- Email: [email protected]
Molecular characterization of a Drosophila melanogaster variant strain defective in the Sgs-4 gene dosage compensation
314
Bioch imica et Biophysica Act a, 1130 (1992) 314-316 © 1992 Elsevier Science Publishers B.V. All rights reserved 0 i 67-4781/92/$05.00
BBAEXP 9 ~
Molecular characterization of a Drosophila melanogaster variant straindefective in the Sgs-4 gene dosage compensation M a r i a F u r i a a,b, F i l o m e n a A. Digilio b, D o r a A r t i a c o a n d L i n g C, Polito a,b
b Guido
Favia b
"Dipartimento di Genetiea, Biologia Generale e Mol¢¢'olare, Universitc',di Napoli, Nalndi fftalv) and b Istituto di Biochbniea delle Proteine ed Enz#nologia, CNR, Napoli ( haly ) (Received 16 September 1991)
Key words: Glue protein: Dosage compensation: Gone: Nucleotide sequence: (Drosophik~)
The X-linked Sgs.4 gone of Drosophilamelanogaswrencodes a salivary glue protein. Here we report the molecular characterization of a non.dosage compensated variant strain, named Karsnas, in which males accumulate only about half of the Sgs-4 polypeptidc amount as do females. The results obtained show that significant nucleotide sequence alterations arc accumulated within the Sgs-4 coding and 3' untranslated region of the variant strain, thus suggesting a possible role of these sequences in the Sgs.4 dosage compensation.
Dosage compensation is the mechanism thP.t ensures the equalization of the X-linked gene products in both sexes. In Drosophila this goal is achieved by hypertranscription of X-linked genes in males [1]. Several lines of evidence indicate that dosage compensation of each Drosophila X-linked gene is autonomously regulated [2]. In fact, several mutations altering dosage compensation of individual genes have been described [3,4]. This paper is focused on the molecular characterization of a variant strain, named Karsnas, deficient in the dosage compensation of the X-linked gene Sgs.4. In this strain the males accumulate about half the amount of Sgs-4 protein with respect to females [5]. This is due to a lack of Sgs-4 gene hypertranscription in males [6]. Since previous works failed to detect for the Karsnas strain any significant nucleotide sequence deviation within the 840 bp Sgs-4 upstream regulatory region [6,7], we decided to extend the sequence analysis of this mutant to the Sgs.4 coding and 3' untranslated region. Fig. I shows the sequence of the entire Sgs.4 transcribed region from the Karsnas strain, aligned
The sequence data in this paper have been submitted to the
EMBL/GeneBank Data Libraries under the accession numbers X61944 for the Oregon R strain, X61942 for ~he Samarkand strain and X61943 for the Karsnas strain. Correspondence: M. Furia, Dipartimento di Genetica, Biologia Generale e Molecolare, via Mezzocanuone 8, 80134, Napoli, Italy,
under those of the wild-type Oregon R (top line) and Samarkand, another variant strain defective in Sgs-4 dosage compensation (middle line). Sequence comparison has revealed several differences between Karsnas and Oregon R in the first 240 bp of the Sgs.4 codh'lg region; most of these substitutions are also present in Samarkand. However, it seems unlikely that these alterations could be relevant to the dosage compensation deficiency, since they have been identically described in at least two wild-type strains [8] where Sgs.4 gene compensation is normally achieved. In addition to those above discussed, Karsnas sequence accumulated specific significant rearrangements involving both Sgs-4 coding and 3' untranslated regions. In fact, the Karsnas sequence is highly divergent at the 3' end of Sgs.4 coding region, showing a 199 bp segment (from nucleotide 792 to nucleotide 990) with no significative homology with both Oregon R and Samarkand sequences. This 199 bp segment contains a UAA stop codon leading to the synthesis of a Sgs-4 polypeptide 33 amino acids shorter than that encoded by the Oregon R strain. Although it is well known that size differences among Sgs-4 polypeptides from different strains are frequent, the length polymorphisms so far described are always due to variation in the number of the seven amino acid repeat present in the so-called Sgs-4 expandable region [8]. This is not the case of the Karsnas strain, in which the above described 199 bp segment follows the expandable region (see Fig. 1). Furthermore, the Karsnas strain presents a 124 bp
315
deletion within the Sgs.4 3' untranslated region, whose right breakpoint is only 26 bp before the position of the polyadenylation signal. The finding that both the Sgs-4 coding and 3' untranslated regions are strongly alterated in this dosage compensation deficient stcain sug-
gests that these regions could play a role in the Sgs-4 dosage-compensated expression. It is interesting to note that molecular analysis of Samarkand has recently suggested that alterations responsable for the dosage compensation deficiency
OREGON R
KARSNA8
OR S K
TT~CAAAGTCAAGATG~G~T~G~AGTTGTTGGTTGTGTTAT~GGTC~G~CTGG~TGCAC~GCCC~GTCAGGTTCTACA~GCTGTAA~ACTGAACCACCGA~ATGCGAAA~CGAAC~ACC 120 ........................... a ............................................................................................ 120 ........................... a............................................................................................ ;20
OR S K
GAGATGCC~tA~CCr9~A~CA~AAGATGCGAAACC~AAc~GCCAAGATG~G~AAC~GAACCA~AAGATGCGAAA~CA~A~CC~TGC~CCACGC~CCC~TGCA~C~GA .................. g .................... a ............... ac . . . . . . c , a . . . . . . . . . . gcgc . . . . . . c . . . . a g . , . t g a . . . . . . . . . . . . . . . . . . . . . .................. g.................... a. . . . . . . . . . . . . . . ac9 . . . . . c - c . . . . a . . . . tga9c . . . . . . c . . . . a . . . . tea . . . . . . . . . . . . . . . . . . . . .
OR S K
GCCACCCACATGCAkAACTGA6CCACCAACATGCA~iV~TGAGCCACC~AcATGCA/L`kACTAAGCCA~CCACATGCA~k~`CTGAGCCACCCA~ATGCAGAAC~GAGCCACCCACATGcAA 360 ....................................................................................................................... 360 ........................... c................................. 9. . . . . . . . . . . . . . . . . . . . . . . . . . . . "< .................. -> . . . . . . . . 528
OR S K
AA~TAAGCr~J`~CA~.TGCM`AACTGAGCCAC~CA~A~.G~AAAA~TGAGCCACCAACATGCAGAACTGAGCCACCCACATGCAAAACTr~AGCCACCAACATG~A~`d~ACTGAGCCACCCAC 480 ................................................................................................... 459 .... 9............... g................................. c ......................................... c ....................... 646
OR
ATGCP~CTGAGCCACCCACATGCAAAACTGAGCCACCCACATGC A.ec~CTGAGCCAccCTGTGA~AGCAcTGcAcGAAACGCATcAAGCGACACCGcAcAAAA~GAAcCAAGcGATc
2~0 240 240
.......................................................................................................................
~EO 579
.........................................................................................................................
768
GAAMCCA~CAAAMGATAGT~CAT~ATCAT~A~cGT~A~GACA~CAGAAT~5GGAT~TGGCTGTGGA~CGAAAAACGAATCGGGCGGTGGAGGAAGC~GTAT~T~ ........................................................................................................................ ....................... t~atc~tacccac~ta~at99acaca~cctaa~c~a99ttcttgttttcaaatt~ttcc9gact9a9~cc~ccacaccaactgt~cc9c~9cca~ i ooleeo
720 699 888
OR S
CCTGCTAACAG~AAGTGCCCCGATTCCAAACCCJ~AGCCIC .........................................
779 158
g
c~a~t~taatcac#tt~gatatuttaaacacc9ttgccc~attatttccc~ct9at~aa~t~ttctccat~atacattccactttca~cgaatgaaa~
OR S K
AGTCCGACCCCdlAACCGA~iGCCGCATCGkAAACCACATCTAAGCCAAAGCCAMr~CG TGTGATTCAGGCAAGAAGAACACCACCAAGAAACCGCG~CTCAGC~C~TG ........................................................................................................................ . . . . . . -~xxX~XXXX~X~XXXxXX~XX~X~XX~X~XXxx~xxXX~XX~XxXX~MXXXXXXXXEXXXX~X~XXXXM~XXXXEX~X~XX~XXXXXXXX~XX~XXXXKXXXX
OR S
GTT~CTA/~CAGCA~CTTGGCT~AAATGT~G1-rGAATATGAATAAAATCACTTTTTTT~TAATATTATATTAT~GAATATATTATTATTGATTTCGCTAr~AATGGAATATGTCACT1019 ........................................................................................................................ 998
K
xxxxxxxxxxxxxxx . . . . . . . . . . . . . . . . . . .
OR S
K
t .....................................................................................
AAGCTTCACCCAAGTGTA . ................. . . . . . . . . . . . . . . . . . .
100B 899 B76 1019
1124
Fig. I. Nucleotide sequence of the Sgs-4 transcribed region from the wild-type Oregon R-Heidelberg (top line) and two strains defective in Sgs-4 dosage compensation, Samarkand (middle line) and Karsnas (bottom line). The Sgs-4 coding region slarts at the ATG initiation codan (marked by the crosses), in the same position for the three strains but ends at a UAA slap codon (marked by the arrow in the Oregon R and Samarkand sequences) present ~t a different position (marked by the black triangle) within the Karsnas sequence. The segment comprised between parenthesis, from i~osition331 to position 352, is perfectly repeated 8-fold within the Karsnas sequence although only one copy is reported in the figure, to make the alignemeat with Oregon R and Samarkand sequences easier; the segment is internal Io the Sg.~'-4 expandable region. Black spots mark the position of the Sgs-4 internal Hindll] site. The extent of the 124 nt deletion presents within Karsnas sequence is also indicated (xxxx). The position of the AATAAA polyadenilation consensus sequence is underlined. On the top. diagramatie representation of the Sg.~.4 transcription unit of the wild-type Oregon R and the non compensated Karsnas strain. The spotted pattern represents the extent of the expandable region; the crossed pattern represents the 199 bp segment in which Karsnas sequence diverges from that of Oregon R and Samarkand. H: position of the HindII] site" the open arrows mark the position of the stop codons.
316 shown by this strain map within the first 840 bp of the
Sgs-4 upstream region [9]. The fact that no significant alteration has been found within this region for the Karsnas strain and that the Samarkand sequence conforms to that of the Oregon R in the Sgs-4 coding and 3' untranslated regions (Fig. 1) suggests that different c/s-acting elements involved in the Sgs-4 dosage-compensated expression are altered in these two variant strains. H e analysis of Karsnas sequence, in fact, suggests that dosage compensation regulatory element(s) reside also within the Sgs-4 transcribed region. It is interesting to note that dosage compensation of another Drosophila gene, i.e., the per gene, has been shown to depend by regulatory element(s) located within the transcription unit [2]. This work was supported by a grant of the CNR Target Project on Biotechnology and Bioinstrumenta-
tion to M.F. and a grant of the CNR Genetic Engineering Project to L.C.P.
References 1 2 3 4 5 6
Lucchesi, J.C. and Manning, J.E. (1987) Adv. Genet. 24, 371-429. Lucchesi, J.C, ,q989) Am. Nat. 134, 474-485. Smith, P,D. ar~ALucchesi, J.C. (1969) Genetics 61,607-618. Korge, (3. (1975) Chromosoma 72, 4550-4554. Kmge, {3. (1981) Chromosoma 84, 373-390. Kaiser, K., Furia, M. and GIover, D.M. (1986) J. Mol. Biol. 187, 529 536. 7 Hofmann, A. and Korge (3. (1987) Chromosoma 96, 1-7. 8 Muskavitch, M.A.T. and Hogness, D.S. (1982) Cell 29. 1041-1051. 9 Korge, (3., Heide, 1., Sehnert, M. and Hofmann, A. (1990) Dev. Biol. 138, 324-337.
Bioch imica et Biophysica Act a, 1130 (1992) 314-316 © 1992 Elsevier Science Publishers B.V. All rights reserved 0 i 67-4781/92/$05.00
BBAEXP 9 ~
Molecular characterization of a Drosophila melanogaster variant straindefective in the Sgs-4 gene dosage compensation M a r i a F u r i a a,b, F i l o m e n a A. Digilio b, D o r a A r t i a c o a n d L i n g C, Polito a,b
b Guido
Favia b
"Dipartimento di Genetiea, Biologia Generale e Mol¢¢'olare, Universitc',di Napoli, Nalndi fftalv) and b Istituto di Biochbniea delle Proteine ed Enz#nologia, CNR, Napoli ( haly ) (Received 16 September 1991)
Key words: Glue protein: Dosage compensation: Gone: Nucleotide sequence: (Drosophik~)
The X-linked Sgs.4 gone of Drosophilamelanogaswrencodes a salivary glue protein. Here we report the molecular characterization of a non.dosage compensated variant strain, named Karsnas, in which males accumulate only about half of the Sgs-4 polypeptidc amount as do females. The results obtained show that significant nucleotide sequence alterations arc accumulated within the Sgs-4 coding and 3' untranslated region of the variant strain, thus suggesting a possible role of these sequences in the Sgs.4 dosage compensation.
Dosage compensation is the mechanism thP.t ensures the equalization of the X-linked gene products in both sexes. In Drosophila this goal is achieved by hypertranscription of X-linked genes in males [1]. Several lines of evidence indicate that dosage compensation of each Drosophila X-linked gene is autonomously regulated [2]. In fact, several mutations altering dosage compensation of individual genes have been described [3,4]. This paper is focused on the molecular characterization of a variant strain, named Karsnas, deficient in the dosage compensation of the X-linked gene Sgs.4. In this strain the males accumulate about half the amount of Sgs-4 protein with respect to females [5]. This is due to a lack of Sgs-4 gene hypertranscription in males [6]. Since previous works failed to detect for the Karsnas strain any significant nucleotide sequence deviation within the 840 bp Sgs-4 upstream regulatory region [6,7], we decided to extend the sequence analysis of this mutant to the Sgs.4 coding and 3' untranslated region. Fig. I shows the sequence of the entire Sgs.4 transcribed region from the Karsnas strain, aligned
The sequence data in this paper have been submitted to the
EMBL/GeneBank Data Libraries under the accession numbers X61944 for the Oregon R strain, X61942 for ~he Samarkand strain and X61943 for the Karsnas strain. Correspondence: M. Furia, Dipartimento di Genetica, Biologia Generale e Molecolare, via Mezzocanuone 8, 80134, Napoli, Italy,
under those of the wild-type Oregon R (top line) and Samarkand, another variant strain defective in Sgs-4 dosage compensation (middle line). Sequence comparison has revealed several differences between Karsnas and Oregon R in the first 240 bp of the Sgs.4 codh'lg region; most of these substitutions are also present in Samarkand. However, it seems unlikely that these alterations could be relevant to the dosage compensation deficiency, since they have been identically described in at least two wild-type strains [8] where Sgs.4 gene compensation is normally achieved. In addition to those above discussed, Karsnas sequence accumulated specific significant rearrangements involving both Sgs-4 coding and 3' untranslated regions. In fact, the Karsnas sequence is highly divergent at the 3' end of Sgs.4 coding region, showing a 199 bp segment (from nucleotide 792 to nucleotide 990) with no significative homology with both Oregon R and Samarkand sequences. This 199 bp segment contains a UAA stop codon leading to the synthesis of a Sgs-4 polypeptide 33 amino acids shorter than that encoded by the Oregon R strain. Although it is well known that size differences among Sgs-4 polypeptides from different strains are frequent, the length polymorphisms so far described are always due to variation in the number of the seven amino acid repeat present in the so-called Sgs-4 expandable region [8]. This is not the case of the Karsnas strain, in which the above described 199 bp segment follows the expandable region (see Fig. 1). Furthermore, the Karsnas strain presents a 124 bp
315
deletion within the Sgs.4 3' untranslated region, whose right breakpoint is only 26 bp before the position of the polyadenylation signal. The finding that both the Sgs-4 coding and 3' untranslated regions are strongly alterated in this dosage compensation deficient stcain sug-
gests that these regions could play a role in the Sgs-4 dosage-compensated expression. It is interesting to note that molecular analysis of Samarkand has recently suggested that alterations responsable for the dosage compensation deficiency
OREGON R
KARSNA8
OR S K
TT~CAAAGTCAAGATG~G~T~G~AGTTGTTGGTTGTGTTAT~GGTC~G~CTGG~TGCAC~GCCC~GTCAGGTTCTACA~GCTGTAA~ACTGAACCACCGA~ATGCGAAA~CGAAC~ACC 120 ........................... a ............................................................................................ 120 ........................... a............................................................................................ ;20
OR S K
GAGATGCC~tA~CCr9~A~CA~AAGATGCGAAACC~AAc~GCCAAGATG~G~AAC~GAACCA~AAGATGCGAAA~CA~A~CC~TGC~CCACGC~CCC~TGCA~C~GA .................. g .................... a ............... ac . . . . . . c , a . . . . . . . . . . gcgc . . . . . . c . . . . a g . , . t g a . . . . . . . . . . . . . . . . . . . . . .................. g.................... a. . . . . . . . . . . . . . . ac9 . . . . . c - c . . . . a . . . . tga9c . . . . . . c . . . . a . . . . tea . . . . . . . . . . . . . . . . . . . . .
OR S K
GCCACCCACATGCAkAACTGA6CCACCAACATGCA~iV~TGAGCCACC~AcATGCA/L`kACTAAGCCA~CCACATGCA~k~`CTGAGCCACCCA~ATGCAGAAC~GAGCCACCCACATGcAA 360 ....................................................................................................................... 360 ........................... c................................. 9. . . . . . . . . . . . . . . . . . . . . . . . . . . . "< .................. -> . . . . . . . . 528
OR S K
AA~TAAGCr~J`~CA~.TGCM`AACTGAGCCAC~CA~A~.G~AAAA~TGAGCCACCAACATGCAGAACTGAGCCACCCACATGCAAAACTr~AGCCACCAACATG~A~`d~ACTGAGCCACCCAC 480 ................................................................................................... 459 .... 9............... g................................. c ......................................... c ....................... 646
OR
ATGCP~CTGAGCCACCCACATGCAAAACTGAGCCACCCACATGC A.ec~CTGAGCCAccCTGTGA~AGCAcTGcAcGAAACGCATcAAGCGACACCGcAcAAAA~GAAcCAAGcGATc
2~0 240 240
.......................................................................................................................
~EO 579
.........................................................................................................................
768
GAAMCCA~CAAAMGATAGT~CAT~ATCAT~A~cGT~A~GACA~CAGAAT~5GGAT~TGGCTGTGGA~CGAAAAACGAATCGGGCGGTGGAGGAAGC~GTAT~T~ ........................................................................................................................ ....................... t~atc~tacccac~ta~at99acaca~cctaa~c~a99ttcttgttttcaaatt~ttcc9gact9a9~cc~ccacaccaactgt~cc9c~9cca~ i ooleeo
720 699 888
OR S
CCTGCTAACAG~AAGTGCCCCGATTCCAAACCCJ~AGCCIC .........................................
779 158
g
c~a~t~taatcac#tt~gatatuttaaacacc9ttgccc~attatttccc~ct9at~aa~t~ttctccat~atacattccactttca~cgaatgaaa~
OR S K
AGTCCGACCCCdlAACCGA~iGCCGCATCGkAAACCACATCTAAGCCAAAGCCAMr~CG TGTGATTCAGGCAAGAAGAACACCACCAAGAAACCGCG~CTCAGC~C~TG ........................................................................................................................ . . . . . . -~xxX~XXXX~X~XXXxXX~XX~X~XX~X~XXxx~xxXX~XX~XxXX~MXXXXXXXXEXXXX~X~XXXXM~XXXXEX~X~XX~XXXXXXXX~XX~XXXXKXXXX
OR S
GTT~CTA/~CAGCA~CTTGGCT~AAATGT~G1-rGAATATGAATAAAATCACTTTTTTT~TAATATTATATTAT~GAATATATTATTATTGATTTCGCTAr~AATGGAATATGTCACT1019 ........................................................................................................................ 998
K
xxxxxxxxxxxxxxx . . . . . . . . . . . . . . . . . . .
OR S
K
t .....................................................................................
AAGCTTCACCCAAGTGTA . ................. . . . . . . . . . . . . . . . . . .
100B 899 B76 1019
1124
Fig. I. Nucleotide sequence of the Sgs-4 transcribed region from the wild-type Oregon R-Heidelberg (top line) and two strains defective in Sgs-4 dosage compensation, Samarkand (middle line) and Karsnas (bottom line). The Sgs-4 coding region slarts at the ATG initiation codan (marked by the crosses), in the same position for the three strains but ends at a UAA slap codon (marked by the arrow in the Oregon R and Samarkand sequences) present ~t a different position (marked by the black triangle) within the Karsnas sequence. The segment comprised between parenthesis, from i~osition331 to position 352, is perfectly repeated 8-fold within the Karsnas sequence although only one copy is reported in the figure, to make the alignemeat with Oregon R and Samarkand sequences easier; the segment is internal Io the Sg.~'-4 expandable region. Black spots mark the position of the Sgs-4 internal Hindll] site. The extent of the 124 nt deletion presents within Karsnas sequence is also indicated (xxxx). The position of the AATAAA polyadenilation consensus sequence is underlined. On the top. diagramatie representation of the Sg.~.4 transcription unit of the wild-type Oregon R and the non compensated Karsnas strain. The spotted pattern represents the extent of the expandable region; the crossed pattern represents the 199 bp segment in which Karsnas sequence diverges from that of Oregon R and Samarkand. H: position of the HindII] site" the open arrows mark the position of the stop codons.
316 shown by this strain map within the first 840 bp of the
Sgs-4 upstream region [9]. The fact that no significant alteration has been found within this region for the Karsnas strain and that the Samarkand sequence conforms to that of the Oregon R in the Sgs-4 coding and 3' untranslated regions (Fig. 1) suggests that different c/s-acting elements involved in the Sgs-4 dosage-compensated expression are altered in these two variant strains. H e analysis of Karsnas sequence, in fact, suggests that dosage compensation regulatory element(s) reside also within the Sgs-4 transcribed region. It is interesting to note that dosage compensation of another Drosophila gene, i.e., the per gene, has been shown to depend by regulatory element(s) located within the transcription unit [2]. This work was supported by a grant of the CNR Target Project on Biotechnology and Bioinstrumenta-
tion to M.F. and a grant of the CNR Genetic Engineering Project to L.C.P.
References 1 2 3 4 5 6
Lucchesi, J.C. and Manning, J.E. (1987) Adv. Genet. 24, 371-429. Lucchesi, J.C, ,q989) Am. Nat. 134, 474-485. Smith, P,D. ar~ALucchesi, J.C. (1969) Genetics 61,607-618. Korge, (3. (1975) Chromosoma 72, 4550-4554. Kmge, {3. (1981) Chromosoma 84, 373-390. Kaiser, K., Furia, M. and GIover, D.M. (1986) J. Mol. Biol. 187, 529 536. 7 Hofmann, A. and Korge (3. (1987) Chromosoma 96, 1-7. 8 Muskavitch, M.A.T. and Hogness, D.S. (1982) Cell 29. 1041-1051. 9 Korge, (3., Heide, 1., Sehnert, M. and Hofmann, A. (1990) Dev. Biol. 138, 324-337.