- Email: [email protected]
Molecular characterization of Brazilian human Giardia duodenalis isolates using isoenzyme and random amplified polymorphic DNA analysis
Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
www.elsevier.com/locate/diagmicrobio
Molecular characterization of Brazilian human Giardia duodenalis isolates using isoenzyme and random amplified polymorphic DNA analysis Mı´riam O. Rochaa,*, Maria A. Gomesb, Adriana O. Costac, Cinthia Furstb, Edward F. Silvab b
a School of Pharmacy, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil Department of Parasitology, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil c Department of Basic Pathology, Federal University of Parana´, Curitiba, PR, Brazil
Received 6 January 2003; received in revised form 2 April 2003
Abstract Isoenzymes and RAPD (random amplified polymorphic DNA) analysis were used to characterize three Brazilian human isolates of Giardia duodenalis and its clones. The Portland-1 strain (ATCC 30888) was included in the study as a reference pattern. Both methods divided the isolates into two main groups, one represented by the Portland-1 strain, the other constituted by the Brazilian isolates, which, in turn, were divided into 2 subgroups. The dendogram constructed with the RAPD data, using seven primers, revealed a great heterogeneity between Brazilian isolates and the Portland-1 strain. There was no relationship to the clinical characteristics of the isolates. Although a lot of similarity has been observed among Brazilian isolates and its clones, individual polymorphism was detected, which could be releated to the clonal reproduction of this protozoan. © 2003 Elsevier Inc. All rights reserved.
1. Introduction Giardia duodenalis (syn: Giardia lamblia, Giardia intestinalis) is a flagellated protozoan that inhabits the small intestine of man and other mammals. It is distributed worldwide and considered the most commonly detected intestinal parasite in humans in developed countries (Schantz 1991), reaching a prevalence of 20 –30% in the developing ones (Sullivan et al., 1991). Infection by G. duodenalis can produce a spectrum of clinical manifestations, varying from asymptomatic to acute or chronic diarrhea with malabsorption syndrome and weight loss. The infection in children can interfere with growth and development (Katz & Taylor 2001). Studies on virulence, infectivity, antigenicity and susceptibility to drugs have shown heterogeneity among Giardia isolates (Thompson 2000) and intra-specific genetic differences have been widely recognized (Andrews et al., 1998; Monis 1999). Studies using phenotypic and genetic criteria have shown that G. duodenalis isolates recovered from * Corresponding author. Tel.: ⫹55-31-3339-7652; fax: ⫹55-31-33397644. E-mail address: [email protected] (M.O. Rocha). 0732-8893/03/$ – see front matter © 2003 Elsevier Inc. All rights reserved. doi:10.1016/S0732-8893(03)00083-X
humans and other mammals can be divided in two major genotypes (Table 1). Molecular studies have revealed that genotype A can be divided into cluster A-I, composed by a mixture of closely related animals and human isolates and cluster A-II, consisting only of human isolates (Andrews et al., 1989; Ey et al.1997). Genotype B comprises a genetically diverse group of predominantly human isolates, even though some animal genotypes have been included. Each major genotype of Giardia contains a genetically diverse collection of isolates distributed worldwide (Thompson 2000). Genetic heterogeneity can vary according to the geographic area (Hopkins et al., 1997). G. duodenalis isolates from various hosts and geographic regions have been characterized using methods such as isoenzyme electrophoresis, antigenic analysis, restriction endonuclease analysis and polymerase-chain reaction (PCR)-based methods (Andrews et al., 1989, Homan et al., 1992, Nash et al., 1985, Van Belkun et al., 1993). Random amplified polymorphic DNA (RAPD) analysis has been increasingly used to verify the DNA polymorphism in several protozoan species (Clark & Lanigan 1993, Williams et al., 1993, Gomes et al., 2000; Valle et al., 2000). The technique requires small amounts of DNA and no prior information about DNA sequence, providing a
274
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Table 1 Correspondence of the two major genotypes of G. duodenalis to the terminology used by different authors Genotype A
Genotype B
Methodology used
Reference
Groups I and II Groups 1 and 2 Polish Assemblage A Group 1
Groups III and IV Group 3 Belgian Assemblage B Group 2
Allozyme electrophoresis Surface antigens, RFLP*, group-specific gene Isoenzyme analysis, RFLP Isoenzyme analysis Sequence of a SSU-rRNA fragment
Andrews et al., 1989 Nash & Mowatt, 1992 Homan et al., 1992 Mayrhofer et al., 1995 Hopkins et al., 1997
* Restriction Fragment Length Polymorphism.
global vision of the composition and organization of the genome. Results can be compared to those obtained by isoenzyme characterization and used in the construction of phylogenetic trees and differentiation of strains (Morgan et al., 1993). G. duodenalis isolates from Brazil are not genetically characterized yet. The present study used isoenzymes and RAPD analysis to assess genetic variability among three Brazilian human isolates of G. duodenalis and its clones. The Portland-1 strain (ATCC 30888) was used as reference pattern.
2. Materials and methods 2.1. G. duodenalis isolates and clones Table 2 shows the characteristics of each isolate used in this paper. The Brazilian isolates were all obtained from cysts purified of human feces, according to Roberts-Thomson et al. (1976). Excystation was induced in acid solution (Bingham & Meyer 1979) and, after a wash step with phosphate-buffered saline (PBS), pH 7.2, the material was transferred to 15 mL tubes, containing TYI -S-33 culture medium (Keister 1983). Tubes were incubated at 37°C until they formed a monolayer (48-72 h). The Portland-1 strain (ATCC 30888) was obtained from duodenal aspirate (Meyer 1976). Cloning of G. duodenalis was carried out according to Binz et al. (1991). Single micro drops (5L) of diluted trophozoite suspension (500 cells/mL) were placed in small cover slips and examined in an inverted microscopy. When only one trophozoite was observed in the micro drop, the
cover slip was aseptically transferred to a 4 mL tube containing TYI-S-33 medium, maintained at 37°C. After the clones were well established they were cloned once again to ensure the homogeneity of the parasites. Trophozoites in the exponential phase of growth were harvested by means of chilling tubes on ice for 30 min followed by centrifugation at 300⫻ g for 10 min. Packed trophozoites were used for DNA extraction or for preparing enzyme extracts. 2.2. Isoenzyme analysis The harvested trophozoites were washed three times with cold PBS (pH 7,2) and the pellet was treated with stabilizing solution (2.0 mM dithiotheitrol, 2.0 mM EDTA and 2.0 mM ⑀-aminocaproic acid). Lysates were made by freezing in liquid nitrogen and thawing at 37°C, 4 times. The lysates were centrifuged at 15.000⫻ g for 15 min, at 4°C. Supernatants were collected and stored as beads in liquid nitrogen until electrophoresis. The protein contents were estimated by Bradford method (Bradford 1976), using bovine serum albumin (BSA) as standard. Isoenzyme analysis was carried out using horizontal thin-layer starch-gel electrophoresis, at 4°C (Sargeaunt & Williams 1978). Four enzymes were studied: malate dehydrogenase (MDH, E.C. 1.1.1.37), malic enzyme (ME, E.C. 1.1.1.40), phosphoglucomutase (PGM, E.C. 2.7.5.1) and glucose phosphate isomerase (GPI, E.C. 5.3.1.9). 2.3. RAPD For DNA extraction trophozoites were treated according to Amershan Life Science protocol for DNA purification
Table 2 Characteristics of Giardia duodenalis isolates Code
Age (years)/sex*
Clinical status at collection
O&P results at collection**
Origin
BHRF92 BHRA93 BHLF93 Portland-1 (ATCC 30888)
4/M 1/M 16/M 36/F
Asymptomatic Symptomatic Asymptomatic Symptomatic
G. duodenalis G. duodenalis G. duodenalis NA***
Belo Horizonte/Brazil Belo Horizonte/Brazil Belo Horizonte/Brazil Oregon/USA
* Sex: M ⫽ masculine, F ⫽ feminine. ** Parasites found at ova and parasite examination at collection. *** Information not available.
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
275
Table 3 Primers tested for random amplified polymorphic DNA analysis of Giardia duodenalis Code
Size*
Sequence
%GC**
ACP3 M-13 LS-10 SRP3 SRP5 HSP2 RD5
22 17 10 20 28 21 20
5⬘GTTTAAATCAAAATCTCTTAAG3⬘ 5⬘CAGGAAACAGCTATGAC3⬘ 5⬘AACCCGCTGT3⬘ 5⬘GGTCTCAAAAAACCCACGAG3⬘ 5⬘CAAACGATAAAATCTAGCAGCAAACTAC3⬘ 5⬘TGTTTCTTTTTGTTGTTTTCG3⬘ 5⬘ATCTGGTTGATCCTGCCACT3⬘
22,7 47,1 60,0 50,0 35,7 28,6 50,0
* Number of nucleotides. ** Guanine and cytosine content.
–Kit Nucleon BACC 1. The DNA was ressuspended in milli-Q sterile water and stored in 20 L aliquots, at 4°C. The concentration of DNA was measured by spectrophotometer at 260 nm (Shimadzu UV –160A). RAPD was performed according to Steindel et al. (1993). Briefly, reactions were carried out in 10L vols. containing 1.0 unit of Taq polymerase (Promega), 0.2 mM of deoxynucleotide, 1.5 mM of MgCl2, 10.0 mM of Tris/HCl (pH 8.5), 1.0 ng of genomic DNA and 10.0 pmol of one of the random selected primers. Amplification was performed in 35 cycles, with initial denaturation at 95°C for 5 min, two cycles of 30°C for 2 min and 30s. at 72°C, followed by 33 cycles where the annealing temperature was raised to 42°C. Amplification products were subjected to 4% polyacrilamide gel electrophoreses and stained with silver. Table 3 shows a list of the seven primers used for RAPD analysis. They were selected at random among the set of primers available in our laboratory. 2.4. Analysis of RAPD data All visible bands were scored as present or absent for each isolate. The genetic distances between G. duodenalis isolates were calculated by Link et al. (1995) method, based on RAPD data achieved from the seven primers. Phylogenetic relationships were determined by the group-average clustering strategy or the unweighted pair group method of analysis (UPGMA), using the “TREECON for Windows” computer program. Dendograms were constructed based on data from the seven primers.
3. Results Figure 1 shows the diagrammatic representation of isoenzyme profiles of all G. duodenalis isolates examined. Isoenzyme electrophoresis with four enzymes grouped the isolates into three profiles. BHRA93 and BHRF92 isolates presented the same profile, which differed from the
Fig. 1. Diagrammatic representation of the isoenzyme patterns of malate dehydrogenase (MDH), phosphoglucomutase (PGM), glucose phosphate isomerase (GPI) and malic enzyme (ME), showing the enzyme profiles of each G. duodenalis isolate examined. Lanes 1 to 8 as follows: Portland-1, Portland-1/A2, BHRF92, BHRF92/A2, BHRA93, BHRA93/A2, BHLF93, BHLF93/B2. Thin dashed line at 0 indicates point of insertion of samples.
276
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Fig. 2. 4% polyacrilamide silver stained gel showing RAPD profiles of G. duodenalis isolates, generated by LS10 and HSP2 primers. Lanes 1 to 8 as follows: Portland-1, Portland-1/A2, BHRF92, BHRF92/A2, BHRA93, BHRA93/A2, BHLF93 and BHLF93/B2. M corresponds to molecular weight marker.
BHLF93 isolate at the mobility of MDH enzyme. The reference Portland-1 strain differed from the Brazilian isolates in 2 of the 4 enzymes examined (GPI and PGM). No difference in the mobility was detected with the enzyme ME for all isolates. The electrophoretic mobility of the clones was similar to the parental isolates. Except for one primer used in the RAPD, the other six were able to detect genetic heterogeneity among the isolates studied (Figure 2). Little variation was observed between each parental isolate and its clone. The dendogram constructed with the RAPD data from the seven primers (Figure 3) revealed two major groups, one represented by Portland-1 strain the other represented by the Brazilian isolates. The latter formed two subgroups, one consisting by the BHRF92 isolate and its clone and the other represented by the BHRA93 and BHLF93 isolates and their clones. The two methods did not present any relationship to the clinical features of the isolates.
Fig. 3. Dendogram of G. duodenalis isolates derived from RAPD data obtained with seven different primers.
4. Discussion Electrophoretic isoenzyme and RAPD profile are very useful for studying intra- and interspecific genetic diversity (Chaudhuri et al., 1991, Williams et al., 1990). The present study used these techniques to assess the polymorphism among three G. duodenalis Brazilian isolates, Portland-1 strain and a clone of each one. The genetic diversity of G. duodenalis from Brazil was not known yet. Previous studies used RAPD and isoenzyme analysis for demonstrating genetic variation among G. duodenalis isolates. Morgan et al. (1993), using RAPD, divided fourteen human and animals isolates from different geographical areas into 10 groups, which were correlated with isoenzyme data. Homan et al. (1992) compared G. duodenalis isolates by isoenzyme, restriction fragment length polymorphism and RAPD and obtained comparable results with the three methods. Both methods were able to reveal a considerable variability between Brazilian isolates and the reference strain Portland-1. RAPD and isoenzyme results are in general agreement, even though the groups generated were not exactly the same. RAPD data grouped BHRA93 isolate together with BHLF93, whereas isoenzyme data grouped BHRA93 with BHRF92 isolate. Similar results were observed by Homan et al. (1992) and Morgan et al. (1993). RAPD is a very sensitive method and is not limited to a single locus, like isoenzyme analysis. It detects polymorphism in several independent coding and non-coding loci, throughout the whole genome (Welsh McClelland 1990; Williams et al., 1990). The genetic distance between Brazilian isolates and the reference strain Portland-1 was as great as that used to discriminate other species of protozoan (Gomes et al., 2000). According to the literature Portland-1 strain belongs to the genotype A, subgroup I (Monis et al., 1996). Studies for identyfying the genotype of Brazilian isolates are in progress.
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Using RAPD and interrepeat PCR techniques Van Belkun et al. (1993) identified different levels of genetic variation among isolates of single species of Giardia depending on the primer used. Some primers allowed differentiation between the clone and the parental isolate while others did not. In our studies, for reliable conclusions, we used seven different primers in RAPD analysis, which generated nearly 300 bands. HSP2 primer showed less discriminatory power than the other six primers. The banding patterns generated by HSP2 were very similar for all G. duodenalis isolates. Besides the polymorphism detected among the parental isolates, RAPD also detected some degree of polymorphism between the latter and the clones, in spite of having shared more than 90% of the bands generated by the primers used. No relationship could be observed between isoenzyme and RAPD analyses and the clinical characteristics of the isolates. The factors determining the variability in clinical outcome in giardiasis are still poorly understood. There is evidence that parasite factors (differences in virulence and pathogenicity of Giardia strains) and/or host factors (age, immune and nutritional status) are involved. Attempts were made to relate some characteristics of G. duodenalis isolates, like in vitro (Cedillo-Rivera et al., 1991) and in vivo growth (Visvevara et al., 1988; Homan et al., 1992; Astiazara´ n-Garcia et al., 2000; Bouza et al., 2000), isoenzymatic analysis (Cedillo-Rivera et al., 1989; Homan et al., 1992) and genotypes (Homan et al., 1992; Homan & Mank 2001) with differences in clinical symptomatology. The results are sometimes controversial and studies with a larger number of isolates are necessary for reliable conclusions. Although a very limited number of G. duodenalis isolates were used in this study, the isoenzyme electrophoretic profiles and RAPD data revealed greater heterogeneity between the Portland-1 strain and the Brazilian isolates. The latter presented a lot of similarity though some individual polymorphism was detected, which could be related to the clonal reprodution in this protozoan. The two methods using different assumptions produced results that are in general agreement. These data represent a significant advance on the current knowledge about G. duodenalis in Brazil.
Acknowledgments This work was supported by FAPEMIG and CNPq. The authors want to thanks Na´ dia Oliveira for English critical reviewing of the manuscript and Edna Maria Pires for her technical support.
References Andrews, R.H., Adams, M., Boreham, P.F.L., Mayrhofer, G., & Meloni, B.P. (1989). Giardia intestinalis: electrophoretic evidence for a species complex. Int J Parasitol 19, 183–190.
277
Andrews, R.H., Monis, P.T., Ey, P.L., & Mayrhofer, G. (1998). Comparison of levels of intra-specific genetic variation within Giardia muris and Giardia intestinalis. Int J Parasitol 28, 1179 –1185. Astiazara´ n-Garcia, H., Espinosa-Cantellano, M., Castano´ n, G., Cha´ vezMunguia, B., & Martı´nez-Palomo, A. (2000). Giardia. lamblia: effect of infection with symptomatic and asymptomatic isolates on the growth of gerbils (Meriones unguiculatus). Exp Parasitol 95, 128 –135. Bingham, A.K., & Meyer, E.A. (1979). Giardia excystation can be induced in vitro in acidic solutions. Nature 277, 301–302. Binz, N., Thompson, R.C.A., Meloni, B.P., & Lymbery, A.J. (1991). A simple method for cloning Giardia duodenalis from cultures and fecal samples. J Parasitol 77, 627– 631. Bouza, M., Maciques, I., Torres, D., & Nu´ nez, F.A. (2000). Giardia. lamblia in mongolian gerbils: characteristics of infection using different human isolates. Exp Parasitol 96, 43– 46. Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of dye binding. Anal Biochem 72, 248 –254. Cedillo-Rivera, R., Enciso-Moreno, J.A., Martinez-Palomo, A., & OrtegaPierres, G. (1989). Giardia lamblia: isoenzyme analysis of 19 axenic strains isolated from symptomatic and asymptomatic patients in Mexico. Trans R Soc Trop Med Hyg 83, 644 – 646. Cedillo-Rivera, R., Enciso-Moreno, J.A., Martinez-Palomo, A., & OrtegaPierres, G. (1991). Isolation and axenization of giardia lamblia isolates from asymptomatic patients in Mexico. Arch Invest Me´ d 22, 79 – 85. Chaudhuri, P., De, A., Bhattacharya, A., Pal, S.C., & Das, P. (1991). Identification of heterogeneity in human isolates of Giardia lamblia by isoenzyme studies. Zbl Bakt 274, 490 – 495. Clark, A.C.G., & Lanigan, M.S. (1993). Prospects for estimating nucleotide divergence with RAPDs. Mol Biol Evol 10, 1096 –1111. Ey, P.L., Mansouri, M., Kulda, J., Nohınkova´ , E., Monis, P.T., Andrews, R.H., & Mayrhofer, G. (1997). Genetic analysis of Giardia from hoofed farm animals reveals artiodactyl-specific and potentially zoonotic genotypes. J Euk Microbiol 44, 626 – 635. Gomes, M.A., Melo, M.N., Macedo, A.M., Furst, C., & Silva, E.F. (2000). RAPD in the analysis of isolates of Entamoeba histolytica. Acta Trop 75, 71–77. Homan, W.L., & Mank, T.G. (2001). Human giardiasis: genotype linked differences in clinical symptomatology. Int J Parasitol 31, 822– 826. Homan, W.L., Van Enckevort, F.H.J., Limper, L., Van Eys, G.J.J.M., Schoone, G.J., Kasprzak, W., Majewska, A.C., & Van Knapen, F. (1992). Comparison of Giardia from different laboratories by isoenzyme analysis and recombinant DNA probes. Parasitol Res 78, 316 – 323. Hopkins, R.M., Meloni, B.P., Groth, D.M., Wetherall, J.D., Reynoldson, J.A., & Thompson, R.C.A. (1997). Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. J Parasitol 83, 44 –51. Katz, D.E., & Taylor, D.N. (2001). Parasitic infections of the gastrointestinal tract. Gastroenterol Clin North Am 30, 797– 815. Keister, D.B. (1983). Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Trans R Soc Trop Med Hyg 77, 487– 488. Link, W., Dixkens, C., Singh, M., & Melchinger, A.E. (1995). Genetic diversity in European and Mediterranean faba bean germ plasm revealed by RAPD markers. Theoret Appl Genet 90, 27–32. Mayrhofer, G., Andrews, R.H., Ey, P.L., & Chilton, N.B. (1995). Division of Giardia isolates from humans into two genetically distinct assemblages by electrophoretic analysis of enzymes encoded at 27 loci and comparison with Giardia muris. Parasitology 111, 11–17. Meyer, E.A. (1976). Giardia lamblia: isolation and axenic cultivation. Exp Parasitol 39, 101–105. Monis, P.T. (1999). The importance of systematics in parasitological research. Int J Parasitol 29, 381–388. Monis, P.T., Mayrhofer, G., Andrews, R.H., Homan, W.L., & Limper, L. (1996). Molecular genetic analysis of Giardia intestinalis isolates at the glutamate dehydrogenase locus. Parasitology 112, 1–12.
278
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Morgan, U.M., Constantine, C.C., Grene, W.K., & Thompson, R.C.A. (1993). RAPD (random amplified polymorphic DNA) analysis of Giardia DNA and correlation with isoenzime data. Trans R Soc Trop Med Hyg 87, 702–705. Nash, T.E., McCutchan, T., Keister, D., Dame, J.B., Conrad, J.D., & Gillin, F.D. (1985). Restriction endonuclease analysis of DNA from 15 Giardia isolates obtained from humans and animals. J Infec Dis 152, 64 –73. Nash, T.E., & Mowatt, M.R. (1992). Identification and characterization of a Giardia lamblia group-specific gene. Exp Parasitol 75, 369 –378. Roberts-Thomson, I.C., Stevens, D.P., Mahmoud, A.A., & Warren, K.S. (1976). Acquired resistance to infection in an animal model of giardiasis. J Immunol 117, 2036 –2037. Sargeaunt, P., & Williams, J. (1978). The differentiation of invasive and non-invasive Entamoeba histolytica by isoenzyme electrophoresis. Trans R Soc Trop Med Hyg 72, 519 –521. Schantz, P.M. (1991). Parasitic zoonoses in perspective. Int J Parasitol 21, 161–170. Steindel, M., Dias Neto, E., Menezes, C.L.P., Romanha, A.J., & Simpson, A.J.G. (1993). Random amplified polymorphic DNA analysis of Trypanosoma cruzi strains. Mol Biochem Parasitol 60, 72– 80. Sullivan, P.B., Marsh, M.N., & Phillips, M.B. (1991). Prevalence and
treatment of giardiasis in chronic darrhoea and malnutrition. Arch Dis Child 66, 304 –306. Thompson, R.C.A., Hopkins, R.M., & Homan, W.L. (2000). Nomenclature and genetic groupings of Giardia infecting mammals. Parasitol Today 16, 210 –213. Valle, P.R., Souza, M.B.G., Pires, E.M., Felix, E.F., & Gomes, M.A. (2000). Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica. Rev Inst Med Trop Sa˜ o Paulo 42, 249 –253. Van Belkun, A.V., Homan, W., Limper, L., & Quinte, W.G.V (1993). Genotyping isolates and clones of Giardia duodenalis by polymerase chain reaction: implications for the detection of genetic variation among protozoan parasite species. Molec Biochem Parasit 61, 69 –78. Visvesvara, G.S., Dickerson, J.W., & Healy, G.R. (1988). Variable infectivity of human-derived Giardia lamblia cysts for Mongolian gerbils (Meriones ungiculatus). J Clin Microbiol 26, 837– 841. Welsh, J., & McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res 18, 7213–7218. Williams, J.G.K., Hanafey, M.K., Rafalski, J.A., & Tingey, S.V. (1993). Genetic analysis using random amplified polymorphic DNA markers. Methods Enzymol 218, 705–740. Williams, J.G.K., Kubelic, A.R., Livak, K.J., Rafalski, J.A., & Tingey, S.V. (1990). DNA polymorphisms amplified by arbitrary are useful as genetic markers. Nucleic Acids Res 18, 6531–35.
www.elsevier.com/locate/diagmicrobio
Molecular characterization of Brazilian human Giardia duodenalis isolates using isoenzyme and random amplified polymorphic DNA analysis Mı´riam O. Rochaa,*, Maria A. Gomesb, Adriana O. Costac, Cinthia Furstb, Edward F. Silvab b
a School of Pharmacy, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil Department of Parasitology, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil c Department of Basic Pathology, Federal University of Parana´, Curitiba, PR, Brazil
Received 6 January 2003; received in revised form 2 April 2003
Abstract Isoenzymes and RAPD (random amplified polymorphic DNA) analysis were used to characterize three Brazilian human isolates of Giardia duodenalis and its clones. The Portland-1 strain (ATCC 30888) was included in the study as a reference pattern. Both methods divided the isolates into two main groups, one represented by the Portland-1 strain, the other constituted by the Brazilian isolates, which, in turn, were divided into 2 subgroups. The dendogram constructed with the RAPD data, using seven primers, revealed a great heterogeneity between Brazilian isolates and the Portland-1 strain. There was no relationship to the clinical characteristics of the isolates. Although a lot of similarity has been observed among Brazilian isolates and its clones, individual polymorphism was detected, which could be releated to the clonal reproduction of this protozoan. © 2003 Elsevier Inc. All rights reserved.
1. Introduction Giardia duodenalis (syn: Giardia lamblia, Giardia intestinalis) is a flagellated protozoan that inhabits the small intestine of man and other mammals. It is distributed worldwide and considered the most commonly detected intestinal parasite in humans in developed countries (Schantz 1991), reaching a prevalence of 20 –30% in the developing ones (Sullivan et al., 1991). Infection by G. duodenalis can produce a spectrum of clinical manifestations, varying from asymptomatic to acute or chronic diarrhea with malabsorption syndrome and weight loss. The infection in children can interfere with growth and development (Katz & Taylor 2001). Studies on virulence, infectivity, antigenicity and susceptibility to drugs have shown heterogeneity among Giardia isolates (Thompson 2000) and intra-specific genetic differences have been widely recognized (Andrews et al., 1998; Monis 1999). Studies using phenotypic and genetic criteria have shown that G. duodenalis isolates recovered from * Corresponding author. Tel.: ⫹55-31-3339-7652; fax: ⫹55-31-33397644. E-mail address: [email protected] (M.O. Rocha). 0732-8893/03/$ – see front matter © 2003 Elsevier Inc. All rights reserved. doi:10.1016/S0732-8893(03)00083-X
humans and other mammals can be divided in two major genotypes (Table 1). Molecular studies have revealed that genotype A can be divided into cluster A-I, composed by a mixture of closely related animals and human isolates and cluster A-II, consisting only of human isolates (Andrews et al., 1989; Ey et al.1997). Genotype B comprises a genetically diverse group of predominantly human isolates, even though some animal genotypes have been included. Each major genotype of Giardia contains a genetically diverse collection of isolates distributed worldwide (Thompson 2000). Genetic heterogeneity can vary according to the geographic area (Hopkins et al., 1997). G. duodenalis isolates from various hosts and geographic regions have been characterized using methods such as isoenzyme electrophoresis, antigenic analysis, restriction endonuclease analysis and polymerase-chain reaction (PCR)-based methods (Andrews et al., 1989, Homan et al., 1992, Nash et al., 1985, Van Belkun et al., 1993). Random amplified polymorphic DNA (RAPD) analysis has been increasingly used to verify the DNA polymorphism in several protozoan species (Clark & Lanigan 1993, Williams et al., 1993, Gomes et al., 2000; Valle et al., 2000). The technique requires small amounts of DNA and no prior information about DNA sequence, providing a
274
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Table 1 Correspondence of the two major genotypes of G. duodenalis to the terminology used by different authors Genotype A
Genotype B
Methodology used
Reference
Groups I and II Groups 1 and 2 Polish Assemblage A Group 1
Groups III and IV Group 3 Belgian Assemblage B Group 2
Allozyme electrophoresis Surface antigens, RFLP*, group-specific gene Isoenzyme analysis, RFLP Isoenzyme analysis Sequence of a SSU-rRNA fragment
Andrews et al., 1989 Nash & Mowatt, 1992 Homan et al., 1992 Mayrhofer et al., 1995 Hopkins et al., 1997
* Restriction Fragment Length Polymorphism.
global vision of the composition and organization of the genome. Results can be compared to those obtained by isoenzyme characterization and used in the construction of phylogenetic trees and differentiation of strains (Morgan et al., 1993). G. duodenalis isolates from Brazil are not genetically characterized yet. The present study used isoenzymes and RAPD analysis to assess genetic variability among three Brazilian human isolates of G. duodenalis and its clones. The Portland-1 strain (ATCC 30888) was used as reference pattern.
2. Materials and methods 2.1. G. duodenalis isolates and clones Table 2 shows the characteristics of each isolate used in this paper. The Brazilian isolates were all obtained from cysts purified of human feces, according to Roberts-Thomson et al. (1976). Excystation was induced in acid solution (Bingham & Meyer 1979) and, after a wash step with phosphate-buffered saline (PBS), pH 7.2, the material was transferred to 15 mL tubes, containing TYI -S-33 culture medium (Keister 1983). Tubes were incubated at 37°C until they formed a monolayer (48-72 h). The Portland-1 strain (ATCC 30888) was obtained from duodenal aspirate (Meyer 1976). Cloning of G. duodenalis was carried out according to Binz et al. (1991). Single micro drops (5L) of diluted trophozoite suspension (500 cells/mL) were placed in small cover slips and examined in an inverted microscopy. When only one trophozoite was observed in the micro drop, the
cover slip was aseptically transferred to a 4 mL tube containing TYI-S-33 medium, maintained at 37°C. After the clones were well established they were cloned once again to ensure the homogeneity of the parasites. Trophozoites in the exponential phase of growth were harvested by means of chilling tubes on ice for 30 min followed by centrifugation at 300⫻ g for 10 min. Packed trophozoites were used for DNA extraction or for preparing enzyme extracts. 2.2. Isoenzyme analysis The harvested trophozoites were washed three times with cold PBS (pH 7,2) and the pellet was treated with stabilizing solution (2.0 mM dithiotheitrol, 2.0 mM EDTA and 2.0 mM ⑀-aminocaproic acid). Lysates were made by freezing in liquid nitrogen and thawing at 37°C, 4 times. The lysates were centrifuged at 15.000⫻ g for 15 min, at 4°C. Supernatants were collected and stored as beads in liquid nitrogen until electrophoresis. The protein contents were estimated by Bradford method (Bradford 1976), using bovine serum albumin (BSA) as standard. Isoenzyme analysis was carried out using horizontal thin-layer starch-gel electrophoresis, at 4°C (Sargeaunt & Williams 1978). Four enzymes were studied: malate dehydrogenase (MDH, E.C. 1.1.1.37), malic enzyme (ME, E.C. 1.1.1.40), phosphoglucomutase (PGM, E.C. 2.7.5.1) and glucose phosphate isomerase (GPI, E.C. 5.3.1.9). 2.3. RAPD For DNA extraction trophozoites were treated according to Amershan Life Science protocol for DNA purification
Table 2 Characteristics of Giardia duodenalis isolates Code
Age (years)/sex*
Clinical status at collection
O&P results at collection**
Origin
BHRF92 BHRA93 BHLF93 Portland-1 (ATCC 30888)
4/M 1/M 16/M 36/F
Asymptomatic Symptomatic Asymptomatic Symptomatic
G. duodenalis G. duodenalis G. duodenalis NA***
Belo Horizonte/Brazil Belo Horizonte/Brazil Belo Horizonte/Brazil Oregon/USA
* Sex: M ⫽ masculine, F ⫽ feminine. ** Parasites found at ova and parasite examination at collection. *** Information not available.
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
275
Table 3 Primers tested for random amplified polymorphic DNA analysis of Giardia duodenalis Code
Size*
Sequence
%GC**
ACP3 M-13 LS-10 SRP3 SRP5 HSP2 RD5
22 17 10 20 28 21 20
5⬘GTTTAAATCAAAATCTCTTAAG3⬘ 5⬘CAGGAAACAGCTATGAC3⬘ 5⬘AACCCGCTGT3⬘ 5⬘GGTCTCAAAAAACCCACGAG3⬘ 5⬘CAAACGATAAAATCTAGCAGCAAACTAC3⬘ 5⬘TGTTTCTTTTTGTTGTTTTCG3⬘ 5⬘ATCTGGTTGATCCTGCCACT3⬘
22,7 47,1 60,0 50,0 35,7 28,6 50,0
* Number of nucleotides. ** Guanine and cytosine content.
–Kit Nucleon BACC 1. The DNA was ressuspended in milli-Q sterile water and stored in 20 L aliquots, at 4°C. The concentration of DNA was measured by spectrophotometer at 260 nm (Shimadzu UV –160A). RAPD was performed according to Steindel et al. (1993). Briefly, reactions were carried out in 10L vols. containing 1.0 unit of Taq polymerase (Promega), 0.2 mM of deoxynucleotide, 1.5 mM of MgCl2, 10.0 mM of Tris/HCl (pH 8.5), 1.0 ng of genomic DNA and 10.0 pmol of one of the random selected primers. Amplification was performed in 35 cycles, with initial denaturation at 95°C for 5 min, two cycles of 30°C for 2 min and 30s. at 72°C, followed by 33 cycles where the annealing temperature was raised to 42°C. Amplification products were subjected to 4% polyacrilamide gel electrophoreses and stained with silver. Table 3 shows a list of the seven primers used for RAPD analysis. They were selected at random among the set of primers available in our laboratory. 2.4. Analysis of RAPD data All visible bands were scored as present or absent for each isolate. The genetic distances between G. duodenalis isolates were calculated by Link et al. (1995) method, based on RAPD data achieved from the seven primers. Phylogenetic relationships were determined by the group-average clustering strategy or the unweighted pair group method of analysis (UPGMA), using the “TREECON for Windows” computer program. Dendograms were constructed based on data from the seven primers.
3. Results Figure 1 shows the diagrammatic representation of isoenzyme profiles of all G. duodenalis isolates examined. Isoenzyme electrophoresis with four enzymes grouped the isolates into three profiles. BHRA93 and BHRF92 isolates presented the same profile, which differed from the
Fig. 1. Diagrammatic representation of the isoenzyme patterns of malate dehydrogenase (MDH), phosphoglucomutase (PGM), glucose phosphate isomerase (GPI) and malic enzyme (ME), showing the enzyme profiles of each G. duodenalis isolate examined. Lanes 1 to 8 as follows: Portland-1, Portland-1/A2, BHRF92, BHRF92/A2, BHRA93, BHRA93/A2, BHLF93, BHLF93/B2. Thin dashed line at 0 indicates point of insertion of samples.
276
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Fig. 2. 4% polyacrilamide silver stained gel showing RAPD profiles of G. duodenalis isolates, generated by LS10 and HSP2 primers. Lanes 1 to 8 as follows: Portland-1, Portland-1/A2, BHRF92, BHRF92/A2, BHRA93, BHRA93/A2, BHLF93 and BHLF93/B2. M corresponds to molecular weight marker.
BHLF93 isolate at the mobility of MDH enzyme. The reference Portland-1 strain differed from the Brazilian isolates in 2 of the 4 enzymes examined (GPI and PGM). No difference in the mobility was detected with the enzyme ME for all isolates. The electrophoretic mobility of the clones was similar to the parental isolates. Except for one primer used in the RAPD, the other six were able to detect genetic heterogeneity among the isolates studied (Figure 2). Little variation was observed between each parental isolate and its clone. The dendogram constructed with the RAPD data from the seven primers (Figure 3) revealed two major groups, one represented by Portland-1 strain the other represented by the Brazilian isolates. The latter formed two subgroups, one consisting by the BHRF92 isolate and its clone and the other represented by the BHRA93 and BHLF93 isolates and their clones. The two methods did not present any relationship to the clinical features of the isolates.
Fig. 3. Dendogram of G. duodenalis isolates derived from RAPD data obtained with seven different primers.
4. Discussion Electrophoretic isoenzyme and RAPD profile are very useful for studying intra- and interspecific genetic diversity (Chaudhuri et al., 1991, Williams et al., 1990). The present study used these techniques to assess the polymorphism among three G. duodenalis Brazilian isolates, Portland-1 strain and a clone of each one. The genetic diversity of G. duodenalis from Brazil was not known yet. Previous studies used RAPD and isoenzyme analysis for demonstrating genetic variation among G. duodenalis isolates. Morgan et al. (1993), using RAPD, divided fourteen human and animals isolates from different geographical areas into 10 groups, which were correlated with isoenzyme data. Homan et al. (1992) compared G. duodenalis isolates by isoenzyme, restriction fragment length polymorphism and RAPD and obtained comparable results with the three methods. Both methods were able to reveal a considerable variability between Brazilian isolates and the reference strain Portland-1. RAPD and isoenzyme results are in general agreement, even though the groups generated were not exactly the same. RAPD data grouped BHRA93 isolate together with BHLF93, whereas isoenzyme data grouped BHRA93 with BHRF92 isolate. Similar results were observed by Homan et al. (1992) and Morgan et al. (1993). RAPD is a very sensitive method and is not limited to a single locus, like isoenzyme analysis. It detects polymorphism in several independent coding and non-coding loci, throughout the whole genome (Welsh McClelland 1990; Williams et al., 1990). The genetic distance between Brazilian isolates and the reference strain Portland-1 was as great as that used to discriminate other species of protozoan (Gomes et al., 2000). According to the literature Portland-1 strain belongs to the genotype A, subgroup I (Monis et al., 1996). Studies for identyfying the genotype of Brazilian isolates are in progress.
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Using RAPD and interrepeat PCR techniques Van Belkun et al. (1993) identified different levels of genetic variation among isolates of single species of Giardia depending on the primer used. Some primers allowed differentiation between the clone and the parental isolate while others did not. In our studies, for reliable conclusions, we used seven different primers in RAPD analysis, which generated nearly 300 bands. HSP2 primer showed less discriminatory power than the other six primers. The banding patterns generated by HSP2 were very similar for all G. duodenalis isolates. Besides the polymorphism detected among the parental isolates, RAPD also detected some degree of polymorphism between the latter and the clones, in spite of having shared more than 90% of the bands generated by the primers used. No relationship could be observed between isoenzyme and RAPD analyses and the clinical characteristics of the isolates. The factors determining the variability in clinical outcome in giardiasis are still poorly understood. There is evidence that parasite factors (differences in virulence and pathogenicity of Giardia strains) and/or host factors (age, immune and nutritional status) are involved. Attempts were made to relate some characteristics of G. duodenalis isolates, like in vitro (Cedillo-Rivera et al., 1991) and in vivo growth (Visvevara et al., 1988; Homan et al., 1992; Astiazara´ n-Garcia et al., 2000; Bouza et al., 2000), isoenzymatic analysis (Cedillo-Rivera et al., 1989; Homan et al., 1992) and genotypes (Homan et al., 1992; Homan & Mank 2001) with differences in clinical symptomatology. The results are sometimes controversial and studies with a larger number of isolates are necessary for reliable conclusions. Although a very limited number of G. duodenalis isolates were used in this study, the isoenzyme electrophoretic profiles and RAPD data revealed greater heterogeneity between the Portland-1 strain and the Brazilian isolates. The latter presented a lot of similarity though some individual polymorphism was detected, which could be related to the clonal reprodution in this protozoan. The two methods using different assumptions produced results that are in general agreement. These data represent a significant advance on the current knowledge about G. duodenalis in Brazil.
Acknowledgments This work was supported by FAPEMIG and CNPq. The authors want to thanks Na´ dia Oliveira for English critical reviewing of the manuscript and Edna Maria Pires for her technical support.
References Andrews, R.H., Adams, M., Boreham, P.F.L., Mayrhofer, G., & Meloni, B.P. (1989). Giardia intestinalis: electrophoretic evidence for a species complex. Int J Parasitol 19, 183–190.
277
Andrews, R.H., Monis, P.T., Ey, P.L., & Mayrhofer, G. (1998). Comparison of levels of intra-specific genetic variation within Giardia muris and Giardia intestinalis. Int J Parasitol 28, 1179 –1185. Astiazara´ n-Garcia, H., Espinosa-Cantellano, M., Castano´ n, G., Cha´ vezMunguia, B., & Martı´nez-Palomo, A. (2000). Giardia. lamblia: effect of infection with symptomatic and asymptomatic isolates on the growth of gerbils (Meriones unguiculatus). Exp Parasitol 95, 128 –135. Bingham, A.K., & Meyer, E.A. (1979). Giardia excystation can be induced in vitro in acidic solutions. Nature 277, 301–302. Binz, N., Thompson, R.C.A., Meloni, B.P., & Lymbery, A.J. (1991). A simple method for cloning Giardia duodenalis from cultures and fecal samples. J Parasitol 77, 627– 631. Bouza, M., Maciques, I., Torres, D., & Nu´ nez, F.A. (2000). Giardia. lamblia in mongolian gerbils: characteristics of infection using different human isolates. Exp Parasitol 96, 43– 46. Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of dye binding. Anal Biochem 72, 248 –254. Cedillo-Rivera, R., Enciso-Moreno, J.A., Martinez-Palomo, A., & OrtegaPierres, G. (1989). Giardia lamblia: isoenzyme analysis of 19 axenic strains isolated from symptomatic and asymptomatic patients in Mexico. Trans R Soc Trop Med Hyg 83, 644 – 646. Cedillo-Rivera, R., Enciso-Moreno, J.A., Martinez-Palomo, A., & OrtegaPierres, G. (1991). Isolation and axenization of giardia lamblia isolates from asymptomatic patients in Mexico. Arch Invest Me´ d 22, 79 – 85. Chaudhuri, P., De, A., Bhattacharya, A., Pal, S.C., & Das, P. (1991). Identification of heterogeneity in human isolates of Giardia lamblia by isoenzyme studies. Zbl Bakt 274, 490 – 495. Clark, A.C.G., & Lanigan, M.S. (1993). Prospects for estimating nucleotide divergence with RAPDs. Mol Biol Evol 10, 1096 –1111. Ey, P.L., Mansouri, M., Kulda, J., Nohınkova´ , E., Monis, P.T., Andrews, R.H., & Mayrhofer, G. (1997). Genetic analysis of Giardia from hoofed farm animals reveals artiodactyl-specific and potentially zoonotic genotypes. J Euk Microbiol 44, 626 – 635. Gomes, M.A., Melo, M.N., Macedo, A.M., Furst, C., & Silva, E.F. (2000). RAPD in the analysis of isolates of Entamoeba histolytica. Acta Trop 75, 71–77. Homan, W.L., & Mank, T.G. (2001). Human giardiasis: genotype linked differences in clinical symptomatology. Int J Parasitol 31, 822– 826. Homan, W.L., Van Enckevort, F.H.J., Limper, L., Van Eys, G.J.J.M., Schoone, G.J., Kasprzak, W., Majewska, A.C., & Van Knapen, F. (1992). Comparison of Giardia from different laboratories by isoenzyme analysis and recombinant DNA probes. Parasitol Res 78, 316 – 323. Hopkins, R.M., Meloni, B.P., Groth, D.M., Wetherall, J.D., Reynoldson, J.A., & Thompson, R.C.A. (1997). Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. J Parasitol 83, 44 –51. Katz, D.E., & Taylor, D.N. (2001). Parasitic infections of the gastrointestinal tract. Gastroenterol Clin North Am 30, 797– 815. Keister, D.B. (1983). Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Trans R Soc Trop Med Hyg 77, 487– 488. Link, W., Dixkens, C., Singh, M., & Melchinger, A.E. (1995). Genetic diversity in European and Mediterranean faba bean germ plasm revealed by RAPD markers. Theoret Appl Genet 90, 27–32. Mayrhofer, G., Andrews, R.H., Ey, P.L., & Chilton, N.B. (1995). Division of Giardia isolates from humans into two genetically distinct assemblages by electrophoretic analysis of enzymes encoded at 27 loci and comparison with Giardia muris. Parasitology 111, 11–17. Meyer, E.A. (1976). Giardia lamblia: isolation and axenic cultivation. Exp Parasitol 39, 101–105. Monis, P.T. (1999). The importance of systematics in parasitological research. Int J Parasitol 29, 381–388. Monis, P.T., Mayrhofer, G., Andrews, R.H., Homan, W.L., & Limper, L. (1996). Molecular genetic analysis of Giardia intestinalis isolates at the glutamate dehydrogenase locus. Parasitology 112, 1–12.
278
M.O. Rocha et al. / Diagnostic Microbiology and Infectious Disease 46 (2003) 273–278
Morgan, U.M., Constantine, C.C., Grene, W.K., & Thompson, R.C.A. (1993). RAPD (random amplified polymorphic DNA) analysis of Giardia DNA and correlation with isoenzime data. Trans R Soc Trop Med Hyg 87, 702–705. Nash, T.E., McCutchan, T., Keister, D., Dame, J.B., Conrad, J.D., & Gillin, F.D. (1985). Restriction endonuclease analysis of DNA from 15 Giardia isolates obtained from humans and animals. J Infec Dis 152, 64 –73. Nash, T.E., & Mowatt, M.R. (1992). Identification and characterization of a Giardia lamblia group-specific gene. Exp Parasitol 75, 369 –378. Roberts-Thomson, I.C., Stevens, D.P., Mahmoud, A.A., & Warren, K.S. (1976). Acquired resistance to infection in an animal model of giardiasis. J Immunol 117, 2036 –2037. Sargeaunt, P., & Williams, J. (1978). The differentiation of invasive and non-invasive Entamoeba histolytica by isoenzyme electrophoresis. Trans R Soc Trop Med Hyg 72, 519 –521. Schantz, P.M. (1991). Parasitic zoonoses in perspective. Int J Parasitol 21, 161–170. Steindel, M., Dias Neto, E., Menezes, C.L.P., Romanha, A.J., & Simpson, A.J.G. (1993). Random amplified polymorphic DNA analysis of Trypanosoma cruzi strains. Mol Biochem Parasitol 60, 72– 80. Sullivan, P.B., Marsh, M.N., & Phillips, M.B. (1991). Prevalence and
treatment of giardiasis in chronic darrhoea and malnutrition. Arch Dis Child 66, 304 –306. Thompson, R.C.A., Hopkins, R.M., & Homan, W.L. (2000). Nomenclature and genetic groupings of Giardia infecting mammals. Parasitol Today 16, 210 –213. Valle, P.R., Souza, M.B.G., Pires, E.M., Felix, E.F., & Gomes, M.A. (2000). Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica. Rev Inst Med Trop Sa˜ o Paulo 42, 249 –253. Van Belkun, A.V., Homan, W., Limper, L., & Quinte, W.G.V (1993). Genotyping isolates and clones of Giardia duodenalis by polymerase chain reaction: implications for the detection of genetic variation among protozoan parasite species. Molec Biochem Parasit 61, 69 –78. Visvesvara, G.S., Dickerson, J.W., & Healy, G.R. (1988). Variable infectivity of human-derived Giardia lamblia cysts for Mongolian gerbils (Meriones ungiculatus). J Clin Microbiol 26, 837– 841. Welsh, J., & McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res 18, 7213–7218. Williams, J.G.K., Hanafey, M.K., Rafalski, J.A., & Tingey, S.V. (1993). Genetic analysis using random amplified polymorphic DNA markers. Methods Enzymol 218, 705–740. Williams, J.G.K., Kubelic, A.R., Livak, K.J., Rafalski, J.A., & Tingey, S.V. (1990). DNA polymorphisms amplified by arbitrary are useful as genetic markers. Nucleic Acids Res 18, 6531–35.