Molecular characterization of drug-resistant and -susceptible Mycobacterium tuberculosis isolated from patients with tuberculosis in Korea

Available online at www.sciencedirect.com

Diagnostic Microbiology and Infectious Disease 72 (2012) 52 – 61 www.elsevier.com/locate/diagmicrobio

Molecular characterization of drug-resistant and -susceptible Mycobacterium tuberculosis isolated from patients with tuberculosis in Korea☆ Jee-Hyun Yoon a,1 , Ji-Sun Nam a,1 , Kyung-Jin Kim a,1 , Yeonim Choi b , Hyeyoung Lee b , Sang-Nae Cho c , Young-Tae Ro a,⁎ a

b

Department of Biochemistry, Graduate School of Medicine, Konkuk University, Chungju 380-701, Korea Department of Biomedical Laboratory Science, College of Health Science, Yonsei University, Wonju 220-710, Korea c Department of Microbiology, Yonsei University College of Medicine, Seoul 120-752, Korea Received 3 May 2011; accepted 6 September 2011

Abstract We investigated the causal relationship between genotype and phenotype of drug-resistant Mycobacterium tuberculosis isolates obtained from patients with pulmonary tuberculosis (TB) in Korea. Of 80 isolates tested, 17, 20, 1, and 7 isolates were mono-resistant to ethambutol (EMB), isoniazid (INH), pyrazinamide (PZA), and rifampicin (RFP), respectively, and 31 isolates (38.8%) were multidrug-resistant (MDR). Sequencing analysis showed that 78% (32/41) of RFP-resistant strains had mutations in the rifampicin resistance–determining region (RRDR) of rpoB, and the mutation at rpoB531 (59.4%) was most abundant. In 52 INH-resistant strains, mutations were found mostly at C-15T (n = 21, 40.4%) in the inhA promoter region as well as at katG315 (n = 12, 23.1%). Mutations at embB306 were mostly found in 26.7% (12/45) of EMB-resistant isolates. New mutations found here in MDR isolates include rpoB523 (Gly523Glu) and embB319 (Tyr319Ser). Consequently, mutations in the rpoB531, C-15T in the inhA promoter region, embB306, and katG315 would be a useful marker for rapid detection of MDR M. tuberculosis isolates in Korea. © 2012 Elsevier Inc. All rights reserved. Keywords: Drug resistant; Korea; Mutation analysis; Mycobacterium tuberculosis; Tuberculosis

1. Introduction Tuberculosis (TB) is a global public health problem that results in the death of millions of humans every year worldwide. Despite optimal TB control programs, it has been estimated that more than 50 million people die from TB between 1998 and 2020 (Brewer and Heymann, 2005). The threat posed by TB is further complicated by the increasing appearance of multidrug-resistant (MDR) Mycobacterium tuberculosis, defined as resistance to both rifampicin (RFP) ☆ This work was supported by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korean government (MEST) (grant no. R01-2008-000-12139-0). ⁎ Corresponding author. Tel.: +82-2-2030-7825; fax: +82-2-2049-6192. E-mail address: [email protected] (Y.-T. Ro). 1 These authors contributed equally to this work.

0732-8893/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2011.09.010

and isoniazid (INH). In Korea, TB also remains a major public health threat. A survey in 2001 reported that 10.6% of new pulmonary TB cases were resistant to at least 1 drug and 2.2% of them were MDR (Espinal et al., 2001). However, from the 2004 survey, a statistically significant increase has been observed in any drug resistance (12.8%) and MDR (2.7%), suggesting that the overall prevalence of drug-resistant TB has been steadily increasing in Korea (Bai et al., 2007). Generally, the detection of M. tuberculosis drug resistance has been performed by using mycobacterial culture and drug susceptibility test (DST) on liquid or solid media. However, they are laborious and time-consuming procedures that can take several weeks to months. Therefore, an efficient and rapid detection of drug-resistant TB is essential for the prevention and control of drug-resistant TB transmission. Drug resistance of TB is known to be associated with mutations in several genes that encode either the target

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

proteins of the drug or enzymes that are involved in drug activation (Somoskovi et al., 2001). The action mechanism of RFP is to inhibit mycobacterial transcription by targeting RNA polymerase. The development of resistance to RFP is due to mutations in the rifampicin resistance–determining region (RRDR), an 81-bp hotspot region (codons 507–533), of the rpoB gene encoding the beta subunit of RNA polymerase (Miller et al., 1994; Telenti et al., 1993). Furthermore, more than 90% of the RFP-resistant strains contain mutations within this RRDR of rpoB (Musser, 1995). Ethambutol (EMB), a frontline anti-TB drug, targets the mycobacterial cell wall, and mutations in the embB gene lead to resistance to EMB in M. tuberculosis (Telenti et al., 1997). The EMB resistance is primarily associated with missense mutations within the conserved ethambutol resistance–determining region (ERDR) of embB, and the most commonly found mutations occur at embB codon 306 in 50% to 70% of EMB-resistant clinical isolates (Plinke et al., 2006). In contrast, resistance to INH is more complex. Many INH-resistant strains have mutations in the katG gene encoding catalase–peroxidase that result in altered enzyme structure. These structural changes apparently result in decreased conversion of INH as a pro-drug to a biologically active form. Some INH-resistant strains also have mutations in the presumed regulatory region of the inhA locus or kasA gene encoding an enoyl-acyl carrier protein reductase or a beta-ketoacyl-acyl carrier protein synthase, respectively (Musser, 1995; Ramaswamy and Musser, 1998). Pyrazinamide (PZA) is also a pro-drug that requires conversion into its active form, pyrazinoic acid (POA), by the bacterial enzyme pyrazinamidase (PZase) encoded by pncA (Scorpio and Zhang, 1996; Zhang and Mitchison, 2003), for activity against M. tuberculosis. Since mutations in pncA result in lost or reduced PZase activity, such mutations are thus considered to be the primary mechanism of PZA resistance in M. tuberculosis (Hirano et al., 1997). However, some PZA-resistant isolates retain PZase activity, suggesting that there are other mechanisms of resistance (Mestdagh et al., 1999). Since the frequency of mutations in genes related to TB drug resistance varies widely around the world, molecular analysis of regional isolates is an essential step to developing molecular-based detection methods for local TB resistance. Because drug resistance in M. tuberculosis is mostly correlated with mutations in the relatively conserved regions of several of the genes (embB, inhA, katG, pncA, and rpoB) described above, therefore, gene sequence-based analysis, including direct DNA sequencing, is the most widely used and reliable technique for detection of both known and novel mutations worldwide. Despite the increasing number of any drug resistance and MDR TB cases in Korea, however, relatively few studies have determined the prevalence of different drug resistance–conferring mutations among drugresistant and MDR clinical isolates (Cho et al., 2009; Nam et al., 2008; Park et al., 2005).

53

In this study, for measuring the link between phenotype and gene mutations in drug-resistant M. tuberculosis isolates in Korea and for finding critical mutation sites that can be used to prospectively and rapidly screen isolates to detect drug-resistant TB in Korea, we sequenced and analyzed the partial embB and rpoB genes including the ERDR and the 81-bp RRDR, respectively, and the complete inhA and pncA loci including the promoter region, as well as the region surrounding katG315 in 80 clinical M. tuberculosis culture isolates obtained from patients with pulmonary TB. The results of sequence analysis were compared with those of drug susceptibility analysis.

2. Materials and methods 2.1. Sample collection and drug susceptibility test For measuring the link between phenotype and gene mutations in drug-resistant M. tuberculosis isolates, a total of 80 TB isolates were deliberately selected for this study based on their phenotypic drug resistance characteristics. All isolates were obtained from specimens that were stored anonymously at Yonsei University College of Medicine in Korea between 2005 and 2008. They comprised 49 isolates resistant to at least one of the primary TB drugs (EMB, INH, PZA, and RFP) and 31 MDR isolates. The drug susceptibility of M. tuberculosis isolates was determined by the absolute concentration method using Löwenstein–Jensen medium (Kim et al., 1997). The drugs and their critical concentrations for resistance were as follows: 0.2 μg/mL of INH, 40 μg/mL of RFP, and 2 μg/mL of EMB. PZA susceptibility was determined by PZase activity assay using the modified PZase agar method (Singh et al., 2007), with slight modifications previously described as the Wayne (1974) method. The PZA-susceptible M. tuberculosis strain H37Rv was used as a positive control for the PZase assay. The PZase assay was performed at least twice. 2.2. DNA extraction and PCR amplification of drug-resistant genes Genomic DNA from each clinical isolate was prepared using a modified cetyltrimethylammonium bromide method (Murray and Thompson, 1980). Genotypic mutations were evaluated by polymerase chain reaction (PCR) amplification followed by DNA sequencing. For targeting the hotspot regions of rpoB, katG, embB, and the complete inhA and pncA loci including the regulatory region, the oligonucleotide primers described in Table 1 were used for PCR amplification. The PCR amplification was performed in a 20 μL reaction mixture containing 8 pmol of each primer, 0.5 U of HotStar Taq DNA polymerase (Qiagen, USA), and 2 μL of each genomic DNA. Amplification was performed with the MJ Mini thermal cycler (Bio-Rad, USA) using the following protocol: initial activation at 95 °C for 5 min, 35 cycles each of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s,

54

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

Table 1 Primers used for the amplification of drug-resistant genes Gene

Primer sequence (5′ - 3′)

GenBank accession no.

embB

EmbB-F: CTGAAACTGCTGGCGATCAT EmbB-R: CGCTCGATCAGCACATAGG InhA-F: CTTCCGAGGATGCGAGCTAT InhA-R: AGCACTACCTGCATTTCGGT Ipro-F: GACATACCTGCTGCGCAAT Ipro-R: ACTGAACGGGATACGAATGG KatG-F: CATGAACGACGTCGAAACAG KatG-R: GTCTCGGTGGATCAGCTTGT PncA-F: CGGATTTGTCGCTCACTACA PncA-R: GTTCCATCGCGATCTGGATA RpoB-F: GCCACCATCGAATATCTGGT RpoB-R: AGGGCACGTACTCCACCTC

U68480

614

U41388

1051

inhA mabA-inhA promoter katG pncA rpoB

and elongation at 72 °C for 1 min, and final extension at 72 °C for 10 min. The following fragments were amplified and sequenced: 614 bp of the embB gene including the 63-bp conserved ERDR (codons 298–318) of embB; 1051 bp of the complete inhA gene; 271 bp of the mabA–inhA promoter region; 490 bp of the katG gene including codon 315; 947 bp of the complete pncA gene including the promoter region; and 700 bp of the rpoB gene including the 81-bp core region (codons 507–533). 2.3. DNA sequencing and analysis For accurate and convenient sequencing, the amplification products were directly cloned into pGEM-T-Easy cloning vector (Promega, USA) according to the manufacturer's instruction. The clones containing each PCR fragment were screened by 1% agarose gel electrophoresis after EcoRI digestion, and then each plasmid was subjected to automated DNA sequencing protocol (Cosmo Genetech, Korea). The mutated regions have been validated by sequencing with more than 2 individual clones and analyzed by using the ExPASy protemics server (http://ca.expasy.org/). 3. Results 3.1. Detailed drug resistance patterns of 80 M. tuberculosis isolates All the 80 isolates deliberately selected for this study showed resistance to at least one of the primary TB drugs (EMB, INH, PZA, and RFP). Of the 80 isolates, 21.3% (n = 17), 25% (n = 20), 1.3% (n = 1), and 8.8% (n = 7) were mono-resistant to EMB, INH, PZA, and RFP, respectively. Overall, 49 isolates (61.2%) were mono- or poly-resistant to the drugs tested and 31 isolates (38.8%) were MDR, as defined by resistance to both INH and RFP (Table 2). 3.2. RFP resistance (mutations in the rpoB gene) The 80 clinical isolates were tested for mutations in the partial rpoB gene including the 81-bp core region (RRDR). The 700-bp PCR product was well amplified with the rpoB

Product size (bp)

BX842576

271

X68081

490

U59967

947

L27989

700

primers shown in Table 1, as expected (data not shown). Sequence analysis revealed that 35 (85.4%) of 41 RFPresistant isolates had at least a mutation in the 700-bp sequenced region, but most of them (91.4%, n = 32) were residing in the 81-bp core RRDR (codons 507–533) of the rpoB gene. 38.5% of RFP-susceptible isolates (15/39) had at least a mutation in the 700-bp sequenced region; however, only 1 isolate had a point mutation in the RRDR (data not shown). Among the mutations in the RRDR, the mutation at rpoB531 (Ser531Leu) was the most common and the percentages found were 46.3% (19/41) and 54.8% (17/31) of RFP-resistant isolates and MDR isolates, respectively (Table 3). Also, 5 isolates (12.2%) among the RFP-resistant isolates had point mutations at rpoB516 (Asp516Val and Asp516Tyr). Other notable mutations included rpoB526 mutations (His526Tyr, His526Arg, and His526Cys) found in 3 RFP-resistant isolates and 1 RFP-susceptible isolate, among others (Table 3). 3.3. INH resistance (mutations in katG and inhA genes) Phenotypic 52 INH-resistant and 28 INH-susceptible isolates were tested for mutations in the partial katG gene (codons 257–419) and the complete inhA locus including the promoter region. Of the phenotypically INH-resistant isolates, 17 (32.7%) or 16 (30.8%) isolates had mutations Table 2 Drug-resistant patterns of 80 M. tuberculosis isolates from Korea Resistant patterns Mono-/Poly-resistance to EMB INH PZA RFP EMB + INH PZA + RFP Total Multidrug resistance INH + RFP + PZA INH + RFP + EMB + PZA Total

No. of resistant isolates

Ratio (%)

17 20 1 7 1 3 49

21.3 25.0 1.3 8.8 1.3 3.8 61.2

4 27 31

5.0 33.8 38.8

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

55

Table 3 Mutations in the 81-bp core region of the rpoB in RFP-susceptible and -resistant M. tuberculosis isolates from Korea rpoB codon a

rpoB511 rpoB513 rpoB516 rpoB518 rpoB523 rpoB526

rpoB531 rpoB513 + rpoB523 rpoB530 + rpoB531

Wild type c a b c d

Mutation

RFP resistant (phenotype)

Amino acid

Nucleotide

Leu511Pro G1n513Leu Asp516Val Asp516Tyr Asn518Ser Gly523Glu His526Tyr His526Cys His526Arg Ser531Leu Gln513Leu Gly523G1u Leu530Pro Ser531Leu

CTG → CCG CAA → CTA GAC → GTC GAC → TAC AAC → AGC GGG → GAG CAC → TAC CAC → TGC CAC → CGC TCG → TTG CAA → CTA GGG → GAG CTG → CCG TCG → TTG

NA d

NA

MDR-TB (n = 31)

Not MDR (n = 10)

RFP susceptible (phenotype, n = 39)

1 1 4 1 1 1 1 1 2 16 1

2

1

3

Total (%) b (n = 42) 1 (2.4) 1 (2.4) 4 (9.5) 1 (2.4) 1 (2.4) 1 (2.4) 1 (2.4) 1 (2.4) 2 (4.8) 18 (42.9) 1 (2.4) 1 (2.4)

6

38

9 (21.4)

Codon numbering using standard Escherichia coli nomenclature. Includes RFP-resistant isolates and strains with the rpoB mutations. No mutations in the 81-bp core region. Not Applicable.

only in either the katG or inhA gene, respectively, and 7 isolates had mutations in both genes (Table 4). Among the mutations, C to A nucleotide substitution at position −15 (C-15T) in the mabA–inhA promoter region and a serine to threonine substitution at katG315 (Ser315Thr) were mostly found in 21 (40.4%) and 12 (23.1%) INH-resistant isolates, respectively. Notably, 3 INH-resistant isolates had mutations at katG285 (2 of Gly285Asp and 1 of Gly285Val) and they all also exhibited MDR. Of 28 INH-susceptible isolates, 17.9% (n = 5) or 3.6% (n = 1) had mutations in the katG or inhA gene, respectively, and the remaining 78.6% of isolates were wild type and had no mutations (Table 4). 3.4. EMB resistance (mutations in the embB gene) The 80 isolates were tested for mutations in the partial embB gene (codons 217–420) including the conserved 63bp ERDR of embB (codons 298–318). Among 45 EMBresistant and 35 EMB-susceptible isolates, 19 (42.2%) and 9 (25.7%) of them, respectively, had at least a mutation in the sequenced region of the embB gene (Table 5). Of 45 EMBresistant isolates, 26.7% (n = 12) had mutations at embB306 including Met306Ile (5 isolates), Met306Leu (4 isolates), and Met306Val (3 isolates), and they were all EMB-resistant MDR strains. However, the mutations (Met306Ile, Met306Leu, and Met306Val substitutions) were also found in strains that were susceptible to EMB, but resistant to INH and/or RFP (3 isolates, 1 for each). Interestingly, a point mutation at Tyr319Ser in the embB gene was found in 2 EMB-resistant MDR isolates. Also, 2 EMB-resistant and MDR isolates had a point mutation at Asp354Ala, but a different amino acid change at the same residue (Asp354Gly) was also found in an EMB-susceptible isolate (Table 5).

3.5. PZA resistance (mutations in the pncA gene) When the 80 M. tuberculosis isolates were tested for PZA susceptibility by the modified PZase assay with 7H9 agar medium, the results revealed that 35 and 45 isolates were determined as PZA resistant and -susceptible, respectively. For determining the link between phenotypic PZA resistance and pncA gene mutations, all the 80 isolates were analyzed for mutations in the complete pncA locus including the regulatory region. Among 35 PZA-resistant isolates, 19 isolates (54.3%) had mutations in the pncA locus including point (n = 15), deletion (n = 3), and insertion (n = 1) mutations (data not shown). Of these, the 18 isolates (94.7%), except a Cys184Arg mutation, exhibited MDR. However, 2 frame-shift mutations including an insertion and a deletion were also found in PZAsusceptible isolates. Because the mutated pncA genes do not encode an active form of PZase, 2 isolates with discordant results were retested. The results showed that the appearance of a pink band in the subsurface agar was uncertain (data not shown), indicating that the 2 isolates could be evaluated as either PZA susceptible or -resistant. Upon repeat testing, therefore, 2 isolates initially found to be susceptible were reclassified as PZA resistant. Notably, Thr135Pro mutation and a nucleotide deletion mutation at codon 94 were found in 3 (8.6%) and 2 (5.7%) PZA-resistant strains, respectively (data not shown). 3.6. Specific mutations associated with drug resistance Comparison of the phenotypic and genotypic data for the most frequently mutated loci in inhA, katG, rpoB, and embB genes showed that specific mutations identified in this study were associated with drug resistance (Table 6). The katG315 mutation was mostly found in INH mono-resistant (33.3%)

56

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

Table 4 inhA and katG mutations found in 80 M. tuberculosis isolates from Korea Genes

Mutations a

No. of isolates (%, phenotype) INH-R (n = 52)

katG

inhA (+ promoter)

katG + inhA c

Wild type d a b c d e

A264V (GCG → GTG)⁎ P280L (CCG → CTG)⁎ A312G (GCG → GGG)⁎ S315T (AGC → ACC) E318G (GAG → GCG)⁎ I335V (ATC → GTC) P347L (CCC → CTC)⁎ P365S (CCG → TCG)⁎ P388L (CCG → CTG)⁎ P388S (CCG → TCG)⁎ A291V (GCT → GTT)⁎, S315T (AGC → ACC) A312V (GCG → GTG)⁎, S315T (AGC → ACC) F368L (TTC → TTA)⁎, S374P (TCC → CCC)⁎ −15C → T b −15C → T, A190S (GCC → TCC)⁎ −15C → T, D256N (GAC → AAC)⁎ −15C → T, I258V (ATC → GTC)⁎ T253A (ACC → GCC)⁎ G285V (GGC → GTC)⁎ + Y259H(TAC → CAC)⁎ G285D (GGC → GAC), A409T (GCC → ACC)⁎ + −15C → T G285D (GGC → GAC), T363A (ACC → GCC)⁎, D381G (GAC → GGC) + −15C → T W328C (TGG → TGT) + −17G → T b T344A (ACG → GCG)⁎ + −15C → T T380I (ACT → ATT) + −15C → T 4 AA′ Deletion (358–361)⁎ + −15C → T, I16T (ATC → ACC) NA e

INH-S (n = 28) 1 1

1 10 (19.2) 1 1 1 1 1 1 1 1 1 13 (25.0) 1 1 1 1 1 1 1 1 1 1 1 12 (23.1)

22 (78.6)

Mutations not previously reported are marked with an asterisk (⁎). Nucleotide numbering in the inhA promoter is situated relative to the mabA start codon. Mutations identified at both loci. No mutations in the sequenced regions (codons 257–419) of katG and a complete inhA locus including the regulatory region. Not applicable.

and MDR (16.1%) isolates. Of 52 phenotypically INHresistant isolates, 40.4% (n = 21) had the C-15T mutation in the inhA promoter region and most of them (71.4%, n = 15) were MDR. The specific rpoB516, rpoB526, and rpoB531 mutations in RRDR, except an rpoB526 mutation found in a RFP-susceptible isolate, were exclusively found in RFPresistant (including MDR) isolates. Interestingly, the embB306 mutation was not detected in 17 of EMB monoresistant isolates at all, but it was found in 13 of MDR isolates and in 2 EMB-susceptible (an INH-resistant and a RFP-resistant) isolates (Table 6).

4. Discussion The global rise of MDR-TB has increased the need for an efficient and reliable analysis for detecting and evaluating drug resistance in TB worldwide. Molecular-based diagnosis could potentially fill this need but it requires data for determining the type and frequency of resistance-associated loci. Drug resistance in M. tuberculosis is caused by mutations in relatively restricted regions of the genome, and most efforts to develop rapid detection of drug-resistant

TB have focused on the most frequently mutated loci in rpoB, katG, and embB genes (Ramaswamy and Musser, 1998; Höfling et al., 2005; Sekiguchi et al., 2007). The molecular mechanism of RFP resistance has been well established so much so that more than 90% of RFPresistant isolates have at least a mutation in an 81-bp core region (RRDR, codon 507–533) of the rpoB gene and that most of the mutations in the RRDR occur exclusively at codons 516, 526, and 531 (Musser, 1995; Ramaswamy and Musser, 1998; Sekiguchi et al., 2007). In this study, 78% (n = 32) of RFP-resistant isolates had at least a point mutation in the 81-bp core RRDR (codons 507–533) of the rpoB gene. This relatively low frequency may be partially attributable to our selection bias, because only 40% (4/10 isolates) of RFP-resistant but non-MDR isolates had mutations in the RRDR. Another explanation might be due to failure of phenotypic DST by deterioration of drugs during storage or media preparation, which has not been uncommon in the literature. A MIC determination or DST by the proportion method using Middlebrook 7H10 agar may give better correlation between phenotypic and molecular DST results. However, 90.3% (28/31) of MDR-TB isolates had at least a mutation in the RRDR and most (n = 24) of them

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

57

Table 5 embB mutations found in 80 M. tuberculosis isolates from Korea Mutations

Amino acid substitution

No. of isolates (phenotype) Drug resistant a (n = 18)

Single

Multiple

Wild type c a b c d

Ser260Leu Ser298Ala Gly305Ser Met306Ile Met306Leu Met306Val Val309Ala Asn318Ser Tyr319Ser Leu336Pro Asp354Ala Asp354Gly Val377Glu Phe398Cys Ile293Thr + Met306Leu Met306Ile + Trp322Arg Met306Val + Gly406Asp Ala281Ser + Met306Leu + Gly406Asp Met306Ile + Asp345Gly + Leu365Pro + Ser380Gly NA d

Multidrug resistant b (n = 27)

Drug susceptible ( n = 35) 1

1 1 1 1 1

3 2 2 1

1 2 1 2 1 1 1 1 1 1 1 1 16

10

26

Resistant to EMB, but not to MDR. Resistant to EMB, INH, and RFP. No mutations in the sequenced region. Not applicable.

predominated in 3 specific loci, rpoB531 (54.8%, n = 17), rpoB516 (12.9%, n = 4), and rpoB526 (9.7%, n = 3), similar to others worldwide (Bolotin et al., 2009; Hillemann et al., 2005; Höfling et al., 2005; Hu et al., 2010; Sajduda et al., 2004; Zenteno-Cuevas et al., 2009). Similar studies have been described in Korea. Park et al. (2005) reported that, among 231 MDR strains, 45.5% (n = 105), 32.5% (n = 75), and 10.8% (n = 25) possessed the point mutations in codon 531, 526, and 516, respectively. Also, a recent study with

direct DNA sequencing analysis revealed that 39 clinical sputa had 1 or more single-point mutations in the rpoB gene and the most prevalent mutation was Ser531Leu (66.7%) (Choi et al., 2010). Between these results and our result, there was little difference in the relative frequency of the mutations, presumably due to the differences in sample collection periods and regions. Interestingly, an RFP-susceptible isolate harbored an rpoB526 mutation (His526Cys) in this study. Occasionally,

Table 6 Summary of drug resistance and notable mutations in 80 M. tuberculosis isolates from Korea Resistance patterns

Mono-/poly-resistant to EMB INH PZA RFP EMB + INH PZA + RFP Total (%) a Multidrug resistant to INH + RFP + PZA INH + RFP + EMB + PZA Total (%) b a b

No. of isolates

17 20 1 7 1 3 49 4 27 31

Mutations katG315

inhA(C-15T)

7

5 -

rpoB516

rpoB526

rpoB531

embB306

-

1

1

-

2

1

2 (20.0)

2 (0)

1

1 7 (33.3)

6 (28.6)

1 (10.0)

1 (0)

1 4 5 (16.1)

2 13 15 (48.4)

4 4 (12.9)

3 3 (9.7)

3 14 17 (54.8)

% indicates the ratio of each gene mutation to each drug only (katG and inhA for INH, rpoB for RFP, and embB for EMB). % indicates the ratio of each gene mutation found in MDR isolates.

1 12 13 (41.9)

58

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

M. tuberculosis isolates harboring the rpoB516 or rpoB526 mutation were classified as RFP susceptible and these mutations could confer low-level but clinically relevant RFP resistance (Van Deun et al., 2009). Recently, the His526Asn and His526Leu mutations in the rpoB gene were also identified in RFP-susceptible isolates (Campbell et al., 2011), suggesting that the rpoB526 mutation may occasionally occur in RFP-susceptible isolates, as similarly shown in this study. However, further studies are required to characterize their role in RFP resistance. On the other hand, the rpoB531 (Ser531Leu) mutation was the most abundant mutation of RFP-resistant isolates and was found exclusively in RFPresistant isolates. Therefore, the rpoB531 mutation could be used as a genetic marker for predicting RFP resistance in M. tuberculosis. Besides these 3 common mutations, an rpoB513 (Gln513Leu, CAA to CTA) mutation was found in 2 RFP-resistant/MDR isolates in this study. This mutation was previously reported in Korea and China with low frequency (Kim et al., 2006; Luo et al., 2010), but the amino acid changes (Gln513Pro or Gln513His) resulting from nucleotide changes (CAA to CCA or CAA to CAC), respectively, were different from those in our report. Also, an rpoB523 (Gly523Glu, GGG to GAG) mutation was notably found in 2 RFP-resistant/MDR isolates. Since the rpoB523 mutation has not been reported previously in TB drug resistance mutation database (Sandgren et al., 2009), therefore, it could be a newly found rpoB mutation associated with RFP resistance and MDR. However, further studies are required to definitively characterize its role in RFP resistance and MDR. In contrast to RFP resistance, several different loci have been known to be involved in resistance to INH. Among them, the mutations at the katG (Ser315Thr, AGC to ACC) and inhA promoter region (C-15T) primarily conferred the most frequently reported mutations associated with INH resistance (Gagneux et al., 2006; Guo et al., 2006; HerreraLeón et al., 2005). Also, a study in Korea showed that 56.6% or 30.2% of INH-resistant isolates had katG Ser315Thr or inhA C-15T mutations, respectively (Cho et al., 2009). In this study, 40.4% (n = 21) of 52 INH-resistant isolates exhibited mutations at C-15T in the inhA promoter region, but only 23.1% (n = 12) of INH-resistant isolates carried the katG Ser315Thr mutation. Therefore, this low frequency of Ser315Thr mutation was unusual, even though it may be partially attributable to our selection bias. Similar to our result, however, a study from Japan showed that only 28.1% (27/96) of INH-resistant strains carried a katG codon 315 mutation (Abe et al., 2008). In this report, M. tuberculosis isolates were divided into 3 groups based on the results obtained with Ogawa egg medium, such as low-S (susceptible at 0.2 μg/mL of INH), low-R (resistant at 0.2 μg/mL of INH), and high-R (resistant at 1.0 μg/mL of INH), and they suggest that mutations in the inhA promoter region are associated with low-level resistance to INH (low-R) and that katG codon 315 mutations are associated with high-level resistance to INH (high-R) (Abe et al., 2008). Because we

evaluated M. tuberculosis isolates which can grow in Löwenstein–Jensen medium with an INH concentration of 0.2 μg/mL as the INH-resistant strains, therefore, some isolates of the 52 INH-resistant isolates reported in this study could be Low-R isolates and the frequency of katG Ser315Thr mutation may increase to some degree. A MIC determination or INH susceptibility test by the proportion method using Middlebrook 7H10 agar may give better correlation between phenotypic and molecular DST results. On the other hand, 17.9% (n = 5) or 3.6% (n = 1) of 28 INH-susceptible isolates had mutations in the partial katG region (codons 257–419) or inhA gene including the promoter region, respectively. However, none of them contained the katG315 and inhA C-15T mutations. Since the overall prevalence of inhA and katG mutations was 63.5% (33/52) and 64.5% (20/31) of INH-resistant and MDR isolates, respectively, therefore, our results suggest that the 2 mutations correlate strongly with INH-resistant and MDR. Perhaps, mutations in other parts of the katG gene and in other genes such as ahpC, kasA, and ndh (Ramaswamy and Musser, 1998; Lee et al., 2001a) may account for resistance in the other 12 INH-resistant isolates (23.1%) in our study (Table 4). Interestingly, 3 isolates having multiple mutations in katG and inhA genes had a common point mutation at katG285 (Gly285Val or Gly285Asp) and they all exhibited MDR. There is a report that a M. tuberculosis isolate having the katG Gly285Asp mutation was INHresistant (Abe et al., 2008), but the role of katG285 mutation on INH resistance is currently uncertain and needs to be evaluated in more INH-resistant and MDR isolates. Resistance to EMB results from an accumulation of genetic events that determine the overexpression of Emb protein(s), structural mutations in embB, or both (Telenti et al., 1997). Sequence analysis of EMB-resistant isolates has shown that most of the mutations occur at embB codon 306 in 50% to 70% of clinical isolates (Plinke et al., 2006; Starks et al., 2009), suggesting that the embB306 mutation is an important molecular indicator of EMB resistance. However, the use of embB306 mutation as a determinant of EMB resistance is controversial, because this mutation is often found in EMB-susceptible clinical isolates (Mokrousov et al., 2002; Lee et al., 2004; Ahmad et al., 2007). Instead, other studies have found strong associations between embB306 mutation and MDR (Hazbón et al., 2005; Shen et al., 2007). Also, a recent study suggested that embB306 mutation in M. tuberculosis may, in fact, have affected antibiotic susceptibility to INH and RFP (Safi et al., 2008). In our study, all 12 EMB-resistant isolates having mutations at embB306 also exhibited MDR, supporting that embB306 mutation is associated with resistance to INH and RFP, not to EMB. In fact, EMB resistance in Korea is usually accompanied by MDR, although the prevalence of mono-resistance to EMB is less than 1% (Bai et al., 2007). Besides the embB306 mutation, a point mutation of Tyr319Ser in the conserved ERDR was found exclusively in 2 EMB-resistant and MDR isolates in this study. Although frequency of this

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

mutation in EMB-resistant and MDR isolates is relatively low (7.4%), this mutation may have a strong association with MDR in M. tuberculosis, like the embB306 mutation. Additional research with more clinical isolates is needed to elucidate the causal relationship between specific embB mutations and the occurrence of MDR. Mutations in the pncA gene have been known to be a major mechanism of PZA resistance, since the mutation usually results in lost or reduced PZase activity in M. tuberculosis (Hirano et al., 1997; Zhang and Mitchison, 2003). However, some PZA-resistant isolates have a wildtype pncA gene and retain PZase activity, suggesting an alternative mechanism for PZA resistance (Scorpio and Zhang, 1996; Morlock et al., 2000). Susceptibility testing of M. tuberculosis against PZA has been known to be difficult because the drug is active only in an acidic environment (pH 5.0–5.5) which causes an inhibitory effect on the bacterial growth and a considerable reduction in colony size compared with a neutral-pH environment (Stottmeier et al., 1967). As PZA-resistant M. tuberculosis clinical isolates are usually defective for PZase activity (Morlock et al., 2000; Zhang and Mitchison, 2003), therefore, an alternative assay for determining PZA susceptibility at neutral pH has been developed (Wayne, 1974). This assay detects the presence of active PZase enzyme by the hydrolysis of PZA to POA as evidenced by a color change. Using the modified PZase assay with the 7H9 agar medium (Singh et al., 2007), we determined 35 isolates (43.8%) from a total of 80 M. tuberculosis isolates as PZA-resistant. Among the PZAresistant isolates, 19 isolates (54.3%) had mutations in the pncA locus and most of them (18 isolates, 94.7%) also exhibited MDR. Because the rest of the 16 PZA-resistant isolates carried no mutations in the pncA locus, however, our results also revealed that another mechanism may be involved in PZA resistance. In this study, 45 isolates were initially classified as PZA susceptible by the PZase test, but 2 of them had frame-shift mutations in the pncA open reading frame, indicating that they could not be PZA susceptible. Upon repeat testing, we reclassified 2 isolates initially found to be PZA susceptible as PZA resistant. Even though the major utility of the PZase assay lies in its high specificity, various levels of sensitivity of the PZase assay (79% to 96%) have been reported (Trivedi and Desai, 1987; Davies et al., 2000; Singh et al., 2007). Therefore, enzymatic PZase assay for PZA susceptibility testing of M. tuberculosis should be carefully interpreted and DNA sequencing analysis of pncA mutation is necessary for determining the accurate drug susceptibility testing. Despite the diverse mutational characteristics of the pncA gene and the lack of any predominant mutations representing PZA resistance, pncA Thr135Pro mutation and a C nucleotide deletion mutation at codon 94 were interestingly found in 3 (8.6%) and 2 (5.7%) of the PZA-resistant strains, respectively. Several reports showed the pncA135 missense mutation found in PZA-resistant isolates, which is the cause of loss of PZase activity (Lee et al., 2001b; Suzuki et al.,

59

2002; O'Sullivan et al., 2005). But, to our knowledge, the C nucleotide deletion mutation at codon 94 has not been reported yet. In conclusion, this study describes the frequency of mutations conferring drug resistance in 80 M. tuberculosis clinical isolates from Korea. Our results confirm that mutations at rpoB531, C-15T in the inhA promoter region and katG315, and embB306 codons could be used as an indicator for determining the resistance to RFP, INH, and EMB, respectively. Furthermore, we reported 2 new mutations, rpoB523 (Gly523Glu) and embB319 (Tyr319Ser), which could be associated with resistance to RFP and EMB, respectively. Understanding the nature and frequency of mutations associated with drug-resistant TB in different settings is important for the development of genetic-based assays useful for the detection of drug resistance on a large scale. Therefore, our study adds to this growing body of knowledge and allows the selection of a parsimonious set of mutations for screening in a sensitive and specific diagnostic test for drug-resistant TB. References Abe C, Kobayashi I, Mitarai S, Wada M, Kawabe Y, Takashima T, Suzuki K, Sng LH, Wang S, Htay HH, Ogata H (2008) Biological and molecular characteristics of Mycobacterium tuberculosis clinical isolates with lowlevel resistance to isoniazid in Japan. J Clin Microbiol 46:2263–2268. Ahmad S, Jaber AA, Mokaddas E (2007) Frequency of embB codon 306 mutations in ethambutol-susceptible and -resistant clinical Mycobacterium tuberculosis isolates in Kuwait. Tuberculosis 87:123–129. Bai GH, Park YK, Choi YW, Bai JI, Kim HJ, Chang CL, Lee JK, Kim SJ (2007) Trend of anti-tuberculosis drug resistance in Korea, 1994–2004. Int J Tuberc Lung Dis 11:571–576. Bolotin S, Alexander DC, Chedore P, Drews SJ, Jamieson F (2009) Molecular characterization of drug-resistant Mycobacterium tuberculosis isolates from Ontario, Canada. J Antimicrob Chemother 64:263–266. Brewer TF, Heymann SJ (2005) Long time due: reducing tuberculosis mortality in the 21st century. Arch Med Res 36:617–621. Campbell PJ, Morlock GP, Sikes RD, Dalton TL, Metchock B, Starks AM, Hooks DP, Cowan LS, Plikaytis BB, Posey JE (2011) Molecular detection of mutations associated with first- and second-line drug resistance compared with conventional drug susceptibility testing of Mycobacterium tuberculosis. Antimicrob Agents Chemother 55: 2032–2041. Cho EH, Bae HK, Kang SK, Lee EH (2009) Detection of isoniazid and rifampicin resistance by sequencing of katG, inhA, and rpoB genes in Korea. Korean J Lab Med 29:455–460. Choi JH, Lee KW, Kang HR, Hwang YI, Jang S, Kim DG, Kim CH, Hyun IG, Shin TR, Park SM, Lee MG, Lee CY, Park YB, Jung KS (2010) Clinical efficacy of direct DNA sequencing analysis on sputum specimens for early detection of drug-resistant Mycobacterium tuberculosis in a clinical setting. Chest 137:393–400. Davies AP, Billington OJ, McHugh TD, Mitchison DA, Gillespie SH (2000) Comparison of phenotypic and genotypic methods for pyrazinamide susceptibility testing with Mycobacterium tuberculosis. J Clin Microbiol 38:3686–3688. Espinal MA, Laszlo A, Simonsen L, Boulahbal F, Kim SJ, Reniero A, Hoffner S, Rieder HL, Binkin N, Dye C, Williams R, Raviglione MC (2001) Global trends in resistance to antituberculosis drugs. World Health Organization-International Union against Tuberculosis and Lung Disease Working Group on Anti-Tuberculosis Drug Resistance Surveillance. N Engl J Med 344:1294–1303.

60

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61

Gagneux S, Burgos MV, DeRiemer K, Encisco A, Muñoz S, Hopewell PC, Small PM, Pym AS (2006) Impact of bacterial genetics on the transmission of isoniazid-resistant Mycobacterium tuberculosis. PLoS Pathog 2:e61. Guo H, Seet Q, Denkin S, Parsons L, Zhang Y (2006) Molecular characterization of isoniazid-resistant clinical isolates of Mycobacterium tuberculosis from the USA. J Med Microbiol 55: 1527–1531. Hazbón MH, Bobadilla del Valle M, Guerrero MI, Varma-Basil M, Filliol I, Cavatore M, Colangeli R, Safi H, Billman-Jacobe H, Lavender C, Fyfe J, García-García L, Davidow A, Brimacombe M, León CI, Porras T, Bose M, Chaves F, Eisenach KD, Sifuentes-Osornio J, Ponce de León A, Cave MD, Alland D (2005) Role of embB codon 306 mutations in Mycobacterium tuberculosis revisited: a novel association with broad drug resistance and IS6110 clustering rather than ethambutol resistance. Antimicrob Agents Chemother 49:3794–3802. Herrera-León L, Molina T, Saíz P, Sáez-Nieto JA, Jiménez MS (2005) New multiplex PCR for rapid detection of isoniazid-resistant Mycobacterium tuberculosis clinical isolates. Antimicrob Agents Chemother 49: 144–147. Hillemann D, Kubica T, Agzamova R, Venera B, Rüsch-Gerdes S, Niemann S (2005) Rifampicin and isoniazid resistance mutations in Mycobacterium tuberculosis strains isolated from patients in Kazakhstan. Int J Tuberc Lung Dis 9:1161–1167. Hirano K, Takahashi M, Kazumi Y, Fukasawa Y, Abe C (1997) Mutation in pncA is a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis. Tuber Lung Dis 78:117–122. Höfling CC, Pavan EM, Giampaglia CM, Ferrazoli L, Aily DC, de Albuquerque DM, Ramos MC (2005) Prevalence of katG Ser315 substitution and rpoB mutations in isoniazid-resistant Mycobacterium tuberculosis isolates from Brazil. Int J Tuberc Lung Dis 9:87–93. Hu Y, Hoffner S, Jiang W, Wang W, Xu B (2010) Genetic characterisation of drug-resistant Mycobacterium tuberculosis in rural China: a population-based study. Int J Tuberc Lung Dis 14:210–216. Kim SJ, Bai GH, Hong YP (1997) Drug-resistant tuberculosis in Korea, 1994. Int J Tuberc Lung Dis 1:302–308. Kim SY, Park YJ, Song E, Jang H, Kim C, Yoo J, Kang SJ (2006) Evaluation of the CombiChip Mycobacteria Drug-Resistance Detection DNA chip for identifying mutations associated with resistance to isoniazid and rifampin in Mycobacterium tuberculosis. Diagn Microbiol Infect Dis 54:203–210. Lee AS, Othman SN, Ho YM, Wong SY (2004) Novel mutations within the embB gene in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 48: 4447–4449. Lee AS, Teo AS, Wong SY (2001a) Novel mutations in ndh in isoniazidresistant Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother 45:2157–2159. Lee KW, Lee JM, Jung KS (2001b) Characterization of pncA mutations of pyrazinamide-resistant Mycobacterium tuberculosis in Korea. J Korean Med Sci 16:537–543. Luo T, Zhao M, Li X, Xu P, Gui X, Pickerill S, DeRiemer K, Mei J, Gao Q (2010) Selection of mutations to detect multidrug-resistant Mycobacterium tuberculosis strains in Shanghai, China. Antimicrob Agents Chemother 54:1075–1081. Mestdagh M, Fonteyne PA, Realini L, Rossau R, Jannes G, Mijs W, De Smet KA, Portaels F, Van den Eeckhout E (1999) Relationship between pyrazinamide resistance, loss of pyrazinamidase activity, and mutations in the pncA locus in multidrug-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 43: 2317–2319. Miller LP, Crawford JT, Shinnick TM (1994) The rpoB gene of Mycobacterium tuberculosis. Antimicrob Agents Chemother 38:805–811. Mokrousov I, Otten T, Vyshnevskiy B, Narvskaya O (2002) Detection of embB306 mutations in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis from northwestern Russia: implications for genotypic resistance testing. J Clin Microbiol 40:3810–3813.

Morlock GP, Crawford JT, Butler WR, Brim SE, Sikes D, Mazurek GH, Woodley CL, Cooksey RC (2000) Phenotypic characterization of pncA mutants of Mycobacterium tuberculosis. Antimicrob Agents Chemother 44:2291–2295. Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321–4325. Musser JM (1995) Antimicrobial agent resistance in mycobacteria: molecular genetic insights. Clin Microbiol Rev 8:496–514. Nam YH, Lee SH, Ahn YC, Cho MH, Jang WC, Park SM, Kwon PS, Kim JW (2008) Detection of rifampin resistant Mycobacterium tuberculosis complex using denaturing HPLC. Korean J Lab Med 28:95–102. O'Sullivan DM, McHugh TD, Gillespie SH (2005) Analysis of rpoB and pncA mutations in the published literature: an insight into the role of oxidative stress in Mycobacterium tuberculosis evolution? J Antimicrob Chemother 55:674–679. Park YK, Shin S, Ryu S, Cho SN, Koh WJ, Kwon OJ, Shim YS, Lew WJ, Bai GH (2005) Comparison of drug resistance genotypes between Beijing and non-Beijing family strains of Mycobacterium tuberculosis in Korea. J Microbiol Methods 63:165–172. Plinke C, Rüsch-Gerdes S, Niemann S (2006) Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother 50:1900–1902. Ramaswamy S, Musser JM (1998) Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber Lung Dis 79:3–29. Safi H, Sayers B, Hazbón MH, Alland D (2008) Transfer of embB codon 306 mutations into clinical Mycobacterium tuberculosis strains alters susceptibility to ethambutol, isoniazid, and rifampin. Antimicrob Agents Chemother 52:2027–2034. Sajduda A, Brzostek A, Poplawska M, Augustynowicz-Kopec E, Zwolska Z, Niemann S, Dziadek J, Hillemann D (2004) Molecular characterization of rifampin- and isoniazid-resistant Mycobacterium tuberculosis strains isolated in Poland. J Clin Microbiol 42: 2425–2431. Sandgren A, Strong M, Muthukrishnan P, Weiner BK, Church GM, Murray MB (2009) Tuberculosis drug resistance mutation database. PLoS Med 6:e2. Scorpio A, Zhang Y (1996) Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus. Nat Med 2:662–667. Sekiguchi J, Miyoshi-Akiyama T, Augustynowicz-Kopeć E, Zwolska Z, Kirikae F, Toyota E, Kobayashi I, Morita K, Kudo K, Kato S, Kuratsuji T, Mori T, Kirikae T (2007) Detection of multidrug resistance in Mycobacterium tuberculosis. J Clin Microbiol 45:179–192. Shen X, Shen GM, Wu J, Gui XH, Li X, Mei J, DeRiemer K, Gao Q (2007) Association between embB codon 306 mutations and drug resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 51: 2618–2620. Singh P, Wesley C, Jadaun GP, Malonia SK, Das R, Upadhyay P, Faujdar J, Sharma P, Gupta P, Mishra AK, Singh K, Chauhan DS, Sharma VD, Gupta UD, Venkatesan K, Katoch VM (2007) Comparative evaluation of Löwenstein–Jensen proportion method, BacT/ALERT 3D system, and enzymatic pyrazinamidase assay for pyrazinamide susceptibility testing of Mycobacterium tuberculosis. J Clin Microbiol 45:76–80. Somoskovi A, Parsons LM, Salfinger M (2001) The molecular basis of resistance to isoniazid, rifampin, and pyrazinamide in Mycobacterium tuberculosis. Respir Res 2:164–168. Starks AM, Gumusboga A, Plikaytis BB, Shinnick TM, Posey JE (2009) Mutations at embB codon 306 are an important molecular indicator of ethambutol resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 53:1061–1066. Stottmeier KD, Beam RE, Kubica GP (1967) Determination of drug susceptibility of mycobacteria to pyrazinamide in 7H10 agar. Am Rev Respir Dis 96:1072–1075.

J.-H. Yoon et al. / Diagnostic Microbiology and Infectious Disease 72 (2012) 52–61 Suzuki Y, Suzuki A, Tamaru A, Katsukawa C, Oda H (2002) Rapid detection of pyrazinamide-resistant Mycobacterium tuberculosis by a PCR-based in vitro system. J Clin Microbiol 40:501–507. Telenti A, Imboden P, Marchesi F, Lowrie D, Cole S, Colston MJ, Matter L, Schopfer K, Bodmer T (1993) Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. Lancet 341:647–650. Telenti A, Philipp WJ, Sreevatsan S, Bernasconi C, Stockbauer KE, Wieles B, Musser JM, Jacobs Jr WR (1997) The emb operon, a gene cluster of Mycobacterium tuberculosis involved in resistance to ethambutol. Nat Med 3:567–570. Trivedi SS, Desai SG (1987) Pyrazinamidase activity of Mycobacterium tuberculosis-a test of sensitivity to pyrazinamide. Tubercle 68: 221–224.

61

Van Deun A, Barrera L, Bastian I, Fattorini L, Hoffmann H, Kam KM, Rigouts L, Rüsch-Gerdes S, Wright A (2009) Mycobacterium tuberculosis strains with highly discordant rifampin susceptibility test results. J Clin Microbiol 47:3501–3506. Wayne LG (1974) Simple pyrazinamidase and urease tests for routine identification of mycobacteria. Am Rev Respir Dis 109: 147–151. Zenteno-Cuevas R, Zenteno JC, Cuellar A, Cuevas B, Sampieri CL, Riviera JE, Parissi A (2009) Mutations in rpoB and katG genes in Mycobacterium isolates from the Southeast of Mexico. Mem Inst Oswaldo Cruz 104:468–472. Zhang Y, Mitchison D (2003) The curious characteristics of pyrazinamide: a review. Int J Tuberc Lung Dis 7:6–21.