Molecular Characterization of Ct-hrp65: Identification of Two Novel Isoforms Originated by Alternative Splicing

Experimental Cell Research 264, 284 –295 (2001) doi:10.1006/excr.2000.5127, available online at http://www.idealibrary.com on

Molecular Characterization of Ct-hrp65: Identification of Two Novel Isoforms Originated by Alternative Splicing Francesc Miralles and Neus Visa 1 Department of Molecular Biology and Functional Genomics, Stockholm University, SE-106 91 Stockholm, Sweden

Hrp65, a protein with two conserved RNA-binding domains, has been identified in Chironomus tentans as a component of nuclear fibers associated with ribonucleoprotein particles in transit from the gene to the nuclear pore. We have cloned two novel hrp65 isoforms and characterized the structure of the hrp65 gene. Comparison of the hrp65 gene to the hrp65 cDNAs revealed that the multiple hrp65 isoforms, hrp65-1, hrp65-2 and hrp65-3, are generated by alternative splicing of a single pre-mRNA. The hrp65-3 mRNA is only detected in C. tentans tissue culture cells of embryonic origin, whereas hrp65-1 and hrp65-2 mRNAs appear to be constitutively expressed. The hrp65 mRNAs are generated by differential 3ⴕ splice site selection at the last exon of the gene. Thus, the three hrp65 transcripts contain different 3ⴕ UTRs and encode proteins that vary in their C-terminal ends. Interestingly, the variant C-terminal region determines the subcellular localization of the hrp65 proteins. In transient transfection assays, hrp65-1 is efficiently targetted to the nucleus, whereas hrp65-2 and hrp65-3 localize mainly to the cytoplasm. Moreover, hrp65-3 is associated with cytoplasmic actin fibers. All together, our findings suggest that the different hrp65 isoforms serve specialized roles related to mRNA localization/transport in the different cell compartments. © 2001 Academic Press Key Words: Chironomus tentans; mRNA biogenesis; hnRNP proteins; mRNA localization; protein localization; genome analysis; PSF; p54 nrb; NonA.

INTRODUCTION

In eukaryotic cells, pre-mRNAs are associated with hnRNP proteins concomitantly with transcription [reviewed in 1, 2]. The resulting pre-mRNP particles are subsequently transported from the site of transcription to the nuclear envelope, where they will be exported to the cytoplasm. The pathways involved in mRNA export have begun to be elucidated [reviewed in 3–5], but the 1 To whom correspondence and reprint requests should be addressed. Fax: ⫹46-8-16 64 88. E-mail: [email protected].

0014-4827/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

mechanisms underlying the intranuclear movement of pre-mRNPs from the site of transcription to the nuclear pore complex are poorly understood. Several lines of evidence suggest that both pre-mRNP diffusion and physical binding of pre-mRNPs to nuclear structures account for the intranuclear trafficking of pre-mRNPs [6 – 8]. Electron tomography studies have recently been carried out in the salivary gland cells of the midge Chironomus tentans in order to investigate possible interactions between a specific pre-mRNP particle, the Balbiani ring (BR) pre-mRNP particle [reviewed in 9], and nucleoplasmic structures. The electron tomographic studies have revealed that the BR particles in transit from the gene to the nuclear pore complex are indeed associated with fibers and large fibrogranular clusters in the nucleoplasm [8]. This observation indicates that pre-mRNPs are not always freely diffusible in the nucleoplasm and reveals the existence of nucleoplasmic structures somehow involved in mRNA biogenesis [8]. The nucleoplasmic fibers in contact with the BR particles, referred to as connecting fibers, have a specific protein composition. Ct-hrp65, also named hrp65 for simplicity, is the first protein that has been identified as a component of these fibers [8]. The hrp65 protein is a 65-kDa protein that shares some common features with hnRNP proteins present in the BR pre-mRNP particles, such as hrp23, hrp36, or hrp45 [10 –12]. These proteins, including hrp65, have a modular structure and contain one or two RNA-binding domains. Moreover, they all can be co-immunoprecipitated from nuclear extracts, which indicates that they are constituents of the same nuclear complexes [8, 13]. However, unlike other hnRNP proteins, hrp65 does not bind the BR pre-mRNA cotranscriptionally nor is it located in the BR pre-mRNP particle itself. Instead, hrp65 is specifically located in the proximal region of the connecting fibers [8]. Database searches have revealed that the hrp65 protein has strong amino acid sequence similarity to other proteins, such as human PSF [14], human p54 nrb [15], and Drosophila NonA/BJ6 [16, 17]. All these proteins contain a central domain of about 320 amino acids

284

ALTERNATIVELY SPLICED FORMS OF hrp65

named DBHS (Drosophila behaviour and human splicing) that is highly conserved. The DBHS domain consists of two RNA-binding domains plus 100 additional amino acids of unknown function located toward the C-terminus [15]. Despite the fact that all these proteins contain a DBHS domain, it has been shown that they play different roles. Human PSF was initially described as a pre-mRNA splicing factor associated with the polypyrimidine tract binding protein [14], and recent reports have proposed a role for both PSF and p54 nrb in transcription regulation [18 –20]. Moreover, it has been shown that the p54 nrb protein is a nonclassical carbonic anhydrase, suggesting a role for this protein in the maintenance of pH homeostasis in the nucleus [21]. In Drosophila, the NonA protein was identified as a chromatin protein that binds to developmentally regulated puffs in a transcription-dependent manner [17, 22]. Mutations in the NonA gene lead to behavioral defects, deterioration of vision, and impaired movement coordination [23], although the precise function of the NonA gene product is not known. Two-dimensional Western blot analysis using antibodies against hrp65 in C. tentans revealed the existence of several immunoreactive proteins of slightly different molecular weights and isoelectric points, which suggested the possible existence of multiple hrp65-related polypeptides [8, 13]. Since hrp65 is likely to play an important role(s) in mRNA biogenesis, we sought to identify and characterize the multiple hrp65 isoforms. Here we describe the cloning and sequencing of cDNAs encoding two novel hrp65 isoforms. We also present the nucleotide sequence, the intron– exon structure, and the chromosomal location of the hrp65 gene. Our results show that the three hrp65 isoforms, which only differ in their C-terminal ends, are generated by alternative splicing. Moreover, we show that the variant C-terminal sequences of the hrp65 isoforms contain determinants for intracellular localization. The biological significance of these findings is discussed in relation to the possible functions of hrp65. MATERIALS AND METHODS Animal and cell culture. C. tentans and C. tentans tissue culture cells were cultivated as described previously [24, 25]. Human HeLa cell and Drosophila Schneider’s cell lines were grown in Dulbecco’s modified Eagle’s medium and Scheider’s medium, respectively. Both media contained 10% fetal bovine serum and were supplemented with 100 U/ml penicillin and 100 ␮g/ml streptomycin. Isolation and cloning of two novel hrp65 cDNAs. In a previous screening of a Lambda ZAP cDNA library from the salivary glands of C. tentans, we obtained four clones. The ␭-hrp65-1 clone and its encoded protein, hrp65 (designated hrp65-1 thereafter), have been described previously [8]. Further analysis of the isolated clones revealed that the ␭-hrp65-4 clone contained a partial ORF, namely, hrp65-2, which was identical to the predicted ORF from ␭-hrp65-1 but with 17 different C-terminal amino acids. The full-length cDNA for hrp65-2 was obtained by PCR using a sense oligonucleotide

285

corresponding to the 5⬘ UTR of ␭-hrp65-1 (65UTR, 5⬘ TTCGGTCTCATTTCAATTA 3⬘) and an antisense primer corresponding to the 3⬘ UTR of ␭-hrp65-4 (5⬘ TTCTGCAATGTCCCTCAACG 3⬘). A Lambda ZAP cDNA library from C. tentans tissue culture cells was used as a template and amplification was carried out with Pfu DNA polymerase (Stratagene). A 1600-bp PCR product was obtained, 3⬘ A-tailed with Taq polymerase, cloned into pCR2.1-TOPO (Invitrogen), and sequenced. A third hrp65 isoform, designated hrp65-3, was obtained when specific oligonucleotides for hrp65-1 (65L, 5⬘ TCTCgtcgacATAACGTCTTCGCTTATTTTGG 3⬘) and hrp65-2 (65S, 5⬘ CATTgtcgacGCCATTCCTATAACGTGCTT 3⬘) were used in conjunction with oligonucleotide 65F5 (5⬘ AATGAATCATCAAGGCGGTG 3⬘) in a PCR reaction to detect the presence of the hrp65-1 and hrp65-2 transcripts in C. tentans tissue culture cells. A third PCR band was detected, which was purified, cloned, and sequenced. Its nucleotide sequence revealed a novel isoform with 12 differing amino acids at the C-terminus. The full-length ORF of hrp65-3 was obtained by PCR from the tissue culture cDNA library using the 65UTR and 65L primers. Since these oligonucleotides also amplify the hrp65-1 cDNA, the PCR products were cloned into pCR.2.1-TOPO (Invitrogen) and different clones were analyzed by sequencing. Analysis of C. tentans hrp65 genomic structure. C. tentans DNA (200 ng) was PCR amplified using four sets of primers designed from the coding region of the ␭-hrp65-1 clone and from the 3⬘ UTR of ␭-hrp65-4. The primer sets were 65ATG (map position 1–21)-65Reco (5⬘ TGgaattcCGGCATTTGCACGATAATC 3⬘, map position 1240 – 1257); 65F1 (5⬘ TGATTATCGTGCAAATGCCG 3⬘, map position 1238 –1257); 65L9R3 (5⬘ TGCATATCGTCTTGTTGCC 3⬘, map position 1942–1960); 65F4 (5⬘ CGTGAACAATTGAGGAAGCG 3⬘, map position 1830 –1849); 65L (map position 4041– 4061); 65F5 (map position 2067–2082); and 3⬘ UTR (5⬘ TTCTGCAATGTCCCTCAACG 3⬘, map position 6890 – 6913). Map positions are given with respect to the final genomic sequence. PCR reactions were performed with Pfu polymerase and the products were purified and directly sequenced using walking primers. In addition, to resolve sequence ambiguities, PCR products were also 3⬘ A-tailed with Taq polymerase and cloned into pCR2.1-TOPO. At least two independent clones were sequenced in each case. Nucleotides 6914 to 7306 were taken directly from the 3⬘ UTR of clone ␭-hrp65-4, since PCR analysis of genomic DNA revealed a lack of introns within this region. RNA and DNA isolation. Total RNA was extracted from freshly dissected C. tentans organs, tissue culture cells, or cytosolic and nuclear fractions of tissue culture cells by the Chomczynski method [26]. Poly(A) ⫹ mRNA was obtained from total RNA from C. tentans tissue culture cells with the Oligotex mRNA kit (Qiagen). Genomic DNA was purified from C. tentans culture cells according to standard procedures [27]. RT–PCR. Total RNA from 10 C. tentans organs or 2 ␮g of total RNA from cytoplasmic, nuclear, or whole C. tentans tissue culture cells was primed with hexanucleotides and reverse transcribed with MML-V reverse transcriptase (Gibco) for 1 h at 37°C in a final volume of 20 ␮l. Then, 5 ␮l of cDNA was used in a multiplex PCR with sense 65F5 oligonucleotide (common to all hrp65 isoform mRNAs) and antisense 65S (specific for hrp65-2 mRNA) and 65L (which anneals both hrp65-1 and hrp65-3 mRNAs) primers. PCR reactions (50 ␮l) were performed with 1.25 mM dNTPs, 1.5 mM MgCl 2, 50 mM KCl, 10 mM Tris–HCl, pH 8.3, 2 U Taq polymerase (Roche), and 0.2 mM each primer. Amplification was carried out for 35 cycles and the parameters were 94°C for 30 s, 50°C for 30 s, and 72°C for 2 min. For semiquantitative PCR, 15-␮l aliquots were removed from the assay during the linear amplification range (15 cycles) and run on a 2% agarose gel. The gel was soaked in denaturing solution (0.4 N NaOH, 1 M NaCl) for 1 h, further neutralized (1 M Tris–HCl, pH 7.4, 1.5 M NaCl) for 1 h, blotted, and hybridized with a full-length digoxigenin-labeled hrp65 probe. The remaining PCR mixture was

286

MIRALLES AND VISA

allowed to proceed for another 20 cycles, run on a 2% agarose gel, and ethidium bromide stained to verify correct amplification products. When indicated, oligonucletides 5⬘ ATGCGAACTGCGTATGAA 3⬘ (map position 3354 –3371, intron 3) and 65I3 (map position 3902– 3921, exon 4a) were used to PCR amplify the cDNA from 2 ␮g of total RNA extracted from the cytoplasmic and nuclear fractions of C. tentans tissue culture cells. Genomic DNA (200 ng) was used as a control. PCR was allowed to proceed for 40 cycles. Northern and Southern blot analyses. For Northern blot analysis, 5 ␮g of poly(A) ⫹ mRNA was size fractionated by electrophoresis on a 1% agarose gel in 200 mM Mops, pH 7.0, 1 mM EDTA, and 6% formaldehyde. For Southern blot analysis, 8 ␮g of restriction enzyme-digested genomic DNA was size fractionated on a 0.8% agarose gel in 0.5 ⫻ TBE. Nucleics acids were transferred to positively charged nylon membranes (Roche) by capillarity and UV crosslinked. A full-length hrp65-1 cDNA was labeled with digoxigenin– dUTP with the random-primed DNA Labeling Kit (Roche) and used as a probe. Prehybridization and hybridization steps were performed at 65°C. Chemiluminescent detection of digoxigenin-labeled nucleic acids was carried out with either CSPD (Roche) or DuoLux (Vector). Plasmid constructions. To solely obtain the open reading frame of the three hrp65 isoforms, the tissue culture cDNA library was PCR amplified using Pfu DNA polymerase and a common sense oligonucleotide containing a XhoI site (65ATG, 5⬘ CCGCCGctcgagATGGATGTGAAAGCGGAAGCA 3⬘) together with oligonucleotides 65L, 65S, and a hrp65-3-specific primer, 65I3 (5⬘ CCGCCGctcgagGATAAGGTTTTTCAGAGTGG 3⬘). Following 3⬘ A-tailing, the PCR products were cloned into pCR.2.1-TOPO, thus generating pCR2.1-hrp65-1, pCR2.1-hrp65-2, and pCR2.1-hrp65-3. These plasmids were sequences to verify correct coding sequences of the cloned inserts and were further used for subcloning purposes. Fusions of green fluorescent protein (GFP) to hrp65 isoforms were constructed in pEGFP-C3 (Clontech). A XhoI fragment from pCR2.1hrp65-3 was cloned into the XhoI site of pEGFP-C3. The resulting plasmid was digested with HindIII and BamHI, and the backbone was purified and ligated with excised HindIII–BamHI fragments from pCR2.1-hrp65-1, pCR2.1-hrp65-2, and pCR2.1-hrp65-3, respectively, thus generating pEGFP-C3-hrp65-1, pEGFP-C3-hrp65-2, and pEGFP-C3-hrp65-3. To generate an EGFP-hrp65 fusion protein spanning amino acids 1– 499, oligonucleotides 65ATG and 5⬘ GCGcctaggCTGATTTCCTTGATAATGCTG 3⬘ were used in a PCR reaction with pCR2.1-hrp65-1 as a template. The resulting PCR product was digested with XhoI and BamHI and cloned into pEGFP-C3 to produce p-EGFP-C3-hrp65(1– 499). Similarly, fusion of hrp65-1 amino acid residues 500 –535 to GFP was performed by PCR with oligonucleotides 5⬘ GGGAggatccCGATCAAGGAAATCGTTTTGAC 3⬘ and M13 reverse primer using pCR2.1-hrp65-1 as a template. The PCR product was digested with BglII and EcoRI and cloned into pEGFP-C3 to obtain pEGFP-C3-hrp65-1(500-535). A Drosophila GFP expression vector, namely, pAct5C-PL-EGFP, was generated by cloning a BglII–NotI EGFP fragment from pEGFP-N1 into the BamHI–NotI sites of pAct5C-PL [28]. To construct the different GFP-hrp65 Drosophila expression plasmids, pEGFPC3-hrp65-1, pEGFP-C3-hrp65-2, and pEGFP-C3-hrp65-3 plasmids were digested with BamHI and the ends were blunt-ended by filling in with Pfu DNA polymerase. These plasmids were further digested with NheI and the corresponding EGFP-C3-hrp65 cassettes were cloned into the SpeI–HpaI sites of pAct5C-PL. The resulting plasmids are designated pAct5C-PL-EGFP-hrp65-1, pAct5C-PL-EGFPhrp65-2, and pAct5C-PL-EGFP-hrp65-3. Transfection assays. For transient transfection experiments, 1.5 ⫻ 10 5 HeLa cells or 5 ⫻ 10 5 Scheider’s cells were seeded overnight onto coverslips in 35-mm dishes. For Drosophila experiments, the coverslips were precoated with poly-L-lysine. Cells were transfected overnight with 5 ␮g of plasmid by the calcium phosphate precipitation method [27]. After transfection, cells were washed three times in PBS and cultured for an additional 6 h in fresh media before assess-

ment of fluorescence. Transfection experiments were repeated at least three times with reproducible results. Fluorescence was observed under a Zeiss Axioplan 2 microscope. When indicated, cells were treated with 10 ␮M colchicine (Sigma), 5 ␮M cytochalasin D (Sigma), or solvent alone for 2 h prior to the assessment of fluorescence. Immunofluorescence assay. C. tentans tissue culture cells were fixed in 3.7% formaldehyde in PBS for 15 min, rinsed twice in PBS, and permeabilized with 0.2% SDS in PBS for 7 min. The cells were blocked for 1 h with 3% BSA in PBS and incubated for an additional h with mAb 4E9 at a 1:4 dilution with 3% BSA in PBS. MAb 4E9 recognizes all three hrp65 isoforms and has been described previously (8). The cells were washed twice in PBS for 5 min and subsequently incubated for an h with a TRITC-labeled secondary antibody in 3% BSA in PBS. Following three washing steps with PBS, mounting medium containing DAPI (Vector) was added, and the cells were visualized under a fluorescence microscope. In situ hybridization of chromosome squashes. Salivary glands were fixed in 3:1 ethanol:acetic acid for 5 min and squashed in a drop of 45% acetic acid. The slides were frozen on dry ice, the coverslips pried off, and the preparations further fixed in 3:1 ethanol:acetic acid for 10 min. Slides were incubated at 70°C for 30 min in 2⫻ SSC, washed in 0.1⫻ SSC, treated with 0.07 M NaOH for 90 s to denature chromosomal DNA, dehydrated, and air-dried at room temperature. Chromosome preparations were covered by hybridization buffer containing 2⫻ SSC, 50% formamide, 10% dextran sulfate, 0.4 mg/ml single-stranded salmon sperm DNA, and 500 ng/ml of digoxigeninlabeled full-length hrp65-1 probe. Slides were incubated at 80°C for 10 min, followed by an overnight incubation at 42°C. The next day, the preparations were washed twice in 2⫻ SSC for 5 min, once in TBS containing 0.1% Triton X-100 for 5 min, and twice in TBS for 5 min. Detection of digoxigenin-labeled probe was performed using an alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) according to the manufacturers. NBT/BCIP (Roche) was used as a colorimetric detection substrate. Stained chromosome preparations were observed under phase-contrast microscopy. Sequence analysis. Sequence analysis was performed with the University of Wisconsin Genetics Computer Group Sequence Analysis Programs [29] and EGCG extensions to the Wisconsin Package Sequence Analysis Programs.

RESULTS

cDNA Cloning of Two Novel hrp65 Isoforms We have previously described the cloning and characterization of the hrp65 protein in C. tentans, designated hrp65-1 hereafter, and we showed by two-dimensional gel analysis that there might be hrp65-related gene products [8]. By using a combination of cDNA library screening and PCR approach, we have cloned two novel hrp65 isoforms. A partial nucleotide sequence for the second hrp65 isoform, hrp65-2, was obtained in the previous C. tentans salivary gland cDNA library screening [8]. One of the isolated clones, ␭-hrp65-4, was found to have a 2-kb insert that included a partial open reading frame (1377 nt), encoding a protein 97% homologous to hrp65-1, and a 3⬘ UTR (624 nt) totally unrelated to that of hrp65-1. A hrp65-2 full-length cDNA was obtained by PCR from a C. tentans cDNA library with oligonucleotides corresponding to the 5⬘ UTR of ␭-hrp65-1 and to the 3⬘ UTR of ␭-hrp65-4.

ALTERNATIVELY SPLICED FORMS OF hrp65

FIG. 1. Schematic structure of the hrp65 protein isoforms. (A) Graphical depictions of the three hrp65 isoforms. The RNA-binding domains (RBDs) and Drosophila behavior human splicing domain (DBHS) are shown in the figure. (B) Amino acid sequences at the C-termini of the different hrp65 protein isoforms.

A third hrp65 isoform, hrp65-3, was incidentally detected when specific oligonucleotides for hrp65-1 and hrp65-2 were used in a PCR reaction to analyze the presence of the hrp65 isoforms in C. tentans tissue culture cells. A third unexpected PCR band was detected, purified, cloned, and sequenced. Its nucleotide sequence revealed a third predicted isoform coding for a different carboxy terminus. As for hrp-65-2, the fulllength ORF of hrp65-3 was obtained by PCR from a tissue culture cDNA library. The predicted proteins encoded by hrp65-1, hrp65-2, and hrp65-3 cDNA clones were 535, 517, and 512 amino acids long, respectively, and their predicted molecular weights were 62, 60, and 59 kDa. Their isoelectric points were 9.64, 9.74, and 9.48. The amino acid sequences of the three hrp65 isoforms were identical

287

from amino acid residues 1 to 499, which includes both the N-terminal region and the DBHS domain (Fig. 1A). The C-termini amino acid sequences of the hrp65 isoforms are shown in Fig. 1B. These C-termini share the characteristic of containing highly charged residues that contribute to the predicted overall basicity of hrp65 isoforms. Database sequence searching with these variant C-terminal amino acid sequences revealed no significant homology to any known sequence, except for the last amino acids of hrp65-1, which have been previously shown to be conserved in the human PSF and p54 nrb proteins and in the Drosophila NonA protein [8]. Chromosomal Mapping of the hrp65 Gene In order to address whether the different hrp65 isoforms were generated from either one or more gene copies, we performed both in situ hybridization and Southern blot analysis. To localize the hrp65 gene in C. tentans chromosomes, in situ hybridization experiments were carried out on polytene chromosomes using squash preparations of salivary gland cells. A fulllength hrp65-1 cDNA was labeled with digoxigenin and used as a probe. As shown in Fig. 2A, a single band was observed on chromosome II-19B. The unique site detected by polytene chromosome in situ hybridization suggested that there was only one copy of the hrp65 gene in the C. tentans genome. We further investigated this by performing Southern hybridization using the same hrp65 cDNA as a probe. Southern hybridization resulted in a very simple band pattern (Fig. 2B). Single bands were observed with restriction enzymes that do not cut the hrp65-1 cDNA, either XbaI or NheI, and only two bands were detected with enzymes that cut

FIG. 2. The presence of a single hrp65 gene in Chironomus tentans. (A) In situ hybridization of a full-length hrp-65-1 cDNA probe to C. tentans polytene chromosomes. Only chromosomes II and III are shown. A single band can be seen on chromosome II (arrow). The bar represents 10 ␮m. (B) Southern hybridization of the hrp-65-1 probe to C. tentans genomic DNA digested with the indicated restriction enzymes. The molecular sizes of a DNA ladder, given in kb, are indicated on the left.

288

MIRALLES AND VISA

FIG. 3. Schematic structure of the hrp65 gene and alternative splicing of the hrp65 pre-mRNA. (A) The hrp65 gene structure is depicted. Exons are shown as black boxes and carets span the alternatively excised sequences. Stop codons in the three cDNA clones are shown, and the position and length of the resulting 3⬘ UTRs are represented as dashed lines. (B) Schematic representation of the exon composition of the three splice variants of the hrp65 gene and of their 3⬘ UTRs. The rectangle represents the protein coding region and the exons are boxed. Dashed lines represent the 3⬘ UTRs. (C) Nucleotide sequences at the intron– exon junctions in the hrp65 gene. Exonic nucleotides are boxed and nucleotides differing from the consensus sequence of splice donor (DS) and acceptor sites (AS) are in bold.

the hrp65 cDNA once, either HindIII or PstI. Two bands were also found with XbaI/HindIII and NheI/ HindIII double digests. All together, the results from both in situ and Southern hybridization were consistent with the presence of a single hrp65 gene and the absence of pseudogenes. Genomic Structure of the hrp65 Gene Since the three hrp65 isoforms were generated from one single gene, we sought to define the splicing patterns that give rise to these isoforms. We therefore determined the DNA nucleotide sequence of the hrp65 gene, which was obtained by means of a PCR-based strategy, as described under Materials and Methods. Several oligonucleotides deduced from the coding region of hrp65-1 cDNA and from the 3⬘ UTR of hrp65-2 cDNA were used to PCR-amplify the hrp65 gene from C. tentans genomic DNA. Four independent overlapping fragments were obtained, cloned, and sequenced. The structure of the whole hrp65 gene, illustrated in Fig. 3A, was deduced from these four sequence overlaps, together with the 3⬘ UTR of the ␭-hrp65-4 cDNA clone, which was shown by PCR not to contain introns.

The hrp65 gene sequence has been deposited in the GenBank nucleotide sequence database with Accession No. AJ404654. The hrp65 gene spans 7.3 kb and is organized into six exons and five introns, whose positions were identified by comparing genomic and cDNA sequences (Fig. 3A). The exons range in size from 41 (exon 4a) to 1194 bp (exon 2) and the sizes of the introns vary from 61 (intron 2) to 4411 bp (intron 3c). The three hrp65 cDNA variants result from differential 3⬘ splice site selection. Hrp65-1, hrp65-2, and hrp65-3 cDNAs contain exons 4b, 4c, and 4a, respectively, and their 3⬘ UTRs are different (Fig. 3B). The 3⬘ UTRs of the hrp65-1 and hrp65-2 transcripts span nucleotides 4066 – 4556 and 6699 –7306, respectively. They contain either one or three polyadenylation signals at nucleotide positions 4119 (hrp65-1) and 6811, 7211, and 7270 (hrp65-2). The 3⬘ UTR of the hrp65-3 transcript spans the intervening sequence between exons 4a and 4b, as well as exon 4b. These sequences do not contain any polyadenylation signal and therefore it is likely that the 3⬘ UTR of hrp65-3 includes the 3⬘ UTR of hrp65-1. The nucleotide sequences at the exon/intron boundaries showed that all of the introns begin with the consensus splice site 5⬘-GT dinucleotide and conclude with 3⬘-AG termini (Fig. 3C). In summary, our results demonstrate that the hrp65 pre-mRNA generates three different mRNAs by alternative selection of acceptor sites in the fourth exon. This results in the generation of three transcripts that contain distinct 3⬘ UTRs and give rise to different protein isoforms. Comparison of Chironomus hrp65 and Drosophila NonA Genes Searches in the Drosophila melanogaster genome database revealed that the hrp65 ortholog in D. melanogaster is the NonA/BJ6 gene. Since the NonA gene structure has been characterized (GenBank Accession No. M33496; and 16), we compared the hrp65 and the NonA genes. Both genes were found to have a highly similar exon organization, consisting of six exons, which were designated 1–3, 4a, 4b, and 5 in the Drosphila gene and 1–3, 4a, 4b, and 4c in the Chironomus gene. The sizes of exons and the phases of splicing were also very conserved, except for intron 2 and exon 3, which were considerably longer in Drosophila than in Chironomus, and intron 3a, which was much longer in Chironomus (Fig. 4). The amino acid sequences of the N-terminal domains encoded by exon 1 were significantly different between the hrp65 and NonA genes. Comparison of the exon structures with the functional domains revealed that the DBHS domain was encoded by most of exon 2 and the whole of exon 3 in the NonA gene and by exon 2 in

ALTERNATIVELY SPLICED FORMS OF hrp65

289

the hrp65 gene. The structural features of the 3⬘ regions of both genes were also conserved. This region contained three short exons (exons 4a– 4c in C. tentans and exons 4a, 4b, and 5 in D. melanogater) which are responsible for the alternate exon coding potential of the two genes (two and three isoforms for the NonA and the hrp65 genes, respectively). The identities of the amino acid sequences coded by these exons were only similar for C. tentans exon 4c and D. melanogaster exon 5, but they all encode highly charged residues. Expression of the hrp65 Gene FIG. 4. Comparison of the Drosophila NonA and the C. tentans hrp65 genes. Exons are represented as black boxes and, for simplicity, two attached exons in the Drosophila gene are simply boxed. The NonA and hrp65 proteins are aligned and the highly conserved DBHS domain, including the two RNA-binding domains, is indicated. Correspondence between the exon structure and the conserved DBHS domains is depicted with dashed lines.

In order to characterize the transcripts originating from hrp65, we first performed Northern blot analysis. Poly(A) ⫹ mRNA was purified from C. tentans tissue culture cells, size fractionated, immobilized on a nylon membrane, and hybridized using the full-length hrp65-1 cDNA as a probe. As shown in Fig. 5A, a

FIG. 5. Transcript analysis of the hrp65 gene. (A) Northern blot analysis of 5 ␮g of poly(A) ⫹ mRNA from C. tentans tissue culture cells with a full-length hrp65-1 probe. Human rRNAs were used as molecular size markers and are shown on the left in kilobases. (B) Semiquantitative RT–PCR of hrp65 mRNAs. Total RNA (2 ␮g) from C. tentans tissue culture cells was reverse-transcribed and subjected to multiplex PCR with specific primers for the hrp65 cDNAs. In the linear amplification range, an aliquot was removed and Southern blot analysis was performed using the full-length hrp65-1 cDNA as a probe. Molecular sizes of a DNA marker run in parallel are shown in basepairs. (C) Total RNA was extracted from the head (H), Malpighian tubules (MT), and gut (G) of fourth instar larvae and adult midges and subjected to multiplex RT–PCR as in B, except that 35 cycles were performed. Total RNA from tissue culture cells (TC) was processed in parallel. Water was used in parallel as a negative control (C⫺). The size of the DNA ladder (lane M) is shown in basepairs. (D) Cytoplasmic analysis of hrp65 transcripts. Total RNA from cytoplasmic (lanes 1, 3, 5) or nuclear fractions (lanes 2, 4, 6) was subjected to PCR analysis with specific primers for hrp65 transcripts (lanes 1 and 2) or primers spanning an intron– exon boundary (lanes 3–7). cDNA synthesis was peformed with (lanes 3 and 4) or without (lanes 5 and 6) the addition of reverse transcriptase. DNA was used in parallel as a control (lane 7).

290

MIRALLES AND VISA

prominent band with an estimated size of 2.6 kb was detected. This was in agreement with the full length of hrp65 cDNA clones which, including the 3⬘ UTR, was 2.2 kb. Based on this result, we suggest that the 5⬘ UTR and the poly(A) ⫹ tail account altogether for approximately 400 bp. We also determined the relative abundance of the alternatively spliced hrp65 transcripts by means of a semiquantitative RT–PCR approach. Total RNA was purified from C. tentans tissue culture cells, reverse transcribed, and subjected to a multiplex PCR reaction with oligonucleotides designed to amplify the distinct hrp65 cDNAs. The PCR reaction was only allowed to proceed in the linear amplification range (15 cycles) and the PCR products were subsequently size fractionated, blotted, and probed with labeled hrp65 cDNA (Fig. 5B). The three types of transcripts could be detected in this assay, which indicated that all of them were relatively abundant RNA species. Moreover, some differences were detected in the relative abundances: hrp65-1 and hrp65-2 mRNAs were expressed at similar levels, whereas hrp65-3 transcripts were less abundant. To address whether the distinct hrp65 transcripts display developmental or tissue-specific expression, total RNA was extracted from different organs at two developmental stages. Gut, malpighian tubules, and head were dissected from both fourth instar larvae and adult midges. Total RNA from C. tentans tissue culture cells was purified in parallel. RNAs were reverse-transcribed and subjected to PCR. As shown in Fig. 5C, hrp65-1 and hrp65-2 transcripts were detected in all of the tissues and developmental stages analyzed, as well as in the C. tentans tissue culture cells. In contrast, hrp65-3 transcript was only detected in C. tentans tissue culture cells, which are of embryonic origin. These results demonstrate the existence of a cell type-specific splicing regulation at the 3⬘ acceptor site of intron 3a. We next confirmed that the three hrp65 mRNAs were present in the cytoplasm of C. tentans tissue culture cells by RT–PCR analysis of total RNA from either cytosolic or nuclear fractions. As shown in Fig. 5D, PCR bands corresponding to each of the three different isoforms were detected in both cytoplasm (lane 1) and nucleus (lane 2). Oligonucleotides designed to detect intron-containing transcripts only produced a band in the nuclear cDNA fraction (lane 4) and in the genomic DNA used as a positive control (lane 7). Moreover, no PCR product was observed in the nuclear cDNA in the absence of reverse transcriptase, which excluded the possibility of DNA contamination (lane 6). In summary, the cytoplasmic detection of hrp65 transcripts excluded the possibility that they could be partially processed transcripts of nuclear origin. Based on this observation, we concluded that hrp65-1, hrp65-2, and hrp65-3 mRNAs were mature transcripts exported

to the cytoplasm and most likely translated into protein. Different Subcellular Localization of hrp65 Isoforms We analyzed the localization of hrp65 in C. tentans tissue culture cells by indirect immunofluorescence using monoclonal antibody 4E9 [8], which recognizes all hrp65 isoforms. As a reference for nuclear localization, the cells were double stained with DAPI. As shown in Fig. 6A, the nuclei of the cells were intensely stained by the anti-hrp65 antibody. However, the anti-hrp65 antibody also gave a significant diffuse fluorescence in the cytoplasm. When we searched for possible nuclear localization signals (NLSs) in the hrp65 sequence, hrp65-1 appeared to be the only isoform that contained a putative NLS. This sequence was located at the C-terminus of hrp65-1, amino acids 526 –534 (DDFQNKRRR), and was similar to basic NLSs, which are characterized by a cluster of basic amino acids preceded by either an acidic amino acid or a proline residue [reviewed in 30]. This putative NLS was absent from hrp65-2 and hrp65-3, but conserved not only in Drosophila NonA but also in the human proteins PSF and p54 nrb [8]. The absence of conserved NLSs in hrp65-2 and hrp65-3 raised a question about the subcellular localization of these isoforms. To investigate this point, each of the three hrp65 isoforms was fused to the GFP and the localization of the fluorescent fusion protein was analyzed in transient transfection assays. Attempts to transfect C. tentans cells were unsuccessful and therefore the experiments were carried out in two heterologous systems: human HeLa and Drosophila Scheider’s cell lines. In all cases, expression plasmids were transfected into cells and fluorescence was observed after 6 h of calcium phosphate removal. Similar results were obtained in human and insect cells, which argued against the possibility that the observed results might be artifactual. As expected, the GFP protein alone was located in both nucleus and cytosol (Fig. 6B). However, when GFP was fused to hrp65-1, the fluorescence was distinctly targeted to the cell nucleus. In contrast to the nuclear localization of GFP-hrp65-1, the GFPhrp65-2 fusion protein was localized diffusely in the cytosol. The GFP-hrp65-3 chimeric protein was also cytosolic but, rather than diffuse, it was localized to fibers of variable length that extended across the cell. Such fibers were longer and more apparent in HeLa than in Schneider’s cells, but short fluorescent fibers were also observed in the Schneider’s cells. In order to determine whether the observed fibers were related to cytoskeletal structures, transfected HeLa cells expressing GFP-hrp65-3 were subsequently treated with either cytochalasin D, an actin disrupting drug, or colchicine, a microtubule disrupting agent (Fig. 6C).

ALTERNATIVELY SPLICED FORMS OF hrp65

291

FIG. 6. Subcellular localization of hrp65 isoforms. (A) C. tentans tissue culture cells were stained with the monoclonal antibody 4E9, which recognizes an epitope in hrp65 that is common to all the isoforms, followed by a TRITC-conjugated secondary antibody. The cells were counterstaied with DAPI as a marker for nuclear localization. The bar represents 5 ␮m. (B) GFP fused to each hrp65 isoform and GFP alone were transiently expressed in human HeLa and Drosophila Scheider’s cell lines grown on coverslips. GFP alone was distributed all through the cell. GFP fused to hrp65-1 (GFP-hrp65-1) gave a distinct spotted pattern in the nucleus. GFP-hrp65-2 was diffusely distributed in the cytoplasm, with occasional cytoplasmic aggregates. GFP-hrp65-3 was also diffuse in the cytoplasm but it was mainly concentrated in fluorescent fibers. Bars represent 5 and 20 ␮m for Schneider’s and HeLa cells, respectively. (C) HeLa cells transfected with GFP-hrp65-3 were treated with cytochalasin D (5 ␮M), colchemid (10 ␮M), or solvent alone (control) and observed under the fluorescence microscope. The fluorescent fibers were no longer visible after cytochalasin D treatment. The bar represents 20 ␮m.

After cytochalasin D treatment, the GFP-hrp65-3 chimeric protein became diffusely localized in the cytosol and formed nonfibrillar fluorescent aggregates. In contrast, treatment of cells with colchicine did not disrupt the fluorescent fibers and had no effect on GFP-hrp65-3 localization. In summary, our results indicated that only one of the isoforms, hrp65-1, was efficiently imported into the nucleus and that the variant C-terminal sequences of

the hrp65 proteins were relevant for the subcellular localization of each isoform. To confirm the role of the variant C-terminal sequence of hrp65-1 in nuclear localization, the following experiment was carried out. We constructed a GFPhrp65 fusion protein that consisted of amino acids 1 to 499, which are identical in all hrp65 isoforms, and a second GFP chimeric protein with only the 36 C-terminal amino acids of hrp65-1. Following transient trans-

292

MIRALLES AND VISA

FIG. 7. The C-terminal region of hrp65-1 contains a nuclear localization signal. Fusions of GFP with either amino acids 1 to 499, identical in all hrp65 isoforms, or amino acids 500 to 535 from hrp65-1 were transiently expressed in HeLa cells. GFP alone was expressed in parallel and found to be present in both the nucleus and cytoplasm. GFP-hrp65(1-499) was excluded from the nucleus and showed diffuse cytoplasmic localization, whereas GFP-hrp65-1(500-535) was diffusely distributed inside the nucleus. The bar represents 20 ␮m.

fection assays in HeLa cells, GFP-hrp65(1-499) was localized diffusely in the cytosol (Fig. 7) and, moreover, it was never found to be associated with fibers. On the other hand, GFP-hrp65-1(500-535) was efficiently localized to the nucleus (Fig. 7). These results demonstrated that the 36 C-terminal amino acids of hrp65-1 contain a NLS sufficient to drive the nuclear localization of a heterologous protein. DISCUSSION

Here we describe the structure of the C. tentans hrp65 gene and the expression of three hrp65 isoforms produced by alternative splicing. The hrp65 gene is composed of six exons and five introns. Multiple 3⬘ splice sites are alternatively used for removal of the downstream intron, which results in three hrp65 mRNAs that differ in the last exon and in the 3⬘ UTR. When translated into protein, these mRNAs give rise to three different protein isoforms that share 499 amino acids and differ at the C-terminus. Furthermore, we have shown that the variable C-terminal sequences are functional determinants of intracellular localization. NonA, the Homolog of Ct-hrp65 in Drosophila The hrp65 protein is structurally very similar to the D. melanogaster NonA protein, not only in the DBHS domain but also in the C-terminal domain. Moreover, the genes that code for hrp65 and NonA in Chironomus and Drosophila, respectively, are also similar in terms of exon organization and splicing patterns. Although a single NonA protein has been reported at the protein level [31], cDNA analysis in Drosophila has revealed that the exons located toward the 3⬘ end of the NonA pre-mRNA are alternatively selected, which results in the production of two NonA mRNAs encoding different C-termini [16]. It is interesting to note that hrp65 exon 4b, which encodes amino acid sequences responsible for

nuclear localization, and NonA exon 5 are highly conserved. Considering that exon 5 of NonA is present in only one of the NonA mRNAs, it is tempting to speculate that the two putative NonA isoforms are also targeted to different cell compartments. Based on the structural conservation between hrp65 and NonA, both proteins are likely to be functionally related. In a recent report, Reim and co-workers [32] showed that NonA is part of a large complex composed of at least four different proteins, including the zing finger containing PEP protein [33]. In C. tentans, hrp65 and PEP co-immunoprecipitate and colocalize in a specific subset of loci in the salivary gland polytene chromosomes (O.P. Singh, N. Visa, S. Amero, and B. Daneholt, in preparation), which suggests that hrp65 and NonA have similar partners in vivo and are likely to be functionally equivalent. It is interesting to note, however, that the amino acid sequences encoded by exon 1 are highly divergent, suggesting that the Nterminal domains of these proteins might serve specialized functions. Specific Features of Hrp65 Isoforms Our RT–PCR analysis revealed that the hrp65-1 and hrp65-2 isoforms are ubiquitously expressed in larval and adult organs, whereas hrp65-3 shows a more restricted pattern of expression. This observation suggests that selection of the 3⬘ acceptor site of hrp65-3 is specifically regulated, since hrp65-3 mRNAs could be detected only in C. tentans tissue culture cells but not in larval and adult tissues. These differences in the pattern of expression suggest that hrp65-1 and hrp65-2 might serve a general function required in all cell types, whereas hrp65-3 might play specialized roles restricted to specific cell types or developmental stages. Interestingly, the C. tentans tissue culture cells that express hrp65-3 are of embryonic origin [25], which suggests that hrp65-3 might have a specialized function in the embryo. Given the essential roles of other

ALTERNATIVELY SPLICED FORMS OF hrp65

RNA-binding proteins in RNA localization during embryonic development [34, 35], it will be interesting to further characterize the embryonic expression of the hrp65 isoforms. When single hrp65 isoforms were transiently expressed in either human or insect cells, only hrp65-1 was efficiently imported into the nucleus. However, the immunofluorescence assay with an antibody against all the isoforms revealed that hrp65 is mostly nuclear. A different abundance of the three isoforms could explain this observation. The three hrp65 mRNAs differ in their 3⬘ UTRs, which might confer different properties in terms of stability and translation efficiency. In this context, it is important to recall that the levels of expression observed in the transfection assays are determined to a large extent by the properties of the expression vector and do not reflect the abundance of each isoform in its physiological context. The C-terminus of hrp65-1 contains a NLS sufficient to drive the nuclear localization of a heterologous protein in both human and insect cells. It is interesting to note that residues 526 –534 of hrp65-1, which resemble a basic NLS, are highly conserved in PSF, p54 nrb, and NonA [8], which suggests that the C-terminal sequences of these proteins account for their nuclear localization. Unlike hrp65-1, hrp65-2 and hrp65-3 proteins are not imported into the nucleus but remain mostly in the cytoplasm. The cytoplasmic localization of hrp65-2 is diffuse, while hrp65-3 is associated with fibers. The nature of these fibers is most likely to be actin, since destabilization of actin microfilaments, but not disruption of the microtubule network, was able to induce a diffuse cytosolic localization of the chimeric GFPhrp65-3 protein. Interestingly, a GFP-hrp65(1-499) fusion protein containing the part of hrp65 common to all hrp65 isoforms failed to associate with fibers. This result indicates that the variant 12 C-terminal amino acids of hrp65-3 determine the association of this protein with actin filaments. Whether these amino acids can establish direct interactions with actin or, alternatively, interactions with other actin-binding proteins remains to be elucidated. Functional Specialization Achieved by Alternative Splicing Alternative splicing is common among hnRNPs and, rather than generating functionally redundant proteins, it has been shown that alternatively spliced products display either different nucleic acid-binding properties, such as human hnRNP K [reviewed in 36] or hnRNP D [37], cell type and tissue specificity, such as hnRNP A/B [38], or different subcellular localization, such as Squid hnRNPs [34]. We have now shown that the hrp65 protein isoforms display tissue specific-

293

ity and differential subcellular localization. The hrp65 proteins contain two RNA-binding domains and are thus likely to be involved in mRNA biogenesis. However, hrp65 is not a general mRNA-binding protein of the hnRNP type [8]. We have previously shown that hrp65 is a component of thin connecting fibers associated with pre-mRNPs in transit from the site of transcription to the nuclear pore, which suggests a role of hrp65 in intranuclear transport or retention of premRNPs [8]. The human proteins PSF and p54 nrb have also been implicated in nuclear events such as premRNA splicing [14] and transcription regulation [18 – 20]. We have now found that the intracellular localization of hrp65, and maybe also that of PSF and p54 nrb, is more complex than initially expected. The lack of canonical NLSs in some of the hrp65 isoforms does not necessarily imply that these proteins are excluded from the nucleus and, theoretically, they could be imported into the nucleus as a complex with other proteins present in their physiological environment. However, the cytoplasmic localization of hrp65-2 and hrp65-3 observed in our experiments, and in particular the specific association of hrp65-3 with actin microfilaments in both human and insect cells, strongly suggests a cytoplasmic role for some of the hrp65 isoforms. Examples of functional specialization of pre-mRNAbinding proteins by means of alternative splicing have previously been reported. For instance the Drosophila Squid/hrp40 protein was initially defined as an abundant nuclear pre-mRNA binding protein of the hnRNP A/B type [39, 40]. However, more recent studies showed that, as in the case of hrp65, alternative splicing produces three Squid isoforms—SqdA, SqdB, and SqdS—with different intracellular localizations and specific functions [35 and references therein]. Among other functions, the Squid proteins are required for proper cytoplasmic localization of Gurken and fushi tarazu transcripts during early embryonic development [34, 35]. Although Squid and hrp65 appear to play different roles, both proteins share a number of common features. Both contain conserved RNA-binding domains and constitute protein families with multiple isoforms originated by alternative splicing. Moreover, the different isoforms show specific subcellular localizations and, at least in the case of Squid, it has been proven that they perform specialized functions related to mRNA localization [35]. The presence of two RNA-binding domains in hrp65 and the existence of cytoplasmic hrp65 isoforms in association with actin microfilaments suggest that the cytoplasmic hrp65 isoforms could be engaged in transport of mRNAs along the actin framework. Given that the sequences of hrp65-1, hrp65-2, and hrp65-3 differ only in the C-termini but are otherwise identical over 499 amino acids, we propose that the three hrp65 isoforms are likely to have very similar

294

MIRALLES AND VISA

structures and serve similar functions, the variant Ctermini being a mechanism to target hrp65 specifically to different locations. Altogether, the putative role of hrp65 in intranuclear transport/retention of premRNPs [8], the finding of hrp65 isoforms in association with actin, and the involvement of actin in mRNA localization [reviewed in 41] suggest that the different hrp65 isoforms could serve specialized roles related to mRNA localization/transport in different cell compartments. We thank Lars Wieslander for providing us with the C. tentans cDNA library and for critical reading of the manuscript, Ylva Engstro¨m for the gift of the pAct5C-PL plasmid, Nafiseh Sabri and Eva Kiesler for help in in situ hybridization and immunofluorescence experiments, respectively, Roger Karlsson for helpful advice regarding cytoskeleton, and Mona Tiba¨ck for technical assistance. This work was supported by grants from The Swedish Natural Science Research Council, the Marianne and Marcus Wallenberg Foundation, the Lars Hiertas Minne Foundation, the Åke Wiberg Foundation, and the Carl Trygger Foundation. Francesc Miralles is the recipient of a long-term postdoctoral EMBO fellowship.

12.

Alzhanova-Ericsson, A., Sun, T. X., Visa, V., Kiseleva, E., Wurtz, T., and Daneholt, B. (1996). A protein of the SR family of splicing factors binds extensively to exonic Balbiani ring pre-mRNA and accompanies the RNA from the gene to the nuclear pore. Genes Dev. 10, 2881–2893.

13.

Wurtz, T., Kiseleva, E., Nacheva, G., Alzhanova-Ericson, A., Rosen, A., and Daneholt, B. (1996). Identification of two RNAbinding proteins in Balbiani ring premessenger ribonucleoprotein granules and presence of these proteins in specific subsets of heterogeneous nuclear ribonucleoprotein particles. Mol. Cell Biol. 16, 1425–1435.

14.

Patton, J. G., Porro, E. B., Galceran, J., Tempst, P., and NadalGinard, B. (1993). Cloning and characterization of PSF, a novel pre-mRNA splicing factor. Genes Dev. 7, 393– 406.

15.

Dong, B., Horowitz, D. S., Kobayashi, R., and Krainer, A. R. (1993). Purification and cDNA cloning of HeLa cell p54nrb, a nuclear protein with two RNA recognition motifs and extensive homology to human splicing factor PSF and Drosophila NONA/ BJ6. Nucleic Acids Res. 21, 4085– 4092.

16.

Jones, K. R., and Rubin, G. M. Molecular analysis of no-ontransient A, a gene required for normal vision in Drosophila. (1990). Neuron 4, 711–723.

17.

von Besser, H., Schnabel, P., Wieland, C., Fritz, E., Stanewsky, R., and Saumweber, H. (1990). The puff-specific Drosophila protein Bj6, encoded by the gene no-on transient A, shows homology to RNA-binding proteins. Chromosoma 100, 37– 47.

18.

Basu, A., Dong, B., Krainer, A. R., and Howe, C. C. (1997). The intracisternal A-particle proximal enhancer-binding protein activates transcription and is identical to the RNA- and DNAbinding protein p54nrb/NonO. Mol. Cell Biol. 17, 677– 686.

19.

Urban, R. J, Bodenburg, Y., Kurosky, A., Wood, T. G., and Gasic, S. (2000). Polypyrimidine tract-binding protein-associated splicing factor is a negative regulator of transcriptional activity of the porcine p450scc insulin-like growth factor response element. Mol. Endocrinol. 14, 774 –782.

REFERENCES 1.

Dreyfuss, G., Matutis, M. J., Pin˜ol-Roma, S., and Burd, C. G. (1993). hnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62, 289 –321.

2.

Krecic, A. M., and Swanson, M. S. (1999). hnRNP complexes: composition, structure, and function. Curr. Opin. Cell Biol. 11, 363–371.

3.

Mattaj, I. W., and Englmeier, L. (1998). Nucleocytoplasmic transport: The soluble phase. Annu. Rev. Biochem. 67, 265–306.

4.

Go¨rlich, D., and Kutay, U. (1999). Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15, 607– 660.

20.

5.

Nakielny, S., and Dreyfuss, G. (1999). Transport of proteins and RNAs in and out of the nucleus. Cell. 99, 677– 690.

Straub, T., Knudsen, B. R., and Boege, F. (2000). PSF/p54(nrb) stimulates “jumping” of DNA topoisomerase I between separate DNA helices. Biochemistry 39, 7552–7558.

21.

6.

Politz, J. C., Browne, E. S., Wolf, D. E., and Pederson, T. (1998). Intranuclear diffusion and hybridization state of oligonucleotides measured by fluorescence correlation spectroscopy in living cells. Proc. Natl. Acad. Sci. USA 95, 6043– 6048.

Karhumaa, P., Parkkila, S., Waheed, A., Parkiila, A. K., Kaunisto, K., Tucker, P. W., Huang, C. J., William, S. S., and Rajaniemi, H. (2000). Nuclear NonO/p54(nrb) protein is a nonclassical carbonic anhydrase. J. Biol. Chem. 275, 16044 –16049.

22.

Saumweber, H., Frasch, M., and Korge, G. (1990). Two puffspecific proteins bind within the 2.5 kb upstream region of the Drosophila melanogaster Sgs-4 gene. Chromosoma 99, 52– 60.

23.

Rendahl, K. G., Jones, K. R., Kulkarni, S. J., Bagully, S. H., and Hall, J. C. (1992). The dissonance mutation at the no-on-transient-A locus of D. melanogaster: Genetic control of courtship song and visual behaviors by a protein with putative RNAbinding motifs. J. Neurosci. 12, 390 – 407.

24.

Lezzi, M., Meyer, B., and Ma¨hr, R. (1981). Heat shock phenomena in Chironomus tentans. I: In vivo effects of heat, overheat, and quenching on salivary chromosome puffing. Chromosoma 83, 327–339.

25.

Wyss, C. (1982). Chironomus tentans epithelial cell lines sensitive to ecdysteroids, juvenile hormone, insulin and heat shock. Exp. Cell Res. 139, 309 –319.

26.

Chomcynzki, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156 –159.

27.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning: A Laboratory Manual” 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

7.

Singh, O. P., Bjo¨rkroth, P. B., Masich, S., Wieslander, L., and Daneholt, B. (1999). The intranuclear movement of Balbiani ring pre-messenger ribonucleoprotein particles. Exp. Cell. Res. 251, 135–146, doi:10.1006/excr.1999.4490. ¨ fverstedt, L. G., Sabri, N., Aissouni, Y., Hellman, 8. Miralles, F., O U., Skoglund, U., and Visa, N. (2000). Electron tomography reveals posttranscriptional binding of pre-mRNPs to specific fibers in the nucleoplasm. J. Cell Biol. 148, 271–282. 9.

Mehlin, H., and Daneholt, B. (1993). The balbiani ring particle: A model for the assembly and export of RNPs from the nucleus? Trends Cell Biol. 3, 443– 447.

10.

Sun, X., Alzhanova-Ericsson, A. T., Visa, N., Aissouni, Y., Zhao, J., and Daneholt, B. (1998). The hrp23 protein in the balbiani ring pre-mRNP particles is released just before or at the binding of the particles to the nuclear pore complex. J. Cell Biol. 142, 1181–1193.

11.

Visa, N., A.T. Alzhanova-Ericsson, X. Sun, Kiseleva, E., Bjo¨rkroth, B., Wurtz, T., and Daneholt, B. (1996). A pre-mRNAbinding protein accompanies the RNA from the gene through the nuclear pores and into polysomes. Cell. 84, 253–264.

ALTERNATIVELY SPLICED FORMS OF hrp65 28.

29.

30. 31.

32.

33.

34.

Krasnow, M. A., Saffman, E. E., Kornfeld, K., and Hogness, D. S. (1989). Transcriptional activation and repression by Ultrabithorax proteins in cultured Drosophila cells. Cell 57, 1031– 1043. Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12, 387–395. Go¨rlich, D., and Mattaj, W. (1996). Nucleocytoplasmic transport. Science 271, 1513–1518. Stanewsky, R., Rendahl, K. G., Dill, M., and Saumweber, H. (1993). Genetic and molecular analysis of the X chromosomal region 14B17–14C4 in Drosophila melanogaster: Loss of function in NONA, a nuclear protein common to many cell types, results in specific physiological and behavioral defects. Genetics 135, 419 – 442. Reim, I., Mattow, J., and Saumweber, H. (1999). The RRM protein NonA from Drosophila forms a complex with the RRM proteins Hrb87F and S5 and the Zn finger protein PEP on hnRNA. Exp. Cell. Res. 253, 573–586, doi:10.1006/ excr.1999.4647. Amero, S. A., Elgin, S. C., and Beyer, A. L. (1991). A unique zinc finger protein is associated preferentially with active ecdysoneresponsive loci in Drosophila. Genes Dev. 5, 188 –200. Lall, S., Francis-Lang, H., Flament, A., Norvell, A., Schupbach, T., and Ish-Horowicz, D. (1999). Squid hnRNP protein promotes apical cytoplasmic transport and localization of Drosophila pair-rule transcripts. Cell 98, 171– 80.

Received September 28, 2000 Revised version received November 27, 2000 Published online February 8, 2001

295

35.

Norvell, A., Kelley, R. L., Wehr, K., and Schupbach, T. (1999). Specific isoforms of squid, a Drosophila hnRNP, perform distinct roles in Gurken localization during oogenesis. Genes Dev. 13, 864 – 876.

36.

Ostareck-Lederer, A., Ostareck, D. H., and Hentze, M. W. (1998). Cytoplasmic regulatory functions of the KH-domain proteins hnRNPs K and E1/E2. Trends Biochem. Sci. 23, 409 – 411.

37.

DeMaria, C. T., Sun, Y., Long, L., Wagner, B. J., and Brewer, G. (1997). Structural determinants in AUF1 required for high affinity binding to A ⫹ U-rich elements. J. Biol. Chem. 272, 27635–27643.

38.

Kamma, H., Horiguchi, H., Wan, L., Matsui, M., Fujiwara, M., Fujimoto, M., Yazawa, T., and Dreyfuss, G. (1999). Molecular characterization of the hnRNP A2/B1 proteins: Tissue-specific expression and novel isoforms. Exp. Cell. Res. 246, 399 – 411, doi:10.1006/excr.1998.4323.

39.

Matunis, M. J., Matunis, E. L., and Dreyfuss, G. (1992). Isolation of hnRNP complexes from Drosophila melanogaster. J. Cell Biol. 116, 245–255.

40.

Matunis, E. L., Kelley, R., and Dreyfuss, G. (1994). Essential role for a heterogeneous nuclear ribonucleoprotein (hnRNP) in oogenesis: hrp40 is absent from the germ line in the dorsoventral mutant squid. Proc. Natl. Acad. Sci. USA 91, 2781–2784.

41.

Oleynikov, Y., and Singer, R. H. (1998). RNA localization: Different zipcodes, same postman? Trends Cell Biol. 8, 381–383.