Molecular characterization and differential expression of multiple goose dopamine D2 receptors

Gene 535 (2014) 177–183

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Molecular characterization and differential expression of multiple goose dopamine D2 receptors Cui Wang a, Yi Liu a, Huiying Wang a, Huali Wu a, Shaoming Gong a, Weihu Chen b, Daqian He a,⁎ a b

Institute of Animal Husbandry and Veterinary Science, Shanghai Academy of Agricultural Sciences, Shanghai 201106, PR China Zhedong White Goose Institute of Xiangshan County, Ningbo, Zhejiang 315700, PR China

a r t i c l e

i n f o

Article history: Accepted 16 November 2013 Available online 2 December 2013 Keywords: DRD2 Cloning Alternative splicing Differential expression SNPs

a b s t r a c t Dopamine D2 receptor (DRD2) gene, a member of the dopamine receptors gene family, has been studied as a candidate gene for broodiness due to its special effects on avian prolactin secretion. Here, the genomic DNA and cDNA sequences of goose (Anser cygnoides) DRD2 gene were cloned and characterized for the first time. The goose DRD2 cDNA is 1353 bp in length and encodes a protein of 450 amino acids. The length of goose DRD2 genomic DNA is 8350 bp, including seven exons and six introns. We identified four goose DRD2 variants, which were generated due to alternative splicing. Bioinformatics analysis indicates that all the deduced DRD2 amino acid sequences contain seven putative transmembrane domains and four potential N-glycosylation sites. A phylogenetic tree based on amino acid sequences displays that the goose DRD2 protein is closely related to those of avian species. Semi-quantitative RT-PCR analysis demonstrates that the DRD2-1, DRD2-2 and DRD2-4 transcripts are differentially expressed in the pituitary, ovary, hypothalamus, as well as in the kidney, whereas the DRD2-3 transcript is widely expressed in all the examined tissues at different levels. Meanwhile, 54 single nucleotide polymorphisms (SNPs) and 4 insert-deletion (indel) variations were identified in the coding region and partial intron region of the goose DRD2 gene. Those findings will help us gain insight into the functions of the DRD2 gene in geese. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved.

1. Introduction Dopamine is a vital neurotransmitter that is found in both the central and periphery nervous systems of many species. In mammals, dopamine is involved in a wide variety of behavioral and physiology functions, such as locomotor activity, cognition, emotion and motivation (Baskerville and Douglas, 2010; Blasi et al., 2009; Korchounov et al., 2010; Missale et al., 1998). In avians, dopamine was demonstrated to be involved in the regulation of prolactin secretion in the brain (El Halawani et al., 1991; Youngren et al., 1995, 1996). Dopamine mediates these diverse effects by binding to its specific receptor on the cell surface. Dopamine receptors are members of the G protein-coupled receptors with seven transmembrane domains. In mammals, five dopamine receptors subtypes, DRD1–DRD5, have been identified and classified to two major subfamilies: D1-like receptors (DRD1 and DRD5) and Abbreviations: DRD2, Dopamine D2 receptor; cDNA, complementary to RNA; bp, base pair(s); RT-PCR, reverse transcription polymerase chain reaction; SNPs, single nucleotide polymorphisms; indel, insert-deletion; DRD1, Dopamine D1 receptor; DRD3, Dopamine D3 receptor; DRD4, Dopamine D4 receptor; DRD5, Dopamine D5 receptor; CDS, complete coding sequence; aa, amino acids; NJ, neighbor-joining; JTT, Jones–Thornton–Taylor; ORF, open reading frame; UTR, untranslated region; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase. ⁎ Corresponding author. Tel./fax: +86 21 62200221. E-mail address: [email protected] (D. He).

D2-like receptors (DRD2, DRD3 and DRD4) based on their pharmacological, biochemical and physiological differences (Gingrich and Caron, 1993; Kebabian and Calne, 1979; Missale et al., 1998). In avians, two distinct dopamine receptor subtypes, DRD1 and DRD2, have been reported. Dopamine D2 receptor (DRD2) belongs to the family of G-proteincoupled receptors and involves in the dopaminergic pathways. Bunzow et al. (1988) first isolated the rat DRD2 from a brain cDNA library. Subsequently, the DRD2 gene had been studied in many species, including human, rat, turkey, canine, pig and chicken (Gandelman et al., 1991; Grandy et al., 1989; Itokawa et al., 1993; Montmayeur et al., 1991; Myeong et al., 2000; Schnell et al., 1999; Seeman et al., 2000; Toso et al., 1989; Xu et al., 2010, 2011). In turkeys, two spliced isoforms were isolated and some studies suggested that the expression of the DRD2 mRNA was correlated with broodiness (Schnell et al., 1999). In chickens, study indicated that the polymorphisms of DRD2 gene were associated with chicken broodiness (Xu et al., 2010). Both of these studies suggested that DRD2 gene played an important role on regulating the reproductive behaviors of avians. In goose, broodiness is a crucial reproductive behavior and can lead to poor egg production. Recently, the DRD2 has been well studied as a candidate gene of broodiness in chicken and turkey. However, the information of goose DRD2 gene is quite limited. In the present study, we isolated and characterized the cDNA and genomic DNA sequences of the goose DRD2 gene, identified four splice variants and investigated their expression patterns in different tissues. Meanwhile, polymorphisms

0378-1119/$ – see front matter. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.11.037

178

C. Wang et al. / Gene 535 (2014) 177–183

were screened in the coding region and partial intron region of this gene. These data will provide a foundation for understanding the molecular mechanisms underlying the goose reproductive behaviors.

2. Materials and methods 2.1. Experimental animals and sample collection Four healthy female Zhedong White geese (Chinese goose, Anser cygnoides) of 150 d were obtained from the laying Zhedong White goose population and all geese were set free in an open ground with a free swimming pool, and reared under normal management conditions. The tissue of pituitary was used for cloning the goose DRD2 cDNA sequence. A total of 12 tissues, including the heart, liver, spleen, lung, kidney, sebum, breast muscle, duodenum, hypothalamus, pituitary, ovary and oviduct were sampled from each goose and used for tissue profile analysis. All tissue samples were collected immediately, frozen in liquid nitrogen, and stored at − 80 °C until RNA extraction. Blood samples were withdrawn from the brachial vein of six Chinese goose breeds (Zhedong White goose, Wanxi White goose, Sichuang White goose, Shitou goose, Zi goose, and Xingguo Grey goose, A. cygnoides) and two foreign goose breeds (White Roman goose and Landes goose, Anser anser), stored at −20 °C until genomic DNA extraction. All animal procedures were handled in compliance with the Law of the People's Republic of China on Animal Protection.

2.2. DNA extraction, RNA extraction and cDNA synthesis Genomic DNA was isolated from the blood samples of geese using a standard phenol–chloroform extraction method (Huang et al., 2003). DNA concentration and quality were measured with the spectrophotometer ND-1000 (Nano-Drop, USA), and the concentrations were adjusted between 50 and 300 ng/μL, stored at −20 °C. Total RNA was extracted from the above twelve tissues with Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and treated with RNase-free DNase I (TOYOBO, Japan) to remove any contaminating genomic DNA. First-strand cDNA was synthesized using ReverTra Ace Kit (TOYOBO, Japan) at 42 °C. 2.3. cDNA cloning of goose DRD2 gene According to the DRD2 mRNA sequences in chicken (NM_001113290), turkey (AF056201) and zebra finch (AB490795), three pairs of primers (D2-F1/D2-R1, D2-F2/D2-R2 and D2-F3/D2-R3, Table 1) were designed to amplify the complete coding sequence (CDS) of goose DRD2 gene. PCR amplification was performed in 50 μL volume with the following program: 94 °C for 5 min, followed by 38 cycles of 94 °C for 40 s, 40 s at annealing temperature, 1 min at 72 °C, and an extension step of 10 min at 72 °C. PCR products were applied on 2.0% agarose gel electrophoresis and purified using the Gel Extraction Kit and cloned into the PEASY-T1 vector (TransGen Biotech Co., Ltd., Beijing, China), then sequenced commercially.

Table 1 Primers used in this study. Primers purpose

Primer name

Primer sequence (5′ → 3′)

Product size (bp)

Tm (°C)

cDNA cloning

D2-F1 D2-R1 D2-F2 D2-R2 D2-F3 D2-R3 D2-GF1 D2-GR1 D2-GF2 D2-GR2 D2-GF3 D2-GR3 D2-GF4 D2-GR4 D2-GF5 D2-GR5 D2-RT-F D2-RT-R GAPDH-F GAPDH-R D2-SF1 D2-SR1 D2-SF2 D2-SR2 D2-SF3 D2-SR3 D2-SF4 D2-SR4 D2-SF5 D2-SR5 D2-SF6 D2-SR6 D2-SF7 D2-SR7 D2-SF8 D2-SR8 D2-SF9 D2-SR9

ATGGATCCCCTGAATCTATCCT CCCAGACCACGGCGATCATGAC ATAACACCCGCTACAGCTCAA GGGAGCCAGCAGATGATGAAA TGGGAAACTGGAGAAGAATG TTAACAGTGGAGGATCTTCAT TTGGCAGTGGCAGATCTCTT GCACATCATGACATCAAGGG TTGATGTCATGATGTGCACC CGATGAAGGGGACGTAGAAG CCCTTCATCGTCACCCTGCT CAGAGCTTCACGTCTTCTGG CCAAGTTAATAAGCGCAAAG GAAGCAACCGGCACAACCAA TTCTAATCGGGGCACCAACT AATCGCAGTGCATGTTCAGG AAGCGGAGGAAGCGTGTCAA CCATTCTTCTCCAGTTTCCC GGTGGTGCTAAGCGTGTCAT CCCTCCACAATGCCAAAGTT AGACCAATGCGGACCAGAAG GGTCCTTTCACTCCACATTT TTGCGCTCCCATGTCTCACT CCGGCCTCGACTACTGTACT GCAAGCTGGAACATGGGAGG GCCAATAGCCATCTGCAGGT GCTTGCAGTTTCATGGGAGG ACCAGCCTGTGACCTGATAA AAGGTGAATGCTGTGTCGTG CCTCGCTGCTTCCTCTGCTT AGCAGCTAGCAGGGATATGT AGAGAAAAGGGGAAAGCTAA ATAAGCGCAAAGTGGTGAGT TGCCCACAACATAAAGACAG AAACATTCATTGCTGCTCCC AAATGGATGCCCTAATTCTG GTGAGAGTGCGCGTTGGATT GACATATCCAAGCCACGTAA

478

58.0

751/739/ 664/604 370

57.4 53.2

2909

54.9

2482

55.8

1009

56.3

786

53.7

771

56.3

356/344/ 257/197 203

56.7

487

54.6

570

56.7

751

57.4

653

57.2

482

57.6

479

54.4

643

52.5

481

55.1

597

54.5

Genomic DNA cloning

Expression profile Internal control Polymorphisms

60.0

C. Wang et al. / Gene 535 (2014) 177–183

179

2.4. Genomic DNA cloning of goose DRD2 gene

2.8. Polymorphism identification

Based on the cDNA sequence obtained from the above RT-PCR reaction and the genomic DNA sequence of chicken (NC_006111), five pairs of primers (D2-GF1/D2-GR1–D2-GF5/D2-GR5, Table 1) were designed to amplify the genomic DNA sequence of goose DRD2 gene. The PCR profile was 5 min at 94 °C followed by 38 cycles of 40 s at 94 °C, 40 s at annealing temperature, 1–2.5 min at 72 °C, and a final extension of 10 min at 72 °C. PCR products were gel purified, cloned and sequenced.

The eight goose populations were applied to construct the DNA pooling. According to the obtained genomic DNA sequence, nine pairs of primers (D2-SF1/D2-SR1 ~ D2-SF9/D2-SR9, Table 1) were synthesized to identify the polymorphisms of the coding region and partial intron region of goose DRD2 gene. PCR products were amplified from the DNA pools and sequenced directly by the SangonBiotech (Shanghai, China). The obtained sequences were aligned by SeqMan of DNASTAR software and we predicated SNPs and analyzed variation of incise enzyme sites by using Primer Premier 5.1 software.

2.5. Sequence analysis 3. Results The obtained cDNA and genomic DNA sequences were matched using DNAMAN software. The cDNA sequence prediction was conducted with GenScan software (http://genes.mit.edu/GENSCAN.html). Sequence similarity searches in Genbank were performed by using the BLAST2.1 search tool (http://www.ncbi.nlm.nih.gov/blast). The cDNA sequence was employed and compared with the genomic sequence to predict potential gene structure. The biophysics characteristics of the putative proteins of DRD2 were performed using online tools on the ExPASy website (http://cn.expasy.org/tools/).

2.6. Phylogenetic analysis The ClustalW Multiple Alignment program (http://www.ebi.ac.uk/ clustalw/) was used to create the multiple sequence alignment. A phylogenetic tree was constructed based on the amino acid sequences alignment by the neighbor-joining (NJ) algorithm using the MEGA 5.0 software (Tamura et al., 2011). The reliability of the branching was tested by bootstrap re-sampling (1000 replicates). The evolutionary distances were computed using the Jones–Thornton–Taylor (JTT) matrix-based method (Jones et al., 1992). All the sequences used were downloaded from the GenBank databases.

2.7. Expression pattern of goose DRD2 mRNAs To detect the tissue distributions of the four mRNAs encoding the DRD2 isoforms, semi-quantitative RT-PCR were carried out using total RNA from twelve goose tissues and a pair of primers (D2-RT-F/D2RT-R, Table 1) encompassing the alternative splicing region. The PCR program included a denaturation step of 5 min at 94 °C, followed by 28–36 cycles of 30 s at 94 °C, 30 s at 60 °C, 30 s at 72 °C, and a final step of 5 min at 72 °C. As control, a pair of primers (GAPDH-F/ GAPDH-R, Table 1) was used under the above conditions. The PCR reactions were optimized for a number of cycles to ensure product intensity within the linear phase of amplification. PCR products were visualized on 3.5% agarose gels stained with ethidium bromide and visualized with ultraviolet light.

3.1. cDNA sequence analysis of goose DRD2 gene The goose DRD2 cDNA was amplified by RT-PCR using the primer pairs D2-F1/D2-R1, D2-F2/D2-R2 and D2-F3/D2-R3 (Fig. 1). The sequence analysis displayed that both the primer pairs D2-F1/D2-R1 and D2-F3/D2-R3 amplified single and clear product (Figs. 1A and C), which exhibited high homology with the cDNA sequence of DRD2 gene in other species. Strikingly, four different length PCR products were obtained from the primer pairs D2-F2/D2-R2 (Fig. 1B), which suggest that the goose DRD2 gene may have four different transcripts, DRD2-1 (Genbank: KF312585), DRD2-2 (Genbank: KF312586), DRD2-3 (Genbank: KF312587) and DRD2-4 (Genbank: KF312588). DRD2-1 transcript contained an open reading frame (ORF) of 1353 base pair (bp) and encoded a protein of 450 amino acids (aa). DRD2-2 transcript contained a 1341 bp ORF, which was generated due to a 12 bp fragment deletion (a portion of exon 6) in DRD2-1 transcript and resulted in a 4 aa absence in its putative third cytoplasmic loop. DRD2-3 transcript had 1254 bp, which was generated due to a 99 bp deletion (the entire exon 5 and a portion of exon 6) in DRD2-1 transcript and resulted in a 33 aa absence in its putative third cytoplasmic loop. DRD2-4 transcript lacked of 159 bp (a portion of exon 6) in DRD2-1 transcript and resulted in 53 aa absence in its putative third cytoplasmic loop (Fig. 2). The four different spliced modes of goose DRD2 gene have been shown in Fig. 3A. The prediction results from the bioinformatics software analysis indicated that all the four deduced goose DRD2 proteins were typical membrane proteins and contained seven putative transmembrane domains and four potential sites of N-linked glycosylation (N-X-S or N-X-T) (Fig. 2). 3.2. Genomic structure of goose DRD2 gene The sequence matching and alignment analysis showed that a genomic DNA sequence (Genbank: KF312584) spanned approximately 8310 bp was amplified from the genomic DNA of Zhedong White goose. Based on the comparison of genomic and cDNA sequences, the goose DRD2 gene is divided into seven exons, which with nucleotide sizes of 282, 110, 137, 191, 87, 352 and 194 bp, respectively. The length

Fig. 1. The amplified product results of goose DRD2 gene. Lane M, DL2000 Marker; Lane A, amplification fragment of primer D2-F1/D2-R1, 478 bp; Lane B, amplification fragment of primer D2-F2/D2-R2, 751, 739, 664 and 604 bp; Lane C, amplification fragment of primer D2-F3/D2-R3, 370 bp.

180

C. Wang et al. / Gene 535 (2014) 177–183

*

C. Wang et al. / Gene 535 (2014) 177–183

181

Fig. 3. The four different spliced modes and genomic organization of goose DRD2 gene. A: The four different splice variants of the goose DRD2 mRNA. B: The genomic organization of goose DRD2 gene. The gray boxes represent the exons and lines denote the introns. Exons are numbered by E1–E7. Numbers below the gray box display the nucleotide size for each exon, whereas numbers above the line display the nucleotide size for each intron. Boundary nucleotides of exons and introns are shown with capital and lowercase characters each. The “gt” and “ag” in bold of indicate that the consensus sequences of introns follow the “GT-AG” rule except for the intron 5.

of six introns is 2710, 1565, 644, 851, 633 and 484 bp, respectively. All the introns of goose DRD2 gene conformed to the “GT-AG” consensus splice site rule, but for the intron 5, which originated by TG splice site (Fig. 3B). Meanwhile, the genomic DNA sequence also verified the existence of the above four goose DRD2 transcripts, which originated by alternative splicing. 3.3. The phylogeny of DRD2 Sequence similarity searches and multiple sequence alignment analysis revealed that the four transcripts shared approximately 76–91% nucleotide identity and 72–91% amino acids identity with the counterparts of other species. Based on the alignment results of the DRD2 amino acids sequences from Anas platyrhynchos (XP_005030946), Columba livia (EMC78343),Gallus gallus (NP_001106761), Meleagris gallopavo (XP_003212779), Taeniopygia guttata (XP_002191647), Homo sapiens (NP_000786), Mus musculus (NP_034207), Macaca mulatta (XP_001085571), Ovis aries (XP_004016081), Sus scrofa (NP_001231182), Bos taurus (NP_776468), Oryctolagus cuniculus (XP_002708433), Felis catus (XP_003992410) and Canis lupus familiaris (NP_001003110) those had been existing in the Genbank, a phylogenetic tree was constructed using MEGA 5.0 software as shown in Fig. 4. It was clustered into two subgroups, the avian species including goose, duck, pigeon, turkey, chicken and zebra finch belonging to one group, and the mammal species belonging to another one. The phylogenetic tree indicated that the deduced goose DRD2 protein showed a closer genetic relationship with the avian species DRD2 than with those of the mammal species (Fig. 4). 3.4. Differential expression of the four goose DRD2 transcripts In order to gain insight into their functions, we analyzed the mRNA distributions of the four goose DRD2 transcripts by semi-quantitative RT-PCR. As shown in Fig. 5, except for DRD2-3 transcript, the other three transcripts displayed specific expression in the examined tissues. The DRD2-1 mRNA presented at high level in the pituitary and ovary,

medium level in the kidney, lung and hypothalamus, and low level in the duodenum. No expression was detected in other tissues including the heart, liver, spleen, sebum, breast muscle and oviduct. The DRD2-2 transcript was detected in the pituitary, ovary, kidney, lung, as well as in the hypothalamus. The DRD2-4 transcript was expressed specifically in the pituitary, ovary and kidney. However, the DRD2-3 transcript was widely expressed in all the examined tissues, it showed the most abundant expression in liver, spleen and kidney tissues, intermediate in lung, sebum, duodenum, pituitary, ovary and oviduct tissues, and negligible in heart and breast muscle tissues (Fig. 5). 3.5. Polymorphisms of the goose DRD2 gene The sequences from the nine pairs of primers (D2-SF1/D2-SR1–D2SF9/D2-SR9) were aligned by SeqMan of DNASTAR software. 54 SNPs and 4 indel variations were identified in about 4860 bp sequence, which covering the complete coding region and part of intron region (Table 2). The polymorphism density was one SNP per 84 bp. In these 58 variations, 3 SNPs located in the coding region and 55 variations in intron region. The average density for the coding region and the intron region was one SNP per 451 bp and one per 64 bp, respectively. In the coding region, the three SNPs were synonymous polymorphisms, C5571T (Ile194Ile) occurred in the transmembrane domain V, both T5625C (Tyr212Tyr) and C7581T (Leu370Leu) located in the third intracellular loop. 4. Discussion Like other member of the dopamine receptors, DRD2 belongs to the family of G protein-coupled receptors with seven primary transmembrane domains. In this study, a length of 1353 bp cDNA sequence was isolated from the pituitary tissues, both the obtaining cDNA and deduced amino acids sequences exhibited high homology with their counterparts of DRD2 in other species. In addition, as shown in Fig. 1, the deduced proteins lacked an apparent signal sequence, contained

Fig. 2. Composite nucleotide and deduced amino acid sequences of goose DRD2 gene. A single open reading frame of 1353 bp (DRD2-1 transcript) is present, encoding a protein of 450 amino acids. The letters are underlined and in bold indicate the start codon (ATG), the stop codon (TAA) is indicated with an asterisk. Seven stretches of amino acid sequence predicted to encode transmembrane domains are boxed with solid lines. Four potential sites of N-linked glycosylation (N-X-S or N-X-T) are indicated by a wavy underline. The additional 12-bp (4aa) specific to the DRD2-1 transcript are boxed with dotted line. Nucleotides and amino acids in shadow indicate a 99-bp deletion in the coding region and 33-aa deletion of goose DRD2-3. A 159-bp deletion (53-aa deletion) in the coding region of goose DRD2-4 is underlined.

182

C. Wang et al. / Gene 535 (2014) 177–183

Ovis aries

72 61

Bos taurus Sus scrofa

26

Felis catus 100 63

Canis lupus familiaris

Mammal species

Mus musculus Oryctolagus cuniculus

46

Homo sapiens

34 99

Macaca mulatta Taeniopygia guttata

100

Gallus gallus Meleagris gallopavo

Columba livia

89

Avian species

Anser sygnoides

56 99

Anas platyrhynchos

0.02 Fig. 4. The phylogenetic tree of goose DRD2 amino acid sequences with other fourteen species. The phylogenetic tree was constructed by the Neighbor-Joining (NJ) method of MEGA 5.0 by using the amino acids sequences of DRD2 in fifteen species. The numbers at the branches denote the bootstrap majority consensus values on 1000 replicates. The branch lengths represent the relative genetic distance among these species.

seven typical transmembrane domains and consensus sequences for three potential N-linked glycosylation sites, which was consistent with the structural features of DRD2 (Sibley and Monsma, 1992). In human, rat and mouse, the DRD2 gene was composed of 8 exons and 7 introns (Mack et al., 1991; O'Malley et al., 1990; Taylor et al., 2006). Similar to the DRD2 gene in cattle, pig, canine and chicken, the goose DRD2 gene contained 7 exons and 6 introns, but the size of partial exons and introns varied in different species (Myeong et al., 2000; Xu et al., 2010, 2011; Zimin et al., 2009). Except for the intron 5, the other five introns of goose DRD2 gene conformed to the GT/AG consensus splice site rule, which was consistent with that had been reported in human (Seeman et al., 2000). The obtaining of cDNA and genomic sequences of goose DRD2 gene will facilitate the future research on the gene functions. In humans, alternative splicing generated three isoforms of DRD2, D2long (DRD2L), D2short (DRD2S) and D2Longer. The D2long referred to the long form of DRD2 (contained an additional 29 amino acids in its putative third cytoplasmic loop), the D2short referred to the short form of DRD2 (deleted the additional 29 amino acids) and the D2Longer contained six extra bases located before the start of exon 6 (in comparison to D2Long or D2Short) (Gandelman et al., 1991; Grandy et al., 1989; Seeman et al., 2000; Toso et al., 1989). In this study, four goose DRD2 transcripts have been identified due to different alternative splicing event. Similar to the human D2Longer variant, the DRD2-1 variant contained 12 extra bases located before the start of exon 6 and had the unusual nature of TG splice site (Seeman et al., 2000). The DRD2-2 and DRD2-3 variants were equal to the DRD2L and DRD2S variants, which were ubiquitous spliced variants and had been characterized in some species, such as human, rat, turkey, canine and pig (Grandy et al., 1989; Myeong et al., 2000; Schnell et al., 1999; Toso et al., 1989; Xu et al., 2011). Different from the above three variants, the DRD2-4 variant was a novel splice variant, which was generated due to a 159 bp fragment deletion (a portion of exon 6) in DRD2-1 transcript or a 147 bp fragment deletion (a portion of exon 6) in DRD2-2 transcript. Except the above four goose DRD2 variants, we have not found other DRD2 forms, which have been submitted in GenBank. Up to now, the distribution of the DRD2 mRNA has been well characterized by several researchers. In humans and mouse, DRD2 expressed high mRNA level in the pituitary and low level in the cortex (Montmayeur et al., 1991; Neve et al., 1991). In turkeys, the DRD2 gene was widely distributed in the cerebellum, hypothalamus and

pituitary (Schnell et al., 1999). In canines, RT-PCR analysis displayed that the DRD2 showed the most abundant expression in brain tissues, including the midbrain, cerebellum, thalamus, cerebral cortex, hippocampus, and brain stem (Myeong et al., 2000). In pigs, both DRD2L and DRD2S were detected in the cerebrum, cerebellum, hypothalamus, pituitary and oviduct (Xu et al., 2011). However, our previous study in geese demonstrated that the DRD2-2 was expressed in the pituitary, ovary, kidney, hypothalamus and lung, but the DRD2-3 was found in all examined tissues, which was a little different from the expression pattern reported in pigs. The different expression patterns of the two spliced transcripts are probably related to their different functions in different species. The specific expression of DRD2-1, DRD2-2 and DRD2-4 transcripts in hypothalamic–pituitary–ovarian axis indicated the important roles of goose DRD2 gene in regulate hormone secretion and reproductive behaviors. Meanwhile, we also found their specific expression in the kidney, a tissue known to be responsive to D2 dopaminergic agents (Gingrich and Caron, 1993). Further studies will be aimed to detect a functional difference between the four forms of goose DRD2 gene. In chickens, Xu et al. (2010) identified 27 variations in DRD2 gene and reported their association with chicken broodiness. Subsequently, their study on the polymorphisms of pig DRD2 gene also demonstrated a large number of variations (Xu et al., 2011). In this research, 58 variations were identified in about 4860 bp sequence of the goose DRD2 gene. Both of the SNP frequencies in the CDS region or in the intron region were consistent with the study on poultry species (Xu et al.,

Fig. 5. Expression profile of four goose DRD2 transcripts in twelve tissues. Lane M, MarkerI; DRD2-1, DRD2-2, DRD2-3 and DRD2-4 are the PCR products of D2-RT-F/D2-RT-R primers, the lengths of the PCR products are 356, 344, 257, and 197 bp, respectively. The tissue samples are heart, liver, spleen, lung, kidney, sebum, breast muscle, duodenum, hypothalamus, pituitary, ovary and oviduct from adult female geese. GAPDH is used as the control.

C. Wang et al. / Gene 535 (2014) 177–183

183

Appendix A. Supplementary data

Table 2 Polymorphisms detected in goose DRD2 gene. No

Variation

Region

No

Variation

Region

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

T384C C459A G496A C513T C521T C2860A T2870A T2882C G2885T C2886T G2916T T2961A C3007T G3012A C3017T C3212T G4282A C4286T T4300C C4226A G4493A A4521G G4555A C4575T G4635A T5356C 5459-60AG indel T5478C C5571T

Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron3 Intron3 Intron3 Exon4

30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 59 50 51 52 53 54 55 56 57 58

T5625C C5729T G5743A T5939C C5956T C5972T T5991A A6164G G6277A C6424T T6488C C6509T A6514G T6682C T6900G6925A T7057C T7074C G7142A A7151G G7161A C7229T A7230G C7581T 7725-26GT indel A7850C 7905-06TACAGC indel G7994C C8079A

Exon4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron4 Intron5 Intron5 Intron5 Intron5 Intron5 Intron5 Intron5 Intron5 Intron5 Intron5 Exon6 Intron6 Intron6 Intron6 Intron6 Intron6

2005). All the SNP densities of DRD2 gene in goose and other species revealed that it was rich in polymorphisms and its amino acid sequences were highly conserved in different individuals of the same species. Even synonymous mutations may be involved in regulating gene expression through effecting on mRNA stability (Duan et al., 2003). Meanwhile, the mutations located in the intron region could affect the mRNA splicing or protein modification and were related with diseases or traits (Xu et al., 2011). The potential effects of the large number of mutations identified in this research will be investigated in our following work. In conclusion, we first cloned and characterized the cDNA and genomic DNA sequences of goose DRD2 gene, identified four splice variants and investigated their distributions in different tissues. Meanwhile, the SNPs were detected in this gene will provide useful molecular marker in future goose breeding. All the information derived from this study could be valuable and facilitate further studies on the functions of goose DRD2 gene. Conflict of interest The authors declare that they have no competing interests. Acknowledgments The authors thank Prof. Yanzhang Gong for the kind advice on this research (Huazhong Agricultural University) and Ph.D Yong Yu for the language editing on our manuscript (Wellcome Trust Sanger Institute, UK). This study was supported by the fund of China Agriculture Research System (Grant No. CARS-43), the Key Research Program of Prospering Agriculture Through Science and Technology of Shanghai Management Office (Grant No. 2009: 2-1) and the Construction Program of Zhedong White Goose Breeding Platform.

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2013.11.037. References Baskerville, T.A., Douglas, A.J., 2010. Dopamine and oxytocin interactions underlying behaviors: potential contributions to behavioral disorders. CNS Neurosci. Ther. 16, 92–123. Blasi, G., et al., 2009. Functional variation of the dopamine D2 receptor gene is associated with emotional control as well as brain activity and connectivity during emotion processing in humans. J. Neurosci. 29, 14812–14819. Bunzow, J.R., et al., 1988. Cloning and expression of a rat D2 dopamine receptor cDNA. Nature 336, 783–787. Duan, J., et al., 2003. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum. Mol. Genet. 12, 205–216. El Halawani, M.E., Youngren, O.M., Silsby, J.L., Phillips, R.E., 1991. Involvement of dopamine in prolactin release induced by electrical stimulation of the hypothalamus of the female turkey (Meleagris gallopavo). Gen. Comp. Endocrinol. 84, 360–364. Gandelman, K.Y., Harmon, S., Todd, R.D., O'Malley, K.L., 1991. Analysis of the structure and expression of the human dopamine D2 receptor gene. J. Neurochem. 56, 1024–1029. Gingrich, J.A., Caron, M.G., 1993. Recent advances in the molecular biology of dopamine receptors. Annu. Rev. Neurosci. 16, 299–321. Grandy, D.K., et al., 1989. Cloning of the cDNA and gene for a human D2 dopamine receptor. Proc. Natl. Acad. Sci. U. S. A. 86, 9762–9766. Huang, M.C., Lin, W.C., Horng, Y.M., Rouvier, R., Huang, C.W., 2003. Female-specific DNA sequences in geese. Br. Poult. Sci. 44, 359–364. Itokawa, M., Arinami, T., Futamura, N., Hamaguchi, H., Toru, M., 1993. A structural polymorphism of human dopamine D2 receptor, D2 (Ser311- N Cys). Biochem. Biophys. Res. Commun. 196, 1369–1375. Jones, D.T., Taylor, W.R., Thornton, J.M., 1992. The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8, 275–282. Kebabian, J.W., Calne, D.B., 1979. Multiple receptors for dopamine. Nature 277, 93–96. Korchounov, A., Meyer, M.F., Krasnianski, M., 2010. Postsynaptic nigrostriatal dopamine receptors and their role in movement regulation. J. Neural Transm. 117, 1359–1369. Mack, K.J., Todd, R.D., O'Malley, K.L., 1991. The mouse dopamine D2A receptor gene: sequence homology with the rat and human genes and expression of alternative transcripts. J. Neurochem. 57, 795–801. Missale, C., Nash, S.R., Robinson, S.W., Jaber, M., Caron, M.G., 1998. Dopamine receptors: from structure to function. Physiol. Rev. 78, 189–225. Montmayeur, J.P., Bausero, P., Amlaiky, N., Maroteaux, L., Hen, R., Borrelli, E., 1991. Differential expression of the mouse D2 dopamine receptor isoforms. FEBS Lett. 278, 239–243. Myeong, H., et al., 2000. Genomic analysis and functional expression of canine dopamine D2 receptor. Gene 257, 99–107. Neve, K.A., Neve, R.L., Fidel, S., Janowsky, A., Hingins, G.A., 1991. Increased abundance of alternatively spliced forms of D2 dopamine receptor mRNA after denervation. Proc. Natl. Acad. Sci. U. S. A. 88, 2802–2806. O'Malley, K.L., Mack, K.J., Gandelman, K.Y., Todd, R.D., 1990. Organization and expression of the rat D2A receptor gene: identification of alternative transcripts and a variant donor splice site. Biochemistry 29, 1367–1371. Schnell, S.A., You, S., Foster, D.N., El Halawani, M.E., 1999. Molecular cloning and tissue distribution of an avian D2 dopamine receptor mRNA from the domestic turkey (Meleagris gallopavo). J. Comp. Neurol. 407, 543–554. Seeman, P., Nam, D., Ulpian, C., Liu, I.S., Tallerico, T., 2000. New dopamine receptor, D2Longer, with unique TG splice site, in human brain. Mol. Brain Res. 76, 132–141. Sibley, D.R., Monsma Jr., F.J., 1992. Molecular biology of dopamine receptors. Trends Pharmacol. Sci. 13, 61–69. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Taylor, T.D., Noguchi, H., Totoki, Y., Toyoda, A., 2006. Human chromosome 11 DNA sequence and analysis including novel gene identification. Nature 440, 497–500. Toso, R.D., et al., 1989. The dopamine D2 receptor: two molecular forms generated by alternative splicing. EMBO J. 8, 4025–4034. Xu, H., et al., 2005. SNP selector: a web tool for selecting SNPs for genetic association studies. Bioinformatics 21, 4181–4186. Xu, H.P., et al., 2010. The dopamine D2 receptor gene polymorphisms associated with chicken broodiness. Poult. Sci. 89, 428–438. Xu, H.P., et al., 2011. Molecular cloning, expression and variation analyses of the dopamine D2 receptor gene in pig breeds in China. Genet. Mol. Res. 10, 3371–3383. Zimin, A.V., et al., 2009. A whole-genome assembly of the domestic cow, Bos taurus. Genome Biol. 10, R42.