Molecular characterization and expression profiles of cdc2 and cyclin B during oogenesis and spermatogenesis in green mud crab (Scylla paramamosain)

Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Molecular characterization and expression profiles of cdc2 and cyclin B during oogenesis and spermatogenesis in green mud crab (Scylla paramamosain) Kunhuang Han a, b, Yanbin Dai a, Zhihua Zou a, Mingjun Fu a, Yilei Wang a,⁎, Ziping Zhang c,⁎⁎ a b c

Key Laboratory of Healthy Mariculture for East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen 361021, China Ningde Fufa Fishery Company Limited, Ningde 352103, China Department of Biological Science, Seton Hall University, NJ 07079, USA

a r t i c l e

i n f o

Article history: Received 7 April 2012 Received in revised form 10 July 2012 Accepted 18 July 2012 Available online 25 July 2012 Keywords: Sp-cdc2 Sp-cyclin B Gene expression Gametogenesis Scylla paramamosain

a b s t r a c t The maturation promoting factor (MPF) is a key regulator of controlling G2/M phase transition in the meiotic maturation of oocyte and spermatocyte in animals, which is a complex of CDC2 (CDK1) and cyclin B. To better understand the molecular mechanism of oocyte and spermatocyte maturation in mud crab (Scylla paramamosain), the full length cDNA of cdc2 (Sp-cdc2) and cyclin B (Sp-cyclin B) were cloned and characterized. The full length cDNA of Sp-cdc2 gene is of 1593 bp encoding a protein of 299 amino acids. Real-time quantitative PCR analysis revealed that the expression level of Sp-cdc2 in the ovary was higher than in other tissues (P b 0.01); and its expression level was not significantly different in different stages of ovary development (P > 0.05), meanwhile there was higher expression in T3 stage than in T1 and T2 stages (P b 0.05). The full length cDNA of Sp-cyclin B is 1492 bp encoding a protein of 391 amino acids. The real-time PCR results showed that its expression level in the ovary was the highest in all examined tissues (P b 0.01), and the gonad expression level in O5 stage was significantly higher than in previous 4 stages and the testis (P b 0.05), and was also significantly higher in T2 stage than in T1 stage (P b 0.05). In situ hybridization analysis showed that the expressions of Sp-cdc2 and Sp-cyclin B transcripts were presented in similar distribution patterns in different developing stages of ovary and testis. The positive signals of Sp-cdc2 and Sp-cyclin B mRNA were detected in the oocytoplasm of oogonia and pre-vitellogenic and primary vitellogenic oocytes, while these two genes had higher expression level in the spermatid and secondary spermatocyte following primary spermatocyte. These results suggested that Sp-cdc2 and Sp-cyclin B may play essential roles in the oogenesis and spermatogenesis of the crab. © 2012 Elsevier Inc. All rights reserved.

1. Introduction In multi-cellular organisms, gametogenesis is an important part of gonad development, which is controlled by several cell cycle regulators, such as cyclins, CDK (cyclin-dependent kinase) and CKI (cyclindependent kinase inhibitor). It is well known that both mitoitc and meiotic cell cycles are regulated by the maturation promoting factor (MPF) (Murray and Hunt, 1993), which is a complex of regulatory subunit cyclin B and its catalytic subunit CDK1. The complex controls the G2/M phase transition in eukaryotes by promoting germinal vesicle breakdown (GVBD), chromatin condensation, microtubule spindle formation and progression into metaphase of the second meiotic division, and so Abbreviations: BCIP, (5-bromo-4-chloro-1H-indol-3-yl) dihydrogen phosphate; BSA, bovine serum albumin; CDC, cell division cycle; CDK, cyclin-dependent kinase; CKI, cyclin-dependent kinase inhibitor; GSI, gonadosomatic index; GVBD, germinal vesicle breakdown; MPF, maturation promoting factor; NBT, nitroblue tetrazolium; ORF, open reading frame; PBS, phosphate-buffered saline; SSC, saline sodium citrate buffer. ⁎ Corresponding author. Tel.: +86 592 6182723; fax: +86 592 6181420. ⁎⁎ Corresponding author. Tel.: +1 973 761 9055. E-mail addresses: [email protected] (Y. Wang), [email protected] (Z. Zhang). 1096-4959/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cbpb.2012.07.001

on (Banerjee et al., 2000). MPF is maintained in an inactive state (pre-MPF) by inhibitory kinases such as Weel and Mytl by Thr 14 and Tyr15 residues phosphorylation of CDK1. The pre-MPF complex becomes active by directly dephosphorylating Thr14 and Tyr15 residues and phosphorylating Thr 161 residue by cdc25c phosphatase of CDC2 (Nigg, 1995; Basu et al., 2004; Chesnel et al., 2007; Kaushal and Bansal, 2007). The cyclin B contains a conserved motif called the destruction box in its N-terminal region, which serves as a signal for ubiquitination and is necessary for cell cycle-regulated proteolysis to exit from M phase (Glotzer et al., 1991). The mechanism of MPF activation during oocytes maturation has been well studied in a wide variety of vertebrate animals such as mammalians (Chapman and Wolgemuth, 1992; Hoffmann et al., 2006), amphibians (Nebreda and Ferby, 2000; Karaiskou et al., 2001; Kotani et al., 2001) and fishes (Hirai et al., 1992; Kajiura et al., 1993; Terasaki et al., 2003; Lapasset et al., 2008). The crustacean is a big branch of animal kingdom, and most of decapods are important economic breeding species. However, there are only a few of researches of CDC2 or cyclin B functions on the oogenesis in the crustacean, such as Eriocheir sinensis (Fang and Qiu, 2009), Penaeus monodon (Qiu et al., 2007; Visudtiphole

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

et al., 2009) Marsupenaeus japonicus (Qiu and Yamano, 2005) and Macrobrachium nipponense (Wu, 2009). These studies indicate that MPF activation plays a crucial role during oocyte maturation. Similarly, it is reasonable to assume that MPF also plays an important role in spermatogenesis. To date, however, fewer detailed studies have been conducted on the role of MPF during crustacean spermatogenesis. Meanwhile, how CDC2 and cyclin B work together in oogenesis and spermatogenesis in the crustacean is unclear, especially at molecular level. On the other hand, successful artificial control of gonad maturation of the commercially important species by understanding molecular regulation mechanism of gametogenesis will contribute to a sustainable cultivation and increase in natural resources. In the present study, the full length cDNAs of Sp-cdc2 and Sp-cyclin B were identified and their differentiated expressions were examined during oogenesis and spermatogenesis in mud crab (Scylla paramamosain), one of important economic breeding crabs around the southeast coast of China. The cloning and characterization of Sp-cdc2 and Sp-cyclin B transcripts will provide us useful information to further investigate molecular mechanism of spermatozoan and oocyte maturation in crabs. 2. Materials and methods 2.1. Animals and tissue collection S. paramamosain (Crustacea: Decapoda: Portunidae) at different stages of ovary and testis development were obtained from a crab farm in Zhangpu, Zhangzhou, Fujian, China. Various tissues including testis, ovary, heart, muscle, hepatopancreas, gill, eye, brain, intestine and haemocytes were immediately frozen in liquid nitrogen and stored at − 80 °C for total RNA extraction. According to external morphology, color, gonadosomatic index (GSI) and histological feature, ovarian development was classified into five stages: proliferation (stage I, GSI = 0.57 ± 0.47), pre-vitellogenesis (stage II, GSI = 2.19 ± 0.21), primary vitellogenesis (stage III, GSI = 3.68 ± 0.20), secondary vitellogenesis (stage IV, GSI = 7.81 ± 0.94), and tertiary vitellogenesis (stage V, GSI = 10.49 ± 0.49). The male crabs were grouped into three stages: stage I (GSI = 0.07 ± 0.01), stage II (GSI = 0.21 ± 0.04), and stage III (GSI = 0.34 ± 0.03). Five crabs at each developmental stage were used for the experiments. For in situ hybridization and histological observations, ovaries and testes at different developmental stages were fixed in 4% paraformaldehyde at 4 °C overnight, then stored in methanol at − 20 °C after washing with PBS four times at room temperature. 2.2. Total RNA isolation and cDNA synthesis Total RNA was isolated from tissues as described in the previous studies (Zhang et al., 2003), and then treated with RNase-free DNase I at 37 °C for 30 min to remove potential trace amount of contaminated genomic DNA. cDNA was synthesized from 2 μg of total RNA by M-MLV reverse transcriptase (Promega, USA) at 42 °C for 90 min with oligo-dT-adaptor primer according to protocol of SMART-RACE cDNA Amplification Kit. For real-time PCR, cDNA was synthesized by M-MLV reverse transcriptase at 37 °C for 60 min with random primer. 2.3. cDNA cloning for Sp-cdc2 and Sp-cyclin B Based on the expressed sequence tags (EST) database from our previous results (Zou et al., 2011), a full-length cDNA of Sp-cdc2 with complete coding regions and partial cDNA sequence of Sp-cyclin B were obtained. The open reading frame (ORF) of Sp-cdc2 was confirmed by head-to-toe PCR amplification, and the missing 5′ and 3′ sequence of Sp-cyclin B was amplified by 5′ RACE and 3′ RACE methods. All the primers used in this experiment were listed in Table 1. PCR analyses were performed in a final volume of 25 μL

293

containing 0.5 μL of the cDNAs, 2.5 μL of 10 × PCR buffer, 0.5 μL of 10 mM dNTPs, 0.5 μL GSP and adaptor, and 0.5 μL Taq polymerase (200 U/μL). The PCR programs were carried out at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 65 °C (5′ RACE)/68 °C (3′ RACE) for 30 s, 72 °C for 2 min and a final extension step at 72 °C for 10 min. The PCR products were resolved by electrophoresis on 1% agarose gel. The fragments of interest were excised and then purified by a Gel Extraction Kit (Generay, China). The purified fragments were then cloned into pMD19-T vectors (Takara, Japan), propagated in Escherichia coli (JM109) competent cells. The plasmids isolated from positive clones were sequenced. 2.4. Quantitative real-time PCR For quantitative real time PCR (qRT-PCR), an amount of cDNA derived from 25 ng of input RNA was used in each reaction. Reactions were performed with the SYBR Green PCR Master Mix (Applied Biosystems, USA), and analyzed in the ABI 7500 real time system. The cycling conditions for Sp-cdc2, Sp-cyclin B and 18S rRNA were as follows: 95 °C, 1 min, followed by 40 cycles (95 °C, 15 s; 60 °C, 1 min). Melting curves were also plotted (60–90 °C) in order to make sure that a single PCR product was amplified for each pair of primers. To identify the efficiency of amplification about both target genes and internal gene, a 10-fold dilution of the cDNA were used as templates to test amplification of different sets of primers of Sp-cdc2, Sp-cyclin B and 18S rRNA. The comparative threshold cycle (CT) method was used to calculate the relative concentrations. This method involves obtaining CT values for Sp-cdc2 and Sp-cyclin B, normalizing to a reference gene, 18S rRNA (GenBank accession no. FJ646616); and comparing the relative expression level among different developing stages of testis and ovary and different tissues of female crabs. Experiments were performed routinely with more than three of each stage and tissue with values presented as 2△△CT for the expression levels of Sp-cdc2 and Sp-cyclin B normalized with 18S rRNA (△CT= CT of Sp-cdc2/ Sp-cyclin B minus CT of 18S rRNA, △△CT= △CT of test sample minus △CT of calibrator sample). Data were expressed as mean and standard error of the mean (SEM) unless otherwise stated. Three separate individuals at least at each time were tested, each assayed in triplicate. Statistical analysis of the normalized CT values was performed with Student's t-test using SPSS. Differences were considered significant at Pb 0.05 or most significant at P b 0.01 (two-tailed test). 2.5. Bioinformatics analysis of sequences Nucleotide and predicted amino acid sequence data were compiled and aligned with sequences in GenBank using the BLAST and FASTA algorithms (http://www.ncbi.nlm.nih.gov) to determine gene identity. Isoelectric point and molecular weight predictions were carried out at (http://cn.expasy.org/tools/pi_tool.html). Sp-CDC2 and Sp-cyclin B amino acid signatures proposed by the prosite database (http:// Table 1 Oligonucleotide primers used. Gene Primer (accession no.)

Sequence

Sp-cdc2 (FJ015041)

5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′ 5′

Sp-cyclin B (FJ595022)

18S rRNA (AY181979)

Head primer Toe primer qRT-PCR sense primer qRT-PCR antisense primer 5′RACE outer primer 5′RACE inner primer 3′RACE outer primer 3′RACE inner primer qRT-PCR sense primer qRT-PCR antisense primer qRT-PCR sense primer qRT-PCR antisense primer

GAACGGTGCCTCACGAGTCCC 3′ TGAAGCCCCTGTGTGACCTCC 3′ AGAATGAGGAGGAGGGTGTG 3′ TTGAGGTCCATGTTGAGGAA 3′ CGAGGCGAGAGAGATTCCTGTTG 3′ TGGAGTGTGGGGCCCTGGAAC 3′ TGACTCCCAGGATGCCAGCAA 3′ TGCACTACCATTACCTGGAGGGG 3′ GGGAGTGACGGCGATGTT 3′ TCAGGAAGTCCAGAGGCAGTG 3′ ATGATAGGGATTGGGGTTTGC 3′ AAGAGTGCCAGTCCGAAGG 3′

294

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

www.expasy.ch/prosite) were systematically compared with the deduced sequence of CDC2 and cyclin B. Protein multiple-alignments were performed with BioEdit software (http://www.mbio.ncsu.edu/ BioEdit/bioedit.html). Phylogenies of protein sequences were estimated using MEGA 4.0 software using neighbor joining method, the amino acid sequence of CDC2 and cyclin B from Arabidopsis thaliana was used as an out group. 2.6. In situ hybridazation DIG-labeled RNA probes were synthesized using a DIG RNA labeling kit (Roche Diagnostics, IN). Fragments of crab Sp-cdc2 and Sp-cyclin B were amplified by PCR and cloned into PGEM T easy vector, and the plasmid clones were used as templates to synthesize both sense and antisense RNA probes by in vitro transcription. The transcriptions were

A

performed from 1 μg linearized plasmid using either T7 or SP6 RNA polymerases. Testis and ovary tissue sections were dewaxed with xylene, hydrated in ethanol gradient, washed in PBS and then digested with proteinase K (10 μg/mL) for 5 min. After washing in PBS with glycine (0.1 M), the section tissues were washed in 4× SSC. Sections were prehybridized for 2 h with 50% (v/v) deionized formamide in 4× SSC at 55 °C and hybridized overnight at 60 °C with either antisense or sense probes in 4× SSC, 50 μg/mL heparin, 0.1% tween-20, 50 μg/mL yeast tRNA and dissolved in 50% (v/v) deionized formamide, and pH adjusted to 6.0 by citric acid. On the following day, sections were washed three times in 50% (v/v) formamide in 4× SSC at 60 °C for 30 min each, and two times in 4× SSC at 60 °C for 20 min, then three times in PBS for 20 min, and then treated with RNase A (20 μg/mL in PBS) at 37 °C for 30 min to digest probes, then washed three times in PBS for 20 min each time, blocked with 2 mg/mL BSA, 5% sheep serum in PBT for a

B

Fig. 1. A. The nucleotide and deduced amino acid sequences of the Sp-cdc2 cDNA. Serine/threonine kinases (STKs), cyclin-dependent protein kinase 1 (CDK1) subfamily, and catalytic (c) domain are underlined, which contains an activation loop (A145–W168). The highly conserved domain of PSTAIRE peptide is in a box, which relates to the binding of the cyclins. The phosphorylation/dephosphorylation sites (Thr14, Tyr15 and Thr161) are marked by ellipse. The ARE motif (AU-rich element, AUUUA) is double-underlined. The eukaryotic polyadenylation signal AATAAA is emphasized in bold. B. The nucleotide and deduced amino acid sequences of the Sp-cyclin B cDNA. The M-phase cyclin specific destruction box is emphasized in bold, which regulates the cyclin degradations by UPP. The typical cyclin box motif is marked by underlined, which contains a cyclin family signature motif sequence (in box). The conserved pkA site which is a characteristic for B-type cyclin RRXSK is indicated by double underline. The K-box (TGTGAT) is in italic.

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

295

minimum of 60 min, then incubated for 2 h at RT in 200 μL of a 1/2000 dilution of preabsorbed sheep anti-DIG-alkaline phosphatase conjugated Fab fragments, and visualized by the corresponding substrate, NBT/ BCIP (Roche Diagnostics, IN, USA). 3. Results 3.1. Molecular characterization of Sp-cdc2 and Sp-cyclin B The full-length Sp-cdc2 cDNA is 1593 bp, containing 57 bp in the 5′-untranslated region (UTR), 900 bp in the ORF, and 636 bp in the 3′-UTR with a poly(A) tail. The cDNA sequence and deduced amino acid sequence have been submitted to the NCBI GenBank accession no.FJ015041. The ORF encodes a polypeptide of 299 amino acids with a predicted molecular mass of 34.7 kDa and a theoretical pI of 7.64. A polyadenylation signal (AATAAA) locates 12 bp upstream of poly (A) tail (Fig. 1A). Some highly conserved sites or domains are found in Sp-CDC2. For instance, phosphorylation site (Thr 161), dephosphorylation sites (Thr14 and Tyr15), catalytic domain of serine/ threonine kinases (STKs) (position 3–287aa), PSTAIRE peptide (position 45–51aa) related to the binding of the cyclins, and GxGxxGxV (11–18aa) elements involved in ATP binding (Fig. 1A). GenBank database analysis with BLAST showed that the deduced amino acid sequences of Sp-CDC2 share high identities with the CDC2 of P. monodon (94%), Haliotis diversicolor supertexta (79%), Xenopus (Silurana) tropicalis (78%), Danio rerio (76%) and Homo sapiens (75%). The full length Sp-cyclin B cDNA is 1492 bp, including 198 bp of 5′‐ UTR, 1176 bp of ORF and 118 bp of 3′‐UTR with a poly(A) tail (Fig. 1B). The K-box (TGTGAT), a conserved 3′‐UTR sequence motif that is essential for normal negative regulation was found. The sequence of Sp-cyclin B has been deposited in the GenBank database under accession no. FJ595022. Sp-cyclin B ORF encodes a polypeptide of 391 amino acids, with a predicted molecular weight of 44.58 kDa and theoretical pI of 8.87. The deduced protein sequence that contains a conserved pkA site (RRxSK) locates at 266–270aa, which is a characteristic of B-type cyclins. The cyclin destruction box (RxALGxIxN) which regulates cyclin destructions by ubiquitin proteasome pathway (UPP) in the N-terminal region was also found in 23–31aa, that is highly conserved among the known B-type cyclins (Fig. 1B). Further bioinformatic analyses showed that the deduced amino acid sequences of Sp-cyclin B share high identities with the cyclin B of E. sinensis (71%), Haliotis discus (59%), Xenopus laevis (54%) and H. sapiens (52%). 3.2. Phylogenetic and homology analyses of Sp-CDC2 and Sp-cyclin B To examine the relationships of CDC2 and cyclin B among various animal species, the phylogenetic trees were constructed separately by using the neighbor joining method with the amino acid sequences of green mud crab and the other known CDC2 and cyclin B retrieved from the GenBank. Phylogenetic analysis of the selected CDC2 amino acid sequences resolved the sequences into two main groups of invertebrate and vertebrate CDC2 proteins with A. thaliana set as the out-group (Fig. 2A). And the crustacean CDC2 protein that contained S. paramamosain composed an independent group. The phylogenetic tree also revealed that Sp-CDC2 was most closely related to E. sinensis CDC2 which belong to Pleocyemata, and both sequences were more closely related to P. monodon CDC2 (Dendrobranchiata). Multiple alignment analysis showed (Fig. 3A) that CDC2 have absolutely conserved site or domain characteristics. These sites include the phosphorylation site (Thr161), dephosphorylation sites (Thr14 and Tyr15), catalytic domains PSTAIRE peptide, and the ATP binding elements. Phylogenetic analysis of the selected cyclin B amino acid sequences revealed that cyclin B proteins were divided into two clusters. One cluster was divided into two branches. One branch is composed of all vertebrates and the urochordate Ciona intestinalis which is most closely related to vertebrate. In the vertebrate branch, cyclin B1 and cyclin B2

Fig. 2. A. Phylogenetic tree of the CDC2 amino acid sequences between S. paramamosain and other species using MEGA 4.0 software through neighbor joining method. The number near node represents bootstrap values. The abbreviations used for CDC2 of species are represented, with GenBank Accession no. as follows: Scylla paramamosain: FJ015041.1; Eriocheir sinensis: FJ210468.1; Penaeus monodon: EU492538.1; Xenopus (Silurana) tropicalis: NM_203577.1; Saccoglossus kowalevskii: XM_002737469.1; Danio rerio: NM_212564.2; Taeniopygia guttata: XM_002190103.1; Ciona intestinalis: XM_002131158.1; Homo sapiens: BT007626.1; Tribolium castaneum: XM_962733.2; Asterina pectinifera: D79982.1; Axinella corrugata: AF305777.1; and Arabidopsis thaliana: AAM61014. The Sp-CDC2 is marked by red triangle. B. Phylogenetic tree of the cyclin B amino acid sequences between S. paramamosain and other species. The number near node represents bootstrap values. The abbreviations used for cyclin B of species are represented, with GenBank accession no. as follows: Scylla paramamosain: FJ595022; E. sinensis: EU622123.1; P. monodon: EU707334.1; S. kowalevskii: NM_001165008.1; X. laevis B1: NM_001087797.1; Sphaerechinus granularis: Y08016.1; Tachypleus tridentatus: GQ260127.1; Helobdella triserialis: DQ054488.1; Astropecten aranciacus: AM851052.1: Ciona intestinalis: XM_002126179.1; H. sapiens B2: BT019456.1; H. sapiens B1: BC006510.2; Danio rerio B1: BC045492.1; Monodelphis domestica B2: XM_001368002.1; Patiria pectinifera: AF334142.1; T. guttata B2: XM_002196811.1; Gallus gallus B2: NM_001004369.1; Ornithorhynchus anatinus B1: XM_001507559.1; Larimichthys crocea B1: FJ195327.1; Arabidopsis thaliana: NM_103168; Hydra viridissima: X90984.1. The Sp-cyclin B is marked by a red triangle.

were divided into two small branches respectively. The second branch is composed of Arthropoda (Tachypleus tridentatus), Mollusca (H. discus) and crustaceans (Fig. 2B). In crustacean, Sp-cyclin B was most closely related to E. sinensis cyclin B; and both sequences were more closely

296

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

related to P. monodon cyclin B. The second cluster was composed of Annelida and Echinodermata. Moreover, multiple alignment analysis showed (Fig. 3B) that the cyclin destruction-box with its consensus

sequence RXALGXIXN and the conserved pkA site RRXSK which is characteristic for B-type cyclins exist in the N-terminal region in most species including the mud crab.

Fig. 3. A. Multiple alignment of the CDC2 amino acid sequence between S. paramamosain and other species. CDC2 amino acid sequences are obtained from GenBank as Fig. 2A. Identical residues among all sequences are shown in black background and gaps are shown by hyphens. The phosphorylation site (Thr 161) and dephosphorylation sites (Thr14 and Tyr15) are denoted under the reversed triangle. The GxGxxGxV elements are marked by broken frame which involved in ATP binding, the conserved domain of PSTAIRE peptide is indicated in blue box. B. Multiple alignment of the cyclin B amino acid sequence between S. paramamosain and other species. Cyclin B amino acid sequences are obtained from GenBank as Fig. 2B. Identical residues among all sequences are shown in black background and gaps are shown by hyphens. The broken frame in blue indicated the putative destruction signal; the cyclin box is marked by red box, and the amino acid residues of pkA site are under the curly braces.

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

Fig. 3 (continued).

297

298

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

3.3. Tissue distribution of Sp-cdc2 and Sp-cyclin B transcripts in female crab Tissue distributions of mRNA expression of the female crab Sp-cdc2 and Sp-cyclin B were examined by qRT-PCR using 18S rRNA as an internal control gene. The results showed that Sp-cdc2 (Fig. 4A) and Sp-cyclin B (Fig. 4B) were differentially expressed in the detected tissues including ovary, heart, muscle, hepatopancreas, gill, eye, brain, intestine and haemocytes, and their expression level in the ovary were highest in all examined tissues (P b 0.01). 3.4. Expression profiles of Sp-cdc2 and Sp-cyclin B transcripts in the different stages of gonad development To further understand the detailed development expression profiles of Sp-cdc2 and Sp-cyclin B in different gonad developing stages, qRT-PCR was employed to compare their relative amounts of mRNA. The results showed that Sp-cdc2 mRNA expression level had no statistically significant difference (P > 0.05) at different developing stages of ovary. However, in the testis, its expression reached the highest level at stage T2 (Fig. 5A). Sp-cyclin B mRNA expression level at stage O5 was significantly higher than that at its earlier four stages and three testicular developing stages (P b 0.05), and its expression was also significantly higher at stage T2 than at stage T1 (P b 0.05) (Fig. 5B). 3.5. Localization of Sp-cdc2 and Sp-cyclin B transcripts in gametogenesis In different developing stages of ovary, the expression of Sp-cdc2 (Fig. 6A–E) and Sp-cyclin B (Fig. 6K–O) transcripts were presented

in similar distribution patterns. The positive signals of these two genes were detected in the oocytoplasm of oogonia (Fig. 6A, K) and pre-vitellogenic and primary vitellogenic oocytes (Fig. 6B, C, L and M). No hybridization signal was found in nearly mature oocytes and mature oocytes. Interestingly, Sp-cdc2 and Sp-cyclin B transcripts also existed in some follicle cells surrounding nearly mature oocytes and mature oocytes (Fig. 6D, E, N and O). In situ hybridization analysis showed that the distribution patterns of Sp-cdc2 and Sp-cyclin B mRNA were similar at spermatogenesis (Fig. 7). The Sp-cdc2 and Sp-cyclin B mRNA had higher expression level in the spermatid and secondary spermatocyte following primary spermatocyte, but hybridization signals were hardly detected in the spermatogonium (Fig. 7A, C). Otherwise, a stronger positive signal of Sp-cdc2 was found in mature sperm (Fig. 7A), but not Sp-cyclin B (Fig. 7C). 4. Discussion Many studies showed that the cyclin box motif of cyclin B combines the PSTAIRE motif of CDC2 to form the complex of mature-promoting factor (MPF), which regulates the cell cycles at the G2/M phase transition in many animals. The activation of MPF may trigger the structural events of the first meiotic division, such as nuclear envelope breakdown (known as germinal vesicle breakdown or GVBD), chromatin condensation and microtubule spindle formation (Vaur et al., 2004), and may induce cells to enter mitosis and meiosis (Murray et al., 1989). The activity of MPF is controlled by the phosphorylation at three highly conserver residues (Thr161, Thr14 and Tyr15) of CDC2 kinase. The phosphorylation on Thr161 is necessary for MPF kinase activation. The phosphorylation on either Thr14 or Tyr 15 dominantly inhibits its activation

Fig. 4. Real-time quantitative PCR analysis of tissue expression profiles of Sp-cdc2 (A) and Sp-cyclin B (B) transcripts in female crab. E, eye; G, gill; B, brain; H, heart; St, stomach; M, muscle; O, ovary; He, hepatopancreas; In, intestine; and Ha, haemocyte. 18S rRNA was used as internal control. **Indicates most significantly difference expression (P b 0.01).

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

299

Fig. 5. Real-time quantitative PCR analysis of Sp-cdc2 (A) and Sp-cyclin B (B) transcripts in different developing stages of crab gonads. O: ovary, T: testis, number: stage of development, and the different letters up the error bars indicated the significant difference (Pb 0.05).

(Coleman and Dunphy, 1994). The molecular mechanism of MPF activation to induce gamete maturation in fishes and amphibians has been widely reported (Schuetz and Samson, 1979; Tanaka and Yamashita, 1995; Yamashita et al., 1995). However, the physiological function of MPF during spermatogenesis and oogenesis in crustaceans remained largely elusive. In this study, we successfully obtained Sp-cdc2 and Sp-cyclin B cDNA sequences from mud crab S. paramamosain. In deduced amino acid sequence of the Sp-cdc2 cDNA, we found three crucial phosphorylation/dephosphorylation sites for the activation of CDK1 and the binding cyclin domains: PSTAIRE motif. In deduced amino acid of Sp-cyclin B, we discovered a conserved cyclin box, destruction box and B-type cyclin specific pkA site. The cyclin box may bind PSTAIRE motif of Sp-CDC2 to form Sp-MPF which will control the G2/M transition. Interestingly, in the phylogenetic tree of cyclin B, the cyclin B1 and B2 were divided into two branches in vertebrate. In Homo sapiens, cyclin B1 (Genbank: NM_031966) shared 50% homology with cyclin B2 (NM_004701). Moreover, while cyclin B1 localized in microtubules, cyclin B2 was in the Golgi region. They may participate in the reorganization of different aspects of the cellular architecture at mitosis and different functions in the cell cycle (Jackman et al., 1995). In frog (Rana japonica) oocytes, cyclin B2 is required for the bipolar spindle formation, but not B1 (Kotani et al., 2001). In Japanese ricefish (medaka, Oryzias latipes), cyclin B1 and B2 mRNAs showed a similar expression profiles during spermatogenesis, but cyclin B1 protein was expressed only in spermatogonia and spermatocytes, while cyclin B2 protein was continuously expressed throughout spermatogenesis. The difference in their protein expression patterns suggests that B1 and B2 have distinct roles in medaka spermatogenesis: B1 controls the meiotic cell cycle, whereas B2 is involved in process other than meiosis (Mita et al., 2000). Based on these facts, some significant differences in structure and function of cyclins B1 and B2 have been confirmed in mammals,

amphibians, birds and fish. In this study, only one type of cyclin B was identified from S. paramamosain. This result was further demonstrated in our recent completed large-scale S. paramamosain transcriptome sequencing project with 1116130 reads. Our result is consistent with other reports that only one type of cyclin B is present in invertebrates including in crustacean such as E. sinensis (Fang and Qiu, 2009), P. monodon (Qiu et al., 2007; Visudtiphole et al., 2009) and M. japonicus (Qiu and Yamano, 2005). The phylogenetic tree analysis also showed that invertebrate cyclin B had not been grouped into one cluster with cyclins B1 and B2 (Fig. 2B). This phenomenon might reflect different regulatory modes of MPF in vertebrate and invertebrate: the activation and inactivation of the CDC2 and cyclin B proteins may be different among vertebrates and invertebrates. Cyclin B in invertebrate may have a dual role as cyclin B1 and B2 in vertebrate, or other substituted B-type cyclins could exist in invertebrate, or cell cycle process may be simpler in invertebrate than in vertebrate. These assumptions need more studies to verify that. The expression level of Sp-cdc2 and Sp-cyclin B mRNAs in the ovary was remarkably higher than in other tissues examined (P b 0.01). This phenomenon coincides with other crustacean, such as E. sinensis (Fang and Qiu, 2009; Wu, 2009), Macrobrachium rosembergii (Wu, 2009), P. monodon (Qiu et al., 2007; Visudtiphole et al., 2009). These results may suggest that more MPF is needed to complete the transition of G2/M-phase in the ovary than in other tissues. However, further investigation is indeed necessary to elucidate the function of Sp-cdc2 and Sp-cyclin B in the ovaries of crustaceans. To date, some studies have reported the expression of cdc2 and cyclin B mRNAs in crustacean gonad development. In E. sinensis and M. nipponense, cdc2 mRNA level had no significant difference at the different stages of ovary development (Qiu and Liu, 2009; Wu, 2009); our results also showed that Sp-cdc2 mRNA level had no significant difference throughout the ovary development. In contrast,

300

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

Fig. 6. Localization of Sp-cdc2 and Sp-cyclin B transcripts in crab oogenesis. The results of In situ hybridization with DIG-labeled antisense RNA probe (A, B, C, D and E for Sp-cdc2; K, L, M, N and O for Sp-cyclin B) and sense probe as negative control (F, G, H, I and J for Sp-cdc2; P, Q, R, S and T for Sp-cyclin B) were shown. Regular histological section was stained with hematoxylin and eosin (U, V, W, X, Y). O: oogonium; Oo: oocyte; Cy: cytoplasm; N: nucleus; Nu, nucleolus; Yg: yolk granules; and Fc: follicle cells. A, F, K, P, U: proliferation stage; B, G, L, Q, V: pre-vitellogenesis stage; C, H, M, R, W: primary vitellogenesis stage; D, I, N, S, X: secondary vitellogenesis stage; and E, J, O, T, Y: tertiary vitellogenesis stage. The scale bar indicates 100 μm.

cyclin B mRNA level differed during the ovary development. Cyclin B of E. sinensis mRNA level at previtellogenesis and late vitellogenesis stages was higher than at early and middle vitellogenesis (Fang and Qiu, 2009). In M. nipponense, Wu (2009) stated that the expression levels of cyclin B were cyclical fluctuation during oogenesis; it showed abundant amount at perinucleolus stage then dropped at fusion nucleolus and oil globule stages, but reached highest at yolk granule stage, then dropped greatly at paracmasis stage. In P. monodon, Visudtiphole et al. (2009) stated that the level of cyclin B in stage IV was greater than in stage I during ovarian development, and Qiu et al. (2007) reported that cyclin B expression was strongest in the second stage of ovarian maturation stages. Similarly, our result showed that Sp-cyclin B mRNA level at tertiary vitellogenesis was significantly higher than that at its earlier four stages, indicating that Sp-cyclin B is

active during ovarian maturation in the crab. It remains unknown why the expression profiles of cdc2 and cyclin B were asynchronous in above shrimp and crab. However, the localization patterns of Sp-cdc2 and Sp-cyclin B transcripts in oogenesis were similar: they all were located on oocytoplasm of oogonia and immature oocytes. Although localization patterns of cdc2 and cyclin B transcripts in crustacean gonad have rarely been studied, similar phenomenon has been reported that the short cyclin B transcript located in the ova at early oogonia stage and abundant at perinucleolus stage in M. japonicus (Qiu and Yamano, 2005). Moreover, strong positive signals of Sp-cdc2 and Sp-cyclin B transcripts also were detected in the follicle cells surrounding nearly mature oocytes and mature oocytes. Our results imply that Sp-cdc2 and Sp-cyclin B of follicle cell play the important role in mitosis of the follicular cells as well.

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

301

Acknowledgments The work was supported by the National Natural Science Foundation of China (No. 31072200, No. 30571430), the Natural Science Foundation of Fujian Province (2009J01179), and the Innovation Team Foundation of Jimei University (No. 2010A001). References

Fig. 7. Localization of Sp-cdc2 and Sp-cyclin B transcripts in spermatogenesis. The results of In situ hybridization with DIG-labeled antisense RNA probe (A for Sp-cdc2; C for Sp-cyclin B) and sense probe as negative control (B for Sp-cdc2; D for Sp-cyclin B) were shown. Regular histological section was stained with hematoxylin and eosin (F). Sg: spermatogonium; P-Sc: Primary Spermatocyte; S-Sc: Secondary Spermatocyte; St: Spermatid; and Sp: Sperm. The scale bar indicates 20 μm.

The role of cdc2 and cyclin B during spermatogenesis is unavailable in crustacean. Our experiments showed that expression profiles of Sp-cdc2 and Sp-cyclin B in testis development and spermatogenesis were similar. The expression levels of Sp-cdc2 and Sp-cyclin B at stage T2 were higher than at stages T1 and T3, although only Sp-cdc2 had significant expression difference (Pb 0.05). Similarly, the in situ hybridization result (Fig. 6) showed that the higher expression levels of Sp-cdc2 and Sp-cyclin B were present in spermatid and secondary spermatocyte following primary spermatocyte, hardly any signal was observed in spermatogonium. These results indicate that the Sp-cdc2 and Sp-cyclin B are also important regulators in the spermatogenesis, especially in spermatid and secondary spermatocyte. In summary, we have successfully identified the full lengths of Sp-cdc2 and Sp-cyclin B cDNA sequences from mud crab. Expression analysis indicated that Sp-cdc2 and Sp-cyclin B may play an important role during spermatogenesis and oogenesis of S. paramamosain.

Banerjee, S.K., Weston, A.P., Zoubine, M.N., Campbell, D.R., Cherian, R., 2000. Expression of cdc2 and cyclin B1 in Helicobacter pylori-associated gastric MALT and MALT lymphoma: relationship to cell death, proliferation, and transformation. Am. J. Pathol. 156, 217–225. Basu, D., Navneet, A.K., Dasgupta, S., Bhattacharya, S., 2004. Cdc2-cyclin B-induced G2 to M transition in perch oocyte is dependent on Cdc25. Biol. Reprod. 71, 894–900. Chapman, D.L., Wolgemuth, D.J., 1992. Identification of a mouse B-type cyclin which exhibits developmentally regulated expression in the germ line. Mol. Reprod. Dev. 33, 259–269. Chesnel, F., Bazile, F., Pascal, A., Kubiak, J.Z., 2007. Cyclin B2/cyclin-dependent kinase1 dissociation precedes CDK1 Thr-161 dephosphorylation upon M-phase promoting factor inactivation in Xenopus laevis cell-free extract. Int. J. Dev. Biol. 51, 297–305. Coleman, T.R., Dunphy, W.G., 1994. Cdc2 regulatory factors. Curr. Opin. Cell Biol. 6, 877–882. Fang, J.J., Qiu, G.F., 2009. Molecular cloning of cyclin B transcript with an unusually long 3′ untranslation region and its expression analysis during oogenesis in the Chinese mitten crab, Eriocheir sinensis. Mol. Biol. Rep. 36, 1521–1529. Glotzer, M., Murray, A.W., Kirschner, M.W., 1991. Cyclin is degraded by the ubiquitin pathway. Nature 349, 132–138. Hirai, T., Yamashita, M., Yoshikuni, M., Lou, Y.H., Nagahama, Y., 1992. Cyclin B in fish oocytes: its cDNA and amino acid sequences, appearance during maturation, and induction of p34cdc2 activation. Mol. Reprod. Dev. 33, 131–140. Hoffmann, S., Tsurumi, C., Kubiak, J.Z., Polanski, Z., 2006. Germinal vesicle material drives meiotic cell cycle of mouse oocyte through the 3′UTR-dependent control of cyclin B1 synthesis. Dev. Biol. 292, 46–54. Jackman, M., Firth, M., Pines, J., 1995. Human cyclins B1 and B2 are localized to strikingly different structures: B1 to microtubules, B2 primarily to the Golgi apparatus. EMBO J. 14, 1646–1654. Kajiura, H., Yamashita, M., Katsu, Y., Nagahama, Y., 1993. Isolation and characterization of goldfish cdc2, a catalytic component of maturation-promoting factor. Dev. Growth Differ. 35, 647–654. Karaiskou, A., Dupré, A., Haccard, O., Jessus, C., 2001. From progesterone to active Cdc2 in Xenopus oocytes: a puzzling signalling pathway. Biol. Cell 93, 35–46. Kaushal, N., Bansal, M.P., 2007. Inhibition of CDC2/cyclin B1 in response to seleniuminduced oxidative stress during spermatogenesis: potential role of Cdc25c and p21. Mol. Cell. Biochem. 298, 139–150. Kotani, T., Yoshida, N., Mita, K., Yamashita, M., 2001. Requirement of cyclin B2, but not cyclin B1, for bipolar spindle formation in frog (Rana japonica) oocytes. Mol. Reprod. Dev. 59, 199–208. Lapasset, L., Pradet-Balade, B., Vergé, V., Lozano, J.C., Oulhen, N., Cormier, P., Peaucellier, G., 2008. Cyclin B synthesis and rapamycin‐sensitive regulation of protein synthesis during starfish oocyte meiotic divisions. Mol. Reprod. Dev. 75, 1617–1626. Mita, K., Ohbayashi, T., Tomita, K., Shimizu, Y., Kondo, T., Yamashita, M., 2000. Differential expression of cyclins B1 and B2 during medaka (Oryzias latipes) spermatogenesis. Zool. Sci. 17, 365–374. Murray, A., Hunt, T., 1993. The Cell Cycle: An Introduction. Oxford University Press. Murray, A.W., Solomon, M.J., Kirschner, M.W., 1989. The role of cyclin synthesis and degradation in the control of maturation promoting factor activity. Nature 339, 280–286. Nebreda, A.R., Ferby, I., 2000. Regulation of the meiotic cell cycle in oocytes. Curr. Opin. Cell Biol. 12, 666–675. Nigg, E.A., 1995. Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. Bioessays 17, 471–480. Qiu, G.F., Liu, P., 2009. On the role of Cdc2 kinase during meiotic maturation of oocyte in the Chinese mitten crab, Eriocheir sinensis. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 152, 243–248. Qiu, G.F., Yamano, K., 2005. Three forms of cyclin B transcripts in the ovary of the kuruma prawn Marsupenaeus japonicus: their molecular characterizations and expression profiles during oogenesis. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 141, 186–195. Qiu, L., Jiang, S., Zhou, F., Huang, J., Guo, Y., 2007. Molecular cloning and characterization of a cyclin B gene on the ovarian maturation stage of black tiger shrimp (Penaeus monodon). Mol. Biol. Rep. http://dx.doi.org/10.1007/s11033-006-9052-4. Schuetz, A.W., Samson, D., 1979. Protein synthesis requirement for Maturation Promoting Factor (MPF) initiation of meiotic maturation in Rana oocytes. Dev. Biol. 68, 636–642. Tanaka, T., Yamashita, M., 1995. Pre-MPF is absent in immature oocytes of fishes and amphibians except Xenopus. Dev. Growth Differ. 37, 387–393. Terasaki, M., Okumura, E., Hinkle, B., Kishimoto, T., 2003. Localization and dynamics of Cdc2-cyclin B during meiotic reinitiation in starfish oocytes. Mol. Biol. Cell 14, 4685–4694. Vaur, S., Poulhe, R., Maton, G., Andéol, Y., Jessus, C., 2004. Activation of Cdc2 kinase during meiotic maturation of axolotl oocyte. Dev. Biol. 267, 265–278. Visudtiphole, V., Klinbunga, S., Kirtikara, K., 2009. Molecular characterization and expression profiles of cyclin A and cyclin B during ovarian development of the

302

K. Han et al. / Comparative Biochemistry and Physiology, Part B 163 (2012) 292–302

giant tiger shrimp Penaeus monodon. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 152, 535–543. Wu, P., 2009. Analysis of Ovary ESTs and cDNA Cloning and Expression Profile of Reproduction-related Genes from Macrobrachium nipponense. East China Normal University, Shanghai. (in Chinese). Yamashita, M., Kajiura, H., Tanaka, T., Onoe, S., Nagahama, Y., 1995. Molecular mechanisms of the activation of maturation-promoting factor during goldfish oocyte maturation. Dev. Biol. 168, 62–75. Zhang, Z., Wu, R.S., Mok, H.O., Wang, Y., Poon, W.W., Cheng, S.H., Kong, R.Y., 2003. Isolation, characterization and expression analysis of a hypoxia-responsive glucose

transporter gene from the grass carp, Ctenopharyngodon idellus. Eur. J. Biochem. 270, 3010–3017. Zou, Z.H., Zhang, Z.P., Wang, Y.L., Han, K.H., Fu, M.J., Lin, P., Jia, X.W., 2011. EST analysis on the gonad development related organs and microarray screen for differentially expressed genes in mature ovary and testis of Scylla paramamosain. Comp. Biochem. Physiol. D 6, 150–157.