Molecular characterization of RsMPK2, a C1 subgroup mitogen-activated protein kinase in the desert plant Reaumuria soongorica

Plant Physiology and Biochemistry 48 (2010) 836e844

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Molecular characterization of RsMPK2, a C1 subgroup mitogen-activated protein kinase in the desert plant Reaumuria soongorica Yubing Liu a, b, *, Xinrong Li a, b, Huijuan Tan a, b, Meiling Liu a, b, Xin Zhao a, b, Jin Wang a, b a

Extreme Stress Resistance and Biotechnology Laboratory, Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Donggang West Road 320, Lanzhou City, Gansu Province 730000, PR China b Shapotou Desert Research & Experiment Station, Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Donggang West Road 320, Lanzhou City, Gansu Province 730000, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 November 2009 Accepted 6 July 2010 Available online 13 July 2010

Reaumuria soongorica (Pall.) Maxim. is a short woody shrub widely found in semi-arid areas of China, and can survive severe environmental stresses. To understand its potential signaling transduction pathway in stress tolerance, we investigated the participation of mitogen-activated protein kinases (MAPKs) as possible mediators of abiotic stresses. A novel MAP kinase cDNA (RsMPK2) that encodes a 374 amino acid protein was isolated from R. soongorica. RsMPK2 belongs to the C1 subgroup, which is still functionally uncharacterized compared to groups A and B; and contains all 11 of the conserved MAPK subdomains and the TEY phosphorylation motif. RsMPK2 is expressed in vegetative (root, stem, leaf and callus) and reproductive (flower) organs. The transcripts of RsMPK2 were rapidly accumulated at high levels when R. soongorica was subjected to dehydration, salinity conditions and treatment with abscisic acid or hydrogen peroxide. Growth analysis of Escherichia coli (srl::Tn10) cells transformed with pPROEXHTRsMPK2 showed that the expression products of RsMPK2 do not act as an osmoprotectant. But, the inhibition of RsMPK2 expression by the inhibitor U0126 induced a decrease of antioxidant enzyme activity under stresses, indicating that RsMPK2 is involved in the regulation of the antioxidant defense system in the response to stress signaling. Ó 2010 Elsevier Masson SAS. All rights reserved.

Keywords: Abscisic acid Antioxidant defense system Dehydration Hydrogen peroxide MAP kinase Salinity

1. Introduction Plant mitogen-activated protein kinase (MAPK) cascades play an important role in mediating biotic and abiotic stress responses, and is a major pathway through which extracellular stimuli are transduced into intracellular signalling. MAPKs have been identified and classified into four major groups (AeD) [17]; among them, groups A and B have been extensively studied, whereas there is limited functional information on groups C and D to date. The first report of group C function demonstrated that the activation of Arabidopsis C1 subgroup MAPKs (AtMPK1/AtMPK2) might be under the control of signals involved in different types of stresses [20]. Studies on Gossypium hirsutum MAPK (GhMAPK), which has a high degree of identity with plant group-C MAPKs, show that it may also play an important role in response to environmental stresses [24]. OrtizMasia et al. [21] demonstrated that the first C1 subgroup MAP

Abbreviations: MAPKs, mitogen-activated protein kinases. * Corresponding author. Tel./fax: þ86 0931 4967199. E-mail address: [email protected] (Y. Liu). 0981-9428/$ e see front matter Ó 2010 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2010.07.001

kinase from pea (Pisum sativum L.), PsMPK2, plays a role in response to mechanical injury and other stress signals such as abscisic acid, jasmonic acid and hydrogen peroxide. A recent article by Zong et al. [31] provides evidence that ZmMPK7, a novel group C MAPK gene from Zea mays, which is induced by abscisic acid and hydrogen peroxide, is responsible for the removal of reactive oxygen species. These findings indicate that the C group of MAPKs may be involved in the response to stress. Reaumuria soongorica (Pall.) is a desiccation-tolerant perennial semi-shrub that is exposed to multiple environmental stress conditions, including low water availability, extreme temperature fluctuations, high irradiance and nutrient deprivation. The desiccationtolerant traits of R. soongorica have recently been investigated at the physiological level [14e16]), and qualified R. soongorica as a resurrection plant since it is dormant during desiccation. Because of their long life span, trees may have evolved adaptive strategies differing from those of annual plants, to survive long periods of stress; consequently, there is an interest in studying stress resistance in shrubs. R. soongorica is one of the most promising plants for such studies. To investigate the signaling transduction of stress tolerance in R. soongorica, we isolated a C1 subgroup MAPKs gene through

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

837

rapid amplification of cDNA ends (RACE) cloning. Our study of the regulation of this gene’s transcripts in response to diverse stress signals suggests that the C1 subgroup gene RsMPK2 may be involved in the plant defense response to environmental stress. Further experiments show that RsMPK2 does not provide osmo-protection but involved in the activation of the activities of antioxidant enzymes. 2. Materials and methods 2.1. Plant material and treatments Seeds of R. soongorica were obtained from the northern foothills of Lanzhou City, Gansu, China (36170 N, 103 480 E, 1700e1900 m a.s.l.) and were planted in individual 9-L plastic pots containing soil. The pots were placed in the experimental field of the Botanical Garden of Lanzhou University. In the second year, the regenerated plants were used for experiments. For drought treatment, plants were dehydrated by withholding water at air temperature and ambient photoperiod in July. For other treatments, plants were excised at the base of the stem and placed in the distilled water for 1 h to eliminate wound stress (according to [28]). After treatment, the cut ends of the stems were placed in beakers wrapped with aluminum foil containing either 100 mM ABA, 10 mM H2O2 or 200 mM NaCl solution for 24 h at 25  C; the stems were exposed to continuous light at an intensity of 200 mmol m2 s1. To study the effect of MAPKK inhibition on the expression of the gene, the detached plants were pretreated with 10 mM U0126 (SigmaeAldrich), for 8 h and then exposed to either 100 mM ABA, 10 mM H2O2, or 10% PEG (PEG 6000) treatment for 12 h, under the same conditions as described above. The detached plants were treated with distilled water under the same conditions for the whole period and served as controls for the above. After the respective treatments, the leaves of detached plants were harvested at different times and immediately frozen in liquid N2 until further analysis. 2.2. Cloning of RsMPK2 cDNA from R. soongorica The degenerate primers P1 and P2 (Table 1) were designed for amplifying RsMPK2 based on the conserved domains of the C1 subgroup MAPKs of various organisms (Fig. 1). The two primers were used to amplify a cDNA fragment that was reverse transcribed from total RNA samples extracted from R. soongorica leaves by the CTAB method [13]. The RT-PCR product, which was about 550 bp, was gelpurified and cloned into the pGEM-T vector (Promega, USA) for sequencing on an automated DNA sequencer (Prism 377, Applied Biosystems). The full-length cDNA was amplified by RACE technology

Fig. 1. Consensus amino acid sequences of MAPK used for degenerated primers design.

(RNA ligase-mediated rapid amplification of 50 and 30 cDNA end), according to the user manual of the GeneRacer kit (Invitrogen). Total RNA was first treated with calf intestinal phosphatase (CIP) to remove the 50 phosphates and then with tobacco acid pyrophosphatase (TAP) to remove the 50 cap structure from the intact, full-length mRNA. The GeneRacer RNA Oligo was ligated to the 50 end of the mRNA using T4 RNA ligase and reverse transcribed the ligated mRNA using Cloned AMV RT and the GeneRacer Oligo dT Primer to create RACE-ready firststrand cDNA with known priming sites at the 50 and 30 ends. To obtain the 50 end, the first-strand cDNA was amplified using the two nested reverse gene-specific primers 5RP1 and 5RP2, and the GeneRacer 50 nested end primers 5FP1 and 5FP2. To obtain the 30 end, the first-strand cDNA was amplified using the two nested forward gene-specific primers 3FP1 and 3FP2, and the GeneRacer 30 primer 3RP. The RACE PCR products were purified using S.N.A.P.Ô columns and subcloned into Pcr4Blunt-TOPO vector for sequencing. By comparing and aligning the sequences of 30 RACE, 50 RACE and the middle region products, the full-length cDNA sequence of RsMPK2 was obtained. This sequence was subsequently amplified via PCR using the P3 and P4 primers, and sequenced. The PCR amplification for generating the full-length RsMPK2 was repeated three times. The full-length RsMPK2 was subsequently analyzed for molecular characterization, i.e., the presence of conserved motifs, sequence homology, and the secondary structure were determined. 2.3. Semi-quantitative RT-PCR analysis To investigate the tissue-specific expression pattern of RsMPK2, and the expression patterns of RsMPK2 under abiotic stresses, total RNA was extracted from the different organs (root, stem, leaf, callus and flower) of 2-year-old plants by the CTAB method and used in RT-PCR analysis. The RNA samples were quantified spectrophotometrically at 260 nm

Table 1 The primers used in this study. Abbreviation

Sequence (50 -30 )

Description

P1 P2 5RP1 5RP2 5FP1 5FP2 3FP1 3FP2 3RP P3 P4 P5 P6 18SF 18SR P7 P8

AT(C/T) GG(C/T) (A/C)(A/G)I GG(A/C/T) GCI TA(C/T) GG AT(A/G) CA(A/G) CCI GAC (A/G/T)GA CCA IAC (A/G)TC CTAAGATGCCGAAGCAGTTTCAAT AATTCGCGCAACGTCCTCAA CGACTGGAGCACGAGGACAC TGGAGCACGAGGACACTGACAT : ATTGCCAGTATTTCCTGTTCCAGT GTTGGTATCGAGCCCCAGAGC GCTGTCAACGATACGCTACGTAACG CAAACCCGGGGAAGCATTACT GCTTCAGGGTGGTAGTGGAGAATC CGATGCCAAATATGTGCCCATTA CAGCTTCAG GGTGGTAGTGGAGAA ATGATAACTCGACGGATCGC CTTGGATGTGGTAGCC GTTT ACGCGTCGACATGGCGACTCCTATC GAACCTC CGGGATCCCAAGGGAGATTTATTGTTGTGAGA

Degenerate primer, Forward Degenerate primer, Reverse Reverse primer for 5 RACE, outer Reverse primer for 5 RACE, Nested Forward primer for 5 RACE, outer Forward primer for 5 RACE, Nested Forward primer for 3 RACE, outer Forward primer for 3 RACE, Nested GeneRacer 30 reverse primer Gene specific primer, Forward Gene specific primer, Reverse Gene specific primer, Forward Gene specific primer, Reverse 18S gene specific primer, Forward 18S gene specific primer, Reverse Gene specific primer, Forward, SalI site underlined Gene specific primer, Reverse, BamHI site underlined

838

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

and 1 mg of total RNA obtained was reverse transcribed using 0.1 mg of oligo(dT)15 primer and Reverse Transcriptase (Takara, Japan) to obtain 20 ml of cDNA solution. PCR amplifications were performed on 1 ml of cDNA template with the forward P5 primer and reverse P6 primer. The PCR products (5 ml) were separated on 1% agarose gels stained with ethidium bromide. The bands of the PCR products were analyzed by the Gene Tools software from Gene Company Ltd. The RT-PCR reaction for the house-keeping gene (18S gene) using the specific primers 18SF and 18SR, was performed at the same conditions as described above to estimate whether equal amounts of RNA were used in the RT-PCR reaction between the samples. 2.4. Preparation of RsMPK2 antibodies and Western blotting analysis The peptide corresponding to the C-terminus of RsMPK2 (HYHPEADSVTDADVSQQ) was synthesized and conjugated to a keyhole limpet hemocyanin carrier. Polyclonal antiserum was raised in rabbits and purified by affinity column chromatography. We called the antibody anti-RsMPK2. R. soongorica leaves were ground in liquid nitrogen and homogenized in extraction buffer containing 200 mM TriseHCl (pH 8.0), 2 mM EDTA, 1 mM DTT, 10 mM PMSF, 2% (w/w) PVPP, 2% (w/v) PEG 20000 containing 60 mg sodium bicarbonate; the homogenized samples were then centrifuged at 13000  g for 20 min, according to the method of [16]. All steps were carried out at 4  C. The supernatants were considered the protein extracts. The protein content was determined by the Bradford assay [3], and the protein were separated by SDS-PAGE on 12% (m/v) polyacrylamide gels and then transferred to nitrocellulose membranes. The membranes were blocked with TTBS (25 mM TriseHCl, pH 7.5; 137 mM NaCl and 0.2% Tween 20) containing 5% non-fat dry milk for at least 1 h [27] and incubated with the anti-RsMPK2 antibody for 2 h in TTBS containing 1% non-fat dry milk. After several washes with TTBS, the bound antibodies were detected with a horseradish peroxidase conjugated anti-rabbit solution (1:10 000 ratio) and a chemiluminescence kit (Pharmaria). 2.5. Bacterial strains and osmotic tolerance determination Fig. 2. (A) The full-length cDNA sequence and deduced amino acid sequence of R. soongorica RsMPK2 cDNA (GenBank Accession No. EM846599). The nucleotides are numbered on the right; the conserved motif TEY is underlined. (B) A hydrophobicity profile of RsMPK2 protein as determined by using the program TMPRED available at http://www.ch.embnet.org/software/TMPREDform.html.

Experiments were carried out using the Escherichia coli (srl::Tn10) strain [5], which can not grow on minimal media containing high concentrations of sorbitol. The open reading frame of RsMPK2 was amplified by PCR with the primers P7 (with SalI site) and P8 (with BamHI site). The resulting fragment encoding the mature protein of RsMPK2 was cloned into the SalI and BamHI sites of the pPROEXHT vector (Prokaryotic Expression Vector System, Novagen), according to the method of Garwe et al. [9]. E. coli (srl::Tn10) cells were transformed with the pPROEXHT-XVSAP1 construct and grown in M9 minimal medium supplemented with 1 mM MgSO4$7H2O, 0.2% glycerol, 0.1% vitamin B, and 100 mg ml1 of ampicillin. Cell cultures were induced in duplicate by adding 0.2 mM isopropyl thiogalactopyranoside (IPTG) after the optical density at 600 nm (OD600) of the cells had reached approximately 0.5. The cells were allowed to grow for a further 2 h before osmotic stress was applied by adding a 4 M sorbitol solution to a final concentration of 1 M. The growth of the cells was monitored by taking absorbance readings at 600 nm over a 48 h period. The experiment was repeated three times. Data were analyzed using Origin 7.0 (Microcal Software Inc., USA).

protein. Antioxidant enzymes activities were determined according to Zhang et al. [28]. Total catalase (CAT, EC 1.11.1.6) activity was assayed by measuring the rate of decomposition of H2O2 at 240 nm. Total glutathione reductase (GR, EC 1.6.4.2) activity was measured by following the change in A340 as the oxidized glutathione-dependent oxidation of NADPH. One unit of enzyme activity was defined as a change in absorbance of 1 mg protein min1. Total superoxide dismutase (SOD, EC 1.15.1.1) activity was assayed by monitoring the inhibition of photochemical reduction of nitro blue tetrazolium. One unit of SOD activity was defined as the amount of enzyme that was required to cause a 50% inhibition of the reduction of nitro blue tetrazolium monitored at 560 nm. Total peroxidase (POD, EC 1.11.1.7) activity was measured using O-methoxyphenol; the initial rate of increase in DA470 was used to measure enzyme activity.

2.6. Antioxidant enzyme assays

3. Results

The protein extracts were obtained as described above, and the supernatant was immediately used for the following antioxidant enzyme assays. The total activities of antioxidant enzymes were determined as described previously [11]; and one unit of enzyme activity was defined as a 0.01 increase in absorbance DA520 of 1 mg

3.1. Sequence analysis of the full-length cDNA of RsMPK2, a C1 subgroup MAP kinase from R. soongorica The cDNA fragment spanning the entire region of the open reading frame was cloned and sequenced (GenBank accession

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

839

Fig. 3. Alignment of the deduced amino acid sequence of RsMPK2 with PsMPK2 (GenBank Accession No. AF154329), AtMPK1 (Accession No. D14713), AtMPK2 (Accession No. D14714), AtMPK7 (Accession No. D21843), NTF3 (Accession No. X69971) and PhMEK1 (Accession No. X83440). The sequences were aligned using the Clustal W program (http://www. ebi.ac.uk/cgi-bin/clustalw). The region of the C-terminal peptide containing the 17 amino acids sequence used to raise polyclonal antibodies is indicated.

number: EU846599). The cDNA of the MAPK gene recovered from R. soongorica was 1235 bp long, and contained a 1125 bp open reading frame, which encodes a protein of 369 amino acids with a theoretical molecular mass of 42.9 kDa and an isoelectric point of 5.79 (Fig. 2). This gene was named RsMPK2 because the protein exhibits closest homology to PsMPK2, a C1 subgroup of plant MAPKs from Pisum sativum. The hydrophobicity profile of RsMPK2 protein was determined by using the program TMPRED (available at http:// www.ch.embnet.org/software/TMPREDform.html.Hydrophilicity); the plot analysis showed that RsMPK2 is highly hydrophilic and has one predicted transmembrane domain (210e229 bp).

Alignment of the predicted amino acid sequences of RsMPK2 with the cloned MAPKs from various plants was performed using the DNAStar software and is shown in Fig. 3. The RsMPK2 protein contained all 11 conserved amino acid and peptide motifs characteristic of the 11 subdomains of protein kinases with serine/threonine specificity. The TEY motif, which includes the threonine and tyrosine residues whose phosphorylation is necessary for MAP kinase activation is a characteristic feature of MAP kinases and was also conserved in the RsMPK2 protein sequence (Fig. 2). A phylogenetic tree based on the genetic distance of the protein sequences was constructed by the Clustal method using the DANStar software; it was proposed from the

840

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

analysis of sequence homology of the predicted amino acid sequences that plant MAPKs can be grouped into four distinct groups. Based on the relationship tree of cloned plant MAPKs, the sequence of RsMPK2 showed high similarity to the C1 MAP kinase subgroup; therefore, RsMPK2 can be classfied into subgroup C1 (Fig. 4). A comparison of the predicted protein sequences of RsMPK2 with MAP kinases of other plants shows that RsMPK2 is most homologous to the Nicotiana tabacum NtNTF3 (85.3%), P. sativum PsMPK2 (84.7%), and Petunia  hybrida PhMEK1 (84.5%) (Fig. 3). 3.2. RsMPK2 is expressed in vegetative and reproductive organs As different patterns of expression have been reported for C1 subgroup MAPKs [25,6,21], we investigated the expression profile of the RsMPK2 gene in different organs of R. soongorica. Semiquantitative RT-PCR was used to analyze the expression of RsMPK2 in the following organs: root, stem, leaf, callus culture, and flower; relatively higher abundance was observed in root tissues (Fig. 5).

This result indicated that RsMPK2 was not selectively expressed in all tissues but exhibits different levels of expression among them. 3.3. RsMPK2 induction by different stress signals To detect whether the C group MAPK RsMPK2 is involved in defense mechanisms of R. soongorica, its expression patterns under different abiotic stresses were analyzed by RT-PCR; some expression patterns were confirmed by Western blotting. The transcript level of RsMPK2 increased rapidly after exposure to drought. The leaf water potentials were measured as 4.2 MPa and 8.1 MPa, and the maximum levels reached up to 5 and 10 times, respectively, in the leaves of R. soongorica compared to control plants (Fig. 6A). The expression of RsMPK2 could also be induced by NaCl, H2O2 and ABA (Fig. 6B, C, D). The NaCl-induced expression of RsMPK2 was time-dependent and was detected at 3 h after treatment with 200 mM NaCl (Fig. 6B). The transcripts of RsMPK2 increased significantly after 3 h of treatment with H2O2 (Fig. 6C). When R. soongorica

Fig. 4. Position of RsMPK2 in the phylogenetic tree of the C subgroup. Multiple sequence alignment was performed with the DNASTAR software and a neighbor-joining tree was constructed by the Clustal method. The accession numbers of MAPKs sequences used for construction of the tree are as follows: MsMMK4 (X82270), PsMAPK3 (AF153061), PARSLEY MAPK (Y12785), CaMPK1 (AF247135), NtWIPK (D61377), SP-MAPK (AF149424), AtMPK3 (D21839), CbMAPK3(AY805424), AsMAP1 (S56638), WCK1 (AF079318), ZmMPK4 (AB016801), OsBIMK1 (AF332873), CaMAPK2 (AF247136), NtP45NTF4 (X83880), NtSIPK (U94192), MsERK1 (L07042), PsMAPK (X70703), EeMAPK (AF242308), AtMPK6 (D21842), AtMPK4 (D21840), MsMMK2 (X82268), AtMPK5 (D21841), MsMMK3 (AJ224336), NtP43NTF6 (X83879), NtNTF3 (X69971), PhMEK1 (X83440), PsMAPK2 (AF154329), AtMPK7 (D21843), PaMAPK (AF134730), OsMAPK4 (AJ251330), OsMPK3 (AF216317), AtMPK1 (D14713), AtMPK2 (D14714), AtMPK2 (NM_101675) AtMPK9 (NM112686), BWMK1 (AF177392), OsMAPK2 (AF194416), CaMAPK (AJ275316), OsWJUMK1 (AJ512643).

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

841

Fig. 5. Expression profile of RsMPK2 in the different organs of R. soongorica. (A) Semiquantitative RT-PCR of RsMPK2 gene. Total RNA was isolated from different organs of R. soongorica. A 460 bp RsMPK2 fragment was amplified by 30 PCR cycles. As control, an 18S gene fragment was simultaneously amplified. (B) Quantitation of the band intensity of the RsMPK2 fragment obtained in three independent experiments as in (A). Values were normalized against the 18S gene fragment band intensity and the relative intensity obtained in root was considered as 100%. Results are mean  SE (n ¼ 3).

was exposed to exogenous ABA, the transcript levels of RsMPK2 also increased rapidly after 3 h and were maintained at a high level for up to 24 h (Fig. 6D). Western blotting analysis showed that RsMPK2 was significantly up-regulated at the initial stages of treatment with exogenous ABA and H2O2 (Fig. 6C, D). 3.4. RsMPK2 expression in osmotically stressed E. coli To assess the role of RsMPK2 as an osmoprotectant, the RsMPK2 cDNA was cloned into a prokaryotic protein expression vector to yield pET28a-RsMPK2. The resulting construct was expressed as a recombinant protein in the E. coli (srl::Tn10) cells, which can not grow on minimal media containing high concentrations of sorbitol. Under controlled conditions, the presence of the eukaryotic RsMPK2 gene had no significant effect on the LB media of the E. coli cells (Fig. 7B). The expression of the RsMPK2 products in the transformants was confirmed by Western blotting analysis (data not shown). The E. coli (srl::Tn10) cells transformed with this plasmid did not exhibit significantly better growth (over a period of 48 h) in the presence of 1 M sorbitol, compared to E. coli (srl::Tn10) transformed with the vector only, after induction with IPTG (Fig. 7A). Although applying osmotic stress by the addition of sorbitol caused an initial decrease in the growth rate of both cultures, there was a steady increase in the growth rate of the experimental cultures. 3.5. U0126 inhibition on the expression of RsMPK2 To study the effect of MAPK expression on the antioxidant system under environmental stresses, the specific MAPKK inhibitor U0126 was used to inhibit the expression of RsMPK2 and other MAPKs. The expression of RsMPK2 was markedly inhibited by U0126 after treating with H2O2, PEG and ABA, when compared to materials not pretreated with U0126 (Fig. 8A). The total activities of the antioxidant enzymes (T-AOC) was increased 3 h after induction

Fig. 6. Induced expression of RsMPK2 mRNA and RsMPK2 product by stresses. (A) RT-PCR expression analysis of RsMPK2 transcripts after dehydration. C was the control material; 4.2 MPa and 8.1 MPa was the treatment materials whose leaf water potential was 4.2 MPa and 8.1 MPa, respectively. (B) RT-PCR expression analysis of RsMPK2 transcripts at 3 h, 12 h and 24 h after treating leaves with 200 mM NaCl. (C) RT-PCR expression analysis (a) and Western blotting analysis (b) of the RsMPK2 gene and RsMPK2 products at 3 h and 12 h after treating plants with 10 mM H2O2. (D) RT-PCR expression analysis (a) and Western blotting analysis (b) of the RsMPK2 gene and RsMPK2 products at 3 h, 12 h and 24 h after treating plants with 100 mM ABA. A 460 bp RsMPK2 fragment was amplified by 30 PCR cycles in the RT-PCR analysis. As control, an 18S gene fragment as actin was simultaneously amplified. Protein was extracted from leaves of the same plants, as described in the Materials and methods section. Twenty mg of protein were loaded per well and separated on a 10% polyacrylamide electrophoresis gel and used for Western blot analysis.

by H2O2, PEG and ABA; no significant variations were observed in the materials pretreated with U0126 (Fig. 8B). Except for SOD, the activities of CAT, GR and POD were markedly inhibited in materials pretreated with U0126 after 12 h of treatment with H2O2, PEG and ABA (Fig. 8C, D, E, F). In conclusion, the expression of MAPKs was involved in the regulation of the activities of antioxidant enzymes. 4. Discussion In recent years, a large number of different components of plant MAPK cascades have been isolated from plants. Molecular and biochemical studies have revealed that plant MAPKs play an

842

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

Fig. 7. Growth analysis of E. coli (srl::Tn10) cells transformed with the prokaryotic protein expression vector pET30a (open circles) and cells transformed with pET30a -RsMPK2 (closed circles) in minimal media (A) and Luria-Bertani (LB) media (B). The expression of RsMPK2 was induced with IPTG at time zero. The cells were allowed to grow for a further 2 h before sorbitol was added to a final concentration of 1 M. Samples were taken at intervals and the absorbance at 600 nm determined. Error bars represent standard deviation based on the average of triplicate samples. * indicates values that are significantly different from control (P  0.05) in culture.

important role in the response of plants to a broad variety of biotic and abiotic stresses (including wounding, pathogen infection, temperature, drought, salinity), but also in the signaling cascades of plant hormones and in cell division [10,30]. Based on the predicted amino acid sequence homology and phosphorylation motifs, plant MAPKs can be divided into four groups (AeD). It has been assumed that MAPKs within one group have similar functions among plant species [12,17]. A large amount of information about MAPKs in groups A and B revealed that they are involved in the transduction of abiotic stress, but less data about the C group has been reported. Nicotiana tabacum MAPK (NtNTF3) [26] and Petunia  hybrida MAPK (PhMEK1) [6], two members of group C, are involved in pollen or ovule development. Oryza sativa MAPK (OsMPK4) is a well-characterized plant response to defense [8,1]. AtMPK1/ AtMPK2 was affected by different types of stresses [20]. GhMAPK is involved in response to diverse environmental stresses [24]. PsMPK2 plays a role in the response to mechanical injury and other stress signals [21], and ZmMPK7 is involved in the removal of reactive oxygen species [31]. These studies show that the group-C MAPKs may be also associated with biotic and abiotic stress responses, and further experiments will demonstrate how group-C MAPKs are involved in response to stresses. In this report, we described the characterization of the first MAPK isolated from R. soongorica, RsMPK2, which belongs to the C1 subgroup. This is the first study to investigate the MAPK cascade in desert shrubs. The corresponding full-length cDNA was isolated from leaves. The amino acid sequence comparison revealed that RsMPK2 belongs to group C of plant MAPKs and contains all 11 conserved amino acid and peptide motifs characteristic of the 11 subdomains of protein kinases with serine/threonine specificity. The TEY motif, which includes the threonine and tyrosine residues whose phosphorylation is necessary for MAP kinase activation, is a characteristic feature of MAP kinase and is also conserved in the RsMPK2 protein sequence. The phylogenetic tree analysis grouped RsMPK2 into subgroup C1 (Fig. 4). RT-PCR analyses demonstrated that RsMPK2 is expressed in vegetative and reproductive organs of

R. soongorica. A similar pattern of expression has been described for other C1 MAPKs such as NTF3 [25], AtMPK1, AtMPK2 and PsMPK2 [21], but differs from the petunia C1 MAPK (PhMEK1), which is not expressed in the stamen [6]. MAP kinases in plant signaling can be regulated at the transcriptional, translational and post-translational levels [18,21]. In recent years, the C1 subgroup members AtMPK1 and AtMPK2 from Arabidopsis [7,20] and PsMPK2 from pea [21] have been studied. The kinase activities of the latter MAPKs are up-regulated in response to diverse stress signals such as wounding, and treatment with jasmonic acid (JA), abscisic acid (ABA) or hydrogen peroxide (H2O2). In this study, we used semi-quantitative RT-PCR to examine the transcription of the RsMPK2 gene under abiotic stresses. The results showed that RsMPK2 was activated at the transcriptional level by dehydration, as well as ABA, H2O2 and NaCl treatments. The conditions under which RsMPK2 was activated were similar to another group-C member, PsMPK2 [21]. To obtain more direct evidence, we used an antibody raised against the C-terminus of RsMPK2 to measure expression profiles by Western blotting analyses. The RsMPK2 protein was induced within 3 h after treatment with ABA and H2O2. Since RsMPK2 was activated at the transcriptional and translational levels by drought, salt-stress and chemical inducers, it is reasonable to hypothesize that a putative RsMPK2-mediated MAPK cascade is a common signaling event that is shared by various signaling pathways leading to activation of defense responses in R. soongorica. This scenario would be analogous to the hypothesis that MAPKs act as a converging point for many different signals [29]. Furthermore, the biochemical complementation experiment of RsMPK2 gene expression was used to determine whether the RsMPK2 itself acts as an osmoprotectant in the defense response. The E. coli (srl::Tn10) mutant strain used in this study lacks a specific sorbitol transport system and is unable to catabolize this osmoticum. The cells are, therefore, unable to grow in minimal media in which sorbitol is the sole carbon and energy source [5]. Mundree et al. [19] and Garwe et al. [9] determined the osmotic protection function of the ALDRXV4 and XVSAP1 genes through the use of the E. coli (srl::Tn10) mutant strain. Sorbitol is not only the sole

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

843

Fig. 8. Induced expression of RsMPK2 mRNA and variation of antioxidant enzyme activity under stresses with the MAPKK inhibitor U0126 (þ) and without U0126 (). (A) RT-PCR expression analysis of RsMPK2 transcripts after 3 h treated with H2O2, PEG and ABA. A 553 bp RsMPK2 fragment was amplified by 30 PCR cycles in the RT-PCR analysis and an 18S gene fragment as actin was simultaneously amplified. (B), (C), (D), (E) and (F) was the effect of specific MAPKK inhibitor U0126 on the total activities of antioxidant enzymes (T-AOC), the activity of anti-oxidant enzyme CAT, GR, SOD, POD, respectively, after 12 h treated with H2O2, PEG and ABA. C was the control material;  represents the treated materials without pretreated with U0126; þ was the treated materials pretreated with U0126. For each treatment, bars with different letters are significantly different (P < 0.05).

carbon but acts as an osmoprotectant in minimal media. Thus, LB media with sorbitol was selected as a control to inspect the growth of E. coli (srl::Tn10) cells. If RsMPK2 cloned in a prokaryotic expression vector was able to rescue E. coli (srl::Tn10) cells growing in media containing a high concentration of sorbitol, then this complementation experiment would confirm the hypothesis that RsMPK2 gene is associated with osmotic stress tolerance. However, The data presented here show that E. coli (srl::Tn10) cells transformed with the RsMPK2 gene did not grow significantly better in the presence of 1 M sorbitol over a period of 48 h in minimal media, when compared to E. coli (srl::Tn10) transformed with the empty vector in LB media. This implies that RsMPK2 is not a stress-associated gene but rather participates in signaling transfer in R. soongorica. As mentioned above, the data on the functional study of C1 subgroup MAP kinases were limited. However, a recent study

showed that MAPK cascades participate in the regulation of NO and oxidative bursts in Nicotiana benthamiana [2]. MAPK is involved in the ABA-induced antioxidant defense in maize (Zea mays), and a cross talk between H2O2 production and MAPK activation plays a pivotal role in the ABA signaling [28]. ABA-induced H2O2 production activates MAPK, which in turn induces the expression and the activities of antioxidant enzymes. The activation of MAPK also enhances H2O2 production, forming a positive feedback loop. In our study, we analyzed the effects of the C1 subgroup MAP kinase RsMPK2 on enzymes of the antioxidant system in R. soongorica. Stress induces the production of stress proteins or antioxidant enzymes to minimise the damage caused by reactive oxygen species (ROS) [22]. These antioxidant systems can be divided into the two following categories: one that reacts with ROS and keeps them

844

Y. Liu et al. / Plant Physiology and Biochemistry 48 (2010) 836e844

at low levels, (POD, SOD and CAT), and one that regenerates the oxidized antioxidants (ascorbate peroxidase and GR) [23]. This study shows that the expression of RsMPK2 was inhibited by the MAPKK inhibitor U0126 in leaves treated with H2O2, PEG and ABA. The activities of the antioxidant enzymes CAT, GR and POD decreased with U0126 compared to those without U0126. These results indicated that the C1 MAP Kinase RsMPK2 was potentially involved in the regulation of antioxidant enzyme activities, both the effects to prevent the damage of ROS and regenerate antioxidants. C1 MAPKs seem to have modified the common docking (CD) domain that is involved in the docking of substrates and regulatory enzymes such as phosphatases and MAPK kinases [4,7]. Antioxidant enzymes seem to be a promising set of reactions acting downstream of C1 MAPKs signaling pathway in response to stress. Although many substrates can be affected in MAPK signaling pathways in plants, the antioxidant system plays an important role in response to stresses. A lot of work will be done in screening the direct substrate acting between the downstream of C1 MAPK signaling pathway of R. soongorica and the antioxidant system in the future. This insight into the function of C1 MAPKs would explain how the C group MAPKs respond to stress signals in the cell. In conclusion, our results suggest that RsMPK2 participates in the regulation of responses to abiotic stresses. RsMPK2 is not an osmoprotectant, but is involved in the activation of the activities of antioxidant enzymes. Further studies are needed to identify the nature of the C1 group MAPKs, and to elucidate the molecular mechanisms of interaction between the antioxidant defense system and the C1 group MAPK activation to explain how the C1 group MAPK up-regulates stress resistance in plant. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (30800122, 31070358, 30960065 and 40825001). We are grateful to the anonymous reviewers for their valuable scientific comments to improve the manuscript. References [1] G.K. Agrawal, S.K. Agrawal, J. Shibato, H. Iwahashi, R. Rakwal, Novel rice MAPK kinase OsMSRMK3 and OsWJUMK1 involved in encountering diverse environmental stresses and developmental regulation, Biochem. Biophys. Res. Commun. 300 (2003) 775e783. [2] S. Asai, K. Ohta, H. Yoshioka, MAPK signaling regulates nitric oxide and NADPH oxidase-dependent oxidative bursts in Nicotiana benthamiana, Plant Cell 20 (2008) 1390e1406. [3] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248e254. [4] A. Champion, M. Kreis, K. Mockaitis, A. Picaud, Y. Henry, Arabidopsis kinome: after the casting, Funct. Integr. Genomics 4 (2004) 163e187. [5] L.N. Csonka, A.J. Clark, Deletions generated by the transposon Tn10 in the srl recA region of Escherichia coli K-12 chromosome, Genetics 93 (1979) 321e343. [6] V. Decroocq-Ferrant, S. Decroocq, J. Van Went, E. Schmidt, M. Kreis, A homologue of the MAP/ERK family of protein kinase genes is expressed in vegetative and in female reproductive organs of Petunia hybrida, Plant Mol. Biol. 27 (1995) 339e350.

[7] R. Doczi, G. Brader, A. Pettko-Szandtner, I. Rajh, A. Djamei, A. Pitzschke, M. Teige, H. Hirt, The Arabidopsis mitogen-activated protein kinase kinase MKK3 is upstream of group C mitogenactivated protein kinases and participates in pathogen signaling, Plant Cell 19 (2007) 3266e3279. [8] S.F. Fu, W.C. Chou, D.D. Huang, H.J. Huang, Transcriptional regulation of a rice mitogen-activated protein kinase gene, OsMAPK4, in response to environmental stress, Plant Cell Physiol. 43 (2002) 958e963. [9] D. Garwe, J.A. Thomson, S.G. Mundree, Molecular characterization of XVSAP1, a stress-responsive gene from the resurrection plant Xerophyta viscosa Baker, J. Exp. Bot. 54 (2003) 191e201. [10] H. Hirt, Multiple roles of MAP kinases in plant signal transduction, Trends Plant Sci. 2 (1997) 11e15. [11] M. Jiang, J. Zhang, Effects of abscisic acid on active oxygen species, antioxidative defence system and oxidative damage in leaves of maize seedling, Plant Cell Physiol. 42 (2001) 1265e1273. [12] C. Jonak, W. Ligterink, H. Hirt, MAP kinase in plant signal transduction, Cell Mol. Life Sci. 55 (1999) 204e213. [13] Y. Liu, T. Zhang, L. An, G. Wang, Isolation of RNA using modified method of CTAB from dehydrated and nondehydrated Reaumuria soongorica tissues, J. Desert Res. 26 (2006) 600e603. [14] Y. Liu, T. Zhang, X. Li, G. Wang, Protective mechanism of desiccation tolerance in Reaumuria soongorica: leaf abscission and sucrose accumulation in the stem, Sci. China Ser. C 50 (2007) 15e21. [15] Y. Liu, G. Wang, J. Liu, X. Zhao, H. Tan, X. Li, Anatomical, morphological and metabolic acclimation in the resurrection plant Reaumuria soongorica during dehydration and rehydration, J. Arid Environ. 70 (2007) 183e194. [16] Y. Liu, T. Zhang, J. Wang, Photosynthesis and metabolite levels in dehydrating leaves of Reaumuria soongorica, Acta Biol. Cracov. Ser. Bot. 50 (2008) 19e26. [17] MAPK-Group, Mitogen-activated protein kinase cascades in plants: a new nomenclature, Trends Plant Sci. 7 (2002) 301e308. [18] N.S. Mishra, R. Tuteja, N. Tuteja, Signaling through MAP kinase networks in plants, Arch. Biochem. Biophys. 452 (2006) 55e68. [19] S.G. Mundree, A. Whittaker, J.A. Thomson, J.M. Farrant, An aldose reductase homolog from the resurrection plant Xerophyta viscose Baker, Planta 211 (2000) 693e700. [20] D. Ortiz-Masia, M.A. Perez-Amador, J. Carbonell, M.J. Marcote, Diverse stress signals activate the C1 subgroup MAP kinases of Arabidopsis, FEBS Lett. 581 (2007) 1834e1840. [21] D. Ortiz-Masia, M.A. Perez-Amador, P. Carbonell, F. Aniento, J. Carbonell, M.J. Marcote, Characterization of PsMPK2, the first C1 subgroup MAP kinase from pea (Pisum sativum L.), Planta 227 (2008) 1333e1342. [22] R. Porcel, J.M. Barea, J.M. Ruiz-Lozano, Antioxidant activities in mycorrhizal soybean plants under drought stress and their possible relationship to the process of nodule senescence, New Phytol. 157 (2003) 135e143. [23] N. Smirnoff, The role of active oxygen in the response of plants to water deficit and desiccation, New Phytol. 125 (1993) 27e58. [24] M. Wang, Y. Zhang, J. Wang, X. Wu, X. Guo, A novel MAP kinase gene in cotton (Gossypium hirsutum L.), GhMAPK, is involved in response to diverse environmental stresses, J. Biochem. Mol. Biol. 40 (2007) 325e332. [25] C. Wilson, N. Eller, A. Gartner, O. Vicente, E. Heberle-Bors, Isolation and characterization of a tobacco cDNA clone encoding a putative MAP kinase, Plant Mol. Biol. 23 (1993) 543e551. [26] V. Wilson, A. Voronin, O. Touraev, E. Vincente, E. Heberle-Bors, A developmentally regulated MAP kinase activated by hydration in tobacco pollen, Plant Cell 9 (1997) 2093e2100. [27] Y. Wu, N. Ding, X. Zhao, M. Zhao, Z. Chang, J. Liu, L. Zhang, Molecular characterization of PeSOS1: the putative Naþ/Hþ antiporter of Populus euphratica, Plant Mol. Biol. 65 (2007) 1e11. [28] A. Zhang, M. Jiang, J. Zhang, M. Tan, X. Hu, Mitogen-activated protein kinase is involved in abscisic acid-induced antioxidant defense and acts downstream of reactive oxygen species production in leaves of maize plants, Plant Physiol. 141 (2006) 475e487. [29] S. Zhang, D.F. Klessig, MAPK cascades in plant defense signaling, Trends Plant Sci. 6 (2001) 520e527. [30] T. Zhang, Y. Liu, T. Yang, L. Xue, S. Xu, L. An, Diverse signals converge at MAPK cascades in plant, Plant Physiol. Biochem. 44 (2006) 274e283. [31] X. Zong, D. Li, L. Gu, D. Li, L. Liu, X. Hu, Abscisic acid and hydrogen peroxide induce a novel maize group C MAP kinase gene, ZmMPK7, which is responsible for the removal of reactive oxygen species, Planta 229 (2009) 485e495.