- Email: [email protected]
Molecular characterization and evolutionary analysis of horse BAFF-R, a tumor necrosis factor receptor related to B-cell survival
International Immunopharmacology 18 (2014) 163–168
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Molecular characterization and evolutionary analysis of horse BAFF-R, a tumor necrosis factor receptor related to B-cell survival Haitao Wu a,b, Shanshan Chen c, Meng Liu a, Xingzhou Xu a, Xuemei Ji a, Kai Gao a, Aiying Tian a, Zhen Ke a, Jianrong Zhang d, Bo Zhao c, Shuangquan Zhang a,⁎ a
Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, Life Science College, Nanjing Normal University, Nanjing 210046, PR China Basic Medical College, Nanjing University of Chinese Medicine, Nanjing 210046, PR China College of Chemistry and Materials Science, Nanjing Normal University, Nanjing 210046, PR China d Hongshan Forest Zoo, Nanjing 210028, PR China b c
a r t i c l e
i n f o
Article history: Received 1 June 2013 Received in revised form 9 November 2013 Accepted 18 November 2013 Available online 28 November 2013 Keywords: Horse (Equus caballus) B cell BAFF-R Ligand–receptor interaction Evolution
a b s t r a c t B-cell survival depends on signals induced by B-cell activating factor (BAFF) that binds to the BAFF receptor (BAFF-R). Herein, a BAFF-R homolog was identified in a horse (Equus caballus). The horse BAFF-R gene, located on chromosome 28, spans 1444 base pairs and encodes a 183-amino acid protein. The protein is structurally conserved, in which the DxL motif plays an important role in binding to BAFF. Furthermore, the horse BAFF-R extracellular domain was expressed and purified, which specifically bound to His6-sBAFF and had the capability of blocking the function of His6-sBAFF in vitro. Finally, evolutionary analyses indicated that some codon sites of BAFF-R evolve with positive selection and that the genetic relationship among a horse, Chiroptera, and Caniformia are the closest. © 2013 Elsevier B.V. All rights reserved.
1. Introduction B cell activating factor belonging to the TNF family (BAFF or BLyS; also known as THANK, TALL-1, and TNFSF13B) is a key B cell survival factor [1] and is associated with autoimmune diseases and B cell lymphomas [2]. BAFF is mainly produced by innate immune cells such as neutrophils, macrophages, monocytes, and dendritic cells. Furthermore, BAFF is produced by malignant B cells and acts as an essential autocrine survival factor for malignant B cells [3]. In BAFF-deficient mice, B cells are unable to progress past the transitional T2 stage that results in impaired humoral immune responses [4]. BAFF-transgenic mice develop a lupus-like autoimmune disease [5], in which self-reactive B cells are rescued from peripheral deletion because of overexpressed BAFF [6]. Therefore, BAFF is considered a therapeutic target for some autoimmune diseases, especially for systemic lupus erythematosus and rheumatoid arthritis. Recently, a human monoclonal antibody targeting soluble BAFF (belimumab) was approved for patients with systemic lupus erythematosus by the United States Food and Drug Administration and the European Medicines Agency [7]. Moreover, three additional BAFF antagonists (atacicept, blisibimod, and tabalumab) are currently involved in clinical trials [8].
⁎ Corresponding author. Tel.: +86 25 8589 1053. E-mail address: [email protected] (S. Zhang). 1567-5769/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.intimp.2013.11.019
BAFF binds to three receptors including the BAFF receptor (BAFF-R, BR3, or TNFRSF13C), transmembrane activator and CAML interactor (TACI or TNFRSF13B), and B-cell maturation antigen (BCMA or TNFRSF17). A proliferation-inducing ligand (APRIL or TNFSF13) shares both TACI and BCMA with BAFF. BAFF-R specifically binds to BAFF, which is the main receptor triggering BAFF-induced B-cell survival [9]. Stimulation of BAFF-R potently activates the alternative NF-κB2 pathway, which provides one of the bases for the effect of BAFF on B-cell survival [10]. In BAFF-R-deficient mice, the number of mature peripheral B cells is significantly reduced [11]. As for the expression of most B-cell subsets [12], BAFF-R is expressed by many low-grade B-cell neoplasms and some diffuse large B-cell lymphomas [13]. Interestingly, surface BAFF-R is downregulated in chronic lymphocytic leukemia [14] and upregulated in precursor B-lineage acute lymphoblastic leukemia [15]. Although the mechanism remains unclear, an understanding of BAFF-R dysregulation may offer novel diagnostic and therapeutic opportunities for these cancers. Horses (Equus caballus) have substantial value in sports and recreational fields and also can develop various immune-mediated diseases. For example, most horse lymphomas are of a B-cell origin [16]. In a horse, common variable immunodeficiency (CVID) is characterized by progressive B-cell lymphopenia [17]. Herein, identification and analysis of a novel horse TNF receptor related to B-cell survival is reported that may provide some information regarding the BAFF–BAFF-R system in a horse.
164
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
2. Materials and methods
2.3. Protein expression and purification
2.1. Molecular cloning of horse BAFF-R
The Fc fragment (hinge, CH2, and CH3) of the human immunoglobulin G1 (IgG1) was fused to the 3′-end of the horse BAFF-R extracellular sequence (1–219 bp), and then, the fused product was cloned into the pET28a vector (Novagen, USA). The approach utilized in this study is as follows. First, the horse BAFF-R extracellular sequence was produced by PCR with the primers, P1 and P2 (Table 1). The 5′-end of P2 was linked with the 15 bases that were located at the head of the human Fc sequence. Second, the Fc fragment was obtained by PCR with the primers, P3 and P4 (Table 1). Third, by using two PCR products as templates, the BAFF-R-Fc sequence was obtained with the primers, P1 and P4, with overlap extension PCR. Finally, the BAFF-R-Fc fragment was ligated to the Xba I–Hind III sites within pET28a. Escherichia coli BL21 (DE3) (Novagen, USA) was utilized to transform with a recombinant plasmid and was cultured in a Luria-Bertani medium with vigorous shaking (220 rpm) at 37 °C to a density of 0.6 (OD600). Then, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the final 0.5-mM concentration, and cells were grown at 20 °C with continuous shaking for another 20 h. The induced bacteria were centrifuged at 6000 g for 15 min, and the bacteria were resuspended in phosphate buffered saline (PBS; 1.47 mM KH2PO4, 10 mM Na2HPO4, 2.7 mM KCl, and 137 mM NaCl). After sonication and 10 000 g centrifugation at 4 °C for 15 min, the pH of the supernatant was adjusted to 8.0 with 2 M of Tris–HCl (pH 8). The supernatant was applied to the protein A resin (Genscript, China) that was previously equilibrated with PBS. The column was washed with PBS and eluted with an eluting buffer (0.1 M, citric acid–sodium citrate buffer; pH 3). The eluted fractions were collected in tubes containing neutralizing buffer (2 M, Tris–HCl; pH 8) in order to adjust the pH to 7. Finally, with an Amicon Ultra-15 3K centrifugal filter device (Millipore, USA), purified samples were concentrated and desalted with PBS. The expression and purification of recombinant protein BAFF-R-Fc was analyzed by using SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting with horseradish peroxidase (HRP)conjugated rabbit anti-human IgG (Boster, China).
For this study, cDNA for a human BAFF-R (GenBank accession no. AF373846) was used to search for the BAFF-R gene from the National Center for Biotechnology Information (NCBI) horse (E. caballus) genomic database (http://blast.ncbi.nlm.nih.gov/). The genomic DNA and total RNA were isolated from the blood of a Mongolian female horse (Hongshan Forest Zoo of Nanjing, Jiangsu, China) using a DNA isolation kit (Qiagen, Germany) and TRIzol (GIBCO/Bethesda Research Laboratory, USA), respectively. First strand cDNA was synthesized from 1 μg of RNA by using M-MLV Reverse Transcriptase (Promega, USA). Nested polymerase chain reaction (PCR) primers, R1, R2, R3, and R4, were used for the BAFF-R genomic DNA and cDNA amplification (Table 1). PCR products of an expected size were cloned with the pEASY-T1 Vector (TransGen Biotech, China) and sequenced with the ABI Prism automated sequencing method (YingJun, China). At least three independent sequencing experiments were conducted to rule out errors introduced by PCR. Finally, the horse BAFF-R genomic DNA, cDNA, and putative protein sequences were submitted to the NCBI GenBank.
2.2. Gene and protein analyses In order to determine the exact location of the exon–intron boundaries, an mRNA-to-genomic alignment program (www.ncbi.nlm.nih. gov/IEB/Research/Ostell/Spidey/index.html) was used. Multiple sequence alignment was performed with the ClustalW Multiple Alignment program (http://www.ebi.ac.uk/clustalw/). The protein was analyzed with the Expert Protein Analysis System (http://www. expasy.org/). The three-dimensional (3D) structure of the protein was determined by a homology modeling program by using ESyPred3D Web Server 1.0 (http://www.fundp.ac.be/sciences/biologie/urbm/bioinfo/ esypred/). Ligand–receptor docking was performed by using the ZDock and RDock modules of Discovery Studio 2.1 (Accelrys, USA). The top 20 poses in the ZDock result were chosen for the RDock calculation. From the RDock result, poses with both high ZRank and RRank (scores in ZDock and RDock) were selected as candidates for further analysis. Positive selection of the BAFF-R protein from the different species was detected by calculating the ratios for the non-synonymous to synonymous rate (ω = dN/dS) with the Adaptive Evolution Server (http://www.datamonkey.org/). A ratio of dN/dS that was greater than one was considered a positive selection. A phylogenetic analysis was performed by using the neighbor-joining method with the ClustalW and MEGA 4 packages (http://www.megasoftware.net/ mega4/mega.html).
Table 1 PCR primers used in this study. Primer
Direction
Nucleotide sequence (5′–3′)
R1 R2 R3 R4 P1
Forward Reverse Forward Reverse Forward
P2a P3a P4
Reverse Forward Reverse
GTCCCACTCCAGCAGGCAGAAGG GTGCGCGCCATCAGCAGC ATTATACATATGATGAGGCGACCGG GCGAAGCTTCTACTGTTGTTCAG CGCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC ATGAGGCGACCGGCGAGG GTCACAAGATTTGGGGGCCTCGGCCTC CCCAAATCTTGTGACAAAACTCAC GCGAAGCTTTNATTTACCNGGNGAC
a The 5′- end of primer P2 and P3 were complementary to each other, which is the former 15 bases of human IgG1 Fc sequence.
2.4. His6-sBAFF and BAFF-R-Fc binding assay Based on the cloning of horse BAFF cDNA (GenBank accession no. GU982934), the recombinant protein His6-soluble BAFF (soluble BAFF, also called sBAFF, is the soluble form of BAFF) was expressed by E. coli BL21 (DE3) and purified with Ni2+ affinity chromatography (data not shown). For the binding reaction, 10 μg of horse His6-sBAFF and 15 μg of BAFF-R-Fc were added to the binding buffer (PBS, 5 mM EGTA, 0.1% Triton X-100, and 0.5 mM PMSF), which was incubated on a rotating wheel at 4 °C overnight. After the addition of protein A/G PlusAgarose (Santa Cruz, USA), samples were incubated on a rotating wheel at 4 °C for another 2 h. Then, the samples were washed 5 times with a binding buffer, boiled in an SDS sample buffer, and analyzed by Western blotting with an HRP-conjugated rabbit anti-human IgG (Boster, China) for the detection of the Fc fragment, as well as a rabbit anti-His6 antibody (Boster, China) and an HRP-conjugated goat antirabbit IgG (Boster, China) for the detection of the His6 fragment. 2.5. Effect of BAFF-R-Fc on B-cell proliferation that was induced by His6-sBAFF and anti-IgM The B cell has been shown to proliferate in response to co-stimulation by BAFF and anti-IgM in vitro [18]. We used this assay to detect the inhibitory effect of BAFF-R-Fc on B-cell proliferation that was induced by His6-sBAFF and anti-IgM in vitro. Human peripheral blood B cells of N 95% purity were enriched with anti-CD19 magnetic beads (Milenyi Biotech, Germany), which were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal bovine serum and 100 U/ml of penicillin/streptomycin. For
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
165
BAFF-R-Fc (expressed and purified in our lab), were added to wells in sextuplicate. The blank group consisted of only human B cells, and the control group comprised cells treated with anti-IgM and His6-sBAFF. The cells were incubated at 37 °C in a humidified atmosphere with 5% CO2 for 48 h and then were measured with the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) method using a BioRad, model 550, microplate reader.
3. Results 3.1. Identification and analysis of the horse BAFF-R gene
Fig. 1. Horse BAFF-R cDNA and deduced amino acid sequence. The gray shading represents the intron location.
the blocking assay, B cells (2 × 105) that were suspended in a 0.1-ml RPMI-1640 medium were placed into individual wells of a 96-well plate, and 5 μg/ml of human His6-sBAFF (expressed and purified in our lab) and 2.5 μg/ml of goat anti-human IgM (Sigma-Aldrich, USA), as well as varying amounts of horse BAFF-R-Fc or human IgG or human
By searching the NCBI horse genomic database, chromosome 28, EquCab2.0, of a thoroughbred E. caballus, including a whole genome shotgun sequence (GenBank accession no. NC_009171), was identified that encompassed the entire horse BAFF-R gene. By further experimentation, 1444 bp of the horse BAFF-R gene and 552 bp of its cDNA were obtained. The horse BAFF-R gene was comprised of three exons and two introns (Fig. 1), of which all the exon–intron splice junction sequences conformed to the canonical GT–AG rule. The horse BAFF-R genomic and mRNA sequences were deposited in GenBank under the accession numbers of JF502271 and JF502272.
Fig. 2. Alignment of deduced amino acid sequences of a horse, human, cattle, mouse, and chicken BAFF-R by using ClustalW software. The asterisk (*) indicates that the aligned residues are identical. Substitutions said to be conservative and semi-conservative are marked by a colon (:) and period (.), respectively.
166
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
binding domain (Fig. 2), which had the highest level of homology among the BAFF-R proteins. In addition, the identity of the amino acid sequence of a BAFF-R between a horse and that of a cattle, human, mouse, or chicken was 68%, 72%, 55%, and 41%, respectively. 3.3. BAFF-R-Fc expression and purification The recombinant protein BAFF-R-Fc contained the first 73 amino acids of the BAFF-R extracellular domain of a horse and 231 amino acids of a human IgG1 Fc fragment (hinge, CH2, and CH3). The molecular weight of the BAFF-R-Fc was 33.39 kDa, with a calculated pI of 8.23. Because of the existence of an Fc fragment, the BAFF-R-Fc protein was successfully purified by affinity chromatography using a protein A resin (Fig. 3A), and the recombinant protein had the ability to form an S-S-linked dimer. Therefore, SDS-PAGE for the BAFF-R-Fc protein should result in a single-banded monomer-sized particle with a reducing condition (addition of 5% β-mercaptoethanol) and a dimer-sized band with a non-reducing condition (no β-mercaptoethanol). According to the SDS-PAGE and Western blotting results, a single band appeared in the position that had a molecular weight of b35 kDa with the reducing condition (Fig. 3B). With the non-reducing condition, besides the monomer band, BAFF-R-Fc also appeared in the 66-kDa position that corresponded to the molecular weight of the BAFF-R-Fc dimer (Fig. 3B). Therefore, the above-mentioned results indicated that the BAFF-R-Fc protein had been successfully expressed and purified. 3.4. Ligand–receptor binding
Fig. 3. Identification and purification of the recombinant protein BAFF-R-Fc. (A) The UV spectrum for affinity chromatography using protein A resin. (B) The SDS-PAGE and Western blotting analysis for the recombinant protein. Lane 1 and Lane 2 indicate the SDS-PAGE results, showing cell lysates of recombinant bacteria without induction and with a 0.5-mM IPTG induction. Lane 3 and Lane 4 indicate the SDS-PAGE results of purified BAFF-R-Fc with a reducing condition and non-reducing condition. Lane 5 indicates the Western blotting result of BAFF-R-Fc with a reducing condition.
3.2. Amino acid sequence analysis of horse BAFF-R The horse BAFF-R encoded a 183-amino acid protein, with a calculated molecular weight (MW) of 19 kDa and an isoelectric point (pI) of 6.12. It is a type III transmembrane protein, with an 81-amino acid cytoplasmic domain, a 23-amino acid hydrophobic transmembrane region, and a 79-amino acid extracellular domain (Fig. 2). By analyzing the primary structure of the horse BAFF-R, its extracellular domain had one cysteine-rich domain (CRD) containing four cysteine residues (Cys19, Cys24, Cys32, and Cys35). The DxL motif (Phe/Tyr/Trp-Asp-XLeu-Val/Thr-Arg/Gly) was located in the CRD. The cytoplasmic domain of the horse BAFF-R had one TNF receptor-associated factor 3 (TRAF3)
According to the immunoprecipitation result, it was shown that the His6-sBAFF bound to the BAFF-R-Fc, did not interact with the human IgG (Fig. 4). Using the Discovery Studio software, a docking study between the horse sBAFF and the BAFF-R extracellular domain was performed. The CRD of the horse BAFF-R spanned from Cys19 to Cys35 and formed a short β-hairpin structure. The DxL motif was located on the tip of the β-hairpin structure (Fig. 5A). According to the best docking pose from the Discovery Studio results (Fig. 5B), the BAFF-R extracellular domain of a horse had its DxL motif binding to a hydrophobic shallow pocket located in the sBAFF, which consisted of the following residues: Ile100, Pro131, Leu78, Ala74, and Gly76. In addition, the side chains of Arg132 and Phe73 for a horse sBAFF may participate in extensive hydrogen bonding with the DxL motif of BAFF-R. 3.5. The blocking of B-cell proliferation with BAFF-R-Fc in vitro It is well known that BAFF is a key B-cell survival factor. In our experiment, the co-stimulation of His6-sBAFF and anti-IgM maintained the survival and proliferation of B cells in vitro. With the addition of horse BAFF-R-Fc, the function of human His6-sBAFF was suppressed (Fig. 6), indicating that horse BAFF-R-Fc was capable of binding to human His6-sBAFF. In addition, the blocking effect of horse BAFF-R-Fc was slightly less than that of human BAFF-R-Fc, an indication that the interaction sites between BAFF-R and BAFF have been evolutionarily conserved. 3.6. BAFF-R evolutionary analysis
Fig. 4. The binding of His6-sBAFF and BAFF-R-Fc in vitro. The immunoprecipitation result confirmed that His6-sBAFF bound to BAFF-R-Fc but not to human IgG. Input, His6-sBAFF, or BAFF-R-Fc as a control for the immunoprecipitation result.
Many genes that are involved in immunity evolve rapidly [19]. An excess of non-synonymous substitutions can be interpreted as adaptive evolution or positive selection, which promotes the emergence of new phenotypes. The positive selection of a BAFF-R protein from different species was detected by the Adaptive Evolution Server. Using significance thresholds for a P value of b0.1, SLAC (single likelihood ancestor counting) and FEL (fixed effects likelihood) identified one and four positively selected codons, respectively. Using significance thresholds for a P value of b0.05, only FEL identified three positively selected codons (Table 2).
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
167
Fig. 5. The 3D structures of a horse BAFF-R CRD and BAFF–BAFF-R complex. (A) The homology-modeled horse BAFF-R CRD forms a short β-hairpin structure, containing two disulfide bonds. The DxL motif is located on the CRD tip. (B) The docking pose of the horse sBAFF (golden-yellow) with the BAFF-R CRD (green), in which some key residues are highlighted (blue).
The phylogenetic position of Perissodactyla has been a controversial issue. According to the phylogenetic analysis of the BAFF-R amino acid sequences from different species, the genetic relationship among a horse (Perissodactyla), Chiroptera, and Caniformia was the closest (Fig. 7).
4. Discussion BAFF receptors are different from that of most TNF receptors. For example, BAFF-R, TACI, and BCMA lack a signal peptide and death domain. The absence of a death domain suggests that their functions are irrelevant to apoptosis. In addition, most TNF receptors are typically organized into multiple CRDs, with each comprised of six cysteine residues and three disulfide bonds [20]. However, the CRD of BAFF-R contains only four cysteine residues and two disulfide bonds, making it the smallest CRD in the TNF receptor family. In this study, a BAFF-R homolog was identified in a horse by in silico cloning and molecular cloning. Similar to other BAFF-Rs, the extracellular and cytoplasmic domain of the BAFF-R from a horse contains one CRD and TRAF3 binding domain, which are more conservative than that of the other BAFF-R regions. The DxL motif located in the CRD plays an important role in BAFF– BAFF-R interaction [21], and the TRAF3 binding domain is associated with the NF-κB signaling pathway [22]. Generally, BAFF-R specifically binds to BAFF. It is reported that a shorter variant of APRIL exhibits weak but detectable binding to the
BAFF-R of a mouse [23]. However, a shorter APRIL variant cannot be produced in humans and is not detected in the expressed sequence tag of dogs, pigs, cows, or horses. In this study, the horse BAFF-R extracellular domain that was fused to the Fc fragment was expressed and purified, which specifically bound to His6-sBAFF. In the BAFF–BAFF-R complex, the BAFF-R extracellular domain has a DxL motif that binds to a hydrophobic shallow pocket located in sBAFF. Because the surface for the interaction is relatively small, the BAFF–BAFF-R interaction could be used as a therapeutic target for BAFF-mediated diseases. Our results also demonstrated that the recombinant protein BAFF-RFc had the capability of blocking the function of His6-sBAFF in vitro. The Fc fusion decoy receptors, BCMA-Fc, BAFF-R-Fc, and TACI-Fc, are therapeutic candidates for blocking BAFF in some human autoimmune diseases. Although BAFF-R-Fc is more effective than that of BCMA-Fc for blocking BAFF [24], progress has been made in preclinical and phase I studies regarding TACI-Fc [25,26]. However, whether TACI-Fc ultimately achieves clinical success from the standpoint of efficacy and safety remains an open question [27,28]. It has been reported that a BAFF-R mutation in codon 159 (His159Tyr) results in increased NF-κB1 and NF-κB2 activity and increased immunoglobulin production in non-Hodgkin's lymphoma [29]. However, it remains unclear as to what extent the BAFF-R from different species is subject to positive selection. Among the positively selected codon identified by Datamonkey, codons 159, 34, and 87 are located in the TRAF3 binding domain, ligand binding site, and transmembrane region of BAFF-R, respectively, suggesting that selection at these sites may affect signal transduction, ligand binding, membrane channel permeability, and membrane location of BAFF-R. The phylogenetic position of Perissodactyla has been a controversial issue. Many molecular studies have shown that the genetic relationship between Perissodactyla and Cetartiodactyla is the closest [30,31]. However, another report showed that Perissodactyla, Chiroptera, and
Table 2 The positively selected sites of BAFF-R examined with Datamonkey. Analysis model
Fig. 6. The binding of BAFF-R-Fc to His6-sBAFF was capable of blocking the function of His 6 -sBAFF in vitro. The inhibition rate was determined as follows: (control − experiment) / (control − blank), in which the blank group was the MTT OD value for the B cells only, while the control group was that of the cells treated with anti-IgM and His6-sBAFF; the experimental group was that of the cells treated with anti-IgM, His6-sBAFF, and BAFF-R-Fc. Error bars indicated S.D.
SLAC FEL
Codon site P = 0.01
P = 0.05
P = 0.1
None None
None 34,151,159
151 34,87,151,159
The following species are involved in the analysis of positive selection of BAFF-R: horse, cattle, human, mouse, chicken, African elephant, dog, chimpanzee, Chinese hamster, northern white-cheeked gibbon, white-tufted-ear marmoset, domestic guinea pig, rhesus monkey, Norway rat, giant panda, rabbit, tree shrew, megabat.
168
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
Fig. 7. A phylogenetic analysis of the BAFF-R amino acid sequences from different species. The tree was constructed with the neighbor-joining method by using the ClustalW and MEGA 4 packages that was bootstrapped 1000 times. The accession numbers of the BAFF-R mRNA in NCBI GenBank are: horse, JF502272; cattle, NM_001193192; human, AF373846; mouse, NM_028075; chicken, NM_001037828; predicted African elephant, XM_003419809; predicted dog, XM_843968; predicted chimpanzee, XM_001154286; predicted Chinese hamster, XM_003512340; predicted northern white-cheeked gibbon, XM_003264627; predicted white-tufted-ear marmoset, XM_002763903; predicted domestic guinea pig, XM_003470524; predicted rhesus monkey, XM_001101623; predicted Norway rat, XM_576316; predicted giant panda, XM_002926684; predicted rabbit, XM_002721383. The predicted BAFF-R sequences of zebra finch, tree shrew, megabat and hyrax have been obtained from Ensembl Genome Browser (http://asia.ensembl.org/ index.html).
Carnivora evolved from one clade of mammals [32]. As our result has demonstrated, the genetic relationship among a horse (Perissodactyla), Chiroptera, and Caniformia is the closest, which is similar to that of the latter phylogenetic position of Perissodactyla. In conclusion, we successfully cloned a full-length genomic DNA and cDNA of horse BAFF-R, illustrated its sequence and structure characterization, as well as analyzed the adaptive evolution and phylogeny of BAFF-R from different species. Moreover, we demonstrated that the recombinant protein BAFF-R-Fc specifically bound to His6-sBAFF with the capability of blocking the function of His6-sBAFF in vitro. These results provide a basis for the investigation of the role of the BAFF–BAFF-R system in regulating B-cell survival, as well as B-cell related immune diseases, in horses. Acknowledgements This work was funded by the grant from The National Science Foundation of China (No. 30971486) and The Priority Academic Program Development of Jiangsu Higher Education Institutions (No. 164320H106). The authors declare that they have no conflict of interest. References [1] Mackay F, Browning JL. BAFF: a fundamental survival factor for B cells. Nat Rev Immunol 2002;2:465–75. [2] Tangye SG, Bryant VL, Cuss AK, Good KL. BAFF, APRIL and human B cell disorders. Semin Immunol 2006;18:305–17.
[3] Kern C, Cornuel JF, Billard C, Tang R, Rouillard D, Stenou V, et al. Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL through an autocrine pathway. Blood 2004;103:679–88. [4] Schiemann B, Gommerman JL, Vora K, Cachero TG, Shulga-Morskaya S, Dobles M, et al. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 2001;293:2111–4. [5] Khare SD, Sarosi I, Xia XZ, McCabe S, Miner K, Solovyev I, et al. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice. Proc Natl Acad Sci 2000;97:3370–5. [6] Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. Predominant autoantibody production by early human B cell precursors. Science 2003;301:1374–7. [7] Chiche L, Jourde N, Thomas G, Bardin N, Bornet C, Darque A, et al. New treatment options for lupus — a focus on belimumab. Ther Clin Risk Manag 2012;8:33–43. [8] Stohl W. Biologic differences between various inhibitors of the BLyS/BAFF pathway: should we expect differences between belimumab and other inhibitors in development? Curr Rheumatol Rep 2012;14:303–9. [9] Bossen C, Schneider P. BAFF, APRIL and their receptors: structure, function and signaling. Semin Immunol 2006;18:263–75. [10] Vallabhapurapu S, Matsuzawa A, Zhang W, Tseng PH, Keats JJ, Wang H, et al. Nonredundant and complementary functions of TRAF2 and TRAF3 in a ubiquitination cascade that activates NIK-dependent alternative NF-kappaB signaling. Nat Immunol 2008;9:1364–70. [11] Thompson JS, Bixler SA, Qian F, Vora K, Scott ML, Cachero TG, et al. BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science 2001;5537:2108–11. [12] Mackay F, Schneider P. Cracking the BAFF code. Nat Rev Immunol 2009;9:491–502. [13] Nakamura N, Hase H, Sakurai D, Yoshida S, Abe M, Tsukada N, et al. Expression of BAFF-R (BR3) in normal and neoplastic lymphoid tissues characterized with a newly developed monoclonal antibody. Virchows Arch 2005;447:53–60. [14] Mihalcik SA, Tschumper RC, Jelinek DF. Transcriptional and post-transcriptional mechanisms of BAFF-receptor dysregulation in human B lineage malignancies. Cell Cycle 2010;9:4884–92. [15] Parameswaran R, Müschen M, Kim YM, Groffen J, Heisterkamp N. A functional receptor for B-cell-activating factor is expressed on human acute lymphoblastic leukemias. Cancer Res 2010;70:4346–56. [16] Kelley LC, Mahaffey EA. Equine malignant lymphomas: morphologic and immunohistochemical classification. Vet Pathol 1998;35:241–52. [17] Flaminio MJ, Tallmadge RL, Salles-Gomes CO, Matychak MB. Common variable immunodeficiency in horses is characterized by B cell depletion in primary and secondary lymphoid tissues. J Clin Immunol 2009;29:107–16. [18] Schneider P, MacKay F, Steiner V, Hofmann K, Bodmer JL, Holler N, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J Exp Med 1999;11:1747–56. [19] Wlasiuk G, Khan S, Switzer WM, Nachman MW. A history of recurrent positive selection at the Toll-like receptor 5 in primates. Mol Biol Evol 2009;26:937–49. [20] Smith CA, Farrah T, Goodwin RG. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell 1994;76:59–962. [21] Kim HM, Yu KS, Lee ME, Shin DR, Kim YS, Paik SG, et al. Crystal structure of the BAFF–BAFF-R complex and its implications for receptor activation. Nat Struct Biol 2003;10:342–8. [22] Ni CZ, Oganesyan G, Welsh K, Zhu X, Reed JC, Satterthwait AC, et al. Key molecular contacts promote recognition of the BAFF receptor by TNF receptorassociated factor 3: implications for intracellular signaling regulation. J Immunol 2004;173:7394–400. [23] Bossen C, Ingold K, Tardivel A, Bodmer JL, Gaide O, Hertig S, et al. Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. J Biol Chem 2006;281:13964–71. [24] Pelletier M, Thompson JS, Qian F, Bixler SA, Gong D, Cachero T, et al. Comparison of soluble decoy IgG fusion proteins of BAFF-R and BCMA as antagonists for BAFF. J Biol Chem 2003;278:33127–33. [25] Dall'Era M, Chakravarty E, Wallace D, Genovese M, Weisman M, Kavanaugh A, et al. Reduced B lymphocyte and immunoglobulin levels after atacicept treatment in patients with systemic lupus erythematosus: results of a multicenter, phase Ib, double-blind, placebo-controlled, dose-escalating trial. Arthritis Rheum 2007;12:4142–50. [26] Tak PP, Thurlings RM, Rossier C, Nestorov I, Dimic A, Mircetic V, et al. Atacicept in patients with rheumatoid arthritis: results of a multicenter, phase Ib, double-blind, placebo-controlled, dose-escalating, single- and repeated-dose study. Arthritis Rheum 2008;1:61–72. [27] Nanda S. Therapy: atacicept lacks clinical efficacy in RA. Nat Rev Rheumatol 2011;7:313. [28] Ginzler EM, Wax S, Rajeswaran A, Copt S, Hillson J, Ramos E, et al. Atacicept in combination with MMF and corticosteroids in lupus nephritis: results of a prematurely terminated trial. Arthritis Res Ther 2012;14:R33. [29] Hildebrand JM, Luo Z, Manske MK, Price-Troska T, Ziesmer SC, Lin W, et al. A BAFF-R mutation associated with non-Hodgkin lymphoma alters TRAF recruitment and reveals new insights into BAFF-R signaling. J Exp Med 2010;207:2569–79. [30] Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, et al. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science 2001;294:2348–51. [31] Zhou X, Xu S, Xu J, Chen B, Zhou K, Yang G. Phylogenomic analysis resolves the interordinal relationships and rapid diversification of the laurasiatherian mammals. Syst Biol 2012;61:150–64. [32] Nishihara H, Hasegawa M, Okada N. Pegasoferae, an unexpected mammalian clade revealed by tracking ancient retroposon insertions. Proc Natl Acad Sci U S A 2006;26:9929–34.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Molecular characterization and evolutionary analysis of horse BAFF-R, a tumor necrosis factor receptor related to B-cell survival Haitao Wu a,b, Shanshan Chen c, Meng Liu a, Xingzhou Xu a, Xuemei Ji a, Kai Gao a, Aiying Tian a, Zhen Ke a, Jianrong Zhang d, Bo Zhao c, Shuangquan Zhang a,⁎ a
Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, Life Science College, Nanjing Normal University, Nanjing 210046, PR China Basic Medical College, Nanjing University of Chinese Medicine, Nanjing 210046, PR China College of Chemistry and Materials Science, Nanjing Normal University, Nanjing 210046, PR China d Hongshan Forest Zoo, Nanjing 210028, PR China b c
a r t i c l e
i n f o
Article history: Received 1 June 2013 Received in revised form 9 November 2013 Accepted 18 November 2013 Available online 28 November 2013 Keywords: Horse (Equus caballus) B cell BAFF-R Ligand–receptor interaction Evolution
a b s t r a c t B-cell survival depends on signals induced by B-cell activating factor (BAFF) that binds to the BAFF receptor (BAFF-R). Herein, a BAFF-R homolog was identified in a horse (Equus caballus). The horse BAFF-R gene, located on chromosome 28, spans 1444 base pairs and encodes a 183-amino acid protein. The protein is structurally conserved, in which the DxL motif plays an important role in binding to BAFF. Furthermore, the horse BAFF-R extracellular domain was expressed and purified, which specifically bound to His6-sBAFF and had the capability of blocking the function of His6-sBAFF in vitro. Finally, evolutionary analyses indicated that some codon sites of BAFF-R evolve with positive selection and that the genetic relationship among a horse, Chiroptera, and Caniformia are the closest. © 2013 Elsevier B.V. All rights reserved.
1. Introduction B cell activating factor belonging to the TNF family (BAFF or BLyS; also known as THANK, TALL-1, and TNFSF13B) is a key B cell survival factor [1] and is associated with autoimmune diseases and B cell lymphomas [2]. BAFF is mainly produced by innate immune cells such as neutrophils, macrophages, monocytes, and dendritic cells. Furthermore, BAFF is produced by malignant B cells and acts as an essential autocrine survival factor for malignant B cells [3]. In BAFF-deficient mice, B cells are unable to progress past the transitional T2 stage that results in impaired humoral immune responses [4]. BAFF-transgenic mice develop a lupus-like autoimmune disease [5], in which self-reactive B cells are rescued from peripheral deletion because of overexpressed BAFF [6]. Therefore, BAFF is considered a therapeutic target for some autoimmune diseases, especially for systemic lupus erythematosus and rheumatoid arthritis. Recently, a human monoclonal antibody targeting soluble BAFF (belimumab) was approved for patients with systemic lupus erythematosus by the United States Food and Drug Administration and the European Medicines Agency [7]. Moreover, three additional BAFF antagonists (atacicept, blisibimod, and tabalumab) are currently involved in clinical trials [8].
⁎ Corresponding author. Tel.: +86 25 8589 1053. E-mail address: [email protected] (S. Zhang). 1567-5769/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.intimp.2013.11.019
BAFF binds to three receptors including the BAFF receptor (BAFF-R, BR3, or TNFRSF13C), transmembrane activator and CAML interactor (TACI or TNFRSF13B), and B-cell maturation antigen (BCMA or TNFRSF17). A proliferation-inducing ligand (APRIL or TNFSF13) shares both TACI and BCMA with BAFF. BAFF-R specifically binds to BAFF, which is the main receptor triggering BAFF-induced B-cell survival [9]. Stimulation of BAFF-R potently activates the alternative NF-κB2 pathway, which provides one of the bases for the effect of BAFF on B-cell survival [10]. In BAFF-R-deficient mice, the number of mature peripheral B cells is significantly reduced [11]. As for the expression of most B-cell subsets [12], BAFF-R is expressed by many low-grade B-cell neoplasms and some diffuse large B-cell lymphomas [13]. Interestingly, surface BAFF-R is downregulated in chronic lymphocytic leukemia [14] and upregulated in precursor B-lineage acute lymphoblastic leukemia [15]. Although the mechanism remains unclear, an understanding of BAFF-R dysregulation may offer novel diagnostic and therapeutic opportunities for these cancers. Horses (Equus caballus) have substantial value in sports and recreational fields and also can develop various immune-mediated diseases. For example, most horse lymphomas are of a B-cell origin [16]. In a horse, common variable immunodeficiency (CVID) is characterized by progressive B-cell lymphopenia [17]. Herein, identification and analysis of a novel horse TNF receptor related to B-cell survival is reported that may provide some information regarding the BAFF–BAFF-R system in a horse.
164
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
2. Materials and methods
2.3. Protein expression and purification
2.1. Molecular cloning of horse BAFF-R
The Fc fragment (hinge, CH2, and CH3) of the human immunoglobulin G1 (IgG1) was fused to the 3′-end of the horse BAFF-R extracellular sequence (1–219 bp), and then, the fused product was cloned into the pET28a vector (Novagen, USA). The approach utilized in this study is as follows. First, the horse BAFF-R extracellular sequence was produced by PCR with the primers, P1 and P2 (Table 1). The 5′-end of P2 was linked with the 15 bases that were located at the head of the human Fc sequence. Second, the Fc fragment was obtained by PCR with the primers, P3 and P4 (Table 1). Third, by using two PCR products as templates, the BAFF-R-Fc sequence was obtained with the primers, P1 and P4, with overlap extension PCR. Finally, the BAFF-R-Fc fragment was ligated to the Xba I–Hind III sites within pET28a. Escherichia coli BL21 (DE3) (Novagen, USA) was utilized to transform with a recombinant plasmid and was cultured in a Luria-Bertani medium with vigorous shaking (220 rpm) at 37 °C to a density of 0.6 (OD600). Then, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the final 0.5-mM concentration, and cells were grown at 20 °C with continuous shaking for another 20 h. The induced bacteria were centrifuged at 6000 g for 15 min, and the bacteria were resuspended in phosphate buffered saline (PBS; 1.47 mM KH2PO4, 10 mM Na2HPO4, 2.7 mM KCl, and 137 mM NaCl). After sonication and 10 000 g centrifugation at 4 °C for 15 min, the pH of the supernatant was adjusted to 8.0 with 2 M of Tris–HCl (pH 8). The supernatant was applied to the protein A resin (Genscript, China) that was previously equilibrated with PBS. The column was washed with PBS and eluted with an eluting buffer (0.1 M, citric acid–sodium citrate buffer; pH 3). The eluted fractions were collected in tubes containing neutralizing buffer (2 M, Tris–HCl; pH 8) in order to adjust the pH to 7. Finally, with an Amicon Ultra-15 3K centrifugal filter device (Millipore, USA), purified samples were concentrated and desalted with PBS. The expression and purification of recombinant protein BAFF-R-Fc was analyzed by using SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting with horseradish peroxidase (HRP)conjugated rabbit anti-human IgG (Boster, China).
For this study, cDNA for a human BAFF-R (GenBank accession no. AF373846) was used to search for the BAFF-R gene from the National Center for Biotechnology Information (NCBI) horse (E. caballus) genomic database (http://blast.ncbi.nlm.nih.gov/). The genomic DNA and total RNA were isolated from the blood of a Mongolian female horse (Hongshan Forest Zoo of Nanjing, Jiangsu, China) using a DNA isolation kit (Qiagen, Germany) and TRIzol (GIBCO/Bethesda Research Laboratory, USA), respectively. First strand cDNA was synthesized from 1 μg of RNA by using M-MLV Reverse Transcriptase (Promega, USA). Nested polymerase chain reaction (PCR) primers, R1, R2, R3, and R4, were used for the BAFF-R genomic DNA and cDNA amplification (Table 1). PCR products of an expected size were cloned with the pEASY-T1 Vector (TransGen Biotech, China) and sequenced with the ABI Prism automated sequencing method (YingJun, China). At least three independent sequencing experiments were conducted to rule out errors introduced by PCR. Finally, the horse BAFF-R genomic DNA, cDNA, and putative protein sequences were submitted to the NCBI GenBank.
2.2. Gene and protein analyses In order to determine the exact location of the exon–intron boundaries, an mRNA-to-genomic alignment program (www.ncbi.nlm.nih. gov/IEB/Research/Ostell/Spidey/index.html) was used. Multiple sequence alignment was performed with the ClustalW Multiple Alignment program (http://www.ebi.ac.uk/clustalw/). The protein was analyzed with the Expert Protein Analysis System (http://www. expasy.org/). The three-dimensional (3D) structure of the protein was determined by a homology modeling program by using ESyPred3D Web Server 1.0 (http://www.fundp.ac.be/sciences/biologie/urbm/bioinfo/ esypred/). Ligand–receptor docking was performed by using the ZDock and RDock modules of Discovery Studio 2.1 (Accelrys, USA). The top 20 poses in the ZDock result were chosen for the RDock calculation. From the RDock result, poses with both high ZRank and RRank (scores in ZDock and RDock) were selected as candidates for further analysis. Positive selection of the BAFF-R protein from the different species was detected by calculating the ratios for the non-synonymous to synonymous rate (ω = dN/dS) with the Adaptive Evolution Server (http://www.datamonkey.org/). A ratio of dN/dS that was greater than one was considered a positive selection. A phylogenetic analysis was performed by using the neighbor-joining method with the ClustalW and MEGA 4 packages (http://www.megasoftware.net/ mega4/mega.html).
Table 1 PCR primers used in this study. Primer
Direction
Nucleotide sequence (5′–3′)
R1 R2 R3 R4 P1
Forward Reverse Forward Reverse Forward
P2a P3a P4
Reverse Forward Reverse
GTCCCACTCCAGCAGGCAGAAGG GTGCGCGCCATCAGCAGC ATTATACATATGATGAGGCGACCGG GCGAAGCTTCTACTGTTGTTCAG CGCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC ATGAGGCGACCGGCGAGG GTCACAAGATTTGGGGGCCTCGGCCTC CCCAAATCTTGTGACAAAACTCAC GCGAAGCTTTNATTTACCNGGNGAC
a The 5′- end of primer P2 and P3 were complementary to each other, which is the former 15 bases of human IgG1 Fc sequence.
2.4. His6-sBAFF and BAFF-R-Fc binding assay Based on the cloning of horse BAFF cDNA (GenBank accession no. GU982934), the recombinant protein His6-soluble BAFF (soluble BAFF, also called sBAFF, is the soluble form of BAFF) was expressed by E. coli BL21 (DE3) and purified with Ni2+ affinity chromatography (data not shown). For the binding reaction, 10 μg of horse His6-sBAFF and 15 μg of BAFF-R-Fc were added to the binding buffer (PBS, 5 mM EGTA, 0.1% Triton X-100, and 0.5 mM PMSF), which was incubated on a rotating wheel at 4 °C overnight. After the addition of protein A/G PlusAgarose (Santa Cruz, USA), samples were incubated on a rotating wheel at 4 °C for another 2 h. Then, the samples were washed 5 times with a binding buffer, boiled in an SDS sample buffer, and analyzed by Western blotting with an HRP-conjugated rabbit anti-human IgG (Boster, China) for the detection of the Fc fragment, as well as a rabbit anti-His6 antibody (Boster, China) and an HRP-conjugated goat antirabbit IgG (Boster, China) for the detection of the His6 fragment. 2.5. Effect of BAFF-R-Fc on B-cell proliferation that was induced by His6-sBAFF and anti-IgM The B cell has been shown to proliferate in response to co-stimulation by BAFF and anti-IgM in vitro [18]. We used this assay to detect the inhibitory effect of BAFF-R-Fc on B-cell proliferation that was induced by His6-sBAFF and anti-IgM in vitro. Human peripheral blood B cells of N 95% purity were enriched with anti-CD19 magnetic beads (Milenyi Biotech, Germany), which were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal bovine serum and 100 U/ml of penicillin/streptomycin. For
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
165
BAFF-R-Fc (expressed and purified in our lab), were added to wells in sextuplicate. The blank group consisted of only human B cells, and the control group comprised cells treated with anti-IgM and His6-sBAFF. The cells were incubated at 37 °C in a humidified atmosphere with 5% CO2 for 48 h and then were measured with the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) method using a BioRad, model 550, microplate reader.
3. Results 3.1. Identification and analysis of the horse BAFF-R gene
Fig. 1. Horse BAFF-R cDNA and deduced amino acid sequence. The gray shading represents the intron location.
the blocking assay, B cells (2 × 105) that were suspended in a 0.1-ml RPMI-1640 medium were placed into individual wells of a 96-well plate, and 5 μg/ml of human His6-sBAFF (expressed and purified in our lab) and 2.5 μg/ml of goat anti-human IgM (Sigma-Aldrich, USA), as well as varying amounts of horse BAFF-R-Fc or human IgG or human
By searching the NCBI horse genomic database, chromosome 28, EquCab2.0, of a thoroughbred E. caballus, including a whole genome shotgun sequence (GenBank accession no. NC_009171), was identified that encompassed the entire horse BAFF-R gene. By further experimentation, 1444 bp of the horse BAFF-R gene and 552 bp of its cDNA were obtained. The horse BAFF-R gene was comprised of three exons and two introns (Fig. 1), of which all the exon–intron splice junction sequences conformed to the canonical GT–AG rule. The horse BAFF-R genomic and mRNA sequences were deposited in GenBank under the accession numbers of JF502271 and JF502272.
Fig. 2. Alignment of deduced amino acid sequences of a horse, human, cattle, mouse, and chicken BAFF-R by using ClustalW software. The asterisk (*) indicates that the aligned residues are identical. Substitutions said to be conservative and semi-conservative are marked by a colon (:) and period (.), respectively.
166
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
binding domain (Fig. 2), which had the highest level of homology among the BAFF-R proteins. In addition, the identity of the amino acid sequence of a BAFF-R between a horse and that of a cattle, human, mouse, or chicken was 68%, 72%, 55%, and 41%, respectively. 3.3. BAFF-R-Fc expression and purification The recombinant protein BAFF-R-Fc contained the first 73 amino acids of the BAFF-R extracellular domain of a horse and 231 amino acids of a human IgG1 Fc fragment (hinge, CH2, and CH3). The molecular weight of the BAFF-R-Fc was 33.39 kDa, with a calculated pI of 8.23. Because of the existence of an Fc fragment, the BAFF-R-Fc protein was successfully purified by affinity chromatography using a protein A resin (Fig. 3A), and the recombinant protein had the ability to form an S-S-linked dimer. Therefore, SDS-PAGE for the BAFF-R-Fc protein should result in a single-banded monomer-sized particle with a reducing condition (addition of 5% β-mercaptoethanol) and a dimer-sized band with a non-reducing condition (no β-mercaptoethanol). According to the SDS-PAGE and Western blotting results, a single band appeared in the position that had a molecular weight of b35 kDa with the reducing condition (Fig. 3B). With the non-reducing condition, besides the monomer band, BAFF-R-Fc also appeared in the 66-kDa position that corresponded to the molecular weight of the BAFF-R-Fc dimer (Fig. 3B). Therefore, the above-mentioned results indicated that the BAFF-R-Fc protein had been successfully expressed and purified. 3.4. Ligand–receptor binding
Fig. 3. Identification and purification of the recombinant protein BAFF-R-Fc. (A) The UV spectrum for affinity chromatography using protein A resin. (B) The SDS-PAGE and Western blotting analysis for the recombinant protein. Lane 1 and Lane 2 indicate the SDS-PAGE results, showing cell lysates of recombinant bacteria without induction and with a 0.5-mM IPTG induction. Lane 3 and Lane 4 indicate the SDS-PAGE results of purified BAFF-R-Fc with a reducing condition and non-reducing condition. Lane 5 indicates the Western blotting result of BAFF-R-Fc with a reducing condition.
3.2. Amino acid sequence analysis of horse BAFF-R The horse BAFF-R encoded a 183-amino acid protein, with a calculated molecular weight (MW) of 19 kDa and an isoelectric point (pI) of 6.12. It is a type III transmembrane protein, with an 81-amino acid cytoplasmic domain, a 23-amino acid hydrophobic transmembrane region, and a 79-amino acid extracellular domain (Fig. 2). By analyzing the primary structure of the horse BAFF-R, its extracellular domain had one cysteine-rich domain (CRD) containing four cysteine residues (Cys19, Cys24, Cys32, and Cys35). The DxL motif (Phe/Tyr/Trp-Asp-XLeu-Val/Thr-Arg/Gly) was located in the CRD. The cytoplasmic domain of the horse BAFF-R had one TNF receptor-associated factor 3 (TRAF3)
According to the immunoprecipitation result, it was shown that the His6-sBAFF bound to the BAFF-R-Fc, did not interact with the human IgG (Fig. 4). Using the Discovery Studio software, a docking study between the horse sBAFF and the BAFF-R extracellular domain was performed. The CRD of the horse BAFF-R spanned from Cys19 to Cys35 and formed a short β-hairpin structure. The DxL motif was located on the tip of the β-hairpin structure (Fig. 5A). According to the best docking pose from the Discovery Studio results (Fig. 5B), the BAFF-R extracellular domain of a horse had its DxL motif binding to a hydrophobic shallow pocket located in the sBAFF, which consisted of the following residues: Ile100, Pro131, Leu78, Ala74, and Gly76. In addition, the side chains of Arg132 and Phe73 for a horse sBAFF may participate in extensive hydrogen bonding with the DxL motif of BAFF-R. 3.5. The blocking of B-cell proliferation with BAFF-R-Fc in vitro It is well known that BAFF is a key B-cell survival factor. In our experiment, the co-stimulation of His6-sBAFF and anti-IgM maintained the survival and proliferation of B cells in vitro. With the addition of horse BAFF-R-Fc, the function of human His6-sBAFF was suppressed (Fig. 6), indicating that horse BAFF-R-Fc was capable of binding to human His6-sBAFF. In addition, the blocking effect of horse BAFF-R-Fc was slightly less than that of human BAFF-R-Fc, an indication that the interaction sites between BAFF-R and BAFF have been evolutionarily conserved. 3.6. BAFF-R evolutionary analysis
Fig. 4. The binding of His6-sBAFF and BAFF-R-Fc in vitro. The immunoprecipitation result confirmed that His6-sBAFF bound to BAFF-R-Fc but not to human IgG. Input, His6-sBAFF, or BAFF-R-Fc as a control for the immunoprecipitation result.
Many genes that are involved in immunity evolve rapidly [19]. An excess of non-synonymous substitutions can be interpreted as adaptive evolution or positive selection, which promotes the emergence of new phenotypes. The positive selection of a BAFF-R protein from different species was detected by the Adaptive Evolution Server. Using significance thresholds for a P value of b0.1, SLAC (single likelihood ancestor counting) and FEL (fixed effects likelihood) identified one and four positively selected codons, respectively. Using significance thresholds for a P value of b0.05, only FEL identified three positively selected codons (Table 2).
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
167
Fig. 5. The 3D structures of a horse BAFF-R CRD and BAFF–BAFF-R complex. (A) The homology-modeled horse BAFF-R CRD forms a short β-hairpin structure, containing two disulfide bonds. The DxL motif is located on the CRD tip. (B) The docking pose of the horse sBAFF (golden-yellow) with the BAFF-R CRD (green), in which some key residues are highlighted (blue).
The phylogenetic position of Perissodactyla has been a controversial issue. According to the phylogenetic analysis of the BAFF-R amino acid sequences from different species, the genetic relationship among a horse (Perissodactyla), Chiroptera, and Caniformia was the closest (Fig. 7).
4. Discussion BAFF receptors are different from that of most TNF receptors. For example, BAFF-R, TACI, and BCMA lack a signal peptide and death domain. The absence of a death domain suggests that their functions are irrelevant to apoptosis. In addition, most TNF receptors are typically organized into multiple CRDs, with each comprised of six cysteine residues and three disulfide bonds [20]. However, the CRD of BAFF-R contains only four cysteine residues and two disulfide bonds, making it the smallest CRD in the TNF receptor family. In this study, a BAFF-R homolog was identified in a horse by in silico cloning and molecular cloning. Similar to other BAFF-Rs, the extracellular and cytoplasmic domain of the BAFF-R from a horse contains one CRD and TRAF3 binding domain, which are more conservative than that of the other BAFF-R regions. The DxL motif located in the CRD plays an important role in BAFF– BAFF-R interaction [21], and the TRAF3 binding domain is associated with the NF-κB signaling pathway [22]. Generally, BAFF-R specifically binds to BAFF. It is reported that a shorter variant of APRIL exhibits weak but detectable binding to the
BAFF-R of a mouse [23]. However, a shorter APRIL variant cannot be produced in humans and is not detected in the expressed sequence tag of dogs, pigs, cows, or horses. In this study, the horse BAFF-R extracellular domain that was fused to the Fc fragment was expressed and purified, which specifically bound to His6-sBAFF. In the BAFF–BAFF-R complex, the BAFF-R extracellular domain has a DxL motif that binds to a hydrophobic shallow pocket located in sBAFF. Because the surface for the interaction is relatively small, the BAFF–BAFF-R interaction could be used as a therapeutic target for BAFF-mediated diseases. Our results also demonstrated that the recombinant protein BAFF-RFc had the capability of blocking the function of His6-sBAFF in vitro. The Fc fusion decoy receptors, BCMA-Fc, BAFF-R-Fc, and TACI-Fc, are therapeutic candidates for blocking BAFF in some human autoimmune diseases. Although BAFF-R-Fc is more effective than that of BCMA-Fc for blocking BAFF [24], progress has been made in preclinical and phase I studies regarding TACI-Fc [25,26]. However, whether TACI-Fc ultimately achieves clinical success from the standpoint of efficacy and safety remains an open question [27,28]. It has been reported that a BAFF-R mutation in codon 159 (His159Tyr) results in increased NF-κB1 and NF-κB2 activity and increased immunoglobulin production in non-Hodgkin's lymphoma [29]. However, it remains unclear as to what extent the BAFF-R from different species is subject to positive selection. Among the positively selected codon identified by Datamonkey, codons 159, 34, and 87 are located in the TRAF3 binding domain, ligand binding site, and transmembrane region of BAFF-R, respectively, suggesting that selection at these sites may affect signal transduction, ligand binding, membrane channel permeability, and membrane location of BAFF-R. The phylogenetic position of Perissodactyla has been a controversial issue. Many molecular studies have shown that the genetic relationship between Perissodactyla and Cetartiodactyla is the closest [30,31]. However, another report showed that Perissodactyla, Chiroptera, and
Table 2 The positively selected sites of BAFF-R examined with Datamonkey. Analysis model
Fig. 6. The binding of BAFF-R-Fc to His6-sBAFF was capable of blocking the function of His 6 -sBAFF in vitro. The inhibition rate was determined as follows: (control − experiment) / (control − blank), in which the blank group was the MTT OD value for the B cells only, while the control group was that of the cells treated with anti-IgM and His6-sBAFF; the experimental group was that of the cells treated with anti-IgM, His6-sBAFF, and BAFF-R-Fc. Error bars indicated S.D.
SLAC FEL
Codon site P = 0.01
P = 0.05
P = 0.1
None None
None 34,151,159
151 34,87,151,159
The following species are involved in the analysis of positive selection of BAFF-R: horse, cattle, human, mouse, chicken, African elephant, dog, chimpanzee, Chinese hamster, northern white-cheeked gibbon, white-tufted-ear marmoset, domestic guinea pig, rhesus monkey, Norway rat, giant panda, rabbit, tree shrew, megabat.
168
H. Wu et al. / International Immunopharmacology 18 (2014) 163–168
Fig. 7. A phylogenetic analysis of the BAFF-R amino acid sequences from different species. The tree was constructed with the neighbor-joining method by using the ClustalW and MEGA 4 packages that was bootstrapped 1000 times. The accession numbers of the BAFF-R mRNA in NCBI GenBank are: horse, JF502272; cattle, NM_001193192; human, AF373846; mouse, NM_028075; chicken, NM_001037828; predicted African elephant, XM_003419809; predicted dog, XM_843968; predicted chimpanzee, XM_001154286; predicted Chinese hamster, XM_003512340; predicted northern white-cheeked gibbon, XM_003264627; predicted white-tufted-ear marmoset, XM_002763903; predicted domestic guinea pig, XM_003470524; predicted rhesus monkey, XM_001101623; predicted Norway rat, XM_576316; predicted giant panda, XM_002926684; predicted rabbit, XM_002721383. The predicted BAFF-R sequences of zebra finch, tree shrew, megabat and hyrax have been obtained from Ensembl Genome Browser (http://asia.ensembl.org/ index.html).
Carnivora evolved from one clade of mammals [32]. As our result has demonstrated, the genetic relationship among a horse (Perissodactyla), Chiroptera, and Caniformia is the closest, which is similar to that of the latter phylogenetic position of Perissodactyla. In conclusion, we successfully cloned a full-length genomic DNA and cDNA of horse BAFF-R, illustrated its sequence and structure characterization, as well as analyzed the adaptive evolution and phylogeny of BAFF-R from different species. Moreover, we demonstrated that the recombinant protein BAFF-R-Fc specifically bound to His6-sBAFF with the capability of blocking the function of His6-sBAFF in vitro. These results provide a basis for the investigation of the role of the BAFF–BAFF-R system in regulating B-cell survival, as well as B-cell related immune diseases, in horses. Acknowledgements This work was funded by the grant from The National Science Foundation of China (No. 30971486) and The Priority Academic Program Development of Jiangsu Higher Education Institutions (No. 164320H106). The authors declare that they have no conflict of interest. References [1] Mackay F, Browning JL. BAFF: a fundamental survival factor for B cells. Nat Rev Immunol 2002;2:465–75. [2] Tangye SG, Bryant VL, Cuss AK, Good KL. BAFF, APRIL and human B cell disorders. Semin Immunol 2006;18:305–17.
[3] Kern C, Cornuel JF, Billard C, Tang R, Rouillard D, Stenou V, et al. Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL through an autocrine pathway. Blood 2004;103:679–88. [4] Schiemann B, Gommerman JL, Vora K, Cachero TG, Shulga-Morskaya S, Dobles M, et al. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 2001;293:2111–4. [5] Khare SD, Sarosi I, Xia XZ, McCabe S, Miner K, Solovyev I, et al. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice. Proc Natl Acad Sci 2000;97:3370–5. [6] Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. Predominant autoantibody production by early human B cell precursors. Science 2003;301:1374–7. [7] Chiche L, Jourde N, Thomas G, Bardin N, Bornet C, Darque A, et al. New treatment options for lupus — a focus on belimumab. Ther Clin Risk Manag 2012;8:33–43. [8] Stohl W. Biologic differences between various inhibitors of the BLyS/BAFF pathway: should we expect differences between belimumab and other inhibitors in development? Curr Rheumatol Rep 2012;14:303–9. [9] Bossen C, Schneider P. BAFF, APRIL and their receptors: structure, function and signaling. Semin Immunol 2006;18:263–75. [10] Vallabhapurapu S, Matsuzawa A, Zhang W, Tseng PH, Keats JJ, Wang H, et al. Nonredundant and complementary functions of TRAF2 and TRAF3 in a ubiquitination cascade that activates NIK-dependent alternative NF-kappaB signaling. Nat Immunol 2008;9:1364–70. [11] Thompson JS, Bixler SA, Qian F, Vora K, Scott ML, Cachero TG, et al. BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science 2001;5537:2108–11. [12] Mackay F, Schneider P. Cracking the BAFF code. Nat Rev Immunol 2009;9:491–502. [13] Nakamura N, Hase H, Sakurai D, Yoshida S, Abe M, Tsukada N, et al. Expression of BAFF-R (BR3) in normal and neoplastic lymphoid tissues characterized with a newly developed monoclonal antibody. Virchows Arch 2005;447:53–60. [14] Mihalcik SA, Tschumper RC, Jelinek DF. Transcriptional and post-transcriptional mechanisms of BAFF-receptor dysregulation in human B lineage malignancies. Cell Cycle 2010;9:4884–92. [15] Parameswaran R, Müschen M, Kim YM, Groffen J, Heisterkamp N. A functional receptor for B-cell-activating factor is expressed on human acute lymphoblastic leukemias. Cancer Res 2010;70:4346–56. [16] Kelley LC, Mahaffey EA. Equine malignant lymphomas: morphologic and immunohistochemical classification. Vet Pathol 1998;35:241–52. [17] Flaminio MJ, Tallmadge RL, Salles-Gomes CO, Matychak MB. Common variable immunodeficiency in horses is characterized by B cell depletion in primary and secondary lymphoid tissues. J Clin Immunol 2009;29:107–16. [18] Schneider P, MacKay F, Steiner V, Hofmann K, Bodmer JL, Holler N, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J Exp Med 1999;11:1747–56. [19] Wlasiuk G, Khan S, Switzer WM, Nachman MW. A history of recurrent positive selection at the Toll-like receptor 5 in primates. Mol Biol Evol 2009;26:937–49. [20] Smith CA, Farrah T, Goodwin RG. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell 1994;76:59–962. [21] Kim HM, Yu KS, Lee ME, Shin DR, Kim YS, Paik SG, et al. Crystal structure of the BAFF–BAFF-R complex and its implications for receptor activation. Nat Struct Biol 2003;10:342–8. [22] Ni CZ, Oganesyan G, Welsh K, Zhu X, Reed JC, Satterthwait AC, et al. Key molecular contacts promote recognition of the BAFF receptor by TNF receptorassociated factor 3: implications for intracellular signaling regulation. J Immunol 2004;173:7394–400. [23] Bossen C, Ingold K, Tardivel A, Bodmer JL, Gaide O, Hertig S, et al. Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. J Biol Chem 2006;281:13964–71. [24] Pelletier M, Thompson JS, Qian F, Bixler SA, Gong D, Cachero T, et al. Comparison of soluble decoy IgG fusion proteins of BAFF-R and BCMA as antagonists for BAFF. J Biol Chem 2003;278:33127–33. [25] Dall'Era M, Chakravarty E, Wallace D, Genovese M, Weisman M, Kavanaugh A, et al. Reduced B lymphocyte and immunoglobulin levels after atacicept treatment in patients with systemic lupus erythematosus: results of a multicenter, phase Ib, double-blind, placebo-controlled, dose-escalating trial. Arthritis Rheum 2007;12:4142–50. [26] Tak PP, Thurlings RM, Rossier C, Nestorov I, Dimic A, Mircetic V, et al. Atacicept in patients with rheumatoid arthritis: results of a multicenter, phase Ib, double-blind, placebo-controlled, dose-escalating, single- and repeated-dose study. Arthritis Rheum 2008;1:61–72. [27] Nanda S. Therapy: atacicept lacks clinical efficacy in RA. Nat Rev Rheumatol 2011;7:313. [28] Ginzler EM, Wax S, Rajeswaran A, Copt S, Hillson J, Ramos E, et al. Atacicept in combination with MMF and corticosteroids in lupus nephritis: results of a prematurely terminated trial. Arthritis Res Ther 2012;14:R33. [29] Hildebrand JM, Luo Z, Manske MK, Price-Troska T, Ziesmer SC, Lin W, et al. A BAFF-R mutation associated with non-Hodgkin lymphoma alters TRAF recruitment and reveals new insights into BAFF-R signaling. J Exp Med 2010;207:2569–79. [30] Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, et al. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science 2001;294:2348–51. [31] Zhou X, Xu S, Xu J, Chen B, Zhou K, Yang G. Phylogenomic analysis resolves the interordinal relationships and rapid diversification of the laurasiatherian mammals. Syst Biol 2012;61:150–64. [32] Nishihara H, Hasegawa M, Okada N. Pegasoferae, an unexpected mammalian clade revealed by tracking ancient retroposon insertions. Proc Natl Acad Sci U S A 2006;26:9929–34.