fibrinolytic activity for Tapes japonica lysozyme, Protein Expr. Purif 36 (2004) 254–262. N. Itoh, K.G. Takahashi, cDNA cloning and in situ hybridization of a novel lysozyme in the Pacific oyster, Crassostrea gigas, Comp. Biochem. Physiol. B 148 (2007) 160–166. T. Goto, A. Yoshito, Y. Kakuta, et al., Crystal structure of tapes japonica lysozyme with substrate analogue: structural basis of the catalytic mechanism and manifestation of its chitinase activity accompanied by quaternary structural change, J. Biol. Chem. 282 (2007) 27459–27467. D.C. Phillips, The three-dimensional structure of an enzyme molecule, Sci. Am. 215 (1966) 78–90. J.G. McHenery, T.H. Birkbeck, J.A. Allan, The occurrence of lysozyme in marine bivalve, Comp. Biochem. Physiol. B 63 (1979) 25–28. W. Maldonado-Aguayo, F.L.D. la Cruz, C. Gallardo-Escárate, Identification and expression of antioxidant and immune defense genes in the surf clam Mesodesma donacium challenged with Vibrio anguillarum, Mar. Genom 19 (2015) 65–73. A.S. Mount, A.P. Wheeler, R.P. Paradkar, D. Snider, Hemocyte-mediated shell mineralization in the eastern oyster, Science 304 (2004) 297–300. P.G.J. de Boissel, M. Fournier, J.C. Rodriguez-Lecompte, et al., Functional and molecular responses of the blue mussel Mytilus edulis' hemocytes exposed to cadmium-An in vitro model and transcriptomic approach, Fish. Shellfish Immunol 67 (2017) 575–585. C. Li, X. Chen, P. Zhang, et al., Di-(2-ethylhexyl) phthalate mediates glycolysis and the TCA cycle in clam Venerupis philippinarum, Invert Surviv. J. 11 (2014) 174–181. J. Zhao, L. Song, C. Li, D. Ni, L. Wu, L. Zhu, H. Wang, W. Xu, Molecular cloning, expression of a big defensin gene from bay scallop Argopecten irradians and the antimicrobial activity of its recombinant protein, Mol. Immunol 44 (2007) 360–368. Y. Liu, H. Zhang, Y. Liu, H. Li, X. Peng, Determination of the heterogeneous interactome between Edwardsiella tarda and fish gills, J. Proteomics 75 (2012) 1119–1128. E.J. Burge, D.J. Madigan, L.E. Burnett, K.G. Burnett, Lysozyme gene expression by hemocytes of Pacific white shrimp, Litopenaeus vannamei, after injection with Vibrio, Fish. Shellfish Immunol 22 (2007) 327–339. L. Callewaert, C.W. Michiels, Lysozymes in the animal kingdom, J. Biosci 35 (2010) 127–160. H. Zhang, C. Sun, S. Sun, X. Zhao, J. Wang, Functional analysis of two invertebratetype lysozymes from red swamp crayfish, Procambarus clarkii, Fish. Shellfish Immunol 29 (2010) 1066–1072. P. Supungul, V. Rimphanitchayakit, T. Aoki, et al., Molecular characterization and expression analysis of a c-type and two novel muramidase-deficient i-type lysozymes from Penaeus monodon, Fish. Shellfish Immunol 28 (2010) 490–498.