Molecular characterization and expression profiles of three GnRH forms in the brain and pituitary of adult chub mackerel (Scomber japonicus) maintained in captivity

Aquaculture 356–357 (2012) 200–210

Contents lists available at SciVerse ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aqua-online

Molecular characterization and expression profiles of three GnRH forms in the brain and pituitary of adult chub mackerel (Scomber japonicus) maintained in captivity Sethu Selvaraj a, Hajime Kitano a, Masafumi Amano b, Mitsuo Nyuji a, Kensuke Kaneko a, Akihiko Yamaguchi a, Michiya Matsuyama a,⁎ a b

Laboratory of Marine Biology, Faculty of Agriculture, Kyushu University, Fukuoka 812-8581, Japan School of Marine Biosciences, Kitasato University, Ofunato, Iwate 022-0101, Japan

a r t i c l e

i n f o

Article history: Received 12 August 2010 Received in revised form 20 April 2012 Accepted 4 May 2012 Available online 17 May 2012 Keywords: GnRH Mackerel Brain Pituitary Gonadal stages

a b s t r a c t Gonadotropin-releasing hormone (GnRH) is a key neuroendocrine peptide involved in the reproduction of fish and other vertebrates. However, characterizing the involvement of GnRH in fish reproduction has been complicated by the discovery of multiple GnRH forms. In the present study, we isolated full-length cDNAs encoding three GnRH forms and analyzed seasonal changes in the concentrations of mRNA in the brain and corresponding peptides in the brain and pituitary, in relation to seasonal gonadal development of chub mackerel (Scomber japonicus). Chub mackerel sbGnRH, cGnRH-II, and sGnRH cDNAs encode 98, 85, and 90 deduced amino acids, respectively. In females, brain sbGnRH mRNA and peptide concentrations were significantly higher only during the post-spawning season (August); however, pituitary peptide concentrations were higher during late vitellogenesis (April) and the post-spawning season, in comparison to immature stage (November). In males, brain sbGnRH mRNA and pituitary peptide concentrations were higher during spermiation (April). No significant differences in cGnRH-II mRNA or peptide concentrations were found in either sex. Furthermore, in females, brain sGnRH mRNA concentrations did not vary significantly; however, corresponding peptide concentrations in the brain and pituitary were higher during late vitellogenesis and the post-spawning season, respectively. In males, only brain sGnRH mRNA concentrations were higher during the post-spawning season, with no significant change in peptide concentrations. This study quantified the seasonal expression changes of three GnRH mRNAs and peptides in both sexes of chub mackerel, and the present results combined with our previous immunocytochemical report indicates that sbGnRH form plays a dominant role in seasonal gonadal development. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Fish represent the largest group of vertebrates and exhibit a wide range of reproductive strategies (Oliveira et al., 2005). The brain– pituitary–gonad (BPG) axis is a key neuroendocrine system involved in the reproductive processes, and gonadotropin-releasing hormone (GnRH) represents a key upstream signaling molecule in this system (Weltzien et al., 2004). Brain GnRH stimulates the synthesis and release of the pituitary gonadotropins (GtHs), follicle-stimulating hormone (FSH) and luteinizing hormone (LH), which regulate the synthesis of sex steroids that are responsible for seasonal gonadal growth and maturation (Nagahama, 1994; Yaron et al., 2003). However, the fish brain expresses multiple GnRH forms, derived from distinct genes. This multiplicity has complicated our understanding of their roles in reproductive processes (Holland et al., 2001; Okubo and Nagahama, 2008). Presently, the GnRH family includes 30

⁎ Corresponding author. Tel./fax: + 81 92 642 2888. E-mail address: [email protected] (M. Matsuyama). 0044-8486/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2012.05.015

different forms, representing 15 vertebrate and 15 invertebrate species; eight of these have been identified in fish (Roch et al., 2011). The GnRH forms in different species are classified as GnRH1, GnRH2, or GnRH3, based on phylogenetic analysis and neuroanatomical distribution (Fernald and White, 1999). GnRH1 is the hypophysiotropic form, with a distribution in the neuronal population of the preoptic area (POA) and hypothalamus. In fish, the GnRH1 forms include the mammalian form (mGnRH) and various fish-specific peptides such as seabream, medaka, whitefish, catfish, and herring GnRH (sbGnRH, mdGnRH, wfGnRH, cfGnRH, and hrGnRH, respectively). The GnRH2 form exists in the midbrain tegmentum region, and it is represented in all vertebrates examined to date by chicken GnRH-II (cGnRH-II). On the contrary, GnRH3 is a teleost-specific form (salmon GnRH, sGnRH) that is expressed in neuronal populations in the olfactory bulb, terminal nerve ganglion region, and POA (Kah et al., 2007; Lethimonier et al., 2004). For convenience, we refer to the various forms as ‘GnRH forms’ in the present study. The chub mackerel (Scomber japonicus) is a marine pelagic fish, which belongs to the order Perciformes and family Scombridae. It is an important commercial fish throughout the tropical and temperate

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

waters of the world and is widely distributed in the waters of Korea, China, Japan, and California (USA) (Collette, 2003; Hwang and Lee, 2005). In Japan, chub mackerel fishery has been managed by the total allowable catch (TAC) system since 1997. Aquaculture of chub mackerel commenced in southwestern Japan due to unpredictable yield of the wild fish. The high demand for live fish is currently addressed using young or adult fish caught from the wild (Matsuyama et al., 2005). This species has been suggested to be a potential scombroid fish for aquaculture, considering its high early growth potential and use in the tuna fishing industry as live bait (Mendiola et al., 2008). The wild-caught adult chub mackerels reared in sea pens and outdoor tanks undergo normal spermatogenesis and vitellogenesis (Matsuyama et al., 2005). This experimental system facilitates fish sampling at different gonadal growth stages to elucidate the role of key neuroendocrine hormones acting at the BPG axis, which are responsible for seasonal gonadal development. However, after the completion of vitellogenesis, female fish fail to undergo final oocyte maturation (FOM) or ovulation during spawning season (April– June) (Shiraishi et al., 2005). The main reason for the failure of FOM in captive stock seems to involve endocrinological dysfunction associated with a lack of spontaneous LH surge, which is typically orchestrated by the pituitary (Shiraishi et al., 2008a). Our previous study found that the chub mackerel brain extracts contain peptides that are chromatographically and immunologically identical to sbGnRH, cGnRH-II, and sGnRH. Further, their neuronal distribution, as revealed using immunocytochemistry, showed that sbGnRH-immunoreactive cell bodies localized in the POA send their axonal projections to the pituitary (Selvaraj et al., 2009). However, teleosts expressing three GnRH transcripts in the brain exhibit differences in abundance of their corresponding peptides in the pituitary; with one or two forms show fluctuation in relation to seasonal gonadal development (Holland et al., 2001; Senthilkumaran et al., 1999). In addition, GnRH is regulated at the transcription, translation, and secretion levels to produce characteristic physiological effects (Nelson et al., 1998). Previous studies measured either mRNA concentrations in the brain and corresponding peptide concentrations in the pituitary or only peptide concentrations in the brain and pituitary to correlate their fluctuations in relation to seasonal gonadal development and maturation (Amano et al., 2008). In the present study, an attempt was made to measure both GnRH mRNA concentrations in the brain as well as their corresponding peptide concentrations in the brain and pituitary to clarify the GnRH form predominantly involved in the seasonal gonadal development of chub mackerel. With this background, the present study was conducted with the following aims: (1) to characterize cDNAs encoding sbGnRH, cGnRH-

201

II, and sGnRH in the brain of chub mackerel; and (2) to analyze the changes in expression of three forms of GnRH, as measured by mRNA concentrations in the brain and corresponding peptide concentrations in the brain and pituitary during different gonadal stages, using quantitative real-time polymerase chain reaction (qRT-PCR) and time-resolved fluoroimmunoassay (TR-FIA), respectively. 2. Materials and methods 2.1. Fish and tissue sampling Adult chub mackerel were caught with a purse seine and reared in sea pens at a fish farm. The fish were reared under natural daylight and fed with commercial dry pellets (Higashimaru Co., Japan) twice per day. This fish stock was reared for one year at ambient temperature after its capture in November 2007, and experimental sampling was carried out from the same stock at different times of the year, representing different stages of reproductive development (Selvaraj et al., 2010). Female and male fish sampling was performed during the months of November 2008 (immature), early March (early vitellogenesis and late spermatogenesis), and late April 2009 (late vitellogenesis and spermiation), corresponding to gonadal growth periods (Shiraishi et al., 2008b). In addition, the sampling was performed during August 2009, corresponding to post-spawning period. During each sampling period, fish were transferred and stocked in 3-ton outdoor concrete tanks at the Tsuyazaki fishery laboratory of Kyushu University. Appropriate measures were taken to prevent handling stress to fish. The fish were maintained in tanks supplied with natural seawater and sampling was performed after one week of acclimatization. The water temperature at the time of sampling in November, March, April, and August was 20.6 °C, 11.9 °C, 15.8 °C, and 24.5 °C, respectively. At each sampling point, female and male fish (n = 12–14 for each sex) were sacrificed in accordance with the guidelines for animal experiments proposed by the Faculty of Agriculture and Graduate Study at Kyushu University and according to the laws (no. 105) and notifications (no. 6) of the Japanese government. All fish sampling was performed during the morning and early afternoon. Body weight and gonad weight were measured to calculate the gonadosomatic index (GSI = gonad weight/body weight without gonads × 100). The brain and pituitary of each fish were removed following decapitation, snap-frozen in liquid nitrogen, and stored at – 80 °C until further analysis. The midsection of each gonad from individual fish was fixed in Bouin's solution for gonadal histology. To analyze the changes in sbGnRH, cGnRH-II, and sGnRH mRNA in the whole brain and corresponding peptide levels in the whole brain

Table 1 Fork length, body weight, and gonadosomatic index (GSI) of the female and male chub mackerels used for GnRH mRNA and peptide analyses. Values are expressed as the mean ± SEM. Different characters represent significant differences (P b 0.05) among months. Analyses

GnRH mRNAs

Sex

Females

Males

GnRH peptides

Females

Males

Parameters

Fork length (cm) Body weight (g) GSI (%) n Fork length (cm) Body weight (g) GSI (%) n Fork length (cm) Body weight (g) GSI (%) n Fork length (cm) Body weight (g) GSI (%) n

Sampling periods November 2008

March 2009

April 2009

August 2009

33.8 ± 0.3a 523 ± 16a 1.0 ± 0.0a 6 33.1 ± 0.4a 489 ± 20a 0.3 ± 0.1a 6 33.5 ± 0.1a 496 ± 11a 0.8 ± 0.1a 6 33.0 ± 0.4a 490 ± 16a 0.2 ± 0.0a 5

34.6 ± 0.3a 566 ± 35a 1.4 ± 0.1a 6 34.2 ± 0.3ab 518 ± 22a 2.2 ± 0.5a 6 33.8 ± 0.3a 523 ± 23a 1.4 ± 0.1a 6 34.1 ± 0.6a 552 ± 44a 2.2 ± 0.6a 7

33.6 ± 0.4a 523 ± 24a 7.3 ± 1.4b 6 33.0 ± 0.3a 513 ± 15a 12.0 ± 1.3b 6 33.5 ± 0.5a 522 ± 24a 6.7 ± 0.8b 6 33.3 ± 0.4a 552 ± 29a 12.1 ± 0.9b 6

34.6 ± 0.2a 523 ± 33a 4.1 ± 0.9ab 6 35.0 ± 0.5b 553 ± 37a 2.6 ± 1.0a 6 34.6 ± 0.3a 503 ± 32a 6.3 ± 0.9b 5 33.8 ± 0.3a 479 ± 15a 1.2 ± 0.3a 7

202

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

and pituitary, two different sets of fish samples were used (Table 1). The brain tissue from the first set was used for GnRH mRNA analysis and the brain and pituitary tissues from the second set were used for GnRH peptide analysis. Due to limitation in the sampling approach, their possible influence on the results of GnRH mRNA and peptide analyses cannot be excluded. However, fish samples that were used for GnRH mRNA analysis were previously used to analyze expression changes of other genes by our group (Nyuji et al., 2012; Selvaraj et al., 2010).

Table 3 List of primers used for real-time PCR expression analysis of GnRH mRNAs. Primer name

Nucleotide sequence (5′–3′)

Mac. Mac. Mac. Mac. Mac. Mac. Mac. Mac.

GCTGCTTCTTGGATCAGTAGTG AACCCCTCAACTACATCATCC TGGGGTTGCTTCTATGTGTG TCCTCTGAAATCTCTGGTGTG ACTGGTCCTATGGATGGCTAC TTCAGGAAGAGACACCACACC ACCGGTATTGTCATGGACTC TCATGAGGTAGTCTGTGAGGTC

RT sbGnRH Fw RT sbGnRH Rv RT cGnRH-II Fw RT cGnRH-II Rv RT sGnRH Fw RT sGnRH Rv β-actin RT Fw β-actin RT Rv

2.2. Gonadal histology After fixation, gonad samples were dehydrated in a series of ethanol solutions ranging up to 100%, embedded in paraffin and sectioned at 5–7 μm using a Leica RM 2155 rotary microtome (Leica, Germany). Sections were stained with hematoxylin and counterstained with eosin. The stained tissues were then observed under a light microscope to confirm the gonadal stage. The female fish sampled during the months of November 2008, early March, late April, and August 2009 were divided in four gonadal stages: (1) immature, (2) early vitellogenesis, (3) late vitellogenesis, and (4) post-spawning. Similarly, male fish were classified as: (1) immature, (2) late spermatogenesis, (3) spermiation, and (4) post-spawning. Based on histological observation of gonads, fish with similar stages at different sampling periods were used for experimental analysis. 2.3. Characterization, sequencing, and phylogenetic analysis of GnRH cDNAs Total cellular RNA from the brain was extracted using ISOGEN (Nippon Gene, Japan), according to the manufacturer's protocol. Firststrand cDNAs were synthesized from 1 μg of total RNA using an oligo(dT) primer (OdT) (Sigma) and superscript III Reverse Transcriptase (Invitrogen). Two overlapping degenerate primers (DP1 and DP2; Invitrogen) were designed from the conserved decapeptide region of each GnRH cDNA sequence. The 3′ ends of cDNAs were amplified by two rounds of PCR using DP and an adaptor primer (AP) as forward and reverse primers, respectively. The first round of PCR was performed with DP1 of each GnRH form and AP using a temperature cycle profile of 95 °C for 9 min, 35 cycles of 94 °C for 1 min, 56 °C for 1 min, and 72 °C

for 1 min. The diluted first-round PCR products served as templates for nested PCR, which utilized the second overlapping DP2 of each GnRH form and AP under similar PCR conditions. To isolate the 5′ ends of cDNAs, gene-specific primers (GSP1 of each GnRH form; Sigma) were used for reverse transcription. First-strand cDNAs were purified and poly-A tailed, before use as templates in the PCR (Selvaraj et al., 2010). The first round of PCR was performed using GSP2 of each GnRH form, OdT and AP using a temperature cycle profile of 95 °C for 9 min, 1 cycle of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min; 35 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min; and finally 72 °C for 3 min. The first-round PCR products served as templates in nested PCR using the third corresponding gene-specific primer (GSP3 of each GnRH form) in combination with the AP under the following conditions: 95 °C for 9 min; 35 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min; and 72 °C for 3 min. Finally, gene-specific primers corresponding to the 5′ and 3′ ends of chub mackerel sbGnRH, cGnRH-II, and sGnRH cDNAs (GSP4 and GSP5 of each GnRH form) were used to amplify the full-length cDNA sequence. The PCR conditions were similar to those used for the isolation of 3′ ends. All PCR were performed using a PCR master mix (AmpliTaqGold) in a thermocycler (PC707, Astec). The additional protocols used for cDNA cloning and sequencing have been described in previous reports (Ohta et al., 2008; Selvaraj et al., 2010). All primers used for cDNA cloning are shown in Table 2. Homology searches of chub mackerel sbGnRH, cGnRH-II, and sGnRH cDNAs were performed with the Basic Local Alignment Search Tool (BLAST). Multiple alignments of amino acid sequences encoding sbGnRH, cGnRH-II, and sGnRH forms in other closely related fish were

Table 2 List of primers used for molecular characterization of GnRH cDNAs. Primer name

Nucleotide sequence (5′–3′)

Purpose

Oligo dT primer (OdT) Oligo dT adaptor primer (AP) sbGnRH DP1 sbGnRH DP2 cGnRH-II DP1 cGnRH-II DP2 sGnRH DP1 sGnRH DP2 sbGnRH GSP1 sbGnRH GSP2 sbGnRH GSP3 sbGnRH GSP4 sbGnRH GSP5 cGnRH-II GSP1 cGnRH-II GSP2 cGnRH-II GSP3 cGnRH-II GSP4 cGnRH-II GSP5 sGnRH GSP1 sGnRH GSP2 sGnRH GSP3 sGnRH GSP4 sGnRH GSP5

GGC CAC GCG TCG ACT AGT ACT TTT TTT TTT TTT TTT T GGC CAC GCG TCG ACT AGT AC CAR CAC TGG TCV TAY GGR CTS AG TAY GGR CTS AGY CCR GGV GG CAR CAC TGG TCY CAY GGB TGG TCY CAY GGB TGG TAY CCB GGD GG CAG CAY TGG TCN TAY GGN TGG TAY GGN TGG CTD CCN GGN GG CTGTGTCCATTCTCCCTGTTG CCATTCTCCCTGTTGGTCAC CTCCCTGTTGGTCACACTGC CACAAACTACAGCACACAAG ACAGCACACAAGAACAAGTC AGCTCTCTGGCTAAGGCATCC GTAGCTGCATTCCCCTGCCT TCGCACAGTTTGATCTCCTC GCCTCTGGAGGACTTTAAGAC CCTCTGGAGGACTTTAAGACG GTTTGGGCACTCGCCTCTTCAG TCGCCTCTTCAGGAAGAGACACCA CGCCTCTTCAGGAAGAGACACCAC TGCTAACAAGGCAAATACAGAGC GCTAACAAGGCAAATACAGAGCT

RACE-PCR RACE-PCR 3′ RACE-PCR 3′ RACE-PCR (nested) 3′ RACE-PCR 3′ RACE-PCR (nested) 3′ RACE-PCR 3′ RACE-PCR (nested) 5′ RACE-PCR 5′ RACE-PCR 5′ RACE-PCR (nested) Full length Full length (nested) 5′ RACE-PCR 5′ RACE-PCR 5′ RACE-PCR (nested) Full length Full length (nested) 5′ RACE-PCR 5′ RACE-PCR 5′ RACE-PCR (nested) Full length Full length (nested)

(DP, degenerate primer; GSP, gene specific primer; B = T or G or C; D = A or T or G; N = A or T or G or C; R = A or G; S = C or G; V = A or G or C; Y = C or T).

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

performed using ClustalW (http://clustalw.ddbj.nig.ac.jp/). A phylogenetic tree was constructed with MEGA4 software using the neighborjoining method (Tamura et al., 2007). 2.4. Quantitative real-time PCR (qRT-PCR) Real-time PCR was performed on an Mx 3000P quantitative PCR system (Stratagene). Total RNA was extracted from brains as described

203

previously in Section 2.3. One microgram of total RNA from each brain sample was digested with DNase I (Invitrogen) and used as the template for reverse transcription using random hexamers (Takara Bio Inc., Japan). All primers for qRT-PCR analysis were designed using GENETYX software (Table 3) and validated with RT-PCR and agarose gel electrophoresis. The qRT-PCR was performed using the Brilliant II Fast SYBR Green QPCR Master Mix (Stratagene), according to the manufacturer's protocol. The thermocycling conditions were 95 °C for

Fig. 1. Sequence alignment of the amino acid sequences of sbGnRH (A), cGnRH-II (B), and sGnRH (C). The identical sequences are indicated by dots. The underlines indicate sequences corresponding to signal peptide, GnRH decapeptide, and GnRH-associated peptide regions. Numbers in parentheses show percent identities among the three GnRH forms in chub mackerel with other fish expressing three GnRH forms. GenBank accession numbers for the sbGnRH, cGnRH-II, and sGnRH forms of the protein are HQ108193, HQ108194, and HQ108195 (chub mackerel, Scomber japonicus); AY324668, AY324669, and AY324667 (Atlantic croaker, Micropogonias undulatus); AF224279, AF224281, and AF224280 (European sea bass, Dicentrarchus labrax); U30320, U30325, and U30311 (gilthead seabream, Sparus aurata); AB066360, AB066359, and AB066358 (barfin flounder, Verasper moseri); AY373450, AY373451, and AY373449 (grey mullet, Mugil cephalus), and AY677175, AY677174, and AY677173 (cobia, Rachycentron canadum).

204

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

5 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Dissociation curve analysis was also included; 1 cycle of 95 °C for 1 min, 55 °C for 30 s, and 95 °C for 30 s. The transcripts were quantified using the standard curve method (Larionov et al., 2005). Standard curves for chub mackerel sbGnRH, cGnRH-II, sGnRH, and β-actin were generated by 10-fold serial dilutions of known concentrations of the plasmids containing the target transcripts. The linearity, detection range, and real-time PCR amplification efficiency of each primer pair for sbGnRH, cGnRH-II, sGnRH, and β-actin were checked before proceeding with sample analysis (see Supplementary data, Fig. 1). The expression of β-actin (GenBank accession no.: GU731674) was used as the endogenous reference gene to correct for differences in reverse transcription efficiency and template quantity. All standards and experimental samples were run in duplicate. The amounts of target and endogenous reference in experimental samples were determined from the respective standard curves using MxPrO QPCR software. Transcript concentrations of GnRH mRNAs were normalized to the concentrations of β-actin; the data are expressed as relative mRNA concentrations. All additional precautionary measures were considered to avoid false positives (Bustin et al., 2009). 2.5. Time-resolved fluoroimmunoassay (TR-FIA) TR-FIA is a highly sensitive lanthanide based immunodetection system in which specific antigen-antibody reaction observed by measuring

the light emitted from labels conjugated to a protein (Degan et al., 1999). Brain and pituitary extracts were prepared following the protocol of Okuzawa et al. (1990) and Pham et al. (2006a). Briefly, tissues were homogenized with 0.1N HCl followed by sonication. After centrifugation at 10,000 g for 30 min. at 4 °C, the supernatant liquid was neutralized with 1N NaOH, lyophilized under vacuum and reconstituted in an assay buffer (20 mM sodium phosphate buffer, 0.9% NaCl, 0.1% bovine serum albumin, 20 μM diethlyenetriamine-N,N,N′,N″,N″-pentaacetic acid, 0.01% Tween40, pH 7.2). The brain and pituitary GnRH peptide concentrations were measured using a previously developed TR-FIA assay system to quantify levels of sbGnRH, cGnRH-II, and sGnRH in extracts (Amano et al., 2004; Yamada et al., 2002). Parallelism between the typical standard curves of each GnRH peptide and the corresponding competition curves of sample extracts of chub mackerel was confirmed with serially two-fold-diluted standards and sample extracts in TR-FIA assay buffer (see Supplementary data, Fig. 2). The detection range of sbGnRH, cGnRH-II, and sGnRH peptides in TR-FIA assay was 0.10–50 ng/ml, 0.008–2 ng/ml, and 0.20– 12.5 ng/ml, respectively. The minimum detectable limit of sbGnRH, cGnRH-II, and sGnRH peptides in TR-FIA assay was 0.072 ng/ml, 0.008 ng/ml, and 0.635 ng/ml, respectively. In TR-FIA, anti-sbGnRH (AS-691), anti-cGnRH-II (acII6), and anti-sGnRH (lot2) showed crossreactivities (%) with other GnRH peptides (see Supplementary data, Table 1). Sample values below the detectable limit were considered zero for data analysis. GnRH peptide concentrations in the brain and pituitary are expressed as ng/mg tissue and ng/pituitary, respectively.

Fig. 2. Phylogenetic analysis of the amino acid sequences of sbGnRH, cGnRH-II, and sGnRH forms using the neighbor-joining method. Branch points were validated by 10,000 bootstrap replications. The positions of chub mackerel are marked by asterisks (∗). The GenBank accession numbers of the sequences is presented in Fig. 1.

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

2.6. Data analysis All data are represented as the mean± standard error of the mean. The fork length, body weight and gonadosomatic index (GSI) values of fish corresponding to different gonadal stages were analyzed by one-way ANOVA, followed by Bonferroni multiple comparison test. Further, a nonparametric Mann–Whitney U test was used to evaluate any

205

differences in the size and GSI of the fish used for mRNA and peptide analyses at different sampling periods. The changes in GnRH mRNA and peptide concentrations in the brain and pituitary during different gonadal stages were analyzed by one-way ANOVA, followed by Bonferroni multiple comparison test. Pb 0.05 was considered statistically significant, and different letters in figures show significant differences between gonadal stages. All analyses were performed in GraphPad Prism4.

Fig. 3. Gonadal stages of female (A–D) and male chub mackerel (E–H) sampled during different months. (A) Immature female (November). (B) Early vitellogenesis (March). (C) Late vitellogenesis (April). (D) Post-spawning female (August). (E) Immature male (November). (F) Late spermatogenesis (March). (G) Spermiation (April). (H) Postspawning male (August). PNO, peri-nucleolar oocyte; EY, early yolk oocyte; LY, late yolk oocyte; AO, atretic oocyte; SG, spermatogonia; SC, spermatocytes; ST, spermatids; SZ, spermatozoa; RS, residual spermatozoa. Scale bars = 100 μm.

206

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

3. Results

3.2. Gonadal histology and gonadosomatic index (GSI)

3.1. Sequence and phylogenetic analysis of GnRH cDNAs

The description of different gonadal stages of female and male chub mackerel analyzed in the study is detailed in Selvaraj et al. (2010) and representative histological images are shown in Fig. 3. The fork length, body weight, and GSI (%) data of fish used for GnRH mRNA and peptide analyses are presented in Table 1. No significant differences (Pb 0.05) were found in the size and GSI of the fish used for mRNA and GnRH peptide analysis excepting GSI (P= 0.004) and fork length (P = 0.04) of immature and early vitellogenic females (see Supplementary data, Table 2). In both female and male fish, GSI values were low during the immature stage (November), increased slightly during early vitellogenesis and late spermatogenesis (March), increased significantly (Pb 0.001) during late vitellogenesis and spermiation (April), and declined during the post-spawning season (August). In males, GSI value significantly (Pb 0.001) declined during post-spawning season.

The full-length chub mackerel sbGnRH, cGnRH-II, and sGnRH cDNAs (GenBank accession nos. HQ108193, HQ108194, and HQ108195) were 382 bp, 532 bp, and 487 bp in length, respectively, excluding the polyA tail. These cDNAs contained open reading frames of 294 bp, 255 bp, and 270 bp encoding precursor proteins of 98, 85, and 90 deduced amino acids (aa), respectively. A putative polyadenylation signal (AATAAA) was recognized 19 bp, 24 bp, and 18 bp upstream of the poly-A tail region of sbGnRH, cGnRH-II, and sGnRH cDNA sequences, respectively (see Supplementary data, Fig. 3). The alignment analysis of amino acid sequences of chub mackerel sbGnRH, cGnRH-II, and sGnRH with those of other fish species is shown in Fig. 1 (A–C). Chub mackerel sbGnRH showed high similarity with sbGnRH from grey mullet (72%) and cobia (71%). However, cGnRH-II and sGnRH showed high similarity with other fish species (>85%). Phylogenetic analysis showed that the sbGnRH, cGnRH-II, and sGnRH forms from fish clustered in three separate clades, revealing a close relationship among similar GnRH forms in different fish species (Fig. 2).

3.3. Changes in sbGnRH mRNA and peptide concentrations In females, brain sbGnRH mRNA concentrations were lower during immature stage and found significantly higher during the post-

4 b

3 ab

ab

2 a 1 0

EV

LV

PS

4

b

3 ab 2 1

ab a

0 IM

LS

SP

PS

BRAIN

IM

Relative mRNA concentrations (sbGnRH/β-actin)

D Relative mRNA concentrations (sbGnRH/β-actin)

A

E

B

b

0.075 0.050 ab 0.025 a

a

IM

EV

sbGnRH (ng/mg tissue)

0.100

a 0.100 0.075 0.050

a a

0.025 a

0.000

0.000 LV

PS

C

IM

LS

SP

PS

F sbGnRH (ng/pituitary)

70

PITUITARY

0.125

b b

60 ab

50 40 30 20

a

10

70

sbGnRH (ng/pituitary)

sbGnRH (ng/mg tissue)

0.125

60 50 40 30 20

b ab a

10

a

0

0 IM

EV

LV

Ovarian stages

PS

IM

LS

SP

PS

Testicular stages

Fig. 4. Changes in the brain sbGnRH mRNA and brain and pituitary sbGnRH peptide levels during different gonadal stages in female (A, B, and C) and male chub mackerel (D, E, and F). Values are expressed as the mean ± SEM. Different letters above the bars represent significant differences (P b 0.05) between stages. IM, immature (November); EV, early vitellogenesis (March); LV, late vitellogenesis (April); LS, late spermatogenesis (March); SP, spermiation (April); PS, post-spawning (August).

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

spawning season (Fig. 4A). Likewise, corresponding brain peptide concentrations were higher during the post-spawning season (Fig. 4B). However, pituitary peptide concentrations were lower during immature stage and found higher during late vitellogenesis (Pb 0.05), in association with an increased GSI values, and remained higher during the post-spawning season (Fig. 4C). In males, brain sbGnRH mRNA concentrations were significantly higher during the spermiation stage (P b 0.05) (Fig. 4D). However, brain peptide concentrations did not vary significantly among different testicular stages (Fig. 4E). The pituitary peptide concentration was significantly (P b 0.05) higher during the spermiation stage (Fig. 4F), in association with an increase in GSI values. The sbGnRH peptide concentration in the vitellogenic female pituitary was approximately 3-fold higher when compared to those in the spermiating male pituitary.

207

3.5. Changes in sGnRH mRNA and peptide concentrations In females, brain sGnRH mRNA concentrations did not vary significantly among ovarian stages (Fig. 6A). However, brain peptide concentrations were significantly higher during the late vitellogenesis stage (Fig. 6B). Further, peptide concentrations in the pituitary were significantly higher during the post-spawning season as compared to immature and early vitellogenesis stages (Fig. 6C). In males, brain sGnRH mRNA concentrations were significantly higher during the post-spawning season (Fig. 6D). However, brain and pituitary peptide concentrations did not show significant fluctuation (Fig. 6E–F). During all gonadal stages, sGnRH peptide concentrations in the male pituitary were higher (by approximately 10– 20-fold) as compared to female pituitary. 4. Discussion

3.4. Changes in cGnRH-II mRNA and peptide concentrations The concentrations of cGnRH-II mRNA and peptide in the brain and pituitary did not vary among ovarian (Fig. 5A–C) or testicular stages (Fig. 5D–F).

Relative mRNA concentrations (cGnRH-II/β-actin)

D 3

2

a a

a

a 1

0 IM

EV

LV

PS

3

a

2 a

a

IM

LS

a

1

0 SP

PS

BRAIN

Relative mRNA concentrations (cGnRH-II/β-actin)

A

In the immature stages of adult chub mackerel, when GSI values were low, sbGnRH peptide concentrations were also low in both females (12.71 ng/pituitary) and males (10.77 ng/pituitary). However, concentrations were significantly higher in the pituitary of late vitellogenic females (4-fold) and spermiating males (2-fold), in accordance with an

E cGnRH-II (ng/mg tissue)

0.125 a 0.100 a

a

a

0.075 0.050 0.025 0.000 IM

EV

LV

cGnRH-II (ng/pituitary)

0.100

a

a

a a

0.075 0.050 0.025 0.000 IM

PS

C PITUITARY

0.125

LS

SP

PS

F 0.0125

a

0.0100 0.0075 0.0050

a

0.0025

a a

0.0000 IM

EV

LV

Ovarian stages

PS

cGnRH-II (ng/pituitary)

cGnRH-II (ng/mg tissue)

B

0.150

a

0.125 0.100 0.075 a

0.050

a

0.025 a

0.000 IM

LS

SP

PS

Testicular stages

Fig. 5. Changes in the brain cGnRH-II mRNA and brain and pituitary cGnRH-II peptide levels during different gonadal stages in female (A, B, and C) and male chub mackerel (D, E, and F). Values are expressed as the mean ± SEM. Different letters above the bars represent significant differences (P b 0.05) between stages. IM, immature (November); EV, early vitellogenesis (March); LV, late vitellogenesis (April); LS, late spermatogenesis (March); SP, spermiation (April); PS, post-spawning (August).

208

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

8 6 4

a

a a

a 2 0 EV

LV

PS

b

8 6 4 2

ab

ab

LS

SP

a

0 IM

PS

BRAIN

IM

Relative mRNA concentrations (sGnRH-/β-actin)

D

Relative mRNA concentrations (sGnRH-/β-actin)

A

B

E ab 1.5 1.0

ab a

0.5

IM

EV

LV

a

a a

a

1.0 0.5

IM

PS

LS

SP

PS

F 18 16 14 12 10 8 6 4 2 0

a

a

ab

IM

EV

LV

b PS

Ovarian stages

sGnRH (ng/pituitary)

C sGnRH (ng/pituitary)

1.5

0.0

0.0

PITUITARY

2.0

b

sGnRH (ng/mg tissue)

sGnRH (ng/mg tissue)

2.0

18 16 14 12 10 8 6 4 2 0

a

a

a

SP

PS

a

IM

LS

Testicular stages

Fig. 6. Changes in the brain sGnRH mRNA and brain and pituitary sGnRH peptide levels during different gonadal stages in female (A, B, and C) and male chub mackerel (D, E, and F). Values are expressed as the mean ± SEM. Different letters above the bars represent significant differences (P b 0.05) between stages. IM, immature (November); EV, early vitellogenesis (March); LV, late vitellogenesis (April); LS, late spermatogenesis (March); SP, spermiation (April); PS, post-spawning (August).

increase in GSI values. In our previous study, we found that sbGnRHimmunoreactive cell bodies in the POA send axonal projections to anterior pituitary regions, where FSH and LH cells are localized (Selvaraj et al., 2009). These results indicate that sbGnRH form is involved in the seasonal gonadal development of chub mackerel. In female red seabream (Pagrus major), sbGnRH levels in the brain and pituitary increased from immature to spawning phases (Okuzawa et al., 2003; Senthilkumaran et al., 1999). Likewise, in female barfin flounder (Verasper moseri), sbGnRH mRNA level in the brain and corresponding peptide level in the pituitary increased during the early spawning stage as compared to the previtellogenic period; in males, sbGnRH peptide level in the pituitary increased from the immature stage to spermiation (Amano et al., 2004, 2008). These findings strongly suggest that higher pituitary sbGnRH peptide concentrations during late vitellogenesis and spermiation are involved in the regulation of gonadal development in chub mackerel. Further, high concentrations of sbGnRH peptides in the pituitary suggest that the peptides synthesized in the brain are immediately released and stored in the nerve endings of the sbGnRH neurons innervating pituitary, in accordance with our previous observation of dense sbGnRH-ir fibers, localized close to FSH- and LH-ir cells in the anterior pituitary (Selvaraj et al., 2009). During the post-

spawning (PS) season, sbGnRH peptide concentrations in the pituitary of female chub mackerel remained high; ovaries contained mainly atretic oocytes with degenerated late-vitellogenic oocytes. Similarly, sbGnRH concentrations were also reported to be high in the pituitary of regressing female red seabream (Senthilkumaran et al., 1999), postspawning season male turbot (Scophthalmus maximus; Andersson et al., 2001), post-spawn female and regressed male grass rockfish (Sebastes rastrelliger; Collins et al., 2001), and regressing female Japanese flounder (Paralichthys olivaceus; Pham et al., 2006b). Collins et al. (2001) suggested that the accumulation of sbGnRH at the end of the reproductive cycle reflects diminished activity of BPG axis. This hypothesis is presently supported by our recent finding on decreased mRNA expression of pituitary gonadotropin subunits in the postspawning season female chub mackerel (Nyuji et al., 2012). The concentrations of cGnRH-II mRNA and peptide in the brain and pituitary of chub mackerel did not show any fluctuations in relation to gonadal development. This result indicates that cGnRH-II may not be directly involved in the seasonal gonadal development of chub mackerel. cGnRH-II in fish is not thought to be directly involved in pituitary gonadotropin secretion, especially in fish that express three GnRH forms (Senthilkumaran et al., 1999; Amano et al.,

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

2002; Zmora et al., 2002). Based on the distribution of the cGnRH-II‐ immunoreactive neuronal system in the midbrain tegmentum, with fibers projecting into different regions of the brain, this form is suggested to play a role in neuromodulation (Okubo and Nagahama, 2008). However, a few reports have suggested that cGnRH-II may be involved in the regulation of pituitary function, e.g., in the goldfish (Carassius auratus; Yu et al., 1988), European eel, (Anguilla anguilla; Dufour et al., 1993), tilapia (Oreochromis mossambicus; Weber et al., 1997), and striped bass, (Morone saxatilis; Holland et al., 2001). Matsuda et al. (2008) showed that intracerebroventricular administration of cGnRH-II decapeptide suppresses food intake in the goldfish. Furthermore, the cGnRH-II form has recently been shown to act as a melatonin-releasing factor in the pineal gland of the European sea bass (Dicentrarchus labrax; Servili et al., 2010). These studies indicate that cGnRH-II form performs diverse roles in fish and may indirectly influence the reproductive process. We found a sexually dimorphic expression profile of sGnRH in the brain and pituitary of chub mackerel. In females, brain mRNA concentration did not show any significant fluctuation; however, corresponding peptide concentrations in the brain and pituitary were significantly elevated during late vitellogenesis and the PS season, respectively. In contrast, only brain mRNA concentrations in males showed significant elevation during the PS season, with no fluctuation in the concentrations of peptides. The physiological significance of sexual dimorphism is not clear at present, but this finding supports our previous observation of differences in the size of sGnRH-ir cells in the ventral olfactory bulb and terminal nerve ganglion regions, with male fish observed to be larger than female fish (Selvaraj et al., 2009). Because sGnRH axonal fibers project to different brain regions, similar to fibers positive for cGnRH-II in fish, sGnRH is suggested to act as a neuromodulator (Abe and Oka, 2000; Okubo and Nagahama, 2008). Nevertheless, in fish (masu salmon, Oncorhynchus masou; goldfish) expressing two GnRH forms (sGnRH and cGnRH-II), sGnRH not only functions as a neuromodulator but also regulates the secretion of pituitary gonadotropins (Amano et al., 1991, 1998; Kim et al., 1995) and other pituitary hormones (Marchant and Peter, 1989; Marchant et al., 1989; Weber et al., 1997). sGnRH was also shown to play a role in nest-building behavior in dwarf gourami (Colisa lalia; Yamamoto et al., 1997) and tilapia (Ogawa et al., 2006), the species expressing three GnRH forms. Overall, the role of sGnRH is not well established, especially in multiplespawning fishes expressing different GnRH forms (Guilgur et al., 2009). In conclusion, the present study isolated cDNAs encoding sbGnRH, cGnRH-II and sGnRH forms in the chub mackerel and quantified their mRNA and peptide concentrations in the brain and pituitary. Pituitary sbGnRH peptide concentrations were significantly higher during late vitellogenic and spermiation stages in females and males, respectively. These results including our previous immunocytochemical report (Selvaraj et al., 2009) indicate that sbGnRH form is predominantly involved in the seasonal gonadal development of chub mackerel. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.aquaculture.2012.05.015. Acknowledgments The authors are thankful to the anonymous reviewers and Dr. E.M. Donaldson for their critical comments and suggestions. We express our special thanks to Mr. Akira Tabuchi of the School of Marine Biosciences, Kitasato University, for his kind help with this study. This work was supported by a grant for scientific research (23658163) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), and through a subproject on studies on the prediction and application of fish species alternation (SUPRFISH) financed by the Agriculture, Forestry and Fisheries Research Council (AFFRC) of Japan, as part of the Population Outbreak of Marine Life (POMAL) Project. The

209

first author (S. Selvaraj) is supported by the Japan Society for the Promotion of Science (JSPS) postdoctoral fellowship (P11406) for foreign researchers.

References Abe, H., Oka, Y., 2000. Modulation of pacemaker activity by salmon gonadotropinreleasing hormone (sGnRH) in terminal nerve (TN)-GnRH neurons. Journal of Neurophysiology 83, 3196–3200. Amano, M., Oka, Y., Aida, K., Okumoto, N., Kawashima, S., Hasegawa, Y., 1991. Immunocytochemical demonstration of salmon GnRH and chicken GnRH-II in the brain of masu salmon, Oncorhynchus masou. The Journal of Comparative Neurology 314, 587–597. Amano, M., Oka, Y., Kitamura, S., Ikuta, K., Aida, K., 1998. Ontogenic development of salmon GnRH and chicken GnRH-II systems in the brain of masu salmon (Oncorhynchus masou). Cell and Tissue Research 293, 427–434. Amano, M., Oka, Y., Yamanome, T., Okuzawa, K., Yamamori, K., 2002. Three GnRH systems in the brain and pituitary of a pleuronectiform fish, the barfin flounder Verasper moseri. Cell and Tissue Research 309, 323–329. Amano, M., Pham, K.X., Amiya, N., Yamanome, T., Yamamori, K., 2008. Changes in brain seabream GnRH mRNA and pituitary seabream GnRH peptide levels during ovarian maturation in female barfin flounder. General and Comparative Endocrinology 158, 168–172. Amano, M., Yamanome, T., Yamada, H., Okuzawa, K., Yamamori, K., 2004. Effects of photoperiod on gonadotropin-releasing hormone levels in the brain and pituitary of underyearling male barfin flounder. Fisheries Science 70, 812–818. Andersson, E., Fjelldal, P.G., Klenke, U., 2001. Three forms of GnRH in the brain and pituitary of the turbot, Scophthalmus maximus: immunological characterization and seasonal variation. Comparative Biochemistry and Physiology 129, 551–558. Bustin, S., Benes, V., Garson, J., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M., Shipley, G., Vandesompele, J., Wittwer, C., 2009. The MIQE guidelines: minimal information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55, 611–622. Collette, B.B., 2003. Family Scombridae Rafinesque 1815 — mackerels, tunas and bonitos. Annotated Checklists of Fishes, No. 19. California Academy of Sciences, San Francisco. Collins, P.M., O'Neill, D.F., Barron, B.R., Moore, R.K., Sherwood, N.M., 2001. Gonadotropin-releasing hormone content in the brain and pituitary of male and female grass rockfish (Sebastes rastrelliger) in relation to seasonal changes in reproductive status. Biology of Reproduction 65, 173–179. Degan, P., Podesta, A., Montagnoli, G., 1999. Time-resolved fluoroimmunoassay. Molecular Biotechnology 13, 215–222. Dufour, S., Montero, M., Le Belle, N., Bassompierre, M., King, J.A., Millar, R.P., 1993. Differential distribution and response to experimental sexual maturation of two forms of gonadotropin-releasing hormone (GnRH) in the European eel, Anguilla anguilla. Fish Physiology and Biochemistry 11, 99–106. Fernald, R.D., White, R.B., 1999. Gonadotropin-releasing hormone genes: phylogeny, structure, and functions. Frontiers in Neuroendocrinology 20, 224–240. Guilgur, L.G., Straussmann, C.A., Somoza, G.M., 2009. mRNA expression of GnRH variants and receptors in the brain, pituitary and ovaries of pejerrey (Odontesthes bonariensis) in relation to the reproductive status. Fish Physiology and Biochemistry 35, 157–166. Hwang, S.D., Lee, T.W., 2005. Spawning dates and early growth of chub mackerel Scomber japonicus as indicated by otolith microstructure of juveniles in the inshore nursery ground. Fisheries Science 71, 1185–1187. Holland, M.C., Hassin, S., Zohar, Y., 2001. Seasonal fluctuations in pituitary levels of the three forms of gonadotropin-releasing hormone in striped bass, Morone saxatilis (Teleostei), during juvenile and pubertal development. Journal of Endocrinology 169, 527–538. Kah, O., Lethimonier, C., Somoza, G., Guilgur, L.G., Vaillant, C., Lareyre, J.J., 2007. GnRH and GnRH receptors in metazoan: a historical, comparative, and evolutive perspective. General and Comparative Endocrinology 153, 346–364. Kim, M.H., Oka, Y., Amano, M., Kobayashi, M., Okuzawa, K., Hasegawa, Y., Kawashima, S., Suzuki, Y., Aida, K., 1995. Immunocytochemical localization of sGnRH and cGnRH-II in the brain of goldfish, Carassius auratus. The Journal of Comparative Neurology 356, 72–82. Larionov, A., Krause, A., Miller, W., 2005. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics 6, 62. Lethimonier, C., Madigou, T., Munoz-Cueto, J.A., Lareyre, J.J., Kah, O., 2004. Evolutionary aspects of GnRHs, GnRH neuronal systems and GnRH receptors in teleost fish. General and Comparative Endocrinology 135, 1–16. Marchant, T.A., Chang, J.P., Nahorniak, C.S., Peter, R.E., 1989. Evidence that gonadotropin-releasing hormone also functions as a growth hormone-releasing factor in the goldfish. Endocrinology 124, 2509–2518. Marchant, T.A., Peter, R.E., 1989. Hypothalamic peptides influencing growth hormone secretion in the goldfish, Carassius auratus. Fish Physiology and Biochemistry 7, 133–139. Matsuda, K., Nakamura, K., Shimakura, S., Miura, T., Kageyama, H., Uchiyama, M., Shioda, S., Ando, H., 2008. Inhibitory effect of chicken gonadotropin-releasing hormones II on food intake in the goldfish, Carassius auratus. Hormones and Behavior 54, 83–89. Matsuyama, M., Shiraishi, T., Sundaray, J.K., Rahman, M.A., Ohta, K., Yamaguchi, A., 2005. Steroidogenesis in ovarian follicles of chub mackerel, Scomber japonicus. Zoological Science 22, 101–110.

210

S. Selvaraj et al. / Aquaculture 356–357 (2012) 200–210

Mendiola, D., Yamashita, Y., Matsuyama, M., Alvarez, P., Tanaka, M., 2008. Scomber japonicus, H. is a better candidate species for juvenile production activities than Scomber scombrus, L. Aquaculture Research 39, 1122–1127. Nagahama, Y., 1994. Endocrine regulation of gametogenesis in fish. International Journal of Developmental Biology 38, 217–229. Nelson, S.B., Eraly, S.A., Mellon, P.L., 1998. The GnRH promoter: target of transcription factors, hormones, and signaling pathways. Molecular and Cellular Endocrinology 140, 151–155. Nyuji, M., Selvaraj, S., Kitano, H., Ohga, H., Yoneda, M., Shimizu, A., Kaneko, K., Yamaguchi, A., Matsuyama, M., 2012. Changes in the expression of pituitary gonadotropin subunits during reproductive cycle of multiple spawning female chub mackerel Scomber japonicus. Fish Physiology and Biochemistry 38, 883–897. Ogawa, S., Akiyama, G., Kato, S., Soga, T., Sakuma, Y., Parhar, I.S., 2006. Immunoneutralization of gonadotropin releasing hormone type-III suppresses male reproductive behavior of cichlids. Neuroscience Letters 403, 201–205. Ohta, K., Mine, T., Yamaguchi, A., Matsuyama, M., 2008. Sexually dimorphic expression of pituitary glycoprotein hormones in a sex-changing fish (Pseudolabrus sieboldi). The Journal of Experimental Zoology 309A, 534–541. Okubo, K., Nagahama, Y., 2008. Structural and functional evolution of gonadotropinreleasing hormone in vertebrates. Acta Physiologica 193, 3–15. Okuzawa, K., Amano, M., Kobayashi, M., Aida, K., Hanyu, I., Hasegawa, Y., Miyamoto, K., 1990. Differences in salmon GnRH and chicken GnRH-II contents in discrete brain areas of male and female rainbow trout according to age and stage of maturity. General and Comparative Endocrinology 80, 116–126. Okuzawa, K., Gen, K., Bruysters, M., Bogerd, J., Gothilf, Y., Zohar, Y., Kagawa, H., 2003. Seasonal variation of the three native gonadotropin-releasing hormone messenger ribonucleic acid levels in the brain of female red seabream. General and Comparative Endocrinology 130, 324–332. Oliveira, R.F., Ros, A.F.H., Gonçalves, D.M., 2005. Intra-sexual variation in male reproduction in teleost fish: a comparative approach. Hormones and Behavior 48, 430–439. Pham, K.X., Amano, M., Amiya, N., Kurita, Y., Yamamori, K., 2006a. Distribution of three GnRHs in the brain and pituitary of the wild Japanese flounder Paralichthys olivaceus. Fisheries Science 72, 89–94. Pham, K.X., Amano, M., Amiya, N., Kurita, Y., Yamamori, K., 2006b. Changes in brain and pituitary GnRH levels during ovarian maturation in wild female Japanese flounder. Fish Physiology and Biochemistry 32, 241–248. Roch, G.J., Busby, E.R., Sherwood, N.M., 2011. Evolution of GnRH: diving deeper. General and Comparative Endocrinology 171, 1–11. Selvaraj, S., Kitano, H., Fujinaga, Y., Amano, M., Takahashi, A., Shimizu, A., Yoneda, M., Yamaguchi, A., Matsuyama, M., 2009. Immunological characterization and distribution of three GnRH forms in the brain and pituitary gland of chub mackerel (Scomber japonicus). Zoological Science 26, 828–839. Selvaraj, S., Kitano, H., Fujinaga, Y., Ohga, H., Yoneda, M., Yamaguchi, A., Shimizu, A., Matsuyama, M., 2010. Molecular characterization, tissue distribution, and mRNA expression profiles of two Kiss genes in the adult male and female chub mackerel

(Scomber japonicus) during different gonadal stages. General and Comparative Endocrinology 169, 28–38. Senthilkumaran, B., Okuzawa, K., Gen, K., Ookura, T., Kagawa, H., 1999. Distribution and seasonal variations in levels of three native GnRHs in the brain and pituitary of perciform fish. Journal of Endocrinology 11, 181–186. Servili, A., Lethimonier, C., Lareyre, J.J., López-Olmeda, J.F., Sánchez-Vázquez, F.J., Kah, O., Muñoz-Cueto, J.A., 2010. The highly conserved gonadotropin-releasing hormone-2 form acts as a melatonin-releasing factor in the pineal of a teleost fish, the European sea bass Dicentrarchus labrax. Endocrinology 151, 2265–2275. Shiraishi, T., Ohta, K., Yamaguchi, A., Yoda, M., Chuda, H., Matsuyama, M., 2005. Reproductive parameters of the chub mackerel Scomber japonicus estimated from human chorionic gonadotropin induced final oocyte maturation and ovulation in captivity. Fisheries Science 71, 531–542. Shiraishi, T., Ketkar, S.D., Kitano, H., Nyuji, M., Yamaguchi, A., Matsuyama, M., 2008a. Time course of final oocyte maturation and ovulation in chub mackerel Scomber japonicus induced by hCG and GnRHa. Fisheries Science 74, 764–769. Shiraishi, T., Okamoto, K., Yoneda, M., Sakai, T., Ohshimo, S., Onoe, S., Yamaguchi, A., Matsuyama, M., 2008b. Age validation, growth and annual reproductive cycle of chub mackerel Scomber japonicus off the waters of northern Kyushu and in the East China Sea. Fisheries Science 74, 947–954. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Weber, G.M., Powell, J.F.F., Park, M., Fischer, W.H., Craig, A.G., 1997. Evidence that gonadotropin-releasing hormone (GnRH) functions as a prolactin releasing factor in a teleost fish (Oreochromis mossambicus) and primary structure for three native GnRH molecules. Journal of Endocrinology 155, 121–132. Weltzien, F.A., Andersson, E., Andersen, Ø., Shalchian-Tabrizi, K., Norberg, B., 2004. The brain–pituitary–gonad axis in male teleosts, with special emphasis on flatfish (Pleuronectiformes). Comparative Biochemistry and Physiology 137A, 447–477. Yamada, H., Amano, M., Okuzawa, K., Chiba, H., Iwata, M., 2002. Maturational changes in brain contents of salmon GnRH in rainbow trout as measured by a newly developed time-resolved fluoroimmunoassay. General and Comparative Endocrinology 126, 136–143. Yamamoto, N., Oka, Y., Kawashima, S., 1997. Lesions of gonadotropin releasing hormone-immunoreactive terminal nerve cells: effects on the reproductive behavior of male dwarf gouramis. Neuroendocrinology 65, 403–412. Yaron, Z., Gur, G., Melamed, P., Rosenfeld, H., Elizur, A., Levavi-Sivan, B., 2003. Regulation of fish gonadotropins. International Review of Cytology 225, 131–185. Yu, K.L., Sherwood, N.M., Peter, R.E., 1988. Differential distribution of two molecular forms of gonadotropin-releasing hormone in discrete brain areas of goldfish (Carassius auratus). Peptides 9, 625–630. Zmora, N., Gonzalez-Martinez, D., Munoz-Cueto, J.A., Madigou, T., Mananos-Sanchez, E., Zanuy-Doste, S., Zohar, Y., Kah, O., Elizur, A., 2002. The GnRH system in the European sea bass (Dicentrarchus labrax). Journal of Endocrinology 172, 105–116.