- Email: [email protected]
Molecular characterization and expression analysis of nine CC chemokines in half-smooth tongue sole, Cynoglossus semilaevis
Fish & Shellfish Immunology 47 (2015) 717e724
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Molecular characterization and expression analysis of nine CC chemokines in half-smooth tongue sole, Cynoglossus semilaevis Lian-xu Hao a, b, c, Mo-fei Li a, b, c, * a
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, China c University of Chinese Academy of Sciences, Beijing, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 August 2015 Received in revised form 1 October 2015 Accepted 2 October 2015 Available online 22 October 2015
Chemokines are a large, diverse group of small cytokines that can be classified into several families, including the CC chemokine family, which plays a pivotal role in host defense by inducing leukocyte chemotaxis under physiological and inflammatory conditions. Here we studied 9 CC chemokines from half-smooth tongue sole (Cynoglossus semilaevis). Phylogenetic analysis divided these chemokines into four groups. The tissue specific expression patterns of the 9 chemokines under normal physiological conditions varied much, with most chemokines highly expressed in immune organs, while some other chemokines showing high expression levels in non-immune organs. In addition, the 9 chemokines exhibited similar or distinctly different expression profiles in response to the challenge of virus and intracellular and extracellular bacterial pathogens. These results indicate that in tongue sole, CC chemokines may be involved in different immune responses as homeostatic or inflammatory chemokines. © 2015 Elsevier Ltd. All rights reserved.
Keywords: CC chemokine Cynoglossus semilaevis Antiviral Antibacterial Immune defense
1. Introduction Chemokines or chemoattractant cytokines are known as a group of 8e14 kDa molecules that regulate cell migrations under various conditions. They also play roles in normal and pathological processes including allergic responses, infectious and autoimmune disease, angiogenesis, inflammation, and tumor growth and metastasis [1]. Functionally, chemokines are divided into two main categories. Some chemokines are produced and secreted constitutively. These chemokines play roles in immune surveillance and function as homeostatic cytokines [2]. Other chemokines are only produced by cells during infection or following a pro-inflammatory stimulus; these chemokines prompt the migration of leukocytes to an injured or infected site [3]. Such inflammatory chemokines can also activate cells to raise an immune response and commence the wound healing process [4]. Chemokines are structurally related, with most containing four invariant cysteine residues involved in two disulphide bonds [5]. The CC (beta) chemokines comprise a subfamily of the chemokine superfamily and are defined by the arrangement of the first two of four invariant cysteine residues
* Corresponding author. Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China. E-mail address: [email protected] (M.-f. Li). http://dx.doi.org/10.1016/j.fsi.2015.10.003 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
found in all chemokines [6]. In CC chemokines, these two cysteines are adjacent, while in the CXC subfamily of chemokines, they are separated by a single amino acid [7]. Chemokines exhibit promiscuous binding to multiple seven-transmembrane, G-protein coupled CC chemokine receptors [8]. In mammals, the broadest functional classification system divides CC chemokines into inflammatory and homeostatic groups [9,10] based on their expression patterns. This division is widely acknowledged too simplistic. Due to the rapid divergence and independent duplication events within each species, the identification of orthologs became more complicated. In teleost, Peatman and Liu have established CC chemokine classification [11]. Seven large groups of fish CC chemokines have been identified through phylogenetic analysis: the CCL19/21/25 group, the CCL20 group, the CCL27/28 group, the CCL17/22 group, the macrophage inflammatory protein (MIP) group, the monocyte chemotactic protein (MCP) group and a fish-specific group [11]. In teleost, researchers have identified more than double of the chemokines of mammals in zebrafish through analyzing expressed sequence tags (ESTs) and genome sequence [12e14]. This phenomenon may be due to their multiple roles in innate immunity which may be a mechanism to react to various pathogens. These chemokines may work together as a complicated network and coordinate immune responses to specific species [11].
718
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
Table 1 The GenBank accession numbers of CCL family members used for construction of the phylogenetic tree and multiple sequence alignment in this study. CCL Cynoglossus semilaevis CCL3a CCL3b CCL20a CCL20b CCL20c CCL20d CCL21 CCL27a CCL27b Homo sapiens CCL2 CCL3 CCL4 CCL5 CCL7 CCL8 CCL13 CCL14 CCL15 CCL17 CCL19 CCL20 CCL21 CCL22 CCL23 CCL24 CCL25 Mus musculus CCL2 CCL4 CCL5 CCL12 CCL19 CCL24 CCL25 CCL27 CCL28 Esox lucius CCL4 CCL8 CCL20 CCL21
Accession no. XP_008309875 XP_008311022 XP_008332070 XP_008306526 XP_008332071 XP_008331981 XP_008332797 XP_008308458 XP_008334193 P13500 P10147 P13236 P13501 P80098 P80075 Q99616 Q16627 Q16663 Q92583 Q99731 P78556 O00585 O00626 P55773 O00175 O15444 NP_035463 P14097 P30882 Q62401 O70460 Q9JKC0 O35903 Q9Z1X0 Q9JIL2 ACO14065 NP_001290574 ACO13905 NP_001290632
However, more researches are needed to understand the function of chemokines in fish. Recent studies with cultured fish species have focused on the immunological roles of chemokines in the defense against pathogens [15]. To date, identification and functional analyses of CC chemokines have been carried out with rainbow trout [16e21], carp [22], catfish [23e25], Japanese flounder [26e29], turbot [30], and half-smooth tongue sole [31e33]. The identification of CC chemokines in teleost was often through analyzing EST database and bioinformatics method, as genome sequences of many cultured fish were released. For example, 32 distinct CC chemokines were identified by analysis of EST database in Atlantic cod (Gadus morhua) [34]. In rainbow trout, several chemokines were identified, which were regulated in expression by viral hemorrhagic septicemia virus and infectious pancreatic necrosis virus [16e18,21]. Recently, the genome sequence of tongue sole has been completed [35], which revealed the existence of 11 putative CC chemokine genes. The aim of this study was to examine, in a comparative and systematic manner, the expression profiles of tongue sole CC chemokines. For this purpose, we selected nine of these putative CCLs that could be successfully amplified by PCR and had not been studied previously. To promote the use of standard nomenclature, we re-named these CCLs based on our phylogenetic
CCL Danio rerio CCL2 CCL3 CCL4 CCL5 CCL13 CCL19 CCL20 CCL21 Rattus norvegicus CCL2 CCL3 CCL4 CCL5 CCL6 CCL7 CCL20 Salmo salar CCL4 CCL8 CCL19 CCL21 CCL25 CCL28 Pundamilia nyererei CCL3 Xiphophorus maculatus CCL3 Oreochromis niloticus CCL3 Stegastes partitus CCL3 Poecilia reticulata CCL3 Anoplopoma fimbria CCL20 Takifugu rubripes CCL13 CCL20 Larimichthys crocea CCL19
Accession no. XP_005162867 XP_003199028 XP_005171406 XP_002666850 XP_001338140 XP_005155699 XP_002666702 XP_002661011 P14844 P50229 P50230 P50231 Q68FP3 Q9QXY8 P97884 ACI67979 ACI68150 ADM15970 NP_001134739 ACI69025 NP_001134950 XP_005754438 XP_005817321 XP_005449343 XP_008296008 XP_008394660 ACQ57955 NP_001266983 NP_001233222 NP_001290247
analysis. The nine CCLs analyzed in this study were named CCL3a, CCL3b, CCL20a, CCL20b, CCL20c, CCL20d, CCL21, CCL27a and CCL27b, which were originally named CCL3, CCL4, CCL26, CCL20, CCL20, CCL20, CCL20, CCL13, and CCL20, respectively [35]. The Table 2 Primers used in this study. Primers
Sequences (50 e30 )
CCL20a-RT-F CCL20a-RT-R CCL20b-RT-F CCL20b-RT-R CCL20c-RT-F CCL20c-RT-R CCL20d-RT-F CCL20d-RT-R CCL27b-RT-F CCL27b-RT-R CCL3a-RT-F CCL3a-RT-R CCL3b-RT-F CCL3b-RT-R CCL27a-RT-F CCL27a-RT-R CCL21-RT-F CCL21-RT-R
GTGCTGCACACAGTACAATGA TGCACCCACTTTGAGTTAGG CCATCGTTTTCCGGTGGAGA TTCCTGGACGTGCCGTTATG TGTGTCCCATCAATGCCATCA TGTTTGACTGGGCTTCAGTGT GACGAGTGGGTGAGAAACACT CAGTGTCTGTGGTGCTGAAGA CAGACTGCAGCATACAAGCC AGCCACATGGTTCGGTGAG GGAGAACGTGGTCAGCTACA CCCAGGTGGCTGAAGGTCTA CTTGCCTGTGAAGAGGGTGAT TGGATCGGCACAGATTTTCCT TCCATTTGCTGCTTCACACG AGTCATTCTGGCGTGCAACA CTGGCCCAAGTGTCCTACG GAATGTTACAGCCTCCGTCCA
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
719
and spleen as described previously [36]. No bacteria or virus were detected from the examined fish. Fish were euthanized with an overdose of tricaine methanesulfonate (Sigma, St. Louis, MO, USA) before tissue collection as reported previously [37]. 2.2. Sequence analysis The CCLs sequences were obtained from GenBank, and the accession numbers of CCL3a, CCL3b, CCL20a, CCL20b, CCL20c, CCL20d, CCL21, CCL27a and CCL27b are listed in Table 1. Domain search was performed with the simple modular architecture research tool (SMART) version 4.0 and the conserved domain search program of NCBI (http://www.ncbi.nlm.nih.gov/Structure/ cdd/wrpsb.cgi). Multiple sequence alignment was carried out with ClustalX program. Sequence similarities were calculated using the Megalign program of DNAStar software package (DNASTAR Inc. Madison, WI, USA). Phylogenetic analysis was performed with ClustalX and the Neighbor-joining algorithm of MEGA 4.0. 2.3. CCLs expression in fish tissues under normal physiological conditions Blood, brain, gill, heart, intestine, head kidney (HK), liver, muscle, and spleen were taken aseptically from five tongue soles (average 15.3 g) and used for total RNA extraction and cDNA synthesis as reported previously [38]. Real-time quantitative polymerase chain reaction (qRT-PCR) was carried out in an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) using the SYBR Premix Ex Taq (Takara, Dalian, China) as described previously [39]. The expression level of CCLs was analyzed using comparative threshold cycle method (2DDCT) with b-actin (ACTB) as an internal control as reported previously [40]. The PCR primers for CCLs are listed in Table 2. Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The experiment was performed three times. 2.4. CCLs expression upon bacterial and viral infection
Fig. 1. Phylogenetic analysis of the nine CC chemokines. A neighbor-joining phylogenetic tree was constructed based on the protein sequences of the CCL subgroup of chemokines from teleosts and mammals. The scale bar is 0.1.
GenBank accession numbers of these nine CCLs are listed in Table 1. 2. Materials and methods 2.1. Fish Half-smooth tongue sole were purchased from a commercial fish farm in Shandong Province, China and maintained at 20 C in aerated seawater and changed daily. Fish were acclimatized in the laboratory for two weeks before experimental manipulation. Before experiment, fish were randomly sampled for the examination of bacterial recovery or megalocytivirus DNA from blood, liver, kidney,
Bacterial and viral infection was performed as reported previously [41]. For bacterial infection, Edwardsiella tarda [42] and Vibrio harveyi [43] were cultured in LB medium at 28 C to an OD600 of 0.8, and the cells were washed with PBS and resuspended in PBS to 2 106 CFU (colony forming unit)/ml and 2 107 CFU/ml, respectively. Tongue soles were divided randomly into three groups (20/group) and injected intraperitoneally (i.p.) with 50 ml E. tarda, V. harveyi, or PBS per fish. Fish were euthanized at 6 h, 12 h, 24 h, and 48 h post-infection, and spleen, HK, and liver were collected under aseptic condition. Total RNA extraction, cDNA synthesis, and qRT-PCR were performed as described above with 60S ribosomal protein L18a (for spleen), ACTB (for HK), and 18s rRNA (for liver) as the internal controls [44]. For viral infection, tongue soles were divided randomly into two groups (20/group) and injected i.p. with 2 106 copies of the megalocytivirus RBIV-C1 [41] in 50 ml PBS; the control fish were injected with 50 ml PBS. Fish (five at each time point) were euthanized at 1 d, 3 d, 5 d, and 7 d post-infection. Spleen, HK and liver were collected and used for qRT-PCR as described above with ACTB as the internal control [44]. The experiment was performed three times. 2.5. Statistical analysis Statistical analyses were carried out with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Data were analyzed with analysis of variance (ANOVA), and statistical significance was defined as
720
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
Fig. 2. Tissue specific expression of CC chemokines under normal physiological conditions. Expressions of the nine chemokines in the brain, gill, liver, blood, heart, spleen, head kidney, intestine, and muscle were determined by quantitative real time RT-PCR. For each chemokine, the expression in the tissue with the lowest mRNA level was set as 1. Vertical bars represent means ± SE (N ¼ 3).
P < 0.05. 3. Results
group. All CCLs have a putative receptor binding site and two glycosaminoglycan (GAG) binding sites. In addition, CCL3a and CCL3b also have a tetramer interface, two dimer interfaces (I form and P form), and a putative receptor binding cleft (Fig. S2).
3.1. Phylogenetic analysis of the nine CCLs A phylogenetic tree was constructed using the neighborjoining method to explore the phylogenetic relationships of the 9 CCLs in vertebrates. The nine CCLs were divided into four groups: CCL20a, CCL20b, CCL20c and CCL20d belong to the CCL20 group, CCL3a and CCL3b belong to the MIP group, CCL27a and CCL27b belong to the CCL27/28 group, and CCL21 belongs to the CCL21/25 group (Fig. 1). 3.2. Sequence characterization of the nine CCLs The proteins of CCL3a, CCL3b, CCL20a, CCL20b, CCL20c, CCL20d, CCL21, CCL27a, and CCL27b consist of 76, 78, 77, 81, 83, 101, 90, 90, and 105 amino acid residues, respectively. Except for CCL20b, all other eight CCL sequences possess four conserved cysteines important for tertiary structure and function (Fig. S1). CCL20b has six conserved cysteine residuals and belongs to the C6b-chemokine
3.3. Expression profiles of the CCLs under normal physiological conditions qRT-PCR analysis was conducted to examine the expression of the 9 CCLs under normal physiological conditions in nine tissues (blood, brain, gill, heart, spleen, muscle, HK, intestine, and liver). The results showed that expression of each of the CCLs was detected in all examined tissues, but the expression patterns differed. For CCL3a, high levels of expression were observed in heart, spleen, liver, gill, HK, and brain (Fig. 2A). The expression pattern of CCL3b was quite different from that of CCL3a, with highest expression detected in gill (Fig. 2B). High levels expressions of CCL20a were detected in heart, gill, and brain (Fig. 2C). CCL20b had high levels of expression in the three main immune organs (HK, liver and spleen), with highest expression in HK (Fig. 2D). CCL20c and CCL20d exhibited similar expression profiles, with high levels of expression occurring in gill and intestine, an important mucosal
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
721
Fig. 3. CCL3a (AeC), CCL3b (DeF) expression in spleen, head kidney, and liver upon Vibrio harveyi, Edwardsiella tarda, megalocytivirus infection or PBS (control), and CCL3a (AeC), CCL3b (DeF) expressions were determined by quantitative real time RT-PCR at various time points. At each time point, the expression level of the control fish was set as 1, which was represented by the dotted horizontal line. Values are shown as means ± SE (N ¼ 3). **P < 0.01, *P < 0.05.
organ (Fig. 2E and F), and low levels of expression detected in spleen (Fig. 2E and F). CCL21 had high levels of expression in intestine and gill and low levels of expression in other tissues (Fig. 2G). CCL27a showed the highest level of expression in HK (Fig. 2H), while CCL27b showed the highest level of expression in brain (Fig. 2I). 3.4. Expression profiles of the CCLs upon experimental infection with extracellular bacterial pathogen, intracellular bacterial pathogen, and virus To examine the expression patterns of the CCLs upon microbial infection, tongue soles were challenged experimentally with the extracellular bacterial pathogen V. harveyi, the intracellular bacterial pathogen E. tarda, or the viral pathogen megalocytivirus. At 6, 12, 24, and 48 h post-bacterial infection (hpi) or 1, 3, 5, and 7 d postviral infection (dpi), the expressions of the CCLs in the spleen, HK, and liver of the infected fish were determined by qRT-PCR. The results showed that CCL3a and CCL3b had the same expression patterns after bacterial infection. In liver and spleen, the expressions of CCL3a and CCL3b were unaffected after V. harveyi infection (Fig. 3A and D). In HK, CCL3a and CCL3b expressions were significantly stimulated, with the highest expression levels (15.2- and 30.2-fold respectively) occurring at 6 h after V. harveyi infection (Fig. 3A and D). High levels of CCL3a and CCL3b expression (10.1and 8.3-fold) were detected at 6 h after E. tarda infection in HK (Fig. 3B and E). After megalocytivirus infection, the expression level of CCL3b had a significant increase (3.2-fold) at 7 dpi in HK (Fig. 3F). CCL20a showed similar expression patterns after V. harveyi and E. tarda infection, with highest mRNA levels occurring in liver (Fig. 4A and B). Compared to the expressions of other CCL20s, the expression of CCL20a showed a significant and rapid increase in all three examined tissues at 6 hpi and then fell steadily to the normal level in liver and HK (Fig. 4A and B). After megalocytivirus infection, the expression levels of CCL20a were dramatically increased in liver and HK, but not in spleen, at 7 dpi (Fig. 4C). CCL20b exhibited a moderate response to the three pathogens. However, CCL20b expression patterns were markedly different in
response to V. harveyi and E. tarda (Fig. 4D and E). CCL20b expression was significantly downregulated in liver and spleen after V. harveyi infection but was not affected by E. tarda and megalocytivirus infection (Fig. 4D, E and F). The expression patterns of CCL20c were similar to that of CCL20a (Fig. 4G, H, and I). After V. harveyi infection, high levels of CCL20d expression were detected at 48 h in liver and spleen (8.3- and 12.8-fold respectively) (Fig. 4J). After E. tarda infection, CCL20d expression increased significantly, with maximum inductions of 40.6-fold, 4.8-fold, and 17.5-fold occurring in liver, spleen, and HK, respectively (Fig. 4K). Infection with megalocytivirus caused high levels of induction of CCL20d expression at 7 dpi in liver, spleen and HK (9.3-, 3.3- and 5.3-fold respectively) (Fig. 4L). After V. harveyi infection, CCL21 expression increased significantly (56.8-fold) at 6 h in the HK (Fig. 5A). High levels of CCL21 were detected at 6 h after E. tarda infection (4.9- and 132-fold) in liver and HK, and low levels of CCL21 expression (0.34- and 0.10fold) occurred at 12 h and 48 h in the spleen (Fig. 5B). Maximum induction of CCL21 expression was detected at 7 dpi (11.0-fold) after megalocytivirus infection (Fig. 5C). For CCL27a, maximum induction occurred at 24 h (4.1-fold) after V. harveyi infection in HK (Fig. 5D). After E. tarda infection, high levels of CCL27a expression (6.6-fold) were detected at 12 h in spleen, and low levels of CCL27a expression (0.14- and 0.16-fold) were detected at 24 h in liver and 48 h in HK (Fig. 5E). After megalocytivirus infection, CCL27a expression increased significantly (3.3- and 5.2-fold) at 1 dpi in liver and at 7 dpi in HK (Fig. 5F). For CCL27b, highest expression was detected at 6 h (11.5-fold) after V. harveyi infection in HK (Fig. 5G). After E. tarda infection, low levels of CCL27b expression (0.28- and 0.35-fold) occurred at 48 h in liver and 6 h in spleen (Fig. 5H). After megalocytivirus infection, high levels of CCL27b expression were detected at 5 dpi (5.1-fold) and 7 dpi (2.4-fold) in the HK, and low levels of CCL27b expression (0.31-fold) were detected at 3 dpi in HK (Fig. 5I). 4. Discussion In the current study, we have identified 9 novel CC chemokine
722
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
Fig. 4. Expression of CCL20a (AeC), CCL20b (DeF), CCL20c (GeI) CCL20d (JeL) in response to bacterial and viral infection. Tongue sole were infected with or without (control) Vibrio harveyi, Edwardsiella tarda, megalocytivirus, and the expression levels of CCL20a (AeC), CCL20b (DeF), CCL20c (GeI) and CCL20d (JeL) in spleen, head kidney, and liver were determined by quantitative real time RT-PCR at various time points. At each time point, the expression level of the control fish was set as 1, which was represented by the dotted horizontal line. Values are shown as means ± SE (N ¼ 3). **P < 0.01, *P < 0.05.
genes from tongue sole, a species of great economic importance in aquaculture. We examined their molecular features and expression patterns under different conditions. We named these chemokines according to the results of the phylogenetic tree, which showed that the nine CCLs distributed in different phylogenetic groups. These results suggest that the 9 CCLs might have different biological functions. However, it should be said that the designation of these chemokines is not something that is completely certain, but would only be confirmed with additional expression studies, functional assays and the identification of the receptors for each of them. qRT-PCR analysis showed that under normal physiological conditions, the 9 CCLs are expressed in 9 tissues but their expression levels varied much. This ubiquitous tissue expression pattern was similar to that of CC chemokines reported for other fish, including Rachycentron canadum [45], Sparus aurata [46], Oncorhynchus mykiss [21] and Ictalurus punctatus [23e25]. The majority of the 9 CCLs were highly expressed in gills and intestine, very important entry sites for pathogens, and also expressed abundantly
in immune-related organs including liver, spleen and HK, where a large number of immune cells, such as macrophages and lymphocytes, exist [47]. In most previous reports, CC chemokines in other teleosts were also highly expressed in immune organs. In R. canadum, RcCC1 was expressed highly in gill, blood, kidney, and spleen [45]. Six chemokines in S. aurata, i.e. CK1, CK3, CK5, CK7, CK8 and CK10, were highly expressed in gills, intestine, HK and spleen [46], and strong constitutive expression of CK3, CK4a, CK4b, CK5b, CK6 and CK7a was observed in trout head kidney [21]. In this study we have also examined the effects of bacterial and viral pathogens on the transcription of the nine CCLs in half-smooth tongue sole, for which little information had been available. CC chemokines play important roles in antibacterial immunity [47e49]. Previous studies in catfish have found that SCYA117 and SCYA125 were rapidly and highly induced after Edwardsiella ictaluri infection in spleen and HK, whereas SCYA115 was moderately upregulated in HK only [50]. In our study, CCL21 was rapidly and highly expressed in liver and HK after E. tarda infection, while in
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
723
Fig. 5. CCL21 (AeC), CCL27a (DeF), CCL27b (GeI) expression in spleen, head kidney, and liver upon Vibrio harveyi, Edwardsiella tarda, megalocytivirus infection or PBS (control), and CCL21 (AeC), CCL27a (DeF), CCL27b (GeI) expressions were determined by quantitative real time RT-PCR at various time points. At each time point, the expression level of the control fish was set as 1, which was represented by the dotted horizontal line. Values are shown as means ± SE (N ¼ 3). **P < 0.01, *P < 0.05.
contrast CCL27a was highly expressed only in spleen (Fig. 5B and E). In another report, seven of the 26 catfish CC chemokines were found to be up-regulated upon E. ictaluri infection, with the most interesting ones being SCYA105, SCYA109, and SCYA117, which were expressed at very low levels before infection, but were dramatically induced after infection [24]. This is in line with our results of CCL20a, which has a high expression level after V. harveyi and E. tarda infection. In the case of viral infection, viral hemorrhagic septicemia virus (VHSV) and infectious pancreatic necrosis virus (IPNV) are known to cause different induction patterns of CC chemokine expression in rainbow trout [21]. In spleen, VHSV provoked a strong upregulation of CK3, CK5B, CK6 and CK12 transcription and a significant downregulation of CK6 expression. IPNV, on the contrary, significantly suppressed the transcription of CK3, and only up-regulated the transcription of CK6 and CK7A. In our study, we found that CCL21 had a high expression level in spleen after viral infection, whereas CCL27a and CCL27b expressions were only moderately increased in the spleen (Fig. 5C, F and I). In seabream, all CC chemokines were drastically induced in response to nodavirus infection [46]. This is in line with our observations that CCL20a, CCL20c, CCL20d, CCL21 expressions were strongly enhanced after megalocytivirus infection (Figs. 4 and 5). In humans, CCL20 was reported to function as both an inflammatory and a homeostatic chemokine [51]. In our study, CCL20a expression induced by the extracellular bacterial pathogen V. harveyi and the intracellular E. tarda were similar, while CCL20b
exhibited very different expression profiles after V. harveyi and E. tarda infection. The expression level of CCL20a and CCL21 were extremely high, which may serve as gene markers linked to antibacterial immunity in tongue sole [30]. These results suggest CCL20a and CCL21 are inflammatory chemokines which react quickly to pathogen invasion. Meanwhile, CCL20b and CCL27a showed weak reactions to bacterial and viral pathogen, suggesting that they are likely homeostatic chemokines. In this study, we observed that the expression profiles of the CC chemokines differed in different tissues and after different pathogen stimulation. For example, megalocytivirus infection had little effect on the expression of CCL20a in spleen compared to that in liver and HK. These differences were observed at both the constitutive and the induced levels of expression of the chemokines, suggesting that the CCLs of tongue sole may play different roles in the immune defense against different pathogens. In conclusion, this study indicates that the 9 CCLs of tongue sole displayed significant and varied changes in mRNA levels in a manner that depended on the pathogen, tissue type, and infection stage. These results provide the first systematic study of a large number of different types of CCLs in tongue sole and will promote our understanding of the function of chemokines in teleosts. Acknowledgments This work was supported by the grants of the 863 High Technology Project of the Chinese Ministry of Science and Technology
724
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
(2014AA093507), the National Basic Research Program of China (2012CB114406), Qingdao National Laboratory for Marine Science and Technology, and the Taishan Scholar Program of Shandong Province. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.10.003. References [1] F.H. Epstein, A.D. Luster, Chemokinesdchemotactic cytokines that mediate inflammation, New Engl. J. Med. 338 (1998) 436e445. [2] E.J. Fernandez, E. Lolis, Structure, function, and inhibition of chemokines, Annu. Rev. Pharmacol. Toxicol. 42 (2002) 469e499. [3] Y. Le, Y. Zhou, P. Iribarren, J. Wang, Chemokines and chemokine receptors: their manifold roles in homeostasis and disease, Cell Mol. Immunol. 1 (2004) 95e104. [4] K.J. Laing, C.J. Secombes, Chemokines, Dev. Comp. Immunol. 28 (2004) 443e460. [5] L. Adrian, M. Shaun, Subversion of the chemokine world by microbial pathogens, Bioessays 25 (2003) 478e488. [6] B.J. Rollins, Chemokines, Blood 90 (1997) 909e928. [7] K. Bacon, M. Baggiolini, H. Broxmeyer, R. Horuk, I. Lindley, A. Mantovani, et al., Chemokine/chemokine receptor nomenclature, J. Leukoc. Biol. 70 (2001) 465e466. bert, R. Horuk, K. Matsushima, et [8] P.M. Murphy, M. Baggiolini, I.F. Charo, C.A. He al., International union of pharmacology. XXII. Nomenclature for chemokine receptors, Pharmacol. Rev. 52 (2000) 145e176. [9] B. Moser, M. Wolf, A. Walz, P. Loetscher, Chemokines: multiple levels of leukocyte migration control, Trends Immunol. 25 (2004) 75e85. [10] A. Zlotnik, O. Yoshie, H. Nomiyama, The chemokine and chemokine receptor superfamilies and their molecular evolution, Genome Biol. 7 (2006) 243. [11] E. Peatman, Z. Liu, Evolution of CC chemokines in teleost fish: a case study in gene duplication and implications for immune diversity, Immunogenetics 59 (2007) 613e623. [12] E. Peatman, Z. Liu, CC chemokines in zebrafish: evidence for extensive intrachromosomal gene duplications, Genomics 88 (2006) 381e385. [13] H. Nomiyama, K. Hieshima, N. Osada, Y. Kato-Unoki, K. Otsuka-Ono, S. Takegawa, et al., Extensive expansion and diversification of the chemokine gene family in zebrafish: identification of a novel chemokine subfamily CX, BMC Genomics 9 (2008) 222. [14] L.-C. Chen, J.-Y. Chen, A.-L. Hour, C.-Y. Shiau, C.-F. Hui, J.-L. Wu, Molecular cloning and functional analysis of zebrafish (Danio rerio) chemokine genes, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151 (2008) 400e409. [15] A. Alejo, C. Tafalla, Chemokines in teleost fish species, Dev. Comp. Immunol. 35 (2011) 1215e1222. [16] B. Dixon, B. Shum, E.J. Adams, K. Magor, R.P. Hedrick, D.G. Muir, et al., CK-1, a putative chemokine of rainbow trout (Oncorhynchus mykiss), Immunol. Rev. 166 (1998) 341e348. [17] K.J. Laing, J.J. Zou, T. Wang, N. Bols, I. Hirono, T. Aoki, et al., Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss, Dev. Comp. Immunol. 26 (2002) 433e444. [18] J. Montero, E. Chaves-Pozo, A. Cuesta, C. Tafalla, Chemokine transcription in rainbow trout (Oncorhynchus mykiss) is differently modulated in response to viral hemorrhagic septicaemia virus (VHSV) or infectious pancreatic necrosis virus (IPNV), Fish Shellfish Immunol. 27 (2009) 661e669. [19] S. Mackenzie, C. Liarte, D. Iliev, J. Planas, L. Tort, F. Goetz, Characterization of a highly inducible novel CC chemokine from differentiated rainbow trout (Oncorhynchus mykiss) macrophages, Immunogenetics 56 (2004) 611e615. [20] L. Liu, K. Fujiki, B. Dixon, R.S. Sundick, Cloning of a novel rainbow trout (Oncorhynchus mykiss) CC chemokine with a fractalkine-like stalk and a TNF decoy receptor using cDNA fragments containing AU-rich elements, Cytokine 17 (2002) 71e81. [21] E. Sanchez, J. Coll, C. Tafalla, Expression of inducible CC chemokines in rainbow trout (Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA vaccine and interleukin 8, Dev. Comp. Immunol. 31 (2007) 916e926. [22] K. Fujiki, D.-H. Shin, M. Nakao, T. Yano, Molecular cloning of carp (Cyprinus carpio) CC chemokine, CXC chemokine receptors, allograft inflammatory factor-1, and natural killer cell enhancing factor by use of suppression subtractive hybridization, Immunogenetics 49 (1999) 909e914. [23] L. Chen, C. He, P. Baoprasertkul, P. Xu, P. Li, J. Serapion, et al., Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and expression after infection with Edwardsiella ictaluri, Dev. Comp. Immunol. 29 (2005) 135e142. [24] E. Peatman, B. Bao, X. Peng, P. Baoprasertkul, Y. Brady, Z. Liu, Catfish CC chemokines: genomic clustering, duplications, and expression after bacterial infection with Edwardsiella ictaluri, Mol. Genet. Genomics 275 (2006)
297e309. [25] C. He, E. Peatman, P. Baoprasertkul, H. Kucuktas, Z. Liu, Multiple CC chemokines in channel catfish and blue catfish as revealed by analysis of expressed sequence tags, Immunogenetics 56 (2004) 379e387. [26] E.-Y. Lee, H.-H. Park, Y.-T. Kim, J.-K. Chung, T.-J. Choi, Cloning and sequence analysis of the interleukin-8 gene from flounder (Paralichthys olivaceous), Gene 274 (2001) 237e243. [27] R. Khattiya, T. Ohira, I. Hirono, T. Aoki, Identification of a novel Japanese flounder (Paralichthys olivaceus) CC chemokine gene and an analysis of its function, Immunogenetics 55 (2004) 763e769. [28] T. Kono, R. Kusuda, E. Kawahara, M. Sakai, The analysis of immune responses of a novel CC-chemokine gene from Japanese flounder Paralichthys olivaceus, Vaccine 21 (2003) 446e457. [29] C.-I. Park, I. Hirono, T. Aoki, Molecular characterization of the Japanese flounder, Paralichthys olivaceus, CD33 and evolution of the CD3 cluster, Dev. Comp. Immunol. 29 (2005) 123e133. [30] S. Chen, Y. Liu, X. Dong, L. Meng, Cloning, characterization, and expression analysis of a CC chemokine gene from turbot (Scophthalmus maximus), Fish Physiol. Biochem. 36 (2010) 147e155. [31] J-s Sun, L. Zhao, L. Sun, Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property, Fish Shellfish Immunol. 30 (2011) 1362e1367. [32] Y-x Li, Y-h Hu, J-s Sun, L. Sun, CsCXCe1: a novel Cynoglossus semilaevis CXC chemokine that functions as a chemoattractant and an immunomodulator for peripheral blood leukocytes, Dev. Comp. Immunol. 37 (2012) 55e64. [33] Y-x Li, J-s Sun, L. Sun, An inflammatory CC chemokine of Cynoglossus semilaevis is involved in immune defense against bacterial infection, Fish Shellfish Immunol. 31 (2011) 446e452. [34] T. Borza, C. Stone, M.L. Rise, S. Bowman, S.C. Johnson, Atlantic cod (Gadus morhua) CC chemokines: diversity and expression analysis, Dev. Comp. Immunol. 34 (2010) 904e913. [35] S. Chen, G. Zhang, C. Shao, Q. Huang, G. Liu, P. Zhang, et al., Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle, Nat. Genet. 46 (2014) 253e260. [36] Y.H. Hu, Y.X. Li, L. Sun, Edwardsiella tarda Hfq: impact on host infection and global protein expression, Vet. Res. 45 (2014) 23. [37] J. Zhang, Y.X. Li, Y.H. Hu, Molecular characterization and expression analysis of eleven interferon regulatory factors in half-smooth tongue sole, Cynoglossus semilaevis, Fish Shellfish Immunol. 44 (2015) 272e282. [38] Z.X. Zhou, L. Sun, Immune effects of R848: evidences that suggest an essential role of TLR7/8-induced, Myd88- and NF-kB-dependent signaling in the antiviral immunity of Japanese flounder (Paralichthys olivaceus), Dev. Comp. Immunol. 49 (2015) 113e120. [39] J. Zhang, Y.H. Hu, Z.Z. Xiao, L. Sun, Megalocytivirus-induced proteins of turbot (Scophthalmus maximus): identification and antiviral potential, J. Proteomics 91 (2013) 430e443. [40] H. Long, L. Sun, CsIFIT1, an interferon-induced protein with tetratricopeptide repeat, inhibits viral infection in tongue sole (Cynoglossus semilaevis), Fish Shellfish Immunol. 41 (2014) 231e237. [41] J. Zhang, L.P. Yu, M.F. Li, L. Sun, Turbot (Scophthalmus maximus) hepcidin-1 and hepcidin-2 possess antimicrobial activity and promote resistance against bacterial and viral infection, Fish Shellfish Immunol. 38 (2014) 127e134. [42] Z.Z. Zhou, B.G. Sun, L. Sun, Edwardsiella tarda Sip1: A serum-induced zinc metalloprotease that is essential to serum resistance and host infection, Vet. Microbiol. 177 (2015) 332e340. [43] Y.H. Hu, L. Sun, A bivalent Vibrio harveyi DNA vaccine induces strong protection in Japanese flounder (Paralichthys olivaceus), Vaccine 29 (2011) 4328e4333. [44] H. Long, C. Chen, J. Zhang, L. Sun, Antibacterial and antiviral properties of tongue sole (Cynoglossus semilaevis) high mobility group B2 protein are largely independent on the acidic C-terminal domain, Fish Shellfish Immunol. 37 (2014) 66e74. [45] Y. Su, Z. Guo, L. Xu, J. Jiang, J. Wang, J. Feng, Identification of a cobia (Rachycentron canadum) CC chemokine gene and its involvement in the inflammatory response, Fish Shellfish Immunol. 32 (2012) 204e210. [46] A. Cuesta, S. Dios, A. Figueras, B. Novoa, M.A. Esteban, J. Meseguer, et al., Identification of six novel CC chemokines in gilthead seabream (Sparus aurata) implicated in the antiviral immune response, Mol. Immunol. 47 (2010) 1235e1243. ~ oz, A. Lo pez-Mun ~ oz, P. Pelegrín, A.G. Ayala, V. Mulero, [47] E. Chaves-Pozo, P. Mun et al., Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected with Vibrio anguillarum, Cell Tissue Res. 320 (2005) 61e68. [48] C.L. Sokol, A.D. Luster, The chemokine system in innate immunity, Cold Spring Harb. Perspect. Biol. 7 (2015) a016303. [49] A.D. Luster, The role of chemokines in linking innate and adaptive immunity, Curr. Opin. Immunol. 14 (2002) 129e135. [50] E. Peatman, B. Bao, P. Baoprasertkul, Z. Liu, In silico identification and expression analysis of 12 novel CC chemokines in catfish, Immunogenetics 57 (2005) 409e419. [51] I.R. Williams, CCR6 and CCL20, Ann. N. Y. Acad. Sci. 1072 (2006) 52e61.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Molecular characterization and expression analysis of nine CC chemokines in half-smooth tongue sole, Cynoglossus semilaevis Lian-xu Hao a, b, c, Mo-fei Li a, b, c, * a
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, China c University of Chinese Academy of Sciences, Beijing, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 August 2015 Received in revised form 1 October 2015 Accepted 2 October 2015 Available online 22 October 2015
Chemokines are a large, diverse group of small cytokines that can be classified into several families, including the CC chemokine family, which plays a pivotal role in host defense by inducing leukocyte chemotaxis under physiological and inflammatory conditions. Here we studied 9 CC chemokines from half-smooth tongue sole (Cynoglossus semilaevis). Phylogenetic analysis divided these chemokines into four groups. The tissue specific expression patterns of the 9 chemokines under normal physiological conditions varied much, with most chemokines highly expressed in immune organs, while some other chemokines showing high expression levels in non-immune organs. In addition, the 9 chemokines exhibited similar or distinctly different expression profiles in response to the challenge of virus and intracellular and extracellular bacterial pathogens. These results indicate that in tongue sole, CC chemokines may be involved in different immune responses as homeostatic or inflammatory chemokines. © 2015 Elsevier Ltd. All rights reserved.
Keywords: CC chemokine Cynoglossus semilaevis Antiviral Antibacterial Immune defense
1. Introduction Chemokines or chemoattractant cytokines are known as a group of 8e14 kDa molecules that regulate cell migrations under various conditions. They also play roles in normal and pathological processes including allergic responses, infectious and autoimmune disease, angiogenesis, inflammation, and tumor growth and metastasis [1]. Functionally, chemokines are divided into two main categories. Some chemokines are produced and secreted constitutively. These chemokines play roles in immune surveillance and function as homeostatic cytokines [2]. Other chemokines are only produced by cells during infection or following a pro-inflammatory stimulus; these chemokines prompt the migration of leukocytes to an injured or infected site [3]. Such inflammatory chemokines can also activate cells to raise an immune response and commence the wound healing process [4]. Chemokines are structurally related, with most containing four invariant cysteine residues involved in two disulphide bonds [5]. The CC (beta) chemokines comprise a subfamily of the chemokine superfamily and are defined by the arrangement of the first two of four invariant cysteine residues
* Corresponding author. Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China. E-mail address: [email protected] (M.-f. Li). http://dx.doi.org/10.1016/j.fsi.2015.10.003 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
found in all chemokines [6]. In CC chemokines, these two cysteines are adjacent, while in the CXC subfamily of chemokines, they are separated by a single amino acid [7]. Chemokines exhibit promiscuous binding to multiple seven-transmembrane, G-protein coupled CC chemokine receptors [8]. In mammals, the broadest functional classification system divides CC chemokines into inflammatory and homeostatic groups [9,10] based on their expression patterns. This division is widely acknowledged too simplistic. Due to the rapid divergence and independent duplication events within each species, the identification of orthologs became more complicated. In teleost, Peatman and Liu have established CC chemokine classification [11]. Seven large groups of fish CC chemokines have been identified through phylogenetic analysis: the CCL19/21/25 group, the CCL20 group, the CCL27/28 group, the CCL17/22 group, the macrophage inflammatory protein (MIP) group, the monocyte chemotactic protein (MCP) group and a fish-specific group [11]. In teleost, researchers have identified more than double of the chemokines of mammals in zebrafish through analyzing expressed sequence tags (ESTs) and genome sequence [12e14]. This phenomenon may be due to their multiple roles in innate immunity which may be a mechanism to react to various pathogens. These chemokines may work together as a complicated network and coordinate immune responses to specific species [11].
718
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
Table 1 The GenBank accession numbers of CCL family members used for construction of the phylogenetic tree and multiple sequence alignment in this study. CCL Cynoglossus semilaevis CCL3a CCL3b CCL20a CCL20b CCL20c CCL20d CCL21 CCL27a CCL27b Homo sapiens CCL2 CCL3 CCL4 CCL5 CCL7 CCL8 CCL13 CCL14 CCL15 CCL17 CCL19 CCL20 CCL21 CCL22 CCL23 CCL24 CCL25 Mus musculus CCL2 CCL4 CCL5 CCL12 CCL19 CCL24 CCL25 CCL27 CCL28 Esox lucius CCL4 CCL8 CCL20 CCL21
Accession no. XP_008309875 XP_008311022 XP_008332070 XP_008306526 XP_008332071 XP_008331981 XP_008332797 XP_008308458 XP_008334193 P13500 P10147 P13236 P13501 P80098 P80075 Q99616 Q16627 Q16663 Q92583 Q99731 P78556 O00585 O00626 P55773 O00175 O15444 NP_035463 P14097 P30882 Q62401 O70460 Q9JKC0 O35903 Q9Z1X0 Q9JIL2 ACO14065 NP_001290574 ACO13905 NP_001290632
However, more researches are needed to understand the function of chemokines in fish. Recent studies with cultured fish species have focused on the immunological roles of chemokines in the defense against pathogens [15]. To date, identification and functional analyses of CC chemokines have been carried out with rainbow trout [16e21], carp [22], catfish [23e25], Japanese flounder [26e29], turbot [30], and half-smooth tongue sole [31e33]. The identification of CC chemokines in teleost was often through analyzing EST database and bioinformatics method, as genome sequences of many cultured fish were released. For example, 32 distinct CC chemokines were identified by analysis of EST database in Atlantic cod (Gadus morhua) [34]. In rainbow trout, several chemokines were identified, which were regulated in expression by viral hemorrhagic septicemia virus and infectious pancreatic necrosis virus [16e18,21]. Recently, the genome sequence of tongue sole has been completed [35], which revealed the existence of 11 putative CC chemokine genes. The aim of this study was to examine, in a comparative and systematic manner, the expression profiles of tongue sole CC chemokines. For this purpose, we selected nine of these putative CCLs that could be successfully amplified by PCR and had not been studied previously. To promote the use of standard nomenclature, we re-named these CCLs based on our phylogenetic
CCL Danio rerio CCL2 CCL3 CCL4 CCL5 CCL13 CCL19 CCL20 CCL21 Rattus norvegicus CCL2 CCL3 CCL4 CCL5 CCL6 CCL7 CCL20 Salmo salar CCL4 CCL8 CCL19 CCL21 CCL25 CCL28 Pundamilia nyererei CCL3 Xiphophorus maculatus CCL3 Oreochromis niloticus CCL3 Stegastes partitus CCL3 Poecilia reticulata CCL3 Anoplopoma fimbria CCL20 Takifugu rubripes CCL13 CCL20 Larimichthys crocea CCL19
Accession no. XP_005162867 XP_003199028 XP_005171406 XP_002666850 XP_001338140 XP_005155699 XP_002666702 XP_002661011 P14844 P50229 P50230 P50231 Q68FP3 Q9QXY8 P97884 ACI67979 ACI68150 ADM15970 NP_001134739 ACI69025 NP_001134950 XP_005754438 XP_005817321 XP_005449343 XP_008296008 XP_008394660 ACQ57955 NP_001266983 NP_001233222 NP_001290247
analysis. The nine CCLs analyzed in this study were named CCL3a, CCL3b, CCL20a, CCL20b, CCL20c, CCL20d, CCL21, CCL27a and CCL27b, which were originally named CCL3, CCL4, CCL26, CCL20, CCL20, CCL20, CCL20, CCL13, and CCL20, respectively [35]. The Table 2 Primers used in this study. Primers
Sequences (50 e30 )
CCL20a-RT-F CCL20a-RT-R CCL20b-RT-F CCL20b-RT-R CCL20c-RT-F CCL20c-RT-R CCL20d-RT-F CCL20d-RT-R CCL27b-RT-F CCL27b-RT-R CCL3a-RT-F CCL3a-RT-R CCL3b-RT-F CCL3b-RT-R CCL27a-RT-F CCL27a-RT-R CCL21-RT-F CCL21-RT-R
GTGCTGCACACAGTACAATGA TGCACCCACTTTGAGTTAGG CCATCGTTTTCCGGTGGAGA TTCCTGGACGTGCCGTTATG TGTGTCCCATCAATGCCATCA TGTTTGACTGGGCTTCAGTGT GACGAGTGGGTGAGAAACACT CAGTGTCTGTGGTGCTGAAGA CAGACTGCAGCATACAAGCC AGCCACATGGTTCGGTGAG GGAGAACGTGGTCAGCTACA CCCAGGTGGCTGAAGGTCTA CTTGCCTGTGAAGAGGGTGAT TGGATCGGCACAGATTTTCCT TCCATTTGCTGCTTCACACG AGTCATTCTGGCGTGCAACA CTGGCCCAAGTGTCCTACG GAATGTTACAGCCTCCGTCCA
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
719
and spleen as described previously [36]. No bacteria or virus were detected from the examined fish. Fish were euthanized with an overdose of tricaine methanesulfonate (Sigma, St. Louis, MO, USA) before tissue collection as reported previously [37]. 2.2. Sequence analysis The CCLs sequences were obtained from GenBank, and the accession numbers of CCL3a, CCL3b, CCL20a, CCL20b, CCL20c, CCL20d, CCL21, CCL27a and CCL27b are listed in Table 1. Domain search was performed with the simple modular architecture research tool (SMART) version 4.0 and the conserved domain search program of NCBI (http://www.ncbi.nlm.nih.gov/Structure/ cdd/wrpsb.cgi). Multiple sequence alignment was carried out with ClustalX program. Sequence similarities were calculated using the Megalign program of DNAStar software package (DNASTAR Inc. Madison, WI, USA). Phylogenetic analysis was performed with ClustalX and the Neighbor-joining algorithm of MEGA 4.0. 2.3. CCLs expression in fish tissues under normal physiological conditions Blood, brain, gill, heart, intestine, head kidney (HK), liver, muscle, and spleen were taken aseptically from five tongue soles (average 15.3 g) and used for total RNA extraction and cDNA synthesis as reported previously [38]. Real-time quantitative polymerase chain reaction (qRT-PCR) was carried out in an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) using the SYBR Premix Ex Taq (Takara, Dalian, China) as described previously [39]. The expression level of CCLs was analyzed using comparative threshold cycle method (2DDCT) with b-actin (ACTB) as an internal control as reported previously [40]. The PCR primers for CCLs are listed in Table 2. Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The experiment was performed three times. 2.4. CCLs expression upon bacterial and viral infection
Fig. 1. Phylogenetic analysis of the nine CC chemokines. A neighbor-joining phylogenetic tree was constructed based on the protein sequences of the CCL subgroup of chemokines from teleosts and mammals. The scale bar is 0.1.
GenBank accession numbers of these nine CCLs are listed in Table 1. 2. Materials and methods 2.1. Fish Half-smooth tongue sole were purchased from a commercial fish farm in Shandong Province, China and maintained at 20 C in aerated seawater and changed daily. Fish were acclimatized in the laboratory for two weeks before experimental manipulation. Before experiment, fish were randomly sampled for the examination of bacterial recovery or megalocytivirus DNA from blood, liver, kidney,
Bacterial and viral infection was performed as reported previously [41]. For bacterial infection, Edwardsiella tarda [42] and Vibrio harveyi [43] were cultured in LB medium at 28 C to an OD600 of 0.8, and the cells were washed with PBS and resuspended in PBS to 2 106 CFU (colony forming unit)/ml and 2 107 CFU/ml, respectively. Tongue soles were divided randomly into three groups (20/group) and injected intraperitoneally (i.p.) with 50 ml E. tarda, V. harveyi, or PBS per fish. Fish were euthanized at 6 h, 12 h, 24 h, and 48 h post-infection, and spleen, HK, and liver were collected under aseptic condition. Total RNA extraction, cDNA synthesis, and qRT-PCR were performed as described above with 60S ribosomal protein L18a (for spleen), ACTB (for HK), and 18s rRNA (for liver) as the internal controls [44]. For viral infection, tongue soles were divided randomly into two groups (20/group) and injected i.p. with 2 106 copies of the megalocytivirus RBIV-C1 [41] in 50 ml PBS; the control fish were injected with 50 ml PBS. Fish (five at each time point) were euthanized at 1 d, 3 d, 5 d, and 7 d post-infection. Spleen, HK and liver were collected and used for qRT-PCR as described above with ACTB as the internal control [44]. The experiment was performed three times. 2.5. Statistical analysis Statistical analyses were carried out with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Data were analyzed with analysis of variance (ANOVA), and statistical significance was defined as
720
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
Fig. 2. Tissue specific expression of CC chemokines under normal physiological conditions. Expressions of the nine chemokines in the brain, gill, liver, blood, heart, spleen, head kidney, intestine, and muscle were determined by quantitative real time RT-PCR. For each chemokine, the expression in the tissue with the lowest mRNA level was set as 1. Vertical bars represent means ± SE (N ¼ 3).
P < 0.05. 3. Results
group. All CCLs have a putative receptor binding site and two glycosaminoglycan (GAG) binding sites. In addition, CCL3a and CCL3b also have a tetramer interface, two dimer interfaces (I form and P form), and a putative receptor binding cleft (Fig. S2).
3.1. Phylogenetic analysis of the nine CCLs A phylogenetic tree was constructed using the neighborjoining method to explore the phylogenetic relationships of the 9 CCLs in vertebrates. The nine CCLs were divided into four groups: CCL20a, CCL20b, CCL20c and CCL20d belong to the CCL20 group, CCL3a and CCL3b belong to the MIP group, CCL27a and CCL27b belong to the CCL27/28 group, and CCL21 belongs to the CCL21/25 group (Fig. 1). 3.2. Sequence characterization of the nine CCLs The proteins of CCL3a, CCL3b, CCL20a, CCL20b, CCL20c, CCL20d, CCL21, CCL27a, and CCL27b consist of 76, 78, 77, 81, 83, 101, 90, 90, and 105 amino acid residues, respectively. Except for CCL20b, all other eight CCL sequences possess four conserved cysteines important for tertiary structure and function (Fig. S1). CCL20b has six conserved cysteine residuals and belongs to the C6b-chemokine
3.3. Expression profiles of the CCLs under normal physiological conditions qRT-PCR analysis was conducted to examine the expression of the 9 CCLs under normal physiological conditions in nine tissues (blood, brain, gill, heart, spleen, muscle, HK, intestine, and liver). The results showed that expression of each of the CCLs was detected in all examined tissues, but the expression patterns differed. For CCL3a, high levels of expression were observed in heart, spleen, liver, gill, HK, and brain (Fig. 2A). The expression pattern of CCL3b was quite different from that of CCL3a, with highest expression detected in gill (Fig. 2B). High levels expressions of CCL20a were detected in heart, gill, and brain (Fig. 2C). CCL20b had high levels of expression in the three main immune organs (HK, liver and spleen), with highest expression in HK (Fig. 2D). CCL20c and CCL20d exhibited similar expression profiles, with high levels of expression occurring in gill and intestine, an important mucosal
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
721
Fig. 3. CCL3a (AeC), CCL3b (DeF) expression in spleen, head kidney, and liver upon Vibrio harveyi, Edwardsiella tarda, megalocytivirus infection or PBS (control), and CCL3a (AeC), CCL3b (DeF) expressions were determined by quantitative real time RT-PCR at various time points. At each time point, the expression level of the control fish was set as 1, which was represented by the dotted horizontal line. Values are shown as means ± SE (N ¼ 3). **P < 0.01, *P < 0.05.
organ (Fig. 2E and F), and low levels of expression detected in spleen (Fig. 2E and F). CCL21 had high levels of expression in intestine and gill and low levels of expression in other tissues (Fig. 2G). CCL27a showed the highest level of expression in HK (Fig. 2H), while CCL27b showed the highest level of expression in brain (Fig. 2I). 3.4. Expression profiles of the CCLs upon experimental infection with extracellular bacterial pathogen, intracellular bacterial pathogen, and virus To examine the expression patterns of the CCLs upon microbial infection, tongue soles were challenged experimentally with the extracellular bacterial pathogen V. harveyi, the intracellular bacterial pathogen E. tarda, or the viral pathogen megalocytivirus. At 6, 12, 24, and 48 h post-bacterial infection (hpi) or 1, 3, 5, and 7 d postviral infection (dpi), the expressions of the CCLs in the spleen, HK, and liver of the infected fish were determined by qRT-PCR. The results showed that CCL3a and CCL3b had the same expression patterns after bacterial infection. In liver and spleen, the expressions of CCL3a and CCL3b were unaffected after V. harveyi infection (Fig. 3A and D). In HK, CCL3a and CCL3b expressions were significantly stimulated, with the highest expression levels (15.2- and 30.2-fold respectively) occurring at 6 h after V. harveyi infection (Fig. 3A and D). High levels of CCL3a and CCL3b expression (10.1and 8.3-fold) were detected at 6 h after E. tarda infection in HK (Fig. 3B and E). After megalocytivirus infection, the expression level of CCL3b had a significant increase (3.2-fold) at 7 dpi in HK (Fig. 3F). CCL20a showed similar expression patterns after V. harveyi and E. tarda infection, with highest mRNA levels occurring in liver (Fig. 4A and B). Compared to the expressions of other CCL20s, the expression of CCL20a showed a significant and rapid increase in all three examined tissues at 6 hpi and then fell steadily to the normal level in liver and HK (Fig. 4A and B). After megalocytivirus infection, the expression levels of CCL20a were dramatically increased in liver and HK, but not in spleen, at 7 dpi (Fig. 4C). CCL20b exhibited a moderate response to the three pathogens. However, CCL20b expression patterns were markedly different in
response to V. harveyi and E. tarda (Fig. 4D and E). CCL20b expression was significantly downregulated in liver and spleen after V. harveyi infection but was not affected by E. tarda and megalocytivirus infection (Fig. 4D, E and F). The expression patterns of CCL20c were similar to that of CCL20a (Fig. 4G, H, and I). After V. harveyi infection, high levels of CCL20d expression were detected at 48 h in liver and spleen (8.3- and 12.8-fold respectively) (Fig. 4J). After E. tarda infection, CCL20d expression increased significantly, with maximum inductions of 40.6-fold, 4.8-fold, and 17.5-fold occurring in liver, spleen, and HK, respectively (Fig. 4K). Infection with megalocytivirus caused high levels of induction of CCL20d expression at 7 dpi in liver, spleen and HK (9.3-, 3.3- and 5.3-fold respectively) (Fig. 4L). After V. harveyi infection, CCL21 expression increased significantly (56.8-fold) at 6 h in the HK (Fig. 5A). High levels of CCL21 were detected at 6 h after E. tarda infection (4.9- and 132-fold) in liver and HK, and low levels of CCL21 expression (0.34- and 0.10fold) occurred at 12 h and 48 h in the spleen (Fig. 5B). Maximum induction of CCL21 expression was detected at 7 dpi (11.0-fold) after megalocytivirus infection (Fig. 5C). For CCL27a, maximum induction occurred at 24 h (4.1-fold) after V. harveyi infection in HK (Fig. 5D). After E. tarda infection, high levels of CCL27a expression (6.6-fold) were detected at 12 h in spleen, and low levels of CCL27a expression (0.14- and 0.16-fold) were detected at 24 h in liver and 48 h in HK (Fig. 5E). After megalocytivirus infection, CCL27a expression increased significantly (3.3- and 5.2-fold) at 1 dpi in liver and at 7 dpi in HK (Fig. 5F). For CCL27b, highest expression was detected at 6 h (11.5-fold) after V. harveyi infection in HK (Fig. 5G). After E. tarda infection, low levels of CCL27b expression (0.28- and 0.35-fold) occurred at 48 h in liver and 6 h in spleen (Fig. 5H). After megalocytivirus infection, high levels of CCL27b expression were detected at 5 dpi (5.1-fold) and 7 dpi (2.4-fold) in the HK, and low levels of CCL27b expression (0.31-fold) were detected at 3 dpi in HK (Fig. 5I). 4. Discussion In the current study, we have identified 9 novel CC chemokine
722
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
Fig. 4. Expression of CCL20a (AeC), CCL20b (DeF), CCL20c (GeI) CCL20d (JeL) in response to bacterial and viral infection. Tongue sole were infected with or without (control) Vibrio harveyi, Edwardsiella tarda, megalocytivirus, and the expression levels of CCL20a (AeC), CCL20b (DeF), CCL20c (GeI) and CCL20d (JeL) in spleen, head kidney, and liver were determined by quantitative real time RT-PCR at various time points. At each time point, the expression level of the control fish was set as 1, which was represented by the dotted horizontal line. Values are shown as means ± SE (N ¼ 3). **P < 0.01, *P < 0.05.
genes from tongue sole, a species of great economic importance in aquaculture. We examined their molecular features and expression patterns under different conditions. We named these chemokines according to the results of the phylogenetic tree, which showed that the nine CCLs distributed in different phylogenetic groups. These results suggest that the 9 CCLs might have different biological functions. However, it should be said that the designation of these chemokines is not something that is completely certain, but would only be confirmed with additional expression studies, functional assays and the identification of the receptors for each of them. qRT-PCR analysis showed that under normal physiological conditions, the 9 CCLs are expressed in 9 tissues but their expression levels varied much. This ubiquitous tissue expression pattern was similar to that of CC chemokines reported for other fish, including Rachycentron canadum [45], Sparus aurata [46], Oncorhynchus mykiss [21] and Ictalurus punctatus [23e25]. The majority of the 9 CCLs were highly expressed in gills and intestine, very important entry sites for pathogens, and also expressed abundantly
in immune-related organs including liver, spleen and HK, where a large number of immune cells, such as macrophages and lymphocytes, exist [47]. In most previous reports, CC chemokines in other teleosts were also highly expressed in immune organs. In R. canadum, RcCC1 was expressed highly in gill, blood, kidney, and spleen [45]. Six chemokines in S. aurata, i.e. CK1, CK3, CK5, CK7, CK8 and CK10, were highly expressed in gills, intestine, HK and spleen [46], and strong constitutive expression of CK3, CK4a, CK4b, CK5b, CK6 and CK7a was observed in trout head kidney [21]. In this study we have also examined the effects of bacterial and viral pathogens on the transcription of the nine CCLs in half-smooth tongue sole, for which little information had been available. CC chemokines play important roles in antibacterial immunity [47e49]. Previous studies in catfish have found that SCYA117 and SCYA125 were rapidly and highly induced after Edwardsiella ictaluri infection in spleen and HK, whereas SCYA115 was moderately upregulated in HK only [50]. In our study, CCL21 was rapidly and highly expressed in liver and HK after E. tarda infection, while in
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
723
Fig. 5. CCL21 (AeC), CCL27a (DeF), CCL27b (GeI) expression in spleen, head kidney, and liver upon Vibrio harveyi, Edwardsiella tarda, megalocytivirus infection or PBS (control), and CCL21 (AeC), CCL27a (DeF), CCL27b (GeI) expressions were determined by quantitative real time RT-PCR at various time points. At each time point, the expression level of the control fish was set as 1, which was represented by the dotted horizontal line. Values are shown as means ± SE (N ¼ 3). **P < 0.01, *P < 0.05.
contrast CCL27a was highly expressed only in spleen (Fig. 5B and E). In another report, seven of the 26 catfish CC chemokines were found to be up-regulated upon E. ictaluri infection, with the most interesting ones being SCYA105, SCYA109, and SCYA117, which were expressed at very low levels before infection, but were dramatically induced after infection [24]. This is in line with our results of CCL20a, which has a high expression level after V. harveyi and E. tarda infection. In the case of viral infection, viral hemorrhagic septicemia virus (VHSV) and infectious pancreatic necrosis virus (IPNV) are known to cause different induction patterns of CC chemokine expression in rainbow trout [21]. In spleen, VHSV provoked a strong upregulation of CK3, CK5B, CK6 and CK12 transcription and a significant downregulation of CK6 expression. IPNV, on the contrary, significantly suppressed the transcription of CK3, and only up-regulated the transcription of CK6 and CK7A. In our study, we found that CCL21 had a high expression level in spleen after viral infection, whereas CCL27a and CCL27b expressions were only moderately increased in the spleen (Fig. 5C, F and I). In seabream, all CC chemokines were drastically induced in response to nodavirus infection [46]. This is in line with our observations that CCL20a, CCL20c, CCL20d, CCL21 expressions were strongly enhanced after megalocytivirus infection (Figs. 4 and 5). In humans, CCL20 was reported to function as both an inflammatory and a homeostatic chemokine [51]. In our study, CCL20a expression induced by the extracellular bacterial pathogen V. harveyi and the intracellular E. tarda were similar, while CCL20b
exhibited very different expression profiles after V. harveyi and E. tarda infection. The expression level of CCL20a and CCL21 were extremely high, which may serve as gene markers linked to antibacterial immunity in tongue sole [30]. These results suggest CCL20a and CCL21 are inflammatory chemokines which react quickly to pathogen invasion. Meanwhile, CCL20b and CCL27a showed weak reactions to bacterial and viral pathogen, suggesting that they are likely homeostatic chemokines. In this study, we observed that the expression profiles of the CC chemokines differed in different tissues and after different pathogen stimulation. For example, megalocytivirus infection had little effect on the expression of CCL20a in spleen compared to that in liver and HK. These differences were observed at both the constitutive and the induced levels of expression of the chemokines, suggesting that the CCLs of tongue sole may play different roles in the immune defense against different pathogens. In conclusion, this study indicates that the 9 CCLs of tongue sole displayed significant and varied changes in mRNA levels in a manner that depended on the pathogen, tissue type, and infection stage. These results provide the first systematic study of a large number of different types of CCLs in tongue sole and will promote our understanding of the function of chemokines in teleosts. Acknowledgments This work was supported by the grants of the 863 High Technology Project of the Chinese Ministry of Science and Technology
724
L.-x. Hao, M.-f. Li / Fish & Shellfish Immunology 47 (2015) 717e724
(2014AA093507), the National Basic Research Program of China (2012CB114406), Qingdao National Laboratory for Marine Science and Technology, and the Taishan Scholar Program of Shandong Province. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.10.003. References [1] F.H. Epstein, A.D. Luster, Chemokinesdchemotactic cytokines that mediate inflammation, New Engl. J. Med. 338 (1998) 436e445. [2] E.J. Fernandez, E. Lolis, Structure, function, and inhibition of chemokines, Annu. Rev. Pharmacol. Toxicol. 42 (2002) 469e499. [3] Y. Le, Y. Zhou, P. Iribarren, J. Wang, Chemokines and chemokine receptors: their manifold roles in homeostasis and disease, Cell Mol. Immunol. 1 (2004) 95e104. [4] K.J. Laing, C.J. Secombes, Chemokines, Dev. Comp. Immunol. 28 (2004) 443e460. [5] L. Adrian, M. Shaun, Subversion of the chemokine world by microbial pathogens, Bioessays 25 (2003) 478e488. [6] B.J. Rollins, Chemokines, Blood 90 (1997) 909e928. [7] K. Bacon, M. Baggiolini, H. Broxmeyer, R. Horuk, I. Lindley, A. Mantovani, et al., Chemokine/chemokine receptor nomenclature, J. Leukoc. Biol. 70 (2001) 465e466. bert, R. Horuk, K. Matsushima, et [8] P.M. Murphy, M. Baggiolini, I.F. Charo, C.A. He al., International union of pharmacology. XXII. Nomenclature for chemokine receptors, Pharmacol. Rev. 52 (2000) 145e176. [9] B. Moser, M. Wolf, A. Walz, P. Loetscher, Chemokines: multiple levels of leukocyte migration control, Trends Immunol. 25 (2004) 75e85. [10] A. Zlotnik, O. Yoshie, H. Nomiyama, The chemokine and chemokine receptor superfamilies and their molecular evolution, Genome Biol. 7 (2006) 243. [11] E. Peatman, Z. Liu, Evolution of CC chemokines in teleost fish: a case study in gene duplication and implications for immune diversity, Immunogenetics 59 (2007) 613e623. [12] E. Peatman, Z. Liu, CC chemokines in zebrafish: evidence for extensive intrachromosomal gene duplications, Genomics 88 (2006) 381e385. [13] H. Nomiyama, K. Hieshima, N. Osada, Y. Kato-Unoki, K. Otsuka-Ono, S. Takegawa, et al., Extensive expansion and diversification of the chemokine gene family in zebrafish: identification of a novel chemokine subfamily CX, BMC Genomics 9 (2008) 222. [14] L.-C. Chen, J.-Y. Chen, A.-L. Hour, C.-Y. Shiau, C.-F. Hui, J.-L. Wu, Molecular cloning and functional analysis of zebrafish (Danio rerio) chemokine genes, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151 (2008) 400e409. [15] A. Alejo, C. Tafalla, Chemokines in teleost fish species, Dev. Comp. Immunol. 35 (2011) 1215e1222. [16] B. Dixon, B. Shum, E.J. Adams, K. Magor, R.P. Hedrick, D.G. Muir, et al., CK-1, a putative chemokine of rainbow trout (Oncorhynchus mykiss), Immunol. Rev. 166 (1998) 341e348. [17] K.J. Laing, J.J. Zou, T. Wang, N. Bols, I. Hirono, T. Aoki, et al., Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss, Dev. Comp. Immunol. 26 (2002) 433e444. [18] J. Montero, E. Chaves-Pozo, A. Cuesta, C. Tafalla, Chemokine transcription in rainbow trout (Oncorhynchus mykiss) is differently modulated in response to viral hemorrhagic septicaemia virus (VHSV) or infectious pancreatic necrosis virus (IPNV), Fish Shellfish Immunol. 27 (2009) 661e669. [19] S. Mackenzie, C. Liarte, D. Iliev, J. Planas, L. Tort, F. Goetz, Characterization of a highly inducible novel CC chemokine from differentiated rainbow trout (Oncorhynchus mykiss) macrophages, Immunogenetics 56 (2004) 611e615. [20] L. Liu, K. Fujiki, B. Dixon, R.S. Sundick, Cloning of a novel rainbow trout (Oncorhynchus mykiss) CC chemokine with a fractalkine-like stalk and a TNF decoy receptor using cDNA fragments containing AU-rich elements, Cytokine 17 (2002) 71e81. [21] E. Sanchez, J. Coll, C. Tafalla, Expression of inducible CC chemokines in rainbow trout (Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA vaccine and interleukin 8, Dev. Comp. Immunol. 31 (2007) 916e926. [22] K. Fujiki, D.-H. Shin, M. Nakao, T. Yano, Molecular cloning of carp (Cyprinus carpio) CC chemokine, CXC chemokine receptors, allograft inflammatory factor-1, and natural killer cell enhancing factor by use of suppression subtractive hybridization, Immunogenetics 49 (1999) 909e914. [23] L. Chen, C. He, P. Baoprasertkul, P. Xu, P. Li, J. Serapion, et al., Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and expression after infection with Edwardsiella ictaluri, Dev. Comp. Immunol. 29 (2005) 135e142. [24] E. Peatman, B. Bao, X. Peng, P. Baoprasertkul, Y. Brady, Z. Liu, Catfish CC chemokines: genomic clustering, duplications, and expression after bacterial infection with Edwardsiella ictaluri, Mol. Genet. Genomics 275 (2006)
297e309. [25] C. He, E. Peatman, P. Baoprasertkul, H. Kucuktas, Z. Liu, Multiple CC chemokines in channel catfish and blue catfish as revealed by analysis of expressed sequence tags, Immunogenetics 56 (2004) 379e387. [26] E.-Y. Lee, H.-H. Park, Y.-T. Kim, J.-K. Chung, T.-J. Choi, Cloning and sequence analysis of the interleukin-8 gene from flounder (Paralichthys olivaceous), Gene 274 (2001) 237e243. [27] R. Khattiya, T. Ohira, I. Hirono, T. Aoki, Identification of a novel Japanese flounder (Paralichthys olivaceus) CC chemokine gene and an analysis of its function, Immunogenetics 55 (2004) 763e769. [28] T. Kono, R. Kusuda, E. Kawahara, M. Sakai, The analysis of immune responses of a novel CC-chemokine gene from Japanese flounder Paralichthys olivaceus, Vaccine 21 (2003) 446e457. [29] C.-I. Park, I. Hirono, T. Aoki, Molecular characterization of the Japanese flounder, Paralichthys olivaceus, CD33 and evolution of the CD3 cluster, Dev. Comp. Immunol. 29 (2005) 123e133. [30] S. Chen, Y. Liu, X. Dong, L. Meng, Cloning, characterization, and expression analysis of a CC chemokine gene from turbot (Scophthalmus maximus), Fish Physiol. Biochem. 36 (2010) 147e155. [31] J-s Sun, L. Zhao, L. Sun, Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property, Fish Shellfish Immunol. 30 (2011) 1362e1367. [32] Y-x Li, Y-h Hu, J-s Sun, L. Sun, CsCXCe1: a novel Cynoglossus semilaevis CXC chemokine that functions as a chemoattractant and an immunomodulator for peripheral blood leukocytes, Dev. Comp. Immunol. 37 (2012) 55e64. [33] Y-x Li, J-s Sun, L. Sun, An inflammatory CC chemokine of Cynoglossus semilaevis is involved in immune defense against bacterial infection, Fish Shellfish Immunol. 31 (2011) 446e452. [34] T. Borza, C. Stone, M.L. Rise, S. Bowman, S.C. Johnson, Atlantic cod (Gadus morhua) CC chemokines: diversity and expression analysis, Dev. Comp. Immunol. 34 (2010) 904e913. [35] S. Chen, G. Zhang, C. Shao, Q. Huang, G. Liu, P. Zhang, et al., Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle, Nat. Genet. 46 (2014) 253e260. [36] Y.H. Hu, Y.X. Li, L. Sun, Edwardsiella tarda Hfq: impact on host infection and global protein expression, Vet. Res. 45 (2014) 23. [37] J. Zhang, Y.X. Li, Y.H. Hu, Molecular characterization and expression analysis of eleven interferon regulatory factors in half-smooth tongue sole, Cynoglossus semilaevis, Fish Shellfish Immunol. 44 (2015) 272e282. [38] Z.X. Zhou, L. Sun, Immune effects of R848: evidences that suggest an essential role of TLR7/8-induced, Myd88- and NF-kB-dependent signaling in the antiviral immunity of Japanese flounder (Paralichthys olivaceus), Dev. Comp. Immunol. 49 (2015) 113e120. [39] J. Zhang, Y.H. Hu, Z.Z. Xiao, L. Sun, Megalocytivirus-induced proteins of turbot (Scophthalmus maximus): identification and antiviral potential, J. Proteomics 91 (2013) 430e443. [40] H. Long, L. Sun, CsIFIT1, an interferon-induced protein with tetratricopeptide repeat, inhibits viral infection in tongue sole (Cynoglossus semilaevis), Fish Shellfish Immunol. 41 (2014) 231e237. [41] J. Zhang, L.P. Yu, M.F. Li, L. Sun, Turbot (Scophthalmus maximus) hepcidin-1 and hepcidin-2 possess antimicrobial activity and promote resistance against bacterial and viral infection, Fish Shellfish Immunol. 38 (2014) 127e134. [42] Z.Z. Zhou, B.G. Sun, L. Sun, Edwardsiella tarda Sip1: A serum-induced zinc metalloprotease that is essential to serum resistance and host infection, Vet. Microbiol. 177 (2015) 332e340. [43] Y.H. Hu, L. Sun, A bivalent Vibrio harveyi DNA vaccine induces strong protection in Japanese flounder (Paralichthys olivaceus), Vaccine 29 (2011) 4328e4333. [44] H. Long, C. Chen, J. Zhang, L. Sun, Antibacterial and antiviral properties of tongue sole (Cynoglossus semilaevis) high mobility group B2 protein are largely independent on the acidic C-terminal domain, Fish Shellfish Immunol. 37 (2014) 66e74. [45] Y. Su, Z. Guo, L. Xu, J. Jiang, J. Wang, J. Feng, Identification of a cobia (Rachycentron canadum) CC chemokine gene and its involvement in the inflammatory response, Fish Shellfish Immunol. 32 (2012) 204e210. [46] A. Cuesta, S. Dios, A. Figueras, B. Novoa, M.A. Esteban, J. Meseguer, et al., Identification of six novel CC chemokines in gilthead seabream (Sparus aurata) implicated in the antiviral immune response, Mol. Immunol. 47 (2010) 1235e1243. ~ oz, A. Lo pez-Mun ~ oz, P. Pelegrín, A.G. Ayala, V. Mulero, [47] E. Chaves-Pozo, P. Mun et al., Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected with Vibrio anguillarum, Cell Tissue Res. 320 (2005) 61e68. [48] C.L. Sokol, A.D. Luster, The chemokine system in innate immunity, Cold Spring Harb. Perspect. Biol. 7 (2015) a016303. [49] A.D. Luster, The role of chemokines in linking innate and adaptive immunity, Curr. Opin. Immunol. 14 (2002) 129e135. [50] E. Peatman, B. Bao, P. Baoprasertkul, Z. Liu, In silico identification and expression analysis of 12 novel CC chemokines in catfish, Immunogenetics 57 (2005) 409e419. [51] I.R. Williams, CCR6 and CCL20, Ann. N. Y. Acad. Sci. 1072 (2006) 52e61.