- Email: [email protected]
Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina)
G Model TTBDIS-310; No. of Pages 5
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina) Gabriel L. Cicuttin a,∗ , Diego F. Brambati a , Juan I. Rodríguez Eugui a , Cecilia González Lebrero a , María N. De Salvo a , Fernando J. Beltrán a , Federico E. Gury Dohmen a , Isabel Jado b , Pedro Anda b a b
Instituto de Zoonosis Luis Pasteur, Ministerio de Salud, Buenos Aires City, Argentina Laboratorio de Espiroquetas y Patógenos Especiales, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain
a r t i c l e
i n f o
Article history: Received 16 November 2013 Received in revised form 25 February 2014 Accepted 4 March 2014 Available online xxx Keywords: Rickettsia massiliae Anaplasma platys Buenos Aires Rhipicephalus sanguineus Dogs
a b s t r a c t Rickettsioses, ehrlichioses and anaplasmoses are emerging diseases that are mainly transmitted by arthropods and that affect humans and animals. The aim of the present study was to use molecular techniques to detect and characterize those pathogens in dogs and ticks from Buenos Aires city. We studied 207 Rhipicephalus sanguineus ticks and 52 canine blood samples from poor neighborhoods of Buenos Aires city. The samples were molecularly screened for the genera Rickettsia, Ehrlichia, and Anaplasma by PCR and sequencing. DNA of Rickettsia massiliae (3.4%) and Anaplasma platys (13.5%) was detected in ticks and blood samples, respectively. For characterization, the positive samples were subjected to amplification of a fragment of the 190-kDa outer membrane protein gene (spotted fever group rickettsiae) and a fragment of the groESL gene (specific for A. platys). A phylogenetic tree was constructed using the neighbor-joining method, revealing that the sequences were closely related to those of strains from other geographic regions. The results indicate that human and animal pathogens are abundant in dogs and their ticks in Buenos Aires city and portray the potentially high risk of human exposure to infection with these agents, especially in poor neighborhoods, where there is close contact with animals in an environment of poor health conditions. © 2014 Elsevier GmbH. All rights reserved.
Introduction Rickettsioses, ehrlichioses and anaplasmoses are infectious diseases caused by Gram-negative obligate intracellular bacteria from the order Rickettsiales (Dumler et al., 2001). These bacteria are primarily transmitted by arthropods, and are considered to be important emerging pathogens for both humans and animals (Parola and Labruna, 2009). Rickettsia massiliae is commonly associated with ticks of the genus Rhipicephalus in different regions (Parola et al., 2008). Pathogenicity associated with R. massiliae remained unknown for many years, until it was first confirmed as a human pathogen in 2005 following a retrospective study conducted on archived samples obtained from a patient with rickettsiosis in the 1980s (Vitale
∗ Corresponding author at: Av. Díaz Vélez 4821, Ciudad Autónoma de Buenos Aires C1405DCD, Argentina. Tel.: +54 11 4958 9941. E-mail address: [email protected] (G.L. Cicuttin).
et al., 2006). Few cases of human disease were confirmed by this pathogen, although it has been implicated in numerous European cases by serological methods (Vitale et al., 2006; Parola et al., 2008; García-García et al., 2010; Renvoisé et al., 2012). Rickettsia massiliae may also be a health threat to domestic dogs, causing clinical signs that are similar to those of other canine rickettsioses (Beeler et al., 2011). Anaplasma platys is distributed worldwide and is transmitted by ticks from the Rhipicephalus sanguineus complex. This bacterium is the causative agent of canine infectious cyclic thrombocytopenia, which is usually a mild disease, though virulence may vary from region to region (de la Fuente et al., 2006; Abarca et al., 2007; Santos et al., 2009). According to available knowledge, the role of A. platys as a zoonotic pathogen remains inconclusive (Tamí and Tamí, 2004; Abarca et al., 2007; Ramos et al., 2009). In Argentina, 3 species of rickettsia (Rickettsia rickettsii, R. parkeri, and R. massiliae) and one of ehrlichia (Ehrlichia chaffeensis) have been described as being associated with clinical conditions in humans. Additionally, R. amblyommii, R. bellii, R. felis, E. canis and
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001 1877-959X/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model
ARTICLE IN PRESS
TTBDIS-310; No. of Pages 5
G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
2 Table 1 Primers used in this study. Organism
Name
Target
Sequence (5 –3 )
Ref
Rickettsia spp.
RCK/23-5-F RCK/23-5-R Rr190.70p Rr190.602n EHR16SD EHR16SR PLA-HS475F PLA-HS1198R
23S-5S intergenic spacer 23S-5S intergenic spacer ompA ompA 16S rRNA 16S rRNA groESL groESL
GATAGGTCRGRTGTGGAAGCAC TCGGGAYGGGATCGTGTGTTTC ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT GGTACCYACAGAAGAAGTCC TAGCACTCATCGTTTACAGC AAGGCGAAAGAAGCAGTCTTA CATAGTCTGAAGTGGAGGAC
Jado et al. (2006) Jado et al. (2006) Regnery et al. (1991) Regnery et al. (1991) Parola et al. (2000) Parola et al. (2000) Inokuma et al. (2002) Inokuma et al. (2002)
Rickettsia spp. (spotted fever group) Anaplasma-taceae family Anaplasma platys
A. platys were detected in several regions of the country (Venzal and Nava, 2011; Cicuttin et al., 2012; Eiras et al., 2013). The aim of this study was to investigate the presence of Rickettsia, Ehrlichia, and Anaplasma species in ticks and domestic dogs from poor neighborhoods in Buenos Aires city, as well as to characterize the positive samples. Materials and methods From November 2009 to February 2011, ticks and whole blood samples were collected from domestic dogs (Canis familiaris) in poor neighborhoods in Buenos Aires city. These areas are characterized by the abundance of free-roaming dogs, high levels of parasitism by ticks, and close human–animal coexistence. Clinically healthy dogs were selected randomly from a subpopulation of animals included in a surgical neutering program. With the consent of the owners, blood samples were collected by jugular or cephalic venipuncture with EDTA (ethylenediaminetetraacetic acid) anticoagulant. Ticks were collected manually from each animal and identified by using previously described taxonomic keys (Boero, 1957). All samples were stored at −70 ◦ C until processing. Nymphs were grouped in pools of 3–6 specimens by dog, and adults were processed individually. Each individual or pool was resuspended in Tris–EDTA buffer, sectioned with scalpel, and macerated. DNA extraction was performed by using the guanidine thiocyanate method (Casas et al., 1995). DNA from whole-blood samples was extracted by using the AxyPrep Multisource Genomic DNA Miniprep Kit (Axygen Biosciences, USA), according to the manufacturer’s instructions. Nuclease-free water was used as a negative control for the extraction. The initial screening for Rickettsia was performed by PCR that amplifies a fragment of the 23S-5S rRNA intergenic spacer (Jado et al., 2006). The size of the amplicon ranges from 329 bp in R. typhi to 519 bp in R. helvetica. PCR-positive samples were further confirmed by amplifying an approximately 532-bp fragment of the 190-kDa outer membrane protein gene (ompA) (Regnery et al., 1991). Rickettsia parkeri was used as a positive control. To detect Ehrlichia and Anaplasma, a 345-bp fragment of the 16S rRNA was amplified (Parola et al., 2000), and positives were confirmed by an A. platys groESL gene-specific PCR protocol (724 bp) (Inokuma et al., 2002). Anaplasma bovis was used as a positive control for 16S rRNA PCR. No positive control was performed in A. platys groESL PCR to avoid any source of sample contamination. Nuclease-free water
was used as a negative control. PCRs were performed according to methods previously described by authors cited in Table 1. PCR products were purified by using PureLinkTM Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen-Life Technologies, Carlsbad, CA, USA) and sequenced with a 3500 Genetic Analyzer sequencer (Applied Biosystems, Foster City, CA, USA) at the Servicio de Neurovirosis, Instituto Nacional de Enfermedades Infecciosas (ANLIS Dr. Carlos G. Malbrán, CABA, Argentina). Sequences obtained were first analyzed by using BLAST (www.ncbi.nlm.nih.gov/blast). A phylogenetic analysis was further performed using MEGA version 5 (Tamura et al., 2011). The DNA sequences obtained (23S-5S rRNA intergenic spacer, ompA, 16S rRNA, and groESL) were aligned with sequences available from GenBank. For each analyzed gene, a dendogram was constructed by using neighbor-joining (NJ) with Kimura 2-parameter model. The confidence values for individual branches of the resulting tree were determined by bootstrap analysis with 1000 replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. Nucleotide sequence accession numbers Representative sequences obtained in this study have been deposited in the GenBank database under the following accession numbers: KC525896 (23S-5S intergenic spacer fragment of R. massiliae), KC525893 (ompA gene fragment of R. massiliae), KC525894 (16S rRNA fragment of A. platys), and KC525895 (groESL gene fragment of A. platys). Results A total of 52 domestic dogs was sampled, from which 207 ticks (128 nymphs, 60 females, and 19 males) were collected. All ticks were identified as belonging to the Rh. sanguineus complex. PCR amplification of the 23S-5S intergenic space of Rickettsia spp. was positive for 6 pools of nymphs and 1 male tick, whereas it was negative for all dogs (Table 2). Positive ticks were collected from 4 dogs. Sequencing of positive products was successful in 5/6 pools of nymphs and 1 male tick. The sequences were 100% identical to each other and to the corresponding partial sequence 23S-5S rRNA of R. massiliae strain AZT80 (CP003319) and to Rickettsia sp. Bar29 (AY125014) and 99.7% to R. massiliae MTU5 (CP000683). Three of the 7 positive samples also tested positive for the ompA
Table 2 Summary of results obtained.
Rh. sanguineus Dogs a
Total
Rickettsia spp.
n
23S-5S
207 52
ompA
F. Anaplasmataceae
A. platys
16S rRNA
groESL
n
%
n
%
n
%
n
%
7 0
3.4a 0
3/7 –
42.8 –
0 7
0 13.5
– 7/7
– 100
Minimum infection rate.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model TTBDIS-310; No. of Pages 5
ARTICLE IN PRESS G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
3
Fig. 1. Phylogenetic tree inferred from comparison of the Rickettsia ompA (A) and Ehrlichia/Anaplasma groESL (B) partial sequences. The numbers at nodes are the bootstrap values. The scale bar represents the difference in nucleotide sequences. Sequences obtained in this study are identified as KC525893 (ompA gene fragment of R. massiliae) and KC525895 (groESL gene fragment of A. platys).
fragment. Sequencing of PCR products revealed 100% identity with each other and with the ompA of R. massiliae strain 017 from Buenos Aires city (JX101680), R. massiliae str. AZT80 (CP003319), Rickettsia sp. Bar29 (U43792), and R. massiliae MTU5 (CP000683), among other sequences. Analysis of sequencing data by the NJ method for the ompA gene fragment is illustrated in Fig. 1A. Blood samples from 7 dogs (13.5%) were positive for the 16S rRNA PCR for Ehrlichia/Anaplasma. Twenty-one ticks (8 females, 3 males, and 10 nymphs) were collected from these animals. However, all ticks were negative. All PCR products obtained were sequenced, evidencing 100% identity with each other and with A. platys isolate 165495 from Buenos Aires province (JX261979) and A. platys Lara (AF399917), among other published sequences. Specific fragments of A. platys groESL were also detected in the positive samples. Three positive products of the groESL gene were sequenced, resulting in 100% identity with each other and with E. platys Lara (AF399916), and 99.6% identity with A. platys isolate Santiago 17 (EF201806). Analysis of sequencing data by the NJ method for the groESL gene fragment is illustrated in Fig. 1B.
Discussion To the best of our knowledge, this is the first report where dogs and their ticks were evaluated simultaneously for the presence of the genera Rickettsia, Ehrlichia, and Anaplasma in Buenos Aires city. Our study provides strong evidence for the endemic presence of R. massiliae and A. platys infecting ticks and dogs, respectively, in poor neighborhoods in Buenos Aires city. The analysis of sequence data showed high identity among positive products and high homology to sequences previously found in the region and around the world. Rickettsia massiliae has been described infecting ticks of the genus Rhipicephalus with different prevalences, 2.5–18% in Europe and 5–6% in Africa from ticks collected from hosts (Psaroulaki et al., 2003; Márquez et al., 2008; Sarih et al., 2008; Khaldi et al., 2012), 25% in Israel from ticks collected from vegetation and ground (Harrus et al., 2011), and more than 25% in the United States from ticks collected by flagging, from ground, and from dogs (Eremeeva et al., 2006; Beeler et al., 2011). These differences are possibly
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model TTBDIS-310; No. of Pages 5 4
ARTICLE IN PRESS G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
related to the populations and tick species studied, the hosts, or the environment from which they were collected and the diagnostic methods used. Moreover, the levels of infection may vary among unfed, partially, or fully fed ticks, since it is expected that fed ticks may be infected with microorganisms circulating in the blood of ˜ et al., 2013). In a previous study conducted the host (Estrada-Pena in similarly poor areas from Buenos Aires city, 20% of ticks collected from dogs tested positive for R. massiliae (Cicuttin et al., 2004). This higher level of infection may be attributed to differences in the diagnostic methods used for testing (i.e., PCR combined with reverse hybridization) or in the demography of dog and tick populations under study. Phylogenetic analysis based on partial sequences of the 23S-5S intergenic spacer and the ompA gene showed that all positive samples shared 100% identity and were identical to strains previously found in Buenos Aires city. Previous studies in dogs with Rickettsia massiliae-infected Rh. sanguineus revealed Rickettsia antibodies; however, it was not possible to detect nucleic acid in blood samples (Beeler et al., 2011). This coincides with our observations. Interestingly, acute canine infection with R. conorii and R. rickettsii produce rickettsiemia detectable from day 2 to day 12 post infection, although canine susceptibility to R. massiliae has not yet been proven, either clinically nor experimentally (Cicuttin et al., 2004; Beeler et al., 2011). Further studies with other more sensitive methods of detection are necessary to elucidate the role of dogs as reservoirs. Anaplasma platys has been found infecting domestic dogs in several continents with differences in prevalence rates (e.g., 4–9% in Europe; 16–20% in America) (de la Fuente et al., 2006; Abarca et al., 2007; Santos et al., 2009; Cicuttin et al., 2012). Variations in prevalence seem to be associated with differences in certain determinants, such as the demography of dog populations, the type and number of specimens tested, the extent of tick infestations, and the used diagnostic methods (Cicuttin et al., 2012). In a previous study conducted in similarly poor areas of Buenos Aires city, 33% of the animals were found infected (Cicuttin et al., 2012). Differences in infection rates between previous (33%) and current findings (13.5%) are likely to be a consequence of variation in diagnostic methods and in the number of samples analyzed. Infections by A. platys and E. canis have been recently reported in dogs in the vicinity of Buenos Aires city, showing a compatible clinical picture (Eiras et al., 2013). Sequence analyses of the 16S rRNA and groESL gene fragments revealed high sequence homology among positive samples, and also in comparison with isolates obtained in the surroundings of Buenos Aires and in other countries. Molecular detection of A. platys in ticks is poorly described in the scientific literature (Inokuma et al., 2000; Sanogo et al., 2003). Interestingly, this pathogen was detected infecting Rh. sanguineus ticks in an urban area of Corrientes (north-eastern Argentina) (Oscherov et al., 2011). No DNA of A. platys in ticks was detected in the present study, and possible reasons for this are the differences in the diagnostic methods used for testing (i.e., different methods for nucleic acid extraction utilized or PCR combined with reverse hybridization) and different tick populations studied. In addition, our findings are consistent with reports that revealed that the taxon Rh. sanguineus is represented by 2 lineages in the Southern Cone of South America with a possibly different vectorial competence, but more studies are needed to elucidate this issue (Nava et al., 2012). In terms of public health importance, the description of a human case due to R. massiliae (García-García et al., 2010) and the confirmation that Rh. sanguineus feed on humans from Buenos Aires city (Cicuttin et al., 2011), highlights the importance of this pathogen in the region. For A. platys, previous studies conducted in Venezuela have identified the presence of morulae in the cytoplasm of platelets of HIV-seropositive patients, which showed morphological characteristics similar to those observed in infected
dogs, also detected by PCR, but without identifying the species of ehrlichia or anaplasma involved (Tamí and Tamí, 2004). Recently, A. platys was also detected in a veterinarian with clinical disease (Maggi et al., 2013). Therefore, it is necessary to conduct further studies to demonstrate its potential role as a zoonotic pathogen. In conclusion, results obtained in this study indicate the presence of R. massiliae and A. platys in domestic dogs and their ticks from Buenos Aires city. These findings are a valuable input to better understand the ecoepidemiology of tick-borne pathogens in urban areas, especially in those of low socioeconomic status, where transmission from vector to man is facilitated by close contact with animals in an environment of poor health conditions. In this context, a multidisciplinary approach seems to be the most appropriate strategy to respond to a multiplicity of determinants, for which scientific research and sustained surveillance are necessary components for success. Acknowledgements This work was partially supported by the Alberto J. Roemmers Foundation (grant for medical research health medicine and epidemiology 2010). References Abarca, K., López, J., Perret, C., Guerrero, J., Godoy, P., Veloz, A., Valiente-Echeverría, F., León, U., Gutjahr, C., Azócar, T., 2007. Anaplasma platys in dogs, Chile. Emerg. Infect. Dis. 13 (9), 1392–1395. Beeler, E., Abramowicz, K.F., Zambrano, M.L., Sturgeon, M.M., Khalaf, N., Hu, R., Dasch, G.A., Eremeeva, M.E., 2011. A focus of dogs and Rickettsia massiliae-infected Rhipicephalus sanguineus in California. Am. J. Trop. Med. Hyg. 84 (2), 244–249. Boero, J.J., 1957. Ticks of Argentina (Acarina–Ixodoidea). Depto. Edit. Univ. Buenos Aires, Buenos Aires, 113 pp. Casas, I., Powell, L., Klapper, P.E., Cleator, G.M., 1995. New method for the extraction of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain reaction assay. J. Virol. Methods 53 (1), 25–36. Cicuttin, G.L., Brambati, D.F., Rodríguez-Eugui, J., González-Lebrero, C., De Salvo, M.N., Vidal, P., Gury-Dohmen, F.E., 2011. Hard ticks (Family Ixodidae) on domestic dogs of the Buenos Aires city and Bahia Blanca (Argentina). In: Symposium Proceedings. 2nd National Meeting on Neglected Diseases and XIV International Symposium on Epidemiological Control of Vector-Borne Diseases, Buenos Aires, Argentina, 2012, October 20–21. Fundación Mundo Sano. Cicuttin, G.L., Rodríguez-Vargas, M., Jado, I., Anda, P., 2004. First detection of Rickettsia massiliae in Buenos Aires city. Rev. Argent. Zoon. I (I), 8–10. Cicuttin, G.L., Navarro O’Connor, M., Lobo, B., Jado, I., Anda, P., 2011. Molecular evidence of Anaplasma platys in domestic dogs of the Autonomous City of Buenos Aires. Rev. FAVE 10 (2), 19–24. de la Fuente, J., Torina, A., Naranjo, V., Nicosia, S., Alongi, A., La Mantia, F., Kocan, K.M., 2006. Molecular characterization of Anaplasma platys strains from dogs in Sicily, Italy. BMC Vet. Res. 2, 24. Dumler, J.S., Barbet, A.F., Bekker, C.P., Dasch, G.A., Palmer, G.H., Ray, S.C., Rikihisa, Y., Rurangirwa, F.R., 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma. Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51, 2145–2165. Eiras, D.F., Craviotto, M.B., Vezzani, D., Eyal, O., Baneth, G., 2013. First description of natural Ehrlichia canis and Anaplasma platys infections in dogs from Argentina. Comp. Immunol. Microbiol. Infect. Dis. 36 (2), 169–173. Eremeeva, M.E., Bosserman, E.A., Demma, L.J., Zambrano, M.L., Blau, D.M., Dasch, G.A., 2006. Isolation and identification of Rickettsia massiliae from Rhipicephalus sanguineus ticks collected in Arizona. Appl. Environ. Microbiol. 72 (8), 5569–5577. ˜ A., Gray, J.S., Kahl, O., Lane, R.S., Nijhof, A.M., 2013. Research on the Estrada-Pena, ecology of ticks and tick-borne pathogens – methodological principles and caveats. Front. Cell. Infect. Microbiol. 3, 29. ˜ ˜ García-García, J.C., Portillo, A., Núnez, M.J., Santibánez, S., Castro, B., Oteo, J.A., 2010. A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med. Hyg. 82 (4), 691–692. Harrus, S., Perlman-Avrahami, A., Mumcuoglu, K.Y., Morick, D., Baneth, G., 2011. Molecular detection of Rickettsia massiliae. Rickettsia sibirica mongolitimonae and Rickettsia conorii israelensis in ticks from Israel. Clin. Microbiol. Infect. 17 (2), 176–180. Inokuma, H., Fujii, K., Okuda, M., Onishi, T., Beaufils, J.P., Raoult, D., Brouqui, P., 2002. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin. Diagn. Lab. Immunol. 9 (5), 1132–1136.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model TTBDIS-310; No. of Pages 5
ARTICLE IN PRESS G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Inokuma, H., Raoult, D., Brouqui, P., 2000. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J. Clin. Microbiol. 38 (11), 4219–4221. Jado, I., Escudero, R., Gil, H., Jiménez-Alonso, M.I., Sousa, R., García-Pérez, A.L., Rodríguez-Vargas, M., Lobo, B., Anda, P., 2006. Molecular method for identification of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol. 44 (12), 4572–4576. Khaldi, M., Socolovschi, C., Benyettou, M., Barech, G., Biche, M., Kernif, T., Raoult, D., Parola, P., 2012. Rickettsiae in arthropods collected from the North African Hedgehog (Atelerix algirus) and the desert hedgehog (Paraechinus aethiopicus) in Algeria. Comp. Immunol. Microbiol. Infect. Dis. 35 (2), 117–122. Maggi, R.G., Mascarelli, P.E., Havenga, L.N., Naidoo, V., Breitschwerdt, E.B., 2013. Coinfection with Anaplasma platys. Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasit. Vectors 6, 103. Márquez, F.J., Rodríguez-Liébana, J.J., Soriguer, R.C., Muniaín, M.A., Bernabeu-Wittel, M., Caruz, A., Contreras-Chova, F., 2008. Spotted fever group Rickettsia in brown dog ticks Rhipicephalus sanguineus in southwestern Spain. Parasitol. Res. 103 (1), 119–122. Nava, S., Mastropaolo, M., Venzal, J.M., Mangold, A.J., Guglielmone, A.A., 2012. Mitochondrial DNA analysis of Rhipicephalus sanguineus sensu lato (Acari: Ixodidae) in the Southern Cone of South America. Vet. Parasitol. 190 (3–4), 547–555. Oscherov, E.B., Milano, A.M.F., Lobo, B., Anda, P., Escudero, R., 2011. Detection of Anaplasma platys and other pathogens in ectoparasites from urban hosts in Northeast Argentine. Rev. Ibero-Latinoam. Parasitol. 70 (1), 42–47. Parola, P., Roux, V., Camicas, J.L., Baradji, I., Brouqui, P., Raoult, D., 2000. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 94, 707–709. Parola, P., Labruna, M.B., 2009. Tick-borne rickettsioses in America: unanswered questions and emerging diseases. Curr. Infect. Dis. Rep. 11 (1), 40–50. Parola, P., Socolovschi, C., Jeanjean, L., Bitam, I., Fournier, P.E., Sotto, A., Labauge, P., Raoult, D., 2008. Warmer weather linked to tick attack and emergence of severe rickettsioses. PLoS Negl. Trop. Dis. 2 (11), e338.
5
Psaroulaki, A., Spyridaki, I., Ioannidis, A., Babalis, T., Gikas, A., Tselentis, Y., 2003. First isolation and identification of Rickettsia conorii from ticks collected in the tregion of Fokida in central Greece. J. Clin. Microbiol. 41 (7), 3317–3319. Ramos, C.A., Ramos, R.A., Araújo, F.R., Guedes, D.S., Souza, I.I., Ono, T.M., Vieira, A.S., Pimentel, D.S., Rosas, E.O., Faustino, M.A., Alves, L.C., 2009. Comparison of nestedPCR with blood smear examination in detection of Ehrlichia canis and Anaplasma platys in dogs. Rev. Bras. Parasitol. Vet. 18 (1), 58–62. Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173 (5), 1576–1589. Renvoisé, A., Delaunay, P., Blanchouin, E., Cannavo, I., Cua, E., Socolovschi, C., Parola, P., Raoult, D., 2012. Urban family cluster of spotted fever rickettsiosis linked to Rhipicephalus sanguineus infected with Rickettsia conorii subsp. caspia and Rickettsia massiliae. Ticks Tick Borne Dis. 3 (5–6), 388–391. Santos, F., Coppede, J.S., Pereira, A.L., Oliveira, L.P., Roberto, P.G., Benedetti, R.B., Zucoloto, L.B., Lucas, F., Sobreira, L., Marins, M., 2009. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs from Ribeirão Preto, Brazil. Vet. J. 179 (1), 145–148. Sanogo, Y.O., Davoust, B., Inokuma, H., Camicas, J.L., Parola, P., Brouqui, P., 2003. First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa. Onderstepoort J. Vet. Res. 70 (3), 205–212. Sarih, M., Socolovschi, C., Boudebouch, N., Hassar, M., Raoult, D., Parola, P., 2008. Spotted fever group rickettsiae in ticks, Morocco. Emerg. Infect. Dis. 14 (7), 1067–1073. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tamí, C.D., Tamí, I.C., 2004. Morphological identification of Ehrlichia sp. in platelets from patients infected with human immunodeficiency virus in Venezuela. Rev. Panam. Salud Publica 16 (5), 345–349. Venzal, D.J.M., Nava, S., 2011. The genus Rickettsia causing zoonoses in the Southern Cone of South America. Rev. Med. Urug. 27, 98–106. Vitale, G., Mansuelo, S., Rolain, J.M., Raoult, D., 2006. Rickettsia massiliae human isolation. Emerg. Infect. Dis. 12 (1), 174–175.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina) Gabriel L. Cicuttin a,∗ , Diego F. Brambati a , Juan I. Rodríguez Eugui a , Cecilia González Lebrero a , María N. De Salvo a , Fernando J. Beltrán a , Federico E. Gury Dohmen a , Isabel Jado b , Pedro Anda b a b
Instituto de Zoonosis Luis Pasteur, Ministerio de Salud, Buenos Aires City, Argentina Laboratorio de Espiroquetas y Patógenos Especiales, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain
a r t i c l e
i n f o
Article history: Received 16 November 2013 Received in revised form 25 February 2014 Accepted 4 March 2014 Available online xxx Keywords: Rickettsia massiliae Anaplasma platys Buenos Aires Rhipicephalus sanguineus Dogs
a b s t r a c t Rickettsioses, ehrlichioses and anaplasmoses are emerging diseases that are mainly transmitted by arthropods and that affect humans and animals. The aim of the present study was to use molecular techniques to detect and characterize those pathogens in dogs and ticks from Buenos Aires city. We studied 207 Rhipicephalus sanguineus ticks and 52 canine blood samples from poor neighborhoods of Buenos Aires city. The samples were molecularly screened for the genera Rickettsia, Ehrlichia, and Anaplasma by PCR and sequencing. DNA of Rickettsia massiliae (3.4%) and Anaplasma platys (13.5%) was detected in ticks and blood samples, respectively. For characterization, the positive samples were subjected to amplification of a fragment of the 190-kDa outer membrane protein gene (spotted fever group rickettsiae) and a fragment of the groESL gene (specific for A. platys). A phylogenetic tree was constructed using the neighbor-joining method, revealing that the sequences were closely related to those of strains from other geographic regions. The results indicate that human and animal pathogens are abundant in dogs and their ticks in Buenos Aires city and portray the potentially high risk of human exposure to infection with these agents, especially in poor neighborhoods, where there is close contact with animals in an environment of poor health conditions. © 2014 Elsevier GmbH. All rights reserved.
Introduction Rickettsioses, ehrlichioses and anaplasmoses are infectious diseases caused by Gram-negative obligate intracellular bacteria from the order Rickettsiales (Dumler et al., 2001). These bacteria are primarily transmitted by arthropods, and are considered to be important emerging pathogens for both humans and animals (Parola and Labruna, 2009). Rickettsia massiliae is commonly associated with ticks of the genus Rhipicephalus in different regions (Parola et al., 2008). Pathogenicity associated with R. massiliae remained unknown for many years, until it was first confirmed as a human pathogen in 2005 following a retrospective study conducted on archived samples obtained from a patient with rickettsiosis in the 1980s (Vitale
∗ Corresponding author at: Av. Díaz Vélez 4821, Ciudad Autónoma de Buenos Aires C1405DCD, Argentina. Tel.: +54 11 4958 9941. E-mail address: [email protected] (G.L. Cicuttin).
et al., 2006). Few cases of human disease were confirmed by this pathogen, although it has been implicated in numerous European cases by serological methods (Vitale et al., 2006; Parola et al., 2008; García-García et al., 2010; Renvoisé et al., 2012). Rickettsia massiliae may also be a health threat to domestic dogs, causing clinical signs that are similar to those of other canine rickettsioses (Beeler et al., 2011). Anaplasma platys is distributed worldwide and is transmitted by ticks from the Rhipicephalus sanguineus complex. This bacterium is the causative agent of canine infectious cyclic thrombocytopenia, which is usually a mild disease, though virulence may vary from region to region (de la Fuente et al., 2006; Abarca et al., 2007; Santos et al., 2009). According to available knowledge, the role of A. platys as a zoonotic pathogen remains inconclusive (Tamí and Tamí, 2004; Abarca et al., 2007; Ramos et al., 2009). In Argentina, 3 species of rickettsia (Rickettsia rickettsii, R. parkeri, and R. massiliae) and one of ehrlichia (Ehrlichia chaffeensis) have been described as being associated with clinical conditions in humans. Additionally, R. amblyommii, R. bellii, R. felis, E. canis and
http://dx.doi.org/10.1016/j.ttbdis.2014.03.001 1877-959X/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model
ARTICLE IN PRESS
TTBDIS-310; No. of Pages 5
G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
2 Table 1 Primers used in this study. Organism
Name
Target
Sequence (5 –3 )
Ref
Rickettsia spp.
RCK/23-5-F RCK/23-5-R Rr190.70p Rr190.602n EHR16SD EHR16SR PLA-HS475F PLA-HS1198R
23S-5S intergenic spacer 23S-5S intergenic spacer ompA ompA 16S rRNA 16S rRNA groESL groESL
GATAGGTCRGRTGTGGAAGCAC TCGGGAYGGGATCGTGTGTTTC ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT GGTACCYACAGAAGAAGTCC TAGCACTCATCGTTTACAGC AAGGCGAAAGAAGCAGTCTTA CATAGTCTGAAGTGGAGGAC
Jado et al. (2006) Jado et al. (2006) Regnery et al. (1991) Regnery et al. (1991) Parola et al. (2000) Parola et al. (2000) Inokuma et al. (2002) Inokuma et al. (2002)
Rickettsia spp. (spotted fever group) Anaplasma-taceae family Anaplasma platys
A. platys were detected in several regions of the country (Venzal and Nava, 2011; Cicuttin et al., 2012; Eiras et al., 2013). The aim of this study was to investigate the presence of Rickettsia, Ehrlichia, and Anaplasma species in ticks and domestic dogs from poor neighborhoods in Buenos Aires city, as well as to characterize the positive samples. Materials and methods From November 2009 to February 2011, ticks and whole blood samples were collected from domestic dogs (Canis familiaris) in poor neighborhoods in Buenos Aires city. These areas are characterized by the abundance of free-roaming dogs, high levels of parasitism by ticks, and close human–animal coexistence. Clinically healthy dogs were selected randomly from a subpopulation of animals included in a surgical neutering program. With the consent of the owners, blood samples were collected by jugular or cephalic venipuncture with EDTA (ethylenediaminetetraacetic acid) anticoagulant. Ticks were collected manually from each animal and identified by using previously described taxonomic keys (Boero, 1957). All samples were stored at −70 ◦ C until processing. Nymphs were grouped in pools of 3–6 specimens by dog, and adults were processed individually. Each individual or pool was resuspended in Tris–EDTA buffer, sectioned with scalpel, and macerated. DNA extraction was performed by using the guanidine thiocyanate method (Casas et al., 1995). DNA from whole-blood samples was extracted by using the AxyPrep Multisource Genomic DNA Miniprep Kit (Axygen Biosciences, USA), according to the manufacturer’s instructions. Nuclease-free water was used as a negative control for the extraction. The initial screening for Rickettsia was performed by PCR that amplifies a fragment of the 23S-5S rRNA intergenic spacer (Jado et al., 2006). The size of the amplicon ranges from 329 bp in R. typhi to 519 bp in R. helvetica. PCR-positive samples were further confirmed by amplifying an approximately 532-bp fragment of the 190-kDa outer membrane protein gene (ompA) (Regnery et al., 1991). Rickettsia parkeri was used as a positive control. To detect Ehrlichia and Anaplasma, a 345-bp fragment of the 16S rRNA was amplified (Parola et al., 2000), and positives were confirmed by an A. platys groESL gene-specific PCR protocol (724 bp) (Inokuma et al., 2002). Anaplasma bovis was used as a positive control for 16S rRNA PCR. No positive control was performed in A. platys groESL PCR to avoid any source of sample contamination. Nuclease-free water
was used as a negative control. PCRs were performed according to methods previously described by authors cited in Table 1. PCR products were purified by using PureLinkTM Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen-Life Technologies, Carlsbad, CA, USA) and sequenced with a 3500 Genetic Analyzer sequencer (Applied Biosystems, Foster City, CA, USA) at the Servicio de Neurovirosis, Instituto Nacional de Enfermedades Infecciosas (ANLIS Dr. Carlos G. Malbrán, CABA, Argentina). Sequences obtained were first analyzed by using BLAST (www.ncbi.nlm.nih.gov/blast). A phylogenetic analysis was further performed using MEGA version 5 (Tamura et al., 2011). The DNA sequences obtained (23S-5S rRNA intergenic spacer, ompA, 16S rRNA, and groESL) were aligned with sequences available from GenBank. For each analyzed gene, a dendogram was constructed by using neighbor-joining (NJ) with Kimura 2-parameter model. The confidence values for individual branches of the resulting tree were determined by bootstrap analysis with 1000 replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. Nucleotide sequence accession numbers Representative sequences obtained in this study have been deposited in the GenBank database under the following accession numbers: KC525896 (23S-5S intergenic spacer fragment of R. massiliae), KC525893 (ompA gene fragment of R. massiliae), KC525894 (16S rRNA fragment of A. platys), and KC525895 (groESL gene fragment of A. platys). Results A total of 52 domestic dogs was sampled, from which 207 ticks (128 nymphs, 60 females, and 19 males) were collected. All ticks were identified as belonging to the Rh. sanguineus complex. PCR amplification of the 23S-5S intergenic space of Rickettsia spp. was positive for 6 pools of nymphs and 1 male tick, whereas it was negative for all dogs (Table 2). Positive ticks were collected from 4 dogs. Sequencing of positive products was successful in 5/6 pools of nymphs and 1 male tick. The sequences were 100% identical to each other and to the corresponding partial sequence 23S-5S rRNA of R. massiliae strain AZT80 (CP003319) and to Rickettsia sp. Bar29 (AY125014) and 99.7% to R. massiliae MTU5 (CP000683). Three of the 7 positive samples also tested positive for the ompA
Table 2 Summary of results obtained.
Rh. sanguineus Dogs a
Total
Rickettsia spp.
n
23S-5S
207 52
ompA
F. Anaplasmataceae
A. platys
16S rRNA
groESL
n
%
n
%
n
%
n
%
7 0
3.4a 0
3/7 –
42.8 –
0 7
0 13.5
– 7/7
– 100
Minimum infection rate.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model TTBDIS-310; No. of Pages 5
ARTICLE IN PRESS G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
3
Fig. 1. Phylogenetic tree inferred from comparison of the Rickettsia ompA (A) and Ehrlichia/Anaplasma groESL (B) partial sequences. The numbers at nodes are the bootstrap values. The scale bar represents the difference in nucleotide sequences. Sequences obtained in this study are identified as KC525893 (ompA gene fragment of R. massiliae) and KC525895 (groESL gene fragment of A. platys).
fragment. Sequencing of PCR products revealed 100% identity with each other and with the ompA of R. massiliae strain 017 from Buenos Aires city (JX101680), R. massiliae str. AZT80 (CP003319), Rickettsia sp. Bar29 (U43792), and R. massiliae MTU5 (CP000683), among other sequences. Analysis of sequencing data by the NJ method for the ompA gene fragment is illustrated in Fig. 1A. Blood samples from 7 dogs (13.5%) were positive for the 16S rRNA PCR for Ehrlichia/Anaplasma. Twenty-one ticks (8 females, 3 males, and 10 nymphs) were collected from these animals. However, all ticks were negative. All PCR products obtained were sequenced, evidencing 100% identity with each other and with A. platys isolate 165495 from Buenos Aires province (JX261979) and A. platys Lara (AF399917), among other published sequences. Specific fragments of A. platys groESL were also detected in the positive samples. Three positive products of the groESL gene were sequenced, resulting in 100% identity with each other and with E. platys Lara (AF399916), and 99.6% identity with A. platys isolate Santiago 17 (EF201806). Analysis of sequencing data by the NJ method for the groESL gene fragment is illustrated in Fig. 1B.
Discussion To the best of our knowledge, this is the first report where dogs and their ticks were evaluated simultaneously for the presence of the genera Rickettsia, Ehrlichia, and Anaplasma in Buenos Aires city. Our study provides strong evidence for the endemic presence of R. massiliae and A. platys infecting ticks and dogs, respectively, in poor neighborhoods in Buenos Aires city. The analysis of sequence data showed high identity among positive products and high homology to sequences previously found in the region and around the world. Rickettsia massiliae has been described infecting ticks of the genus Rhipicephalus with different prevalences, 2.5–18% in Europe and 5–6% in Africa from ticks collected from hosts (Psaroulaki et al., 2003; Márquez et al., 2008; Sarih et al., 2008; Khaldi et al., 2012), 25% in Israel from ticks collected from vegetation and ground (Harrus et al., 2011), and more than 25% in the United States from ticks collected by flagging, from ground, and from dogs (Eremeeva et al., 2006; Beeler et al., 2011). These differences are possibly
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model TTBDIS-310; No. of Pages 5 4
ARTICLE IN PRESS G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
related to the populations and tick species studied, the hosts, or the environment from which they were collected and the diagnostic methods used. Moreover, the levels of infection may vary among unfed, partially, or fully fed ticks, since it is expected that fed ticks may be infected with microorganisms circulating in the blood of ˜ et al., 2013). In a previous study conducted the host (Estrada-Pena in similarly poor areas from Buenos Aires city, 20% of ticks collected from dogs tested positive for R. massiliae (Cicuttin et al., 2004). This higher level of infection may be attributed to differences in the diagnostic methods used for testing (i.e., PCR combined with reverse hybridization) or in the demography of dog and tick populations under study. Phylogenetic analysis based on partial sequences of the 23S-5S intergenic spacer and the ompA gene showed that all positive samples shared 100% identity and were identical to strains previously found in Buenos Aires city. Previous studies in dogs with Rickettsia massiliae-infected Rh. sanguineus revealed Rickettsia antibodies; however, it was not possible to detect nucleic acid in blood samples (Beeler et al., 2011). This coincides with our observations. Interestingly, acute canine infection with R. conorii and R. rickettsii produce rickettsiemia detectable from day 2 to day 12 post infection, although canine susceptibility to R. massiliae has not yet been proven, either clinically nor experimentally (Cicuttin et al., 2004; Beeler et al., 2011). Further studies with other more sensitive methods of detection are necessary to elucidate the role of dogs as reservoirs. Anaplasma platys has been found infecting domestic dogs in several continents with differences in prevalence rates (e.g., 4–9% in Europe; 16–20% in America) (de la Fuente et al., 2006; Abarca et al., 2007; Santos et al., 2009; Cicuttin et al., 2012). Variations in prevalence seem to be associated with differences in certain determinants, such as the demography of dog populations, the type and number of specimens tested, the extent of tick infestations, and the used diagnostic methods (Cicuttin et al., 2012). In a previous study conducted in similarly poor areas of Buenos Aires city, 33% of the animals were found infected (Cicuttin et al., 2012). Differences in infection rates between previous (33%) and current findings (13.5%) are likely to be a consequence of variation in diagnostic methods and in the number of samples analyzed. Infections by A. platys and E. canis have been recently reported in dogs in the vicinity of Buenos Aires city, showing a compatible clinical picture (Eiras et al., 2013). Sequence analyses of the 16S rRNA and groESL gene fragments revealed high sequence homology among positive samples, and also in comparison with isolates obtained in the surroundings of Buenos Aires and in other countries. Molecular detection of A. platys in ticks is poorly described in the scientific literature (Inokuma et al., 2000; Sanogo et al., 2003). Interestingly, this pathogen was detected infecting Rh. sanguineus ticks in an urban area of Corrientes (north-eastern Argentina) (Oscherov et al., 2011). No DNA of A. platys in ticks was detected in the present study, and possible reasons for this are the differences in the diagnostic methods used for testing (i.e., different methods for nucleic acid extraction utilized or PCR combined with reverse hybridization) and different tick populations studied. In addition, our findings are consistent with reports that revealed that the taxon Rh. sanguineus is represented by 2 lineages in the Southern Cone of South America with a possibly different vectorial competence, but more studies are needed to elucidate this issue (Nava et al., 2012). In terms of public health importance, the description of a human case due to R. massiliae (García-García et al., 2010) and the confirmation that Rh. sanguineus feed on humans from Buenos Aires city (Cicuttin et al., 2011), highlights the importance of this pathogen in the region. For A. platys, previous studies conducted in Venezuela have identified the presence of morulae in the cytoplasm of platelets of HIV-seropositive patients, which showed morphological characteristics similar to those observed in infected
dogs, also detected by PCR, but without identifying the species of ehrlichia or anaplasma involved (Tamí and Tamí, 2004). Recently, A. platys was also detected in a veterinarian with clinical disease (Maggi et al., 2013). Therefore, it is necessary to conduct further studies to demonstrate its potential role as a zoonotic pathogen. In conclusion, results obtained in this study indicate the presence of R. massiliae and A. platys in domestic dogs and their ticks from Buenos Aires city. These findings are a valuable input to better understand the ecoepidemiology of tick-borne pathogens in urban areas, especially in those of low socioeconomic status, where transmission from vector to man is facilitated by close contact with animals in an environment of poor health conditions. In this context, a multidisciplinary approach seems to be the most appropriate strategy to respond to a multiplicity of determinants, for which scientific research and sustained surveillance are necessary components for success. Acknowledgements This work was partially supported by the Alberto J. Roemmers Foundation (grant for medical research health medicine and epidemiology 2010). References Abarca, K., López, J., Perret, C., Guerrero, J., Godoy, P., Veloz, A., Valiente-Echeverría, F., León, U., Gutjahr, C., Azócar, T., 2007. Anaplasma platys in dogs, Chile. Emerg. Infect. Dis. 13 (9), 1392–1395. Beeler, E., Abramowicz, K.F., Zambrano, M.L., Sturgeon, M.M., Khalaf, N., Hu, R., Dasch, G.A., Eremeeva, M.E., 2011. A focus of dogs and Rickettsia massiliae-infected Rhipicephalus sanguineus in California. Am. J. Trop. Med. Hyg. 84 (2), 244–249. Boero, J.J., 1957. Ticks of Argentina (Acarina–Ixodoidea). Depto. Edit. Univ. Buenos Aires, Buenos Aires, 113 pp. Casas, I., Powell, L., Klapper, P.E., Cleator, G.M., 1995. New method for the extraction of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain reaction assay. J. Virol. Methods 53 (1), 25–36. Cicuttin, G.L., Brambati, D.F., Rodríguez-Eugui, J., González-Lebrero, C., De Salvo, M.N., Vidal, P., Gury-Dohmen, F.E., 2011. Hard ticks (Family Ixodidae) on domestic dogs of the Buenos Aires city and Bahia Blanca (Argentina). In: Symposium Proceedings. 2nd National Meeting on Neglected Diseases and XIV International Symposium on Epidemiological Control of Vector-Borne Diseases, Buenos Aires, Argentina, 2012, October 20–21. Fundación Mundo Sano. Cicuttin, G.L., Rodríguez-Vargas, M., Jado, I., Anda, P., 2004. First detection of Rickettsia massiliae in Buenos Aires city. Rev. Argent. Zoon. I (I), 8–10. Cicuttin, G.L., Navarro O’Connor, M., Lobo, B., Jado, I., Anda, P., 2011. Molecular evidence of Anaplasma platys in domestic dogs of the Autonomous City of Buenos Aires. Rev. FAVE 10 (2), 19–24. de la Fuente, J., Torina, A., Naranjo, V., Nicosia, S., Alongi, A., La Mantia, F., Kocan, K.M., 2006. Molecular characterization of Anaplasma platys strains from dogs in Sicily, Italy. BMC Vet. Res. 2, 24. Dumler, J.S., Barbet, A.F., Bekker, C.P., Dasch, G.A., Palmer, G.H., Ray, S.C., Rikihisa, Y., Rurangirwa, F.R., 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma. Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51, 2145–2165. Eiras, D.F., Craviotto, M.B., Vezzani, D., Eyal, O., Baneth, G., 2013. First description of natural Ehrlichia canis and Anaplasma platys infections in dogs from Argentina. Comp. Immunol. Microbiol. Infect. Dis. 36 (2), 169–173. Eremeeva, M.E., Bosserman, E.A., Demma, L.J., Zambrano, M.L., Blau, D.M., Dasch, G.A., 2006. Isolation and identification of Rickettsia massiliae from Rhipicephalus sanguineus ticks collected in Arizona. Appl. Environ. Microbiol. 72 (8), 5569–5577. ˜ A., Gray, J.S., Kahl, O., Lane, R.S., Nijhof, A.M., 2013. Research on the Estrada-Pena, ecology of ticks and tick-borne pathogens – methodological principles and caveats. Front. Cell. Infect. Microbiol. 3, 29. ˜ ˜ García-García, J.C., Portillo, A., Núnez, M.J., Santibánez, S., Castro, B., Oteo, J.A., 2010. A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med. Hyg. 82 (4), 691–692. Harrus, S., Perlman-Avrahami, A., Mumcuoglu, K.Y., Morick, D., Baneth, G., 2011. Molecular detection of Rickettsia massiliae. Rickettsia sibirica mongolitimonae and Rickettsia conorii israelensis in ticks from Israel. Clin. Microbiol. Infect. 17 (2), 176–180. Inokuma, H., Fujii, K., Okuda, M., Onishi, T., Beaufils, J.P., Raoult, D., Brouqui, P., 2002. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin. Diagn. Lab. Immunol. 9 (5), 1132–1136.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001
G Model TTBDIS-310; No. of Pages 5
ARTICLE IN PRESS G.L. Cicuttin et al. / Ticks and Tick-borne Diseases xxx (2014) xxx–xxx
Inokuma, H., Raoult, D., Brouqui, P., 2000. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J. Clin. Microbiol. 38 (11), 4219–4221. Jado, I., Escudero, R., Gil, H., Jiménez-Alonso, M.I., Sousa, R., García-Pérez, A.L., Rodríguez-Vargas, M., Lobo, B., Anda, P., 2006. Molecular method for identification of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol. 44 (12), 4572–4576. Khaldi, M., Socolovschi, C., Benyettou, M., Barech, G., Biche, M., Kernif, T., Raoult, D., Parola, P., 2012. Rickettsiae in arthropods collected from the North African Hedgehog (Atelerix algirus) and the desert hedgehog (Paraechinus aethiopicus) in Algeria. Comp. Immunol. Microbiol. Infect. Dis. 35 (2), 117–122. Maggi, R.G., Mascarelli, P.E., Havenga, L.N., Naidoo, V., Breitschwerdt, E.B., 2013. Coinfection with Anaplasma platys. Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasit. Vectors 6, 103. Márquez, F.J., Rodríguez-Liébana, J.J., Soriguer, R.C., Muniaín, M.A., Bernabeu-Wittel, M., Caruz, A., Contreras-Chova, F., 2008. Spotted fever group Rickettsia in brown dog ticks Rhipicephalus sanguineus in southwestern Spain. Parasitol. Res. 103 (1), 119–122. Nava, S., Mastropaolo, M., Venzal, J.M., Mangold, A.J., Guglielmone, A.A., 2012. Mitochondrial DNA analysis of Rhipicephalus sanguineus sensu lato (Acari: Ixodidae) in the Southern Cone of South America. Vet. Parasitol. 190 (3–4), 547–555. Oscherov, E.B., Milano, A.M.F., Lobo, B., Anda, P., Escudero, R., 2011. Detection of Anaplasma platys and other pathogens in ectoparasites from urban hosts in Northeast Argentine. Rev. Ibero-Latinoam. Parasitol. 70 (1), 42–47. Parola, P., Roux, V., Camicas, J.L., Baradji, I., Brouqui, P., Raoult, D., 2000. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 94, 707–709. Parola, P., Labruna, M.B., 2009. Tick-borne rickettsioses in America: unanswered questions and emerging diseases. Curr. Infect. Dis. Rep. 11 (1), 40–50. Parola, P., Socolovschi, C., Jeanjean, L., Bitam, I., Fournier, P.E., Sotto, A., Labauge, P., Raoult, D., 2008. Warmer weather linked to tick attack and emergence of severe rickettsioses. PLoS Negl. Trop. Dis. 2 (11), e338.
5
Psaroulaki, A., Spyridaki, I., Ioannidis, A., Babalis, T., Gikas, A., Tselentis, Y., 2003. First isolation and identification of Rickettsia conorii from ticks collected in the tregion of Fokida in central Greece. J. Clin. Microbiol. 41 (7), 3317–3319. Ramos, C.A., Ramos, R.A., Araújo, F.R., Guedes, D.S., Souza, I.I., Ono, T.M., Vieira, A.S., Pimentel, D.S., Rosas, E.O., Faustino, M.A., Alves, L.C., 2009. Comparison of nestedPCR with blood smear examination in detection of Ehrlichia canis and Anaplasma platys in dogs. Rev. Bras. Parasitol. Vet. 18 (1), 58–62. Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173 (5), 1576–1589. Renvoisé, A., Delaunay, P., Blanchouin, E., Cannavo, I., Cua, E., Socolovschi, C., Parola, P., Raoult, D., 2012. Urban family cluster of spotted fever rickettsiosis linked to Rhipicephalus sanguineus infected with Rickettsia conorii subsp. caspia and Rickettsia massiliae. Ticks Tick Borne Dis. 3 (5–6), 388–391. Santos, F., Coppede, J.S., Pereira, A.L., Oliveira, L.P., Roberto, P.G., Benedetti, R.B., Zucoloto, L.B., Lucas, F., Sobreira, L., Marins, M., 2009. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs from Ribeirão Preto, Brazil. Vet. J. 179 (1), 145–148. Sanogo, Y.O., Davoust, B., Inokuma, H., Camicas, J.L., Parola, P., Brouqui, P., 2003. First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa. Onderstepoort J. Vet. Res. 70 (3), 205–212. Sarih, M., Socolovschi, C., Boudebouch, N., Hassar, M., Raoult, D., Parola, P., 2008. Spotted fever group rickettsiae in ticks, Morocco. Emerg. Infect. Dis. 14 (7), 1067–1073. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tamí, C.D., Tamí, I.C., 2004. Morphological identification of Ehrlichia sp. in platelets from patients infected with human immunodeficiency virus in Venezuela. Rev. Panam. Salud Publica 16 (5), 345–349. Venzal, D.J.M., Nava, S., 2011. The genus Rickettsia causing zoonoses in the Southern Cone of South America. Rev. Med. Urug. 27, 98–106. Vitale, G., Mansuelo, S., Rolain, J.M., Raoult, D., 2006. Rickettsia massiliae human isolation. Emerg. Infect. Dis. 12 (1), 174–175.
Please cite this article in press as: Cicuttin, G.L., et al., Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-borne Dis. (2014), http://dx.doi.org/10.1016/j.ttbdis.2014.03.001