Molecular characterization and hormonal regulation of tissue inhibitor of metalloproteinase 1 in goat ovarian granulosa cells

Domestic Animal Endocrinology 52 (2015) 1–10

Contents lists available at ScienceDirect

Domestic Animal Endocrinology journal homepage: www.domesticanimalendo.com

Molecular characterization and hormonal regulation of tissue inhibitor of metalloproteinase 1 in goat ovarian granulosa cells J.Y. Peng, P. Han, H.Y. Xin, S.Y. Ji, K.X. Gao, X.P. An, B.Y. Cao* College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, P.R. China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 July 2014 Received in revised form 10 January 2015 Accepted 12 January 2015

Tissue inhibitor of metalloproteinase 1 (TIMP1) belongs to a group of endogenous inhibitors that control the activity of matrix metalloproteinases and other metalloproteinases. TIMP1 is ubiquitously expressed and implicated in many physiological and pathologic processes. In this study, the full-length complementary DNA of goat (Capra hircus) Timp1 was cloned from adult goat ovary for the first time to better understand the regulatory role of TIMP1. The putative TIMP1 protein shared a high amino acid sequence identity with other species. Real-time polymerase chain reaction results showed that Timp1 was widely expressed in adult goat tissues, and messenger RNA expression was higher in the ovary than in other tissues; meanwhile, increasing expression of Timp1 was also discovered during the process of follicle growth and corpus luteum. We then investigated Timp1 expression patterns in different types of ovarian follicular cells from goats. In small or large antral follicles, Timp1 expression was higher (P < 0.05) in theca cells than in granulosa cells, cumulus cells, and oocytes. Increasing expression of Timp1 in theca and granulosa cells was observed as the variation of the follicle size. Immunohistochemical analyses further revealed the presence of the TIMP1 proteins in follicles at all antral stages of development. The most intense staining for TIMP1 was observed in the theca cells and granulosa cells of large antral follicles and corpus luteum. Timp1 was highly (P < 0.05) induced in granulosa cells in vitro after treatment with the luteinizing hormone agonist, human chorionic gonadotropin. Treatments with forskolin, phorbol 12-myristate 13acetate, or phorbol 12-myristate 13-acetate þ forskolin could also stimulate Timp1 messenger RNA expression. The effects of human chorionic gonadotropin were reduced (P < 0.05) by the inhibitors of protein kinase A, protein kinase C, MAPK kinase, or p38 kinase, indicating that Timp1 expression could be adjusted by luteinizing hormone–initiated activation of these signaling mediators. Our results suggested that TIMP1 may be involved in regulating ovarian follicle development and ovulation. Ó 2015 Elsevier Inc. All rights reserved.

Keywords: Goat Tissue inhibitor of metalloproteinase 1 Granulosa cell hCG

1. Introduction Tissue inhibitors of metalloproteinases (TIMPs) belong to endogenous protein regulators of the matrix

* Corresponding author. Tel.: þ86 29 87092120; fax: þ86 29 87092164. E-mail address: [email protected] (B.Y. Cao). 0739-7240/$ – see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.domaniend.2015.01.001

metalloproteinases and other metalloproteinases [1,2]. In mammals, 4 TIMPs (TIMP1–4) that share substantial sequence homology and structural identity at the protein level have been identified [2,3]. TIMP proteins possess a similar domain structure, which is composed of an Nterminal domain and a C-terminal domain [4]. Previous studies have shown that the members of TIMPs have key functions in various physiological processes, including

2

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

morphogenesis, reproduction, cancer, arthritis, and angiogenesis [5–10]. TIMP1 is the first member of the TIMPs family with multiple functions in numerous human and rodent cells [4,11]. It is expressed in a wide range of mammalian tissues, notably in the reproductive organs [12,13]. Earlier studies have reported that Timp1-null mice could cause reproductive cycle disorder and fertility reduction [14–16]. In the ovary, TIMP1 has been postulated to have a critical role in extracellular matrix remodeling associated with ovulation and luteal formation and regression [17,18]. The gonadotropin, luteinizing hormone (LH) is an essential regulator of ovarian endocrine function and female fertility [19]. The LH-induced preovulatory changes are mediated by inducing a complex pattern of gene expression in the granulosa cells (GCs) that is regulated by different signaling cascades such as cAMP/protein kinase A (PKA), ERK1/2, and phosphatidylinositol-3 kinase (PI3K) cascades [20]. Evidence has pointed out the key role of TIMP1 during the ovulatory process. Studies on rodents have identified a gonadotropin-dependent upregulation of TIMP1 in GCs after LH and/or human chorionic gonadotropin (hCG) stimulation [21,22]. The hCG-stimulated expression of Timp1 messenger RNA (mRNA) can be inhibited by inhibitors of PKA (H89), protein kinase C (PKC and GF109203X), and MAPK (SB2035850) pathways [22]. In a previous study, we have demonstrated that Timp1, a differentially expressed gene, was screened from ovarian tissues between polytocous and monotocous Guanzhong dairy goats by suppressive subtractive hybridization [23]. The results confirmed that the different levels of Timp1 mRNA expression in the ovarian tissues of polytocous and monotocous goats could lead to different ovulation rates, which causes a difference in litter size. To identify the role of TIMP1 in the development of GCs during folliculogenesis, in the present study, we cloned and characterized the goat Timp1 gene. The sequence of the deduced form of TIMP1 protein was analyzed, and its phylogenetic relationship was compared with TIMP1 from various species. The expression level in various tissues was analyzed by real-time polymerase chain reaction (PCR). Furthermore, we explored the expression abundance of the Timp1 gene transcript at different ovarian follicle stages and the modulatory effects of gonadotropin on the expression of Timp1 mRNA in goat ovarian GCs in vitro. The results of this study provided information on the Timp1 gene with regard to its sequence, tissue expression profile, and influence of gonadotropin on its expression.

UDG were the products of Life Technologies Inc (Carlsbad, CA, USA). 2.2. Collection of tissues and cells To evaluate the tissue-specific pattern of Timp1 expression, different tissues (uterus, spleen, kidney, heart, liver, lung, ovary, muscle, fat, mammary gland, and oviduct) were isolated from 4 adult Guanzhong dairy goats. Healthy adult Guanzhong dairy goats at the estrous cycle stage were stunned with a captive bolt and slaughtered to collect the different tissues. In 0.1% w/v diethylpyrocarbonate water, the different tissues of the goats were cut into small pieces of approximately 1 g and immediately placed in liquid nitrogen until RNA isolation. Ovaries of cyclic Guanzhong dairy goats were collected and fixed in paraformaldehyde for immunohistochemical localization of TIMP1 protein or used to collect follicles and luteal tissue to study the mRNA expression of Timp1 using real-time PCR. During the breeding season, ovaries were recovered from slaughtered cyclic adult Guanzhong dairy goats and transported to the laboratory in phosphatebuffered saline (PBS, 4 C) supplemented with penicillin (100 IU/mL) and streptomycin (50 mg/mL). The ovaries were washed 3 times in PBS, and the different cell types were recovered according to their follicular diameter. The small (1 mm–3 mm) and large (>3 mm) healthy antral follicles were isolated from 30 ovaries and dissected free from stromal tissue using 25-gauge needles as describe by Lucci et al [24]. After 3 times of brief washing with PBS, the small (60 follicles per pool; n ¼ 4 independent sample pools) and large (48 follicles per pool; n ¼ 4 independent sample pools) healthy antral follicles were cut into pieces, and then, an aseptic needle was used to release the GCs. The cumulus–oocyte complexes (COCs) and layers of theca cells (TCs) were collected under a stereomicroscope (Nikon, Tokyo, Japan). The COCs that were surrounded by at least 3 layers of cumulus cells (CCs) and with evenly granulated cytoplasm were selected. After collecting the COCs, the CCs were mechanically separated by careful and repeated pipetting until no adherent CCs could be observed under the stereomicroscope. Oocytes were denuded, and the CCs from the COCs were collected. GCs were harvested by centrifuging (800g) for 10 min and washed twice in PBS. To collect TCs, layers of TCs were washed 3 times in PBS then vortex mixed for 1 min in 1 mL of PBS, transferred to 1 mL of fresh buffer, and centrifuged for 1 min. The cell pellets were homogenized in 0.5 mL of RNAiso Plus (TaKaRa, Dalian, China) and stored at 80 C until RNA extraction.

2. Materials and methods 2.3. Isolation and culture of GCs 2.1. Reagents hCG (human chorionic gonadotropin) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Chemicals and reagents including H89, LY294002, PD98059, GF109203X, and forskolin (FSK) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Phorbol 12-myristate 13-acetate (PMA) and SB2035850 were purchased from Beyotime Biotechnology (Jiangsu, China). The DMEM/F12, FBS (fetal bovine serum), and Platinum SYBR Green qPCR SuperMix-

Goat ovaries were obtained from a local slaughterhouse, irrespective of stage of the estrous cycle, and then, placed into PBS supplemented with penicillin (100 IU/mL) and streptomycin (50 mg/mL) at 4 C. The samples were then transported to the laboratory within 2 h. The ovaries were washed 3 times with prewarmed PBS. The method of collecting and culturing GCs has been described previously [25]. Briefly, the tissue was first washed with 75% alcohol for 1 min and then washed 3 times with PBS to eliminate

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

alcohol. Small antral follicles (1 mm–3 mm) were then harvested by an aseptic needle under the stereomicroscope. After washing 3 times with DMEM/F12 medium (Gibco, Grand Island, NY, USA), the small antral follicles were cut into pieces, and then, an aseptic needle was used to release the GCs. The COCs and ovarian tissues were discarded under the stereomicroscope. GCs were harvested by centrifuging (800g) for 10 min and washing twice in DMEM/F12 medium. The GCs were counted in a hemocytometer, the viability was determined by trypan blue exclusion, and the cells were seeded in 6-well culture plates (Costar, Corning, Inc, New York, NY, USA) at a density of 2  106/well in 2 mL of DMEM/ F12 with 10% FBS, 100 IU/mL penicillin, and 50 mg/mL streptomycin. The cells were cultured at 37 C in a 5% CO2 atmosphere. After 24 h, the cells were washed twice with PBS and changed with fresh DMEM/F12 medium without serum for 12 h. The cells were then treated with specific reagents for the time interval indicated in the text. When the reagents were dissolved in dimethylsulfoxide (DMSO) and added to the culture medium, the same concentration of DMSO was added to the medium for the control cells. The final concentration of DMSO in the cultures was less than 0.05%. At the end of each culture period, cells were collected for later isolation of total RNA. 2.4. RNA isolation and reverse transcription Total RNA was extracted from 11 different tissues (uterus, spleen, kidney, heart, liver, lung, ovary, muscle, fat, mammary gland, and oviduct) and cells using RNAiso Plus (TaKaRa) following the manufacturer’s instructions. RNA concentration and purity were determined by measuring the optical density at 260 and 280 nm wavelengths using an Epoch microplate spectrophotometer (BioTek Instruments Inc, USA). The optical density260/280 ratios were >1.8 and <2.1 for all samples. The total RNAs (500 ng) from GCs were used to convert mRNAs into complementary DNAs (cDNAs) using a Prime Script RT reagent (TaKaRa) according to the manufacturer’s instructions.

3

Table 1 Sequences of oligonucleotide primers used in the present study. Gene

Sense/ antisense

Primer sequence(50 -30 )

Primers for cDNA of goat Timp1 gene Timp1 Sense CTACACCAGAGAACCCACCAT Antisense AAAGGTGGGAGTGGAAACAG Primers for real-time PCR Timp1 Sense GATACTTCCACAGGTCCCAGAA Antisense CACAACCAGCAGCATAGGTCT FSHR Sense TGTTATGTCCCTCCTTGTGCTC Antisense CGCTTGGCTATCTTGGTGTCA GDF9 Sense AAGGTTCTGTATGATGGGCACG Antisense AGAGGTGGCGTCTGTTGGAT CYP17A1 Sense TGATGATTGGACACCACCAGTTG Antisense AGAGAGAGAGGCTCGGACAGATC b-actin Sense TGACCCAGATCATGTTTGAGA Antisense CAAGGTCCAGACGCAGGAT

Size (bp) 701

162 129 143 297 186

Abbreviations: cDNA, complementary DNA; PCR, polymerase chain reaction. All primers were synthesized by Sangon Biotech Co, Ltd (Shanghai, China).

Center for Biotechnology Information website (http://www. ncbi.nlm.nih.gov). The signal peptide was predicted using SignalP 4.0 (http://www.cbs.dtu.dk/services/SignalP4.0/). A multiple-sequence alignment was performed using ClustalW (http://www.ebi.ac.uk/clustalw), and the phylogenetic tree was constructed by Mega 5.0 using the neighbor-joining method [26]. 2.7. Real-time PCR Total RNA was extracted and 500 ng was reversetranscribed as outlined previously. Real-time PCR was

2.5. Cloning of goat Timp1 Cloning of goat Timp1 was achieved through reverse transcription-PCR using the cDNA obtained from the adult goat ovary. A pair of primers (Table 1) was synthesized based on the Timp1 cDNA sequences of cattle (NM_174471), sheep (NM_001009319), and pig (NM_213857). The amplified fragments were placed on 1.5% agarose gel, and the products with the expected size were cut and purified using a TIAN gel Midi Purification kit (Tiangen Bio-tech, Beijing, China). The purified PCR products were ligated into a pMD19-T vector and transformed into DH5a (Escherichia coli) according to the manufacturer’s instruction. The full-length open reading frame cDNA was finally determined by sequencing (Invitrogen, Shanghai, China). 2.6. Sequence alignment and phylogenetic analyses The deduced amino acid sequences were compared with the sequences in the GenBank database using basic local alignment search tool program available from the National

Fig. 1. Nucleotide and deduced amino acid sequences of goat tissue inhibitor of metalloproteinase 1. The putative signal peptide was shaded in gray. The translation start codon (ATG) and stop codon (TGA) were bold-typed. Nucleotides were numbered at the right end of the lines.

4

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

Fig. 2. Multiple sequence alignment and phylogenetic tree analysis of goat tissue inhibitor of metalloproteinase 1 (TIMP1). (A) Multiple sequence alignment of TIMP1 amino acids of cattle, sheep, goat, swine, human, mouse, and rat. The conserved cysteine residues were shaded in gray. The putative signal peptide was in solid frame. The amino acid sequences were obtained from the National Center for Biotechnology Information GenBank database (accession numbers: Bos taurus, NP_776896; Ovis aries, NP_001009319; Sus scrofa, NP_999022; Homo sapiens, NP_003245; Mus musculus, NP_001037849; Rattus norvegicus, NP_446271). (B) The phylogenic tree was constructed using MEGA 5.0 program with neighbor-joining method and bootstrap resampling (1,000 replications). The numbers in this tree indicated the bootstrap value (%). Cloned goat TIMP1 was marked for easy reference.

then performed in a 25 mL reaction volume that contains 12.5 mL of Platinum SYBR Green qPCR SuperMix-UDG, 2 mL of template cDNA, and 1 mM of primers using the CFX Connect Real-Time PCR Detection System (Bio-Rad, CA, USA). The thermal cycling conditions were 95 C for 10 min, followed by 45 cycles at 94 C for 15 s, 60 C for 30 s, and 72 C for 30 s. b-actin was used for normalization. Each experiment was repeated independently at least 3 times, and the fold change in the expression of each gene was analyzed via a 2DDCt method [27].

2.8. Western blot analysis The GCs were harvested and rinsed twice with PBS and then lyzed in denaturing lysis buffer that contains protease inhibitors (RIPA; Applygen Technologies Inc, Beijing, China) for 30 min on ice and centrifuged (12,000g) for 15 min at 4 C. The protein concentration in the lysate was determined using a BCA protein assay kit (Vazyme Biotech, Nanjing, China). Exactly 30 mg of protein was separated on a 12% sodium dodecyl sulfate-polyacrylamide gel

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

5

Fig. 3. Expression of goat Timp1 messenger RNA (mRNA). The expression of Timp1 mRNA was measured in various tissues (A), intact ovary, follicles of different sizes (small [1–3 mm] and large [>3 mm] goat antral follicles) and corpus luteum (B), and GCs, TCs, CCs, and oocytes isolated from small (1–3 mm) and large (>3 mm) goat antral follicles (C) by real-time polymerase chain reaction. Levels of mRNA for Timp1 were normalized to the b-actin in each sample (mean  standard error of the mean; n ¼ 4 biological replicates). Bars with no common superscripts were significantly different (P < 0.05). CC, cumulus cells; GC, granulosa cell; Oo, oocyte; TC, theca cell.

electrophoresis gel and transferred to a PVDF membrane (Merck Millipore). The membrane was blocked using 5% nonfat dried milk in Tris-buffered saline with 0.1% Tween 20 (pH 7.6) for 1 h at room temperature and incubated with primary antibodies against TIMP1(1:200 [orb100174]; Biorbyt Ltd, Cambridge, UK) or b-actin (1:1000 [AA128]; Beyotime Biotechnology) overnight at 4 C. The blot was then incubated with a horseradish peroxidase (HRP)–conjugated secondary antibody for 1 h at room temperature. The HRP was detected by an enhanced chemiluminescence detection system (ECL kit; Pierce, Rockford, IL, USA).

buffer (3% bovine serum albumin in PBS) for 45 min at room temperature. The sections were then incubated overnight at 4 C with the primary antibody against TIMP1 (1:200, orb100174) in PBS. After washing in PBS, the sections were then incubated with a biotinylated secondary antibody for 1 h (37 C) and HRP–streptavidin for 15 min before visualization with 3,3N-diaminobenzidine tertrahydrochloride. For negative controls, the primary antibodies were replaced with nonspecific rabbit IgG. Digital images were captured using an Olympus BX53 microscope. 2.10. Statistical analysis

2.9. Immunohistochemistry Immunohistochemistry was performed according to a previously described protocol [28]. Briefly, the ovaries were fixed in 4% paraformaldehyde for 24 h before paraffin embedding, and 5-mm paraffin sections were attached to microscope slides. The paraffin sections were heated at 60 C for 1 h. Afterward, the sections were deparaffinized in xylene and rehydrated through a graded series of ethanol. For antigen retrieval, these sections were then boiled in 10 mM citrate buffer (pH 6.0) in a microwave oven at 600 W for 15 min and cooled down to room temperature. After washing in PBS, endogenous peroxidase activity was blocked by incubating the sections in 3% hydrogen peroxide for 10 min. To block nonspecific binding, the sections were incubated in a blocking

All data were presented as the mean  standard error of the mean. The results were analyzed using 1- or 2-way analysis of variance, followed by a least significant difference post hoc test, and P < 0.05 was considered statistically significant. All statistical analyses were performed in Statistical Product and Service Solutions 17.0. 3. Results 3.1. Cloning of goat Timp1 cDNA The full-length coding sequence of Timp1 was cloned from the goat ovary. The obtained Timp1 cDNA (GenBank ID: KM215210) was 701 bp that covered the complete open

6

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

Fig. 4. Immunohistochemistry showing tissue inhibitor of metalloproteinase 1 expression in different structures of goat ovaries. (A) Small antral follicle, (B) COC, granulosa and theca cells of a large antral follicle, (C) corpus luteum, and (D) negative control. Scale bars represent 50 mm. CL, corpus luteum; COC, cumulus– oocyte complex; GC, granulosa cell; TC, theca cell; Oo, oocyte.

reading frame of 624 bp, which encoded a peptide of 207 amino acid residues including the 23-residue putative signal peptide and 184-residue putative mature peptide (Fig. 1). The coding region of goat Timp1 shared 99%, 95%, 91%, 88%, 77%, and 76% identity with sheep, cattle, pig, human, rat, and mouse Timp1, respectively, whereas the deduced amino acid sequence showed 99%, 97%, 89%, 85%, 70%, and 70% similar homologs with sheep, cattle, pig, human, rat, and mouse, respectively (Fig. 2 and Supplementary Table 1). Sequence analyses indicated that TIMP1 contained an N-terminal domain, a C-terminal domain, and 12 conserved cysteine residues (Fig. 2A). Sequence similarity results were further reflected in a phylogenetic tree constructed by neighborjoining method (Fig. 2B). The phylogenetic analysis revealed that TIMP1 was clearly divided into 2 clades, the rodents and other mammals, and that the goat TIMP1 was closely related to sheep and cattle. 3.2. Tissue-specific abundance of goat Timp1 mRNA The relative expression levels of Timp1 mRNA in various tissues of goat were studied by real-time PCR. Results suggested that the abundance of Timp1 was high in ovary, low in lung, oviduct, uterus, and mammary gland, and very low or undetectable in other tissues (Fig. 3A). Based on this ovary-specific abundant expression, we further isolated follicles of different sizes (small antral follicles, 1–3 mm; large antral follicles, >3 mm) and corpus luteum and collected COCs, GCs, and TCs from small and large antral follicles for Timp1 mRNA expression analysis. As shown in Figure 3B, the amount of Timp1 transcripts was higher in

corpus luteum than that in the whole ovary, small antral follicles and large antral follicles. As shown in Figure 3C, the expression of Timp1 mRNA was detected in GCs, TCs, CCs, and oocytes. No product was detected in the negative controls (data not shown). In small antral follicles, the level of Timp1 mRNA expression was higher (P < 0.05) in TCs than in the GCs, CCs, and oocytes. In large antral follicles, the level of Timp1 mRNA expression was also higher (P < 0.05) in TCs than in the GCs, CCs, and oocytes. A comparison of TCs and GCs from large and small antral follicles showed that the Timp1 mRNA expression level was higher (P < 0.05) in TCs and GCs from large antral follicles than in those from small antral follicles (Fig. 3C). No difference (P > 0.05) in Timp1 mRNA levels was observed in CCs and oocytes from large vs small antral follicles. The purity of different cell types was confirmed using different cell markers: GDF9 for oocytes, FSH receptor for GCs, and cytochrome P450 17A1 (CYP17A1) for TCs (Supplementary Fig. 1) 3.3. Immunohistochemistry We further localized TIMP1 protein in goat ovary by immunohistochemistry. The results demonstrated that TIMP1 protein was present in the TCs, CCs, and GCs of the small (Fig. 4A) and large antral follicles (Fig. 4B). In addition, TIMP1 protein was also found in the oocytes at all antral follicles (Fig. 4A, B). In antral stages, the GCs and TCs had a moderate-to-strong reaction to TIMP1. Apart from follicles, strong immunoreaction to TIMP1 was observed in corpus luteum (Fig. 4C). For all antibodies tested, control

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

Fig. 5. Hormonal regulation of tissue inhibitor of metalloproteinase 1 (TIMP1) expression in cultured granulosa cells. The expression of Timp1 messenger RNA (mRNA) (A) and TIMP1 protein (B) in granulosa cells from goat ovaries cultured in medium alone (control) or with hCG (1 IU/mL) for 0, 2, 4, 8, 12, 16, or 24 h. Relative levels of Timp1 mRNA and TIMP1 protein were normalized to the b-actin in each sample (mean  standard error of the mean; n ¼ 3 independent culture experiments). Bars with no common superscripts were significantly different (P < 0.05). hCG, human chorionic gonadotropin.

reactions (Fig. 4D) confirmed the absence of nonspecific staining. 3.4. Effects of hCG on the expression of Timp1 mRNA in goat GCs A study has demonstrated that Timp1 mRNA expression is induced in rat GCs after hCG (1 U/mL) treatment using Northern blot analyses [22]. In our present study, to determine whether the induction of Timp1 in rat GCs can be mimicked in goat GCs by hCG treatment, GCs were isolated from goat ovaries and cultured in the absence or the presence of a luteinizing dose of hCG (1 IU/mL). The results showed that hCG induced a similar pattern of Timp1 mRNA expression in cultured goat GCs (Fig. 5A)

7

Fig. 6. Regulation of Timp1 messenger RNA (mRNA) expression by agonists or inhibitors of various intracellular signaling modulators in granulosa cells in vitro. (A) Real-time polymerase chain reaction (PCR) analysis showed the expression of Timp1 in granulosa cells from goat ovaries cultured in medium alone (control) or with hCG (1 IU/mL), forskolin (FSK, 10 mM), PMA (100 nM) for 4 h. Relative levels of Timp1 mRNA were normalized to the b-actin mRNA in each sample (mean  standard error of the mean [SEM]; n ¼ 3 independent culture experiments). (B) Granulosa cells were cultured with medium alone (Ctrl), inhibitors of various signaling molecules (an inhibitor of protein kinase A [H89, 10 mM], MEK [PD98059 {PD}, 20 mM], p38 kinase [SB2035850 {SB}, 20 mM], PI3 kinase [LY294002 {LY}, 25 mM], and PKC [GF109203X {GF}, 1 mM]), hCG, or hCG þ inhibitors of various signaling molecules for 4 h. Levels of Timp1 mRNA were measured by real-time PCR. Relative levels of Timp1 mRNA were normalized to the b-actin mRNA in each sample (mean  SEM; n ¼ 4 independent culture experiments). Bars with no common superscripts were significantly different (P < 0.05). DMSO, dimethylsulfoxide; hCG, human chorionic gonadotropin; PMA, phorbol 12myristate 13-acetate.

compared with its expression in cultured rat GCs. Thus, hCG treatment induced a dramatic, transient increase in the levels of Timp1 mRNA. The expression reached the highest level at 4 h of culture and then expression declined to basal levels by 16 h (Fig. 5A). Western blot analysis showed that TIMP1 protein levels increased after 8 h of hCG treatment, further increased after 16 h, and then began to decline at 24 h after culture (Fig. 5B), thereby indicating the time delay (z4 h) in TIMP1 protein accumulation compared with the profile of Timp1 mRNA expression.

8

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

3.5. Intracellular signaling mechanism of Timp1 mRNA induction in vitro Timp1 expression was dramatically increased by hCG stimulation, which suggested that Timp1 may have an important function in goat GCs. Thus, we further investigated the regulation mechanism of Timp1 in response to hCG stimulation. The PKA and PKC signaling pathways are known to be activated by hCG in preovulatory GCs [20]. In this study, we cultured GCs from goat ovaries with hCG, FSK, which is an activator of adenylate cyclase, and PMA to mimic the activation of PKA and PKC signaling. The GCs from goat ovaries were cultured for 4 h, at which time point Timp1 mRNA expression reached the highest level in goat GCs in vitro. The treatment of FSK, PMA, or FSK þ PMA could increase the Timp1 mRNA expression in goat GC cultures (Fig. 6A). To further determine the signaling mediators involved in LH-induced Timp1 expression, GCs were cultured with and without hCG (1 IU/mL) in the presence of 1 h pretreatment with 0.1% DMSO, PKA inhibitor (H89, 10 mM), PKC inhibitor (GF109203X [GF], 1 mM), PI3K inhibitor (LY294002 [LY], 25 mM), p38 MAPK inhibitor (SB2035850 [SB], 20 mM), or MAPK kinase (MEK) inhibitor (PD98059 [PD], 20 mM) for 4 h. The stimulatory effect of hCG on Timp1 mRNA was reduced by the treatment with specific inhibitors of PKA, PKC, MAPK kinase, and p38 kinase but not by the inhibitor of PI3K (P < 0.05, Fig. 6B). 4. Discussion A number of studies on rodents has established that TIMP1 played a role in follicular development, ovulation, and luteal development [17,18], and the generation of Timp1-null mice could cause reproductive cycle disorder and fertility reduction [14–16]. By contrast, much less is known about the role and molecular regulation of Timp1 in the ovarian follicles of goat. In this study, we isolated cDNA clones encoding the Timp1 molecule of the goat. The nucleotide sequence was determined, and the amino acid sequences were deduced. The predicted structure of the goat TIMP1 contained 2 domains: an N-terminal domain (including 6 conserved cysteine residues) and a C-terminal domain (also contains 6 conserved cysteine residues), which characterize the TIMPs family [4]. Based on the comparison of the precursor sequences of different species, the amino acid sequence of TIMP1 was highly conserved in various mammals. Earlier studies have demonstrated that TIMP1 is widely expressed in many mammalian tissues, notably in the reproductive organs [12,13,29]. TIMP1 has been shown to be present in the ovaries of cow, hamster, human, mouse, rat, and sheep [17,21,30–36]. We presented quantitative data on Timp1 expression in a variety of goat tissues using real-time PCR. The results demonstrated that Timp1 expression was greater in reproductive organs such as the ovary, oviduct, and uterus, and these results were in accordance with the previous study [12,13,29]. The special distribution of TIMP1 suggested the important roles of this protein in the goat ovary. Then, we further confirmed the expression of Timp1 mRNA in follicles of different sizes and corpus luteum. Real-time PCR data revealed that the

expression of Timp1 mRNA had a significant increase in its expression levels with increasing follicular size and higher level in corpus luteum. Similar finding has been reported that the expression of Timp1 mRNA in the GCs of bovine antral follicles were significantly higher in large follicles than that in small follicles [37]. Therefore, we guess that the increasing expression of Timp1 during the process of follicle growth may be crucial for ovarian follicle development and ovulation. We also confirmed the expression patterns of Timp1 in different types of ovarian follicular cells from goats. Real-time PCR data revealed that the expression level of Timp1 in the TCs of antral follicles was significantly higher than other cells, with a significant improvement in its expression level with increasing follicular size. In addition, we demonstrated the expression of TIMP1 protein in the oocytes, TCs, CCs, and GCs of goat antral follicles and corpus luteum using immunohistochemistry. The expression pattern of TIMP1 in the antral follicles was similar to that described for sheep but not for rodents, bovine, and human. The TIMP1 expression in sheep follicles was localized in the oocytes of follicles [31], whereas Timp1 mRNA or TIMP1 protein was not found in the oocytes of rodents [17,21], bovine [38], and human [32,39]. Previous studies revealed that Timp1 mRNA expression was increased after LH stimulus in rats [22,30], mice [21], and sheep [40], and TIMP1 protein was localized to GCs and luteal tissue after an LH stimulus in sheep follicles [31]. In agreement with these observations, our results showed that the levels of Timp1 mRNA and protein were highly induced in goat GCs by hCG. The upregulation of Timp1 after hCG treatment confirmed the hypothesis that TIMP1 may be involved in the process of GC luteinization. Therefore, we further investigated the regulatory mechanisms by which LH/hCG induced Timp1 expression in goat GCs. A study showed that LH/hCG could activate both PKA and PKC signaling pathways in preovulatory GCs [20]. In the present study, our results showed that the Timp1 mRNA expression in cultured goat GCs was dependent on the LH-induced activation of PKA and PKC signaling pathways. Studies have indicated that multiple additional signaling cascades were activated by the gonadotropins, including the cAMP-dependent, PKA-independent activation of PI3K [41], receptor tyrosine kinase [42], and the phosphorylation of p38 kinase by a PKA- and PKCindependent pathway [43]. We found that hCG worked on PKA, PKC, MAPK kinase, and p38 kinase but not on PI3K, which were the dominant signaling mediators in inducing Timp1 expression. However, this finding was in conflict with the results Li et al reported that LH could regulate Timp1 expression through PKA, PKC, and MAPK kinase in cultured ovarian GCs of rat [22]. The discrepancies in the reported actions may have resulted from species differences or more likely from the differences in the stage of follicle development used for investigation. In the present study, the full-length cDNA of goat Timp1 was cloned, and it was detected to be widely expressed in adult goat tissues, especially in the reproductive organs. The mRNA and protein of TIMP1 were expressed in goat ovarian follicles at the antral stages of their development. In addition, Timp1 was highly expressed in goat GCs in vitro after hCG administration. Our data indicated that the

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

induction of Timp1 mRNA expression in cultured goat GCs was mediated by the LH-induced activation of various intracellular signaling molecules, including PKA, PKC, MAPK kinase, and p38 kinase, which suggested the involvement of multiple signaling pathways for Timp1 expression in goat GCs. Further studies would be needed to identify the mechanism of TIMP1 that functions in promoting GC survival and thus provide new insights into the periovulatory survival programming necessary for successful ovulation and luteal formation.

[17]

[18]

[19]

[20]

Acknowledgments [21]

This work was supported by the National Support Program of China (2011BAD28B05-3), the Science and Technology Innovation Project of Shaanxi Province (2011KTCL02-09), and the National Spark Plan (2013GA850003). The authors have nothing to disclose.

[22]

[23]

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.domaniend.2015.01.001. References [1] Brew K, Nagase H. The tissue inhibitors of metalloproteinases (TIMPs): an ancient family with structural and functional diversity. Biochim Biophys Acta 2010;1803:55–71. [2] Murphy G. Tissue inhibitors of metalloproteinases. Genome Biol 2011;12:233. [3] Greene J, Wang M, Liu YE, Raymond LA, Rosen C, Shi YE. Molecular cloning and characterization of human tissue inhibitor of metalloproteinase 4. J Biol Chem 1996;271:30375–80. [4] Stetler-Stevenson WG. Tissue inhibitors of metalloproteinases in cell signaling: metalloproteinase-independent biological activities. Sci Signal 2008;1:re6. [5] Goldman S, Shalev E. MMPs and TIMPs in ovarian physiology and pathophysiology. Front Biosci 2004;9:2474–83. [6] Stetler-Stevenson WG, Seo DW. TIMP-2: an endogenous inhibitor of angiogenesis. Trends Mol Med 2005;11:97–103. [7] Catania JM, Chen G, Parrish AR. Role of matrix metalloproteinases in renal pathophysiologies. Am J Physiol Ren Physiol 2007;292:F905–911. [8] Kang KH, Park SY, Rho SB, Lee JH. Tissue inhibitor of metalloproteinases-3 interacts with angiotensin II type 2 receptor and additively inhibits angiogenesis. Cardiovasc Res 2008;79:150–60. [9] Fiedorczyk M, Klimiuk PA, Sierakowski S, Kita K. Matrix metalloproteinases and tissue inhibitors of metalloproteinases in the pathogenesis of rheumatoid arthritis. Pol Merkur Lekarski 2006;20:228–31. [10] Qi JH, Ebrahem Q, Ali M, Cutler A, Bell B, Prayson N, Sears J, Knauper V, Murphy G, Anand-Apte B. Tissue inhibitor of metalloproteinases-3 peptides inhibit angiogenesis and choroidal neovascularization in mice. PLoS One 2013;8:e55667. [11] Docherty AJ, Lyons A, Smith BJ, Wright EM, Stephens PE, Harris TJ, Murphy G, Reynolds JJ. Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid-potentiating activity. Nature 1985;318:66–9. [12] Nomura S, Hogan BL, Wills AJ, Heath JK, Edwards DR. Developmental expression of tissue inhibitor of metalloproteinase (TIMP) RNA. Development 1989;105:575–83. [13] Flenniken AM, Williams BR. Developmental expression of the endogenous TIMP gene and a TIMP-lacZ fusion gene in transgenic mice. Genes Dev 1990;4:1094–106. [14] Nothnick WB. Reduction in reproductive lifespan of tissue inhibitor of metalloproteinase 1 (TIMP-1)-deficient female mice. Reproduction 2001;122:923–7. [15] Nothnick WB. Tissue inhibitor of metalloproteinase-1 (TIMP-1) deficient mice display reduced serum progesterone levels during corpus luteum development. Endocrinology 2003;144:5–8. [16] Nothnick WB, Soloway P, Curry Jr TE. Assessment of the role of tissue inhibitor of metalloproteinase-1 (TIMP-1) during the

[24]

[25]

[26]

[27] [28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

9

periovulatory period in female mice lacking a functional TIMP-1 gene. Biol Reprod 1997;56:1181–8. Curry Jr TE, Song L, Wheeler SE. Cellular localization of gelatinases and tissue inhibitors of metalloproteinases during follicular growth, ovulation, and early luteal formation in the rat. Biol Reprod 2001; 65:855–65. McIntush EW, Smith MF. Matrix metalloproteinases and tissue inhibitors of metalloproteinases in ovarian function. Rev Reprod 1998;3:23–30. Richards JS, Russell DL, Ochsner S, Hsieh M, Doyle KH, Falender AE, Lo YK, Sharma SC. Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Prog Horm Res 2002;57:195–220. Jo M, Curry Jr TE. Luteinizing hormone-induced runx1 regulates the expression of genes in granulosa cells of rat periovulatory follicles. Mol Endocrinol 2006;20:2156–72. Hagglund AC, Ny A, Leonardsson G, Ny T. Regulation and localization of matrix metalloproteinases and tissue inhibitors of metalloproteinases in the mouse ovary during gonadotropin-induced ovulation. Endocrinology 1999;140:4351–8. Li F, Curry Jr TE. Regulation and function of tissue inhibitor of metalloproteinase (TIMP) 1 and TIMP3 in periovulatory rat granulosa cells. Endocrinology 2009;150:3903–12. An XP, Hou JX, Li G, Peng JY, Liu XQ, Liu HY, Xiao WP, Wang JG, Song YX, Cao BY. Analysis of differentially expressed genes in ovaries of polytocous versus monotocous dairy goats using suppressive subtractive hybridization. Reprod Domest Anim 2012;47:498–503. Lucci CM, Amorim CA, Bao SN, Figueiredo JR, Rodrigues AP, Silva JR, Goncalves PB. Effect of the interval of serial sections of ovarian tissue in the tissue chopper on the number of isolated caprine preantral follicles. Anim Reprod Sci 1999;56:39–49. Orisaka M, Tajima K, Mizutani T, Miyamoto K, Tsang BK, Fukuda S, Yoshida Y, Kotsuji F. Granulosa cells promote differentiation of cortical stromal cells into theca cells in the bovine ovary. Biol Reprod 2006;75:734–40. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731–9. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3:1101–8. Yang X, Wang Q, Gao Z, Zhou Z, Peng S, Chang WL, Lin HY, Zhang W, Wang H. Proprotein convertase furin regulates apoptosis and proliferation of granulosa cells in the rat ovary. PLoS One 2013;8:e50479. Leco KJ, Apte SS, Taniguchi GT, Hawkes SP, Khokha R, Schultz GA, Edwards DR. Murine tissue inhibitor of metalloproteinases-4 (Timp4): cDNA isolation and expression in adult mouse tissues. FEBS Lett 1997;401:213–7. Kennedy JL, Muse KN, Keeble SC, Curry TE. Hormonal regulation of tissue inhibitors of metalloproteinases during follicular development in the rat ovary. Endocrine 1996;5:299–305. Dhar A, Salamonsen LA, Doughton BW, Brown RW, Findlay JK. Effect of immunization against the amino-terminal peptide (alpha N) of the alpha 43-subunit of inhibin on follicular atresia and expression of tissue inhibitor of matrix metalloproteinase (TIMP-1) in ovarian follicles of sheep. J Reprod Fertil 1998;114:147–55. Robinson LL, Sznajder NA, Riley SC, Anderson RA. Matrix metalloproteinases and tissue inhibitors of metalloproteinases in human fetal testis and ovary. Mol Hum Reprod 2001;7:641–8. Zhang B, Moses MA, Tsang PC. Temporal and spatial expression of tissue inhibitors of metalloproteinases 1 and 2 (Timp-1 and -2) in the bovine corpus luteum. Reprod Biol Endocrinol 2003;1:85. Fedorcsak P, Polec A, Raki M, Holm R, Jebsen P, Abyholm T. Differential release of matrix metalloproteinases and tissue inhibitors of metalloproteinases by human granulosa-lutein cells and ovarian leukocytes. Endocrinology 2010;151:1290–8. Malik N, Evans B, Greenfield BW, Shapiro RA, Hanson M, Shoyab M. Autocrine/paracrine induction of tissue inhibitor of metalloproteinase-1 in chinese hamster ovary cells by oncostatin m. Matrix Biol 1995;14:677–80. Curry Jr TE, Wheeler SE. Cellular localization of tissue inhibitors of metalloproteinases in the rat ovary throughout pseudopregnancy. Biol Reprod 2002;67:1943–51. Hatzirodos N, Irving-Rodgers HF, Hummitzsch K, Harland ML, Morris SE, Rodgers RJ. Transcriptome profiling of granulosa cells of bovine ovarian follicles during growth from small to large antral sizes. BMC Genomics 2014;15:24. Satoh T, Kobayashi K, Yamashita S, Kikuchi M, Sendai Y, Hoshi H. Tissue inhibitor of metalloproteinases (TIMP-1) produced by

10

J.Y. Peng et al. / Domestic Animal Endocrinology 52 (2015) 1–10

granulosa and oviduct cells enhances in vitro development of bovine embryo. Biol Reprod 1994;50:835–44. [39] Lind AK, Dahm-Kahler P, Weijdegard B, Sundfeldt And K, Brannstrom M. Gelatinases and their tissue inhibitors during human ovulation: increased expression of tissue inhibitor of matrix metalloproteinase-1. Mol Hum Reprod 2006;12:725–36. [40] Smith G, Goetz T, Anthony R, Smith M. Molecular cloning of an ovine ovarian tissue inhibitor of metalloproteinases: ontogeny of messenger ribonucleic acid expression and in situ localization within preovulatory follicles and luteal tissue. Endocrinology 1994; 134:344–52. [41] Carvalho CR, Carvalheira JB, Lima MH, Zimmerman SF, Caperuto LC, Amanso A, Gasparetti AL, Meneghetti V, Zimmerman LF,

Velloso LA. Novel signal transduction pathway for luteinizing hormone and its interaction with insulin: activation of janus kinase/signal transducer and activator of transcription and phosphoinositol 3-kinase/AKT pathways. Endocrinology 2003;144: 638–47. [42] Hsieh M, Lee D, Panigone S, Horner K, Chen R, Theologis A, Lee DC, Threadgill DW, Conti M. Luteinizing hormone-dependent activation of the epidermal growth factor network is essential for ovulation. Mol Cell Biol 2007;27:1914–24. [43] Salvador LM, Maizels E, Hales DB, Miyamoto E, Yamamoto H, Hunzicker-Dunn M. Acute signaling by the LH receptor is independent of protein kinase c activation. Endocrinology 2002;143: 2986–94.