Molecular characterization of MHC class I and beta-2 microglobulin in a clonal strain of ginbuna crucian carp, Carassius auratus langsdorfii

Fish & Shellfish Immunology 31 (2011) 469e474

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short sequence report

Molecular characterization of MHC class I and beta-2 microglobulin in a clonal strain of ginbuna crucian carp, Carassius auratus langsdorfii Shinji Urabe a, Tomonori Somamoto a, *, Shiro Sameshima a, Yoko Unoki-Kato a, Teruyuki Nakanishi b, Miki Nakao a a

Laboratory of Marine Biochemistry, Department of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, Hakozaki, Fukuoka 812-8581, Japan Department of Veterinary Medicine, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-8510, Japan

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 March 2011 Received in revised form 24 May 2011 Accepted 5 June 2011 Available online 13 June 2011

Clonal ginbuna crucian carp is, a naturally gynogenetic fish, and is a useful model animal for studying T-cell-mediated immunity. To gain molecular information on MHC class I molecules from this species, we have identified four types of MHC class I (caauUA-S3n, caauUF-S3n, caauZE-S3n, and caauZB-S3n) and five beta 2-microglobulin (b2m) (caaub2m-1a, caaub2m-1b, caaub2m-2, caaub2m-3a and caaub2m-3b) by an expressed sequence tag (EST) analysis and using homology cloning with degenerated primers. Like UA class I genes in other cyprinid fish, the caauUA-S3n shows features of classical MHC class I, such as conservation of all key amino acids interacting with antigenic peptides, and ubiquitous tissue expression. A phylogenetic analysis shows that the b2m-1 and b2m-2 isoforms are clustered with those of other cyprinid fishes, while b2m-3 isoforms make a cluster that is separated from a common ancestor of salmonid and cyprinid fishes. This finding suggests that the b2m isoforms of ginbuna cruician carp comprise two lineages and may possess different functions. The MHC class I and b2m sequences from one clonal strain will facilitate our understanding of the interaction of MHC class I with b2m in teleosts. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: MHC class I Beta 2-microglobulin EST Clonal ginbuna crucian carp

1. Introduction Clonal triploid ginbuna crucian carp are naturally occurring gynogenetic fish, and several clonal strains have been available for laboratory study [1]. Using the ginbuna crucian carp, we have demonstrated that cytotoxic T-cell (CTL) activity against virusinfected cells can be induced by infection with crucian carp haematopoietic necrosis virus (CHNV), suggesting that CTL from ginbuna carp recognize virus-infected cells in a MHC-restricted manner [2,3]. However, there is no direct evidence that their recognition of cells infected with virus involves MHC class I molecules. MHC class I molecules have been identified in various fish species, and classified into U-, Z- and L-lineages based on evolutionary relationships [4,5]. The U- or Z-lineages are present in salmonid and cyprinid fishes, covering both classical and nonclassical MHC class I. Beta-2 microglobulin (b2m) is the light chain of the MHC class I, and associates with the heavy chain to stabilize the complex [6]. The b2m genes have been identified in several fish species and some of them have multiple isoforms

* Corresponding author. Tel.: þ81 92 642 2895; fax: þ81 92 642 2897. E-mail address: [email protected] (T. Somamoto). 1050-4648/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2011.06.004

[7e9]. However, molecular information on MHC class I molecules in this species is limited in comparison with that of salmonids and other cyprinid fishes. In the present study, by means of an expressed sequence tag (EST) analysis, we accumulated sequence information on antigen presenting-related genes in the ginbuna crucian carp, and characterized four types of MHC I and five b2m isoforms from a clonal strain.

2. Materials and methods 2.1. Fish, cell line and virus Triploid clonal ginbuna crucian carp (Carassius auratus langsdorfii), an isogeneic strain from Lake Suwa in Nagano prefecture (S3n), were obtained from the National Research Institute of Aquaculture, Japan. The fish were maintained at 25
C and were fed daily with commercial pellets. A CFS cell line derived from the S3n strain of ginbuna crucian carp has been established and maintained as described by Hasegawa et al. [10]. As described previously [2,3], crucian carp haematopoietic necrosis virus (CHNV) was inoculated into the CFS cells growing in Eagle’s minimal essential medium

470

S. Urabe et al. / Fish & Shellfish Immunology 31 (2011) 469e474

(MEM, Nissui) with 2% fetal bovine serum (FBS, Gemini BioProducts Inc, USA). 2.2. Construction of cDNA library for EST analysis of ginbuna crucian carp Ginbuna crucian carp, weighting 15e35 g, were infected with 2  104 TCID50/g fish weight of CHNV by intraperitoneal (i.p.) injection. From four infected fish, the body kidneys and spleens were collected and pooled at 1 and 4 days post-infection. The pooled organs were immediately subjected to total RNA isolation with ISOGEN reagent (Nippon Gene, Tokyo, Japan) according to the manufacture’s instruction. Poly (A)þ RNA was purified using a Quick Prep Micro mRNA kit (Amersham Pharmacia Biotech, UK). Five mg poly(A)þ RNA was subjected to cDNA synthesis using ZAPcDNA Synthesis Kit (Stratagene, USA). Then, a unidirectional cDNA library was constructed in ZAP Express vector (Stratagene, USA). Aliquots were converted into pBK-CMV plasmids by mass excision. Templates for sequencing reaction were prepared by colonydirect PCR. Single path-sequencing from 50 -end of the insert cDNAs (0.5e4.0 kbp) were performed on Beckman CEQ-8800 sequencer, using the following primer: 50 -CACTAAAGGGAA CAAAAGCTGGAG-30 . 2.3. Cloning and sequencing of four MHC class I genes Partial sequences of two MHC class I genes (caauUF and caauZE) were obtained from the EST library. In addition, two more MHC class I genes (caauUA and caauZB) were amplified by 50 - or 30 -RACE PCR using degenerate primers (see Table 1) which were designed from regions that are conserved in other teleosts. Total RNA was extracted with ISOGEN reagent from CFS cells and was prepared for 50 - and 30 -RACE PCR with a SMART RACE cDNA amplification kit (Clontech Laboratories, USA) according to the manufacturer’s protocol.

To obtain complete sequence for the ORFs of the four MHC class I genes, we performed RACE PCR following the protocol previously described [11]. Sequence and usage of all primers are described in Table 1. The 50 - and 30 -ends were generated in two successive rounds of PCR, first with the specific primer and then with nested primers, in conjunction with primers from the kit (Clontech Laboratories, USA). After the 50 - and/or 30 - untranslated regions (UTR) were sequenced, the cDNAs with complete ORFs were generated by RACE PCR using primers corresponding to the 50 - UTR or 30 -UTR, respectively. The amplified fragments were introduced into pGEMT vector (Promega, USA). Plasmid DNA was purified and both strands were sequenced in both directions using CEQ 8800 sequencer (Beckman Coulter, USA). 2.4. Expression analysis of MHC class I mRNA by RT-PCR To investigate whether the four class I genes are expressed in all tissues, we performed an RT-PCR analysis. Following the protocol described above, total RNA was extracted from brain, gill, heart, thymus, head kidney, posterior kidney, spleen, liver, intestine, muscle, ovary and PBL from the S3n strain of ginbuna and from CFS cells. PCRs were carried out with the specific primer sets that are indicated in Table 1. EF1-a mRNA was amplified as an internal control. The PCR cycling protocols for analysis of tissue distribution were as follows: for MHC class I; 95
C for 2 min, 30 cycles of 95
C for 15 s, 57
C (caauUF and caauZE), 58
C (caauZB) or 60
C (caauUA) for 30 s, 72
C for 20 s, finally 72
C for 5 min; for EF1-a: 95
C for 2 min, 25 cycles of 95
C for 15 s, 58
C for 30 s, 72
C for 5 min. 3. Results and discussion 3.1. Genes involved in antigen presentation A total of 2006 clones were sequenced from the cDNA library. 267 contigs and 999 singletons were obtained by clustering

Table 1 Primers used to amplify cDNA for MHC class I and EF1-a. Gene name

Primer name

Sequences (50 e30 )

Usages

Caau-UA

Caau-UAR1 Caau-UAR2 Caau-UAF1 Caau-UAF2 Caau-UAF3 Caau-UAR3

TCCCAGTAATCTKCYCCYWCAYTCT TSATCCACTCTGTCTTBGGVAC GAGTCTGGATCACTTATTTTAACCC GGATCACTTATTTTAACCCAATTCTCTGG TGCTTTGAGCTCCATGTTCTTCAG GACACGAAGATCTTGTGTTGTCTTT

gene cloning gene cloning gene cloning gene cloning Tissue distribution analysis Tissue distribution analysis

Caau-UF

Caau-UFR1 Caau-UFF1 Caau-UFF2 Caau-UFF3 Caau-UFR2

ACAACACAGCCCACAATGAA GGAGACAACTGAGGTGTCTGC TGAAAGGAGGCAAGCGCAAGG CTTGTCTGTGCTGGCCAGCATTCC CAGCTCACAGCGTACATCAGCTGG

gene cloning gene cloning gene cloning Tissue distribution analysis Tissue distribution analysis

Caau-ZE

Caau-ZEF1 Caau-ZER1 Caau-ZER2 Caau-ZEF2 Caau-ZER3

GGAATGGTGATTGGAGCTGT CACACATGCATAACTACACATTACTGA AGTAACCTATGTCTGACTCTTACACAC GGCGTTGTCTAAACCCGTTGAG CTGAAGAACATGAACATCAGACTCA

gene cloning gene cloning gene cloning Tissue distribution analysis Tissue distribution analysis

Caau-ZB

Caau-ZBF1 CaauZBF2 CaauZBR2 CaauZBR3 Caau-ZBF3 Caau-ZBR4

GTGTTTGCRAGGARAKCTCCWG CTCCWGATGATCACASYAAGCTG CTGGACCGGGGATCTGAACAA GTGAGGTTGGATCCAATCTTGAG TGCTTTGAGCTCCATGTTCTTCAG GACACGAAGATCTTGTGTTGTCTTT

gene cloning gene cloning gene cloning gene cloning Tissue distribution analysis Tissue distribution analysis

EF1-a

EF1-aF1 EF1-aR1

CGGCTTCAATGCTCAGGTCATC GGGAAATTCATTTGGTCTTGGCAGCCT

Tissue distribution analysis Tissue distribution analysis

The code for mixed nucleotides is as follows: S is G or C, W is T or A, R is G or A, Y is C or T, and M is A or C.

S. Urabe et al. / Fish & Shellfish Immunology 31 (2011) 469e474

analysis. EST sequences relating to antigen presentation by MHC were identified as summarized in Table 1. Two types of MHC class I (similar to ZE and UF genes of cyprinid fishes), five distinct b2m and other proteins related to antigen presentation and antigenprocessing, such as MHC class II, invariant chain, ubiquitinrelated proteins and proteasome activator (PA28), were found in the library. 3.2. Identification of four types of MHC class I genes Teleost species display a wide variety of MHC class I molecules, and previous studies classified these genes into the U-, Z-, L-lineage [4,5,8,12,13]. In the present study, complete ORFs of four MHC class I genes have been identified in the S3n strain of ginbuna crucian carp (Fig. 1A). They were classified into U- or Z-lineage and

471

designated caauUA-S3n, caauUF-S3n, caauZE-S3n and caauZB-S3n, based on their phylogenetic relationship (Fig. 2A). Each of the four MHC class I genes consists of a signal peptide, a1, a2 and a3 domains, transmembrane domain (TM), and a cytoplasmic domain (CYT) similar to other known MHC class I genes. Cysteine residues forming a disulfide bond in a2 and a3 domains and residues binding to b2m are conserved in all MHC class I genes (Fig. 1A). Cyprinid MHC class I-UA or UB -genes can be categorized as classical MHC molecules that present nonself peptides primarily to CD8þ T-cells, because like other classical class I molecules, they are ubiquitously expressed, are polymorphic, and retain conserved potential peptide anchoring residues [4]. Antigen presentation and regulation of Ctid-UBA by IFN have been characterized recently in grass carp, indicating that the Ctid-UBA plays a role in antigen presentation to CTL [14]. As in other cyprinid UA genes, the

A

B

Fig. 1. Alignment of deduced amino acid sequences of MHC class I (A) and b2m (B) from the S3n strain of ginbuna crucian carp. Gaps in the alignment are shown by dashes, conserved or similar amino acids are shown with an asterisk (*) or dot and colon (. and :), respectively. Cysteine residues forming disulfide bonds are indicated by arrows. (A) Comparison of the a1, a2 and a3 domains of the MHC class I from ginbuna crucian carp and other cyprinids. The conserved residues (YYRFTKWYY), which are crucial for peptide binding in non-mammalian MHC class I, are boxed. A line above the alignment shows the CD8 binding site. Putative N-linked glycosylation sites are underlined. Arrow heads indicate the amino acids binding to b2m. (B) Comparison of the five caau-b2m and human b2m. Predicted signal peptides are indicated by bold font. Gene accession number of human b2m is CR457066. Additional gene accession numbers are indicated in Fig. 2.

472

S. Urabe et al. / Fish & Shellfish Immunology 31 (2011) 469e474

A 1000 900 231

Medaka fish: Orla-UAA*0201 (AB450992) Rainbow trout- Onmy-UBA*0101 (AF091785) Rainbow trout: Onmy-UBA*401 (AF287487) Rainbow trout: Onmy-UCA-C32 (U55380) Rainbow trout: Onmy-UDA*0104 (AY523669) Medaka fish: Orla-UCA (AB033381) Rainbow trout-OnmyUEA*0102 (AY525776) Crucai carp- Caau-UA-S3n (AB618656) Grass carp: Ctid-UAA106 (AB190929) Zebrafish: Dare-UEA (NM 131705) Zebrafish: Dare-UAA (Z46776) Common carp: Cyca-UA1-01 (X91015) Common carp: CycaUAw-1(X91022) Crucian carp: Caau-UF-S3n (AB618658) Zebrafish: Dare-UFA (BC066754) Catfish: Icpu-UA-3 (AY008848) Crucian carp-Caau-ZE-S3n p ((AB618657)) 356 Common car: Cyca-ZE*0101 (AJ420957) 998 Barbus Bain-ZE*0201 (AJ420275) 1000 Zebrafish: Dare-ZE*0201 (AJ420954) Crucian carp: Caau-ZB-S3n (AB618659) 983 Common carp: Cyca-ZB*0201 (AJ007848) 1000 Crucian carp: Caau-ZA (L10418) 1000 Common carp: y ((M37107)) p Cyca-ZA Coelacanth: Lach-UB-01 (U08034) Rainbow trout: Onmy-SAA (AF091779)

826 565

297 229 261

658 596 972 635 461 724

Medaka fish: Orla-UBA*0206 (AB451005) Medaka fish: Orla-UBA*0204 (AB451002)

440 997

833 998 545 0.1

B

Human (CR457066) Mouse (NM_009735)

1000

Chicken (NM_001001750) Frog (AF217962) Atlantic cod ((AJ132752)) Seabream -2 (AB469144) Sturgeon(AJ133655) Yellow croaker(DQ234793) Seabream -1 (AB469145)

679

757

437

935

Catfish (AF016043) Barbus(AJ507010)

513 579 364

990 322

Zebrafish (NP_571238) Grass carp -1 (AB190815) Grass carp -2 (AB128864) Atlantic salmon salmon-BA1 BA1 (AF180478) Atlantic salmon-BA6 (AF180484) Rainbow trout -1 (L63533) 688

1000

848

993

969

Rainbow trout -2 (L63539) 1000 0.1

Fig. 2. Phylogenetic tree of MHC class I (A) and b2m (B) drawn by the neighbor-joining method, based on the amino acid alignment (Clustal W). Node values represent bootstrap analysis of 1000 replicants. Accession numbers of all genes are noted in this tree. The genes which were characterized in this study are underlined.

caauUA-S3n gene also retains all the peptide termini-binding residues [15] and is expressed in various tissues (Fig. 3). These findings show that caauUA-S3n resembles classical MHC class I genes in several respects. In the future, polymorphic and functional analyses are needed to confirm whether caauUA-S3n molecule functions as classical MHC class I in the strain of ginbuna carp. Another U-lineage of MHC class I has been found in the S3n strain of ginbuna carp. As the phylogenetic analysis indicates that the sequence is closely related to the zebrafish UFA gene, we named the U-lineage gene “caauUF-S3n”. The caauUF-S3n gene conserves seven of the nine peptide termini-binding residues (Y7 and Y60 are replaced to V and F, respectively) and is ubiquitously expressed (Fig. 1A and Fig. 3). Since it is unclear whether the two amino acid substitutions affect the ability to bind peptides, it is possible that caauUF-S3 functions as a classical MHC molecule. ZE molecules are found throughout teleosts and display a number of features typical of classical MHC [12]. In fact, like

other cyprinid ZE genes, caauZE-S3n is ubiquitously expressed and conservs eight of the nine of putative peptide-binding residues (Fig. 1A and Fig. 3). However, Miller et al. [16] expressed the view that the pattern of polymorphism observed at ZE loci does not fit a classical model, because exons 2 and 3 are less polymorphic than exon 4 in genomic sequences of ZE genes from all species surveyed. To clarify whether ZE gene is classical MHC, further investigations are needed to accumulate information on polymorphisms and functions of ZE molecules in various fish species. Kruiswijk et al. [12] have reported that ZB molecules are nonclassical MHC class I in fish, because they do not conserve the peptide-binding residues. caau-ZB-S3n also lacks three key residues for binding peptides (Fig. 1A) and, therefore, seems to be categorized as non-classical MHC class I in ginbuna carp. Triploid ginbuna crucian carp are heterozygous clones, with chromosome numbers exceeding 150 [17,18]. In addition, many

NTC

CFS cells

PBL

473

Muscle

Ovary

Intestine

Spleen

Trunk Kidney

Head Kidney

Liver

Thymus

Heart

Gill

Brain

S. Urabe et al. / Fish & Shellfish Immunology 31 (2011) 469e474

CaauUA-S3n CaauUF-S3n CaauZE-S3n CaauZB-S3n EF1alpha Fig. 3. Tissue distribution of four MHC class I mRNAs in ginbuna crucian carp. Data are representative of two fish analyzed.

genes of cyprinid fishes appear to be present in multiple copies, possibly as a result of gene duplication. Therefore, it is not easy to understand the evolutionary relationship among the four MHC class I genes in triploid ginbuna carp. In the present study, it is

unclear whether the same lineages of the caauMHC class I genes diverged from single locus. To resolve this question, further sequence analysis would be needed not only in other strains of triploid ginbuna carp but in diploid ginbuna carp.

Table 2 ESTs encoding for possible antigen presentation-related molecules from S3n strain of ginbuna carp. a

E-value

a

Clones

Accession number

Subject (name of top hit genes by BlastX)

Species

aa identity

FS997912

MHC class I UFA gene

Danio rerio

46%

2E-20

1

FS998510

MHC class I antigen (ZE genes)

Labeobarbus intermedius

74%

5.00E-91

1

FS998101

MHC class II alpha chain

Cyprinus

89%

1E-26

1

FS998380 FS998599 FS998690

MHC class II-associated invariant chain

Danio rerio

64%, 68%, 67%

4E-35, 8E-34, 1E-84

3

FS999016 FS999096 FS999264

Beta-2-microglobulin

Barbus intermedius

84%, 82%, 82%

2E-59, 1E-58, 1E-58

3

FS998333 FS998523

Beta-2-microglobulin

Labeobarbus intermedius

87%, 82%

6E-60, 7E-58

2

FS998558 FS998955

Beta-2-microglobulin precursor

Salmo salar

78%, 80%

2E-40, 4E-42

2

FS999328 FS999340 FS999380

Beta-2-microglobulin precursor

Cyprinus carpio

93%, 93%, 93%

3E-61,3E-61,3E-61

3

FS998052

Proteasome activator subunit 1

Danio rerio

94%

7E-69

1

FS998496

Signal transducer and activator of transcription 1, (STAT1)

Pongo abelii

41%

4E-14

1

FS998829 FS999211

Ubiquitin

Salmo salar

98%

4E-102

2

FS998847

Ubiquitin-conjugating enzyme E2 E2

Salmo salar

95%

5E-59

1

FS997417 FS997418 FS997861 FS999087

ubiquitin specific protease 1

Danio rerio

77%, 70%, 80%, 80%

4E-58, 3E-41,1E-71, 5E-81

4

FS998034

heat shock cognate 70 kDa protein

Carassius auratus

100%

3E-41

2

FS998304 FS998813

heat shock cognate 70 kDa protein

Carassius auratus gibelio

99%

1E-97, 2E-93

2

a b

Amino acid identities and E-values against the subjects. Number of clones found in this EST analysis.

b

474

S. Urabe et al. / Fish & Shellfish Immunology 31 (2011) 469e474

3.3. Identification of b2m genes Although MHC class I heavy chain genes are highly polymorphic,

b2m is not polymorphic and has no isoform diversity in higher vertebrates. However, it has been reported that multiple isoforms of b2m exist in several fish species [8,9]. In the present study, we found five distinct cDNA sequences encoding complete ORF of b2m (Table 2 and Fig. 1B). The caaub2m-1a, caaub2m-1b and caaub2m-2 share 82.8e94.8% amino acid identities, whereas the identities of caaub2m-3 with the other isoforms are low (59.0e64.1%). Phylogenetic analysis indicates that caaub2m-3 isoforms diverged before the separation of other cyprinid b2m and salmonid b2m, while the other three isoforms (caaub2m-1, caaub2m-2a and caaub2m-2b) are clustered into a cyprinid b2m clade (Fig. 2B). As caaub2m-3 and other isoforms show low identity and different evolutionary relationship, they may have distinct functions, for example, interacting with different lineages of MHC class I. 3.4. Conclusion Four types of MHC class I and five b2m isoforms have been identified from the S3n strain of clonal ginbuna crucian carp. Since CTL assays using this S3n strain of ginbuna carp have already been established, and since monoclonal antibodies against ginbuna CD8a and CD4 have been previously produced [19,20], functional studies employing the ginbuna carp should be done to facilitate understanding of the interaction of CTL with MHC class I molecules, a critical step in cellular immunity. Acknowledgments This research was supported in part by a Grant-in-Aid for Young Scientists (B) from Japan Society and a Grant-in-Aid for Scientific Research (B) for the Promotion of Science (JSPS). We thank Dr C. J. Bayne (Department of Zoology, Oregon State University, Corvallis) for correcting English of this manuscript. References [1] Nakanishi T, Toda H, Shibasaki Y, Somamoto T. Cytotoxic T cells in teleost fish. Dev Comp Immunol. 2011; doi:10.1016/j.dci.2011.03.033. [2] Somamoto T, Nakanishi T, Okamoto N. Role of specific cell-mediated cytotoxicity in protecting fish from viral infections. Virology 2002;297:120e7.

[3] Somamoto T, Okamoto N, Nakanishi T, Ototake M, Nakao M. In vitro generation of viral-antigen dependent cytotoxic T-cells from ginbuna crucian carp, Carassius auratus langsdorfii. Virology 2009;389:26e33. [4] Stet RJ, Kruiswijk CP, Saeij JP, Wiegertjes GF. Major histocompatibility genes in cyprinid fishes: theory and practice. Immunol Rev 1998;166:301e16. [5] Dijkstra JM, Katagiri T, Hosomichi K, Yanagiya K, Inoko H, Ototake M, et al. A third broad lineage of major histocompatibility complex (MHC) class I in teleost fish; MHC class II linkage and processed genes. Immunogenetics 2007; 59:305e21. [6] Solheim JC. Class I MHC molecules: assembly and antigen presentation. Immunol Rev 1999;172:11e9. [7] Magor KE, Shum BP, Parham P. The beta 2-microglobulin locus of rainbow trout (Oncorhynchus mykiss) contains three polymorphic genes. J Immunol 2004;172:3635e43. [8] Lukacs MF, Harstad H, Bakke HG, Beetz-Sargent M, McKinnel L, Lubieniecki KP, et al. Comprehensive analysis of MHC class I genes from the U-, S-, and Zlineages in atlantic salmon. BMC Genomics 2010;11:154. [9] Kondo H, Darawiroj D, Gung YT, Yasuike M, Hirono I, Aoki T. Identification of two distinct types of beta-2 microglobulin in marine fish, Pagrus major and Seriola quinqueradiata. Vet Immunol Immunopathol 2010;134: 284e8. [10] Hasegawa S, Nakayasu C, Okamoto N, Nakanishi T, Ikeda Y. Fin cell line from isogeneic ginbuna crucian carp. In Vitro Cell Dev Biol Anim 1997;33: 232e3. [11] Somamoto T, Yoshiura Y, Nakanishi T, Ototake M. Molecular cloning and characterization of two types of CD8alpha from ginbuna crucian carp, Carassius auratus langsdorfii. Dev Comp Immunol 2005;29:693e702. [12] Kruiswijk CP, Hermsen TT, Westphal AH, Savelkoul HF, Stet RJ. A novel functional class I lineage in zebrafish (Danio rerio), carp (Cyprinus carpio), and large barbus (Barbus intermedius) showing an unusual conservation of the peptide binding domains. J Immunol 2002;169:1936e47. [13] Shiina T, Dijkstra JM, Shimizu S, Watanabe A, Yanagiya K, Kiryu I, et al. Interchromosomal duplication of major histocompatibility complex class I regions in rainbow trout (Oncorhynchus mykiss), a species with a presumably recent tetraploid ancestry. Immunogenetics 2005;56: 878e93. [14] Chen W, Jia Z, Zhang T, Zhang N, Lin C, Gao F, et al. MHC class I presentation and regulation by IFN in bony fish determined by molecular analysis of the class I locus in grass carp. J Immunol 2010;185:2209e21. [15] Madden DR. The three-dimensional structure of peptideeMHC complexes. Annu Rev Immunol 1995;13:587e622. [16] Miller KM, Li S, Ming TJ, Kaukinen KH, Schulze AD. The salmonid MHC class I: more ancient loci uncovered. Immunogenetics 2006;58:571e89. [17] Murakami M, Fujita H. Polyploid-specific repetitive DNA sequences from triploid ginbuna (Japanese silver crucian carp, Carassius auratus langsdorfi). Genes Genet Syst 1997;72:107e13. [18] Murakami M, Matsuba C, Fujitani h. Characterization of DNA markers isolated from the gynogenetic triploid ginbuna (Carassius auratus langsdorfi) by representational difference analysis. Aquaculture 2002;208: 59e68. [19] Toda H, Shibasaki Y, Koike T, Ohtani M, Takizawa F, Ototake M, et al. Alloantigen-specific killing is mediated by CD8-positive T cells in fish. Dev Comp Immunol 2009;33:646e52. [20] Toda H, Saito Y, Koike T, Takizawa F, Araki K, Yabu T, et al. Conservation of characteristics and functions of CD4 positive lymphocytes in a teleost fish. Dev Comp Immunol 2011;35:646e52.