Molecular characterization of the myostatin gene and its regulation on muscle growth in Yesso scallop Patinopecten yessoensis

Aquaculture 520 (2020) 734982

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Molecular characterization of the myostatin gene and its regulation on muscle growth in Yesso scallop Patinopecten yessoensis

T

⁎

Xiujun Suna,b, Li Lic, Zhihong Liua,b, Dan Zhaoa,d, Aiguo Yanga,b, , Liqing Zhoua,b, Biao Wua,b, Jiteng Tiana,b a

Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture and Rural Affairs, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China b Function Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266200, China c Marine Biology Institute of Shandong Province, Qingdao 266104, China d Shanghai Ocean University, Shanghai 201306, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Scallops Myostatin Adductor muscle Whole-mount in situ hybridization RNA interference

Myostatin (MSTN) belongs to the transforming growth factor β (TGF-β) family, which plays a critical role in negatively regulating muscle growth in vertebrates. However, little is known about its function in muscle growth of scallops that possess a large adductor muscle composed of striated and smooth muscle fibers. In this study, we first indentify and characterize the complete cDNA sequence of the myostatin gene from Yesso scallop P. yessoensis, an economically important species in Asian countries. The C-terminal mature TGF-β peptides are highly conserved in scallops, with sequence identity of > 97% among these species. Gene expression at developmental stages revealed by whole-mount in situ hybridization indicates that myostatin is mainly expressed on the profusely ciliated rim of velum in veligers. The significant increase of muscle cellularity induced by RNA interference of myostatin can be explained as a result of a combination of hyperplasia and hypertrophy of MHC II striated myofibers, rather than myofiber growth of the paramyosin-rich smooth muscle. This is also evidenced by the quantification results of muscle gene expression, which indicate the significant increase of MHC expression after the inhibition of myostatin mRNA in the striated muscle, but not in the smooth muscle. For both of the striated and smooth muscles, however, no significant difference between the treatment and control groups is detected by real-time quantitative PCR analysis in other muscle genes. These findings suggest that the cellular targets of myostatin in scallop muscles are probably regulated by signaling directly to striated MHC. The new additional nuclei are potentially supplied by a population of satellite cells or muscle stem cell-like adult muscle precursors that may fuse with existing muscle fibers during muscle hypertrophy. These evidences found in this study highlight that myostatin may not only be involved in the development of larval musculature, but also play an important role in regulating scallop muscle growth.

1. Introduction Myostatin (MSTN) belongs to the transforming growth factor β (TGF-β) superfamily. As an important negative regulator of skeletal muscle growth in animals, it is commonly expressed in somites throughout the development stages and in adults (McPherron et al., 1997; Lee, 2004; Huang et al., 2011). In model species, the deletion of myostatin results in a dramatic increase in skeletal muscle mass,

showing the increasing number of muscle fibers (hyperplasia) and the increasing size of fibers (hypertrophy; Poncelet, 1997). In terrestrial vertebrates, the double-muscling phenotypes are associated with the sequence variations of their MSTN genes, which have been previously revealed in a number of mammals, such as cattle (Poncelet, 1997; Kambadur et al., 1997; McPherron et al., 1997; Grobet et al., 1998), sheep (Clop et al., 2006), dogs (Mosher et al., 2007), and humans (Stolz, 2004). In addition to what was observed in mammals, the

Abbreviations: MSTN, myostatin; RNAi, RNA interference; MHC, myosin heavy chain; RLC, myosin regulatory light chain; ELC, myosin essential light chain; TGF-β, transforming growth factor β; PBST, phosphate-buffered saline with 0.1% Tween-20; WISH, whole-mount in situ hybridization; UPM, universal primer; ISH, in situ hybridization; UTR, untranslated region; ORF, open reading frame; dsRNA, double-stranded RNA; qPCR, quantitative real-time PCR ⁎ Corresponding author at: Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China. E-mail address: [email protected] (A. Yang). https://doi.org/10.1016/j.aquaculture.2020.734982 Received 22 July 2019; Received in revised form 15 January 2020; Accepted 18 January 2020 Available online 18 January 2020 0044-8486/ © 2020 Elsevier B.V. All rights reserved.

Aquaculture 520 (2020) 734982

X. Sun, et al.

absence or blockage of myostatin in early developmental stages of fish has also produced the giant phenotypes (Acosta et al., 2005; Terova et al., 2013). One possible explanation for the regulation of MSTN in muscle growth is that myostatin acts in vivo to balance proliferation and differentiation of embryonic muscle progenitors by promoting their terminal differentiation through the activation of p21 and MyoD (Manceau et al., 2008). In aquaculture, a potential strategy to enhance muscle growth of farmed fish is to inhibit the activity of myostatin (Rebhan and Funkenstein, 2008; Lee et al., 2010; Yang et al., 2012). However, the pattern of muscle growth in aquatic animals, such as fish and marine invertebrates, is quite different from that in mammals. Animals possess two distinct growth patterns, indeterminate growth throughout the adult life period and determinate growth ceasing at sexual maturity (Rowlerson and Veggetti, 2001; Mumby et al., 2015). In mammals' skeletal muscles, the increase in the number of muscle fibers stops shortly after birth, whereas further muscle growth is mainly driven by hypertrophy (growth of existing fibers). In contrast, muscle growth post juvenile stages usually depends on the combination of fiber hypertrophy (increase in size) and hyperplasia in fish (increase in number; Rowlerson and Veggetti, 2001). In aquaculture, the number and size of muscle fibers are usually used to reflect muscle hypertrophy and hyperplasia in order to determine flesh texture and meat quality in commercial species, such as fish (Johnston, 1999). Different muscle growth patterns between mammals and aquatic animals may be reflected by the differences in myosatellite cell populations (Koumans et al., 1990; Garikipati and Rodgers, 2012). Clearly, a better understanding of the factors controlling the proliferation of myosatellite cells in meat-producing animals would be of immense benefit in animal farming. In contrast to mammals and fish, there is little information on MSTN involved in muscle growth regulation in aquatic invertebrates (eg. bivalve molluscs), despite the fact that aquatic invertebrates can keep growing throughout their entire life (Vogt, 2012; Mumby et al., 2015). Scallops are marine bivalve molluscs distributed all over the world. During the last decade, scallop aquaculture has achieved the commercial success owing to a global appreciation of the gastronomic delights of their adductor muscles (Øivind et al., 2016; Chantler, 2016). The scallop adductor muscle is usually composed of two muscle types, the striated muscle for fast swimming and the smooth muscle for maintaining a catch state (Sun et al., 2018). Similar to that in most vertebrates, the protein sequences of MSTN in scallops are highly conserved in the C-terminal mature TGF-β domain, and the predominant expression of MSTN in scallops is found in the striated muscle, rather than the smooth part (Hu et al., 2010; Guo et al., 2012). Moreover, the relatively higher mRNA expression was found in the gastrulae stage than in other developmental stages in Zhikong scallop (Hu et al., 2010). Despite this, the effects of MSTN specifically on hyperplastic and hypertrophic growth of muscle fibers in bivalve molluscs are rarely known until now. To satisfy the increasing consumption of scallop muscle worldwide, a better understanding of molecular strategies for enhancing muscle growth of farmed scallops is of vital importance in aquaculture. Here, we first cloned and characterized the full length cDNA of the myostatin gene from Yesso scallop Patinopecten yessoensis, an economically important species in Asian countries (Sun et al., 2015). The cellular location of MSTN transcripts in muscle tissues was determined using in situ hybridization, and the temporal expression patterns at developmental stages were studied using whole-mount in situ hybridization. The number and size of muscle fibers were measured after RNA interference to examine the function of MSTN in scallop muscle growth. Our findings would enable us to better understand the molecular basis underlying the regulation of muscle growth in bivalve molluscs, and potentially manipulate muscle cellularity to promote muscle production for farmed animals.

2. Materials and methods 2.1. Experimental animals and sample collection Healthy P. yessoensis (average shell length: 9.76 ± 0.47 cm) was purchased from the Nanshan aquatic market (Qingdao, China) and cultured in seawater tanks at 15–16 °C for a week before processing. Seven different tissues including smooth and striated adductor muscles, digestive gland, sexual gland, mantle tissue, foot and gill were sampled. All tissue samples were frozen in liquid nitrogen and stored at −80 °C for RNA extraction. For in situ hybridization, the striated and smooth adductor muscles were embedded immediately in FSC22 Frozen Section Compound (Surgipath, Leica microsystems). Larvae samples during the embryonic and larval stages, including fertilized eggs, blastula, gastrula, trochophore, D-shape veliger, and umbo veliger were collected by 25-μm mesh in Changdao Enhancement and Experiment Station, China. For whole-mount in situ hybridization, P. yessoensis larvae were fixed in 4% paraformaldehyde (PFA) for 2–4 h at 4 °C, and then the PFA solution was replaced by methanol. The veliger larvae were anesthetized with 7.5% MgCl2 prior to fixation. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from the seven tissues with TRIzol reagent (Invitrogen, USA) following the manufacturer's instruction. The quality and purity of RNA products were assessed using the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). The degradation and contamination of RNA samples was checked by 1% agarose gels. For RACE amplification, the first strand cDNA was synthesized from 1 mg of total RNA using the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Japan). For quantitative real-time PCR (qPCR), cDNA templates were produced from total RNA using a PrimerScript™ RT reagent kit with gDNA Eraser (TaKaRa, Japan) following the manufacturer's protocol. 2.3. Cloning of the full-length Py-MSTN cDNA The fragment sequence of Py-MSTN was obtained from the previous transcriptome data (Sun et al., 2015). The 5′ and 3’ cDNA sequences of MSTN gene were cloned using the SMARTer® RACE 5′/3’ Kit (Clontech) according to the manufacturer's protocol (Zheng et al., 2016). Briefly, the RACE primers were designed by Primer Premier 5.0 (Table 1). The 5’-RACE of the Py-MSTN cDNA was amplified using the universal primer (UPM) and reverse primer MSTN_1R, whereas the 3’RACE of the Py-MSTN was produced by sense primer MSTN_2F and reverse primer UPM. The PCR reaction was performed by 30 cycles of 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min. All of the amplified products were examined by 1% gel electrophoresis. The purified fragments were further cloned for Sanger sequencing. The sequences were assembled to the full length of cDNA using the program SeqMan (DNASTAR Inc., USA). 2.4. Sequence analyses The assembled sequence of Py-MSTN was selected for open reading frame (ORF) predictions. The protein feature was predicted by Simple Modular Architecture Research Tool (SMART). The signal peptide of Py-MSTN protein was predicted using SignalP 4.1 Server. The protein sequence alignment was performed using COBALT at NCBI. The threedimensional structure was predicted by Swiss Model (https:// swissmodel.expasy.org/interactive). The aligned sequences were further used to generate new aligned sequences with secondary protein structure by ESPript 3.0 (Robert and Gouet, 2014). A phylogenetic tree based on amino acid sequences was constructed using the Neighbor-Joining (NJ) method with 1000 bootstrap replicates among 17 molluscan species in MEGA 7.0. The MSTN sequence from 2

Aquaculture 520 (2020) 734982

X. Sun, et al.

Table 1 Primer sequences used in this study. Primer name

Sequences

Tm

Efficiency

Product size (bp)

Information

MSTN_1R MSTN_2F β-actin_F2 β-actin_R2 UBQ_F UBQ_R qMSTN_F2 qMSTN_R2 MSTN _F MSTN _R wish_MSTN_T7 _F wish_MSTN_T7 _R

CCTCCTTCCGTCTACTAGGTGAATCCGA TGACCAGCGAGAGGAGACCGCGTGTT CTCAACCCCAAAGCCAACAG GTAGATGGGGACGGTGTGAG TCGCTGTAGTCTCCAGGATTGC TCGCCACATACCCTCCCAC TAGTGCTTCCTCCGACGTTT ACCCAAACGCAACGAAATCA CTCCTTTAACGTACGCTGCC AGATCGACAGGAAAGACGCA GATCACTAATACGACTCACTATAGGGCTCCTTTAACGTACGCTGCC GATCACTAATACGACTCACTATAGGGAGATCGACAGGAAAGACGCA

–

–

58

1.77–1.88

2810 1550 171

62

1.76–2.02

184

59

1.84–2.09

174

59

–

699

59

–

699

RACE-PCR RACE-PCR Internal control Internal control Internal control Internal control qPCR qPCR In situ hybridization In situ hybridization In situ hybridization In situ hybridization

−25 °C using a Leica CM1850 cryotome. Serial cryosections were then collected on the adhesive sides and stored at −80 °C until use. The ISH experiment was carried out according to the published protocol with some modifications (Xu et al., 2018). The sections were rehydrated though a graded series of ethyl alcohol into PBST (phosphate-buffered saline with 0.1% Tween-20), and digested with proteinase K (4 μg/mL) for 30 min at 37 °C. Pre-hybridization was performed in MS oven (Major Science, USA) for 4 h at 65 °C in the hybridization buffer, which contained the mixture of 5 × SSC, 50% formamide, 100 μg/mL yeast tRNA, 1.5% blocking reagent, 5 mM EDTA, and 0.1% Tween-20. The sections were subsequently hybridized with 25 ng/mL RNA probes overnight at 65 °C. Antibody incubation was performed overnight at 4 °C in alkaline phosphatase conjugated anti-digoxigenin antibody (1:5000 diluted in blocking solution) using DIG-RNA labeling Kit (Roche). Washing steps were carried out in MABT (0.1% Tween-20, 150 mM sodium chloride, 100 mM maleic acid, pH 7.5) for three times, followed by alkaline Tris-buffer. The samples were incubated with NBT/BCIP solution for 30–60 min in darkness at room temperature, and the incubation was terminated by 4% PFA for 20 min, followed by three-time washes in PBST. For whole-mount in situ hybridization, embryos and larvae were treated similarly as the tissue samples, including dehydration, digestion by proteinase K, pre-hybridization, probe hybridization, antibody incubation, MABT washing, and NBT/BCIP staining. All images were captured using the digital camera on Leica DM 4000b.

Florida lancelet Branchiostoma floridae serves as the outgroup. All of the sequences were downloaded from GenBank database, except for PyMSTN in this study. 2.5. Quantitative expression of Py-MSTN transcription The expression profiles of Py-MSTN transcripts in the seven tissues (smooth and striated adductor muscles, digestive gland, sexual gland, mantle tissue, foot and gill) were detected by quantitative real-time PCR (qPCR). Three biological replicates in each tissue were used for qPCR analysis on a StepOne Real-Time PCR system (Applied Biosystems). The qPCR reactions were amplified using ChamQTM SYBR qPCR Master Mix (Vazyme, Nanjing, China) in a 20 μL reaction system, including 10 μL ChamQTM SYBR Master Mix, 0.4 μL ROX Reference Dye I, 0.4 μL forward and reverse primers, and 1 μL cDNA templates. The qPCR reaction was performed at the following conditions, 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s according to the manufacturer's protocol. To calculate the relative gene expression among different tissues, we used the improved method to calculate the fold changes relative to the reference sample using the corrected PCR efficiency (Pfaffl, 2004). The corrected PCR efficiency was determined by the eq. E = 10(−1/slope) for each sample using 5-fold serial dilutions according to the previous study (Pfaffl, 2004). The fold changes of target gene expression relative to the reference sample were calculated using the individual efficiency corrected calculation method according to the typical study design (Eq.7; Rao et al., 2013). The primer information for qPCR analysis among tissues was displayed in Table 1, which included the primer sequences, product sizes and their PCR efficiencies among different tissues. In this study, PCR efficiencies of PyMSTN among tissues were calculated to be from 1.84 to 2.09, whereas PCR efficiencies of the internal control ubiquitin (UBQ) ranged from 1.76 to 2.02 (Table 1). The expression data were subsequently subjected to one-way ANOVA in SPSS 17.0 to determine whether there was any significant difference at P < .05.

2.7. Double-stranded RNA (dsRNA) synthesis and muscle histological analysis A 699 bp cDNA fragment of Py-MSTN was generated by RT-PCR using muscle RNA extracted from the striated adductor. The PCR products were then purified by SanPrep Column PCR Product Purification Kit (Sangon Biotech). The dsRNA targeting Py-MSTN was synthesized using the in vitro transcription T7 kit (TaKaRa, Japan) according to the manufacture's instruction with minor modifications. The transcription product was treated with RNase-free DNase I for 30 min at 37 °C to degrade DNA template. The synthesized RNA was purified by phenolchloroform extraction and ethanol precipitation. The remaining pellet was rinsed with cold 70% ethanol, and finally suspended in RNase-free water. The purity and quality of the obtained dsRNA were checked using the NanoPhotometer™ spectrophotometer (Implen, CA, USA) and 1% agarose electrophoresis. Young scallops P. yessoensis (average shell length: 9.76 ± 0.47 cm; average body weight: 109.77 ± 2.71 g) were obtained from Changdao, Yantai, China. Six scallops were randomly selected and divided into two groups. Three biological replicates were used in this experiment. The injection solution was prepared by diluting the purified dsRNA at 100 μg/μl in filter-sterilized seawater according to the previous study (Xin et al., 2016). Three scallops were injected with the purified dsRNA at a dose of 100 μg per scallop once a week for a total of four times.

2.6. Tissue in situ hybridization (ISH) and whole-mount in situ hybridization (WISH) The sense and anti-sense RNA probes were synthesized using the in vitro transcription T7 kit for siRNA synthesis (TaKaRa, Japan) with some modifications. Briefly, the cDNA fragment of Py-MSTN (699 bp) was amplified with specific primers (wish_MSTN_T7 _R and MSTN _F), having T7 promoter sequence in the sense primer. The purified PCR products were used as the template for T7 in vitro transcription reaction. In contrast, the transcription product of another primer pairs (wish_MSTN_T7 _F and MSTN _R) was used as the negative control probe. The anti-sense RNA probes used for in situ hybridization were labeled with Digoxigenin using a DIG-RNA labeling Kit (Roche), while the sense RNA probes were used as the negative control. The embedded muscles were further sectioned in 10-μm slices at 3

Aquaculture 520 (2020) 734982

X. Sun, et al.

and Peruvian scallop, probably due to their close phylogenetic relationship. Although Zhikong scallop Chlamys farreri belongs to a different genus (Pectinidae) than Yesso scallop P. yessoensis, their MSTN sequences showed a high level of identity (94.7%). The C-terminal mature TGF-β peptides were highly conserved (sequence identity > 97%) in the five scallops, including P. yessoensis, C. farreri, A. irradians, N. subnodosus and A. purpuratus. The Py-MSTN sequence was predicted to possess 5 α-helix, 17 βsheets, and 4 coils (η) in the secondary structure (Fig. 2). As shown in the blue boxes, the most conservative sites among these bivalves were mainly distributed in the region of predicted secondary structure. The nine conserved cysteines at the C-terminus were consistently observed in the studied bivalves. However, the proteolytic processing site is not consistent among these species. Like P. yessoensis, other four scallops and the pearl oyster share the common proteolytic processing site (RSKR). However, the two alternative proteolytic processing sites (RRKR and KKRS) were observed in the mussel, oyster, and clam, according to the results of multiple sequence alignments (Fig. 2). Consistent with the sequence alignment, the phylogenetic analysis of MSTN also revealed the close relationship among scallops, which clustered together with T. granosa (blood clam) and formed an independent branch (Fig. 3). All MSTN genes in bivalves were clustered together with 100% confidence, which were separated from those in gastropods, except for S. constricta (razor clam). It suggests the evolutionary conservation in sequence and structure of MSTN proteins in bivalves.

Meantime, the remaining scallops received the muscle injection of filter-sterilized seawater (negative control group) at the same time on a weekly basis. The injection of prepared solution was given slowly into the striated adductor muscle with a sterile microsyringe. The scallops were cultured with the filtered seawater in a 100 L container at 15 ± 2 °C for 28 days at Yellow Sea Fisheries Research Institute (YSFRI). The scallops were fed with Nitzschia closterium f. minutissima and 50% of the culture water was exchanged every day. At the end of the experiment, a portion of the striated and smooth adductor muscle from the three scallops in each group were individually sampled and fixed in the 4% paraformaldehyde solution for histological analysis. The fixed striated and smooth muscles were then treated by routine paraffin sectioning and Haematoxilin/Eosin staining. The measurements of muscle fibers and nuclei were made in a given area under a microscope using Toupview 3.7 program. Ten randomly selected cross-sections of muscle tissue from each scallop were used for quantification of the muscle fiber area, the number of muscle fibers (per 500 μm2), and nuclei numbers. The quantification of the muscle fiber area was performed on 150 strips of muscle fibers (30 fibers × 5 images) per scallop, whereas the number of muscle fibers and nuclei was counted according to 10 randomly selected images per scallop. The fold changes of eight muscle genes (myosin heavy chain, Dtitin, MSTN, tropomodulin, filamin, paramyosin, myosin regulatory light chain, myosin essential light chain) were estimated by qPCR analysis in the control and dsRNA treatment groups using the corrected PCR efficiency as described above (Pfaffl, 2004). The PCR amplification efficiencies for the striated and smooth muscles were calculated by the eq. E = 10(−1/slope) for each gene and sample, which ranged from 1.75 to 1.88 (Supplementary Table S1). Subsequently, the fold changes of target mRNA expression relative to the reference sample and reference gene (actin) were determined by the equation Eqs.3.3 according to the previous study (Pfaffl, 2004). The primer information was provided in Supplementary Table S1, which included primer sequences, product sizes and their PCR efficiencies for samples and genes. The data were statistically compared between the two groups using independent t-test in SPSS 19.0. The level of statistical significance was set at P < .05.

3.3. Quantitative expression of Py-MSTN and in situ hybridization (ISH) Quantitative expression of Py-MSTN in different tissues exhibited a tissue-specific expression pattern in P. yessoensis (Fig. 4). Py-MSTN mRNA expression was detected in all tissues, including smooth adductor muscle (BS), striated adductor muscle (BL), He (digestive gland), sexual gland (Sex), mantle tissue (Man), foot, and gill. The predominant expression of Py-MSTN mRNA were detected in the striated and smooth adductor muscles, which were significant higher than those in other tissues (P < .01). No significant difference in Py-MSTN mRNA expression was detected among other tissues, including He, Sex, Man, foot and gill. In situ hybridization experiments revealed that Py-MSTN mRNA expression was found in both muscle types, striated and smooth muscles. The Py-MSTN mRNA anti-sense probes produced strong positive signals in both transverse and longitudinal section of muscle fibers (Fig. 5A and B). In contrast, there was no positive signal detected using the sense RNA probes (Fig. 5C and D). It was evidenced that the expression of Py-MSTN mRNA was unevenly distributed in striated and smooth muscle fibers, and was mainly located in adjacent to intermyofibrillar (Fig. 5).

3. Results 3.1. Cloning and characterization of the Py-MSTN cDNA The full length cDNA of Py-MSTN was obtained by 5′ and 3’ RACE (Genbank accession number: MH843154). The assembled sequence was 3696 bp in length, which contained a 135 bp 5’-UTR (untranslated region), a 1374 bp ORF (Open Reading Frame) and a 2187 bp 3’-UTR (Fig. 1). The canonical start (ATG) and stop (TAA) codons were found in the ORF region, which encoded a polypeptide of 457 amino acids. The protein had a molecular weight of 53.06 kDa and theoretical pl of 5.74. The functional domains for Py-MSTN mainly included three parts, a putative signal peptide of 19 amino acid (MHRLFHSLLFLVMLSTVYA), a TGF-β propeptide of 227 amino acids, and a mature TGF-β peptide of 104 amino acids in the C-terminal region. Two proteolytic processing sites RSKR and RRKR were marked in the green frames, as displayed in Fig. 1. Furthermore, three polyadenylation signal peptides (AATAAA, red frame) were discovered at the 3′ downstream region. Although no putative TATA box was detected in the 5′ flanking sequence, two putative E-box sites (CATCTG and CAGCTG) were identified in Py-MSTN cDNA sequence (Fig. 1, black frames).

3.4. Whole amount in situ hybridization (WISH) The expression pattern of Py-MSTN mRNA during developmental stages was revealed by whole amount in situ hybridization in this study (Fig. 6). No positive signal for Py-MSTN mRNA probe was detected in early embryonic stages, such as multicellular, blastula, and gastrula stages. In contrast, mRNA expression was initially located near the pretrochal region of the trochophore (Fig. 6D). The four black dots represented the strong hybridization signals for the Py-MSTN mRNA expression at this stage. After the transition from trochophore to veliger, the four positive signals were separated into two pairs by shells, suggesting an ordered pattern of ciliation. The strong positive signals for Py-MSTN probe were positively detected in five bands, each extending round the rim of the velum, probably at the bases of cilia.

3.2. Sequence alignment and phylogenetic analysis Multiple sequence alignments of the amino acid sequence for MSTN among nine bivalve species was displayed in Fig. 2. As expected, a high sequence similarity was detected in the five scallops (> 80%), whereas other bivalves showed a relatively low level of sequence conservation (29–50%). The highest similarity (98.8%) occurred between Bay scallop 4

Aquaculture 520 (2020) 734982

X. Sun, et al.

Fig. 1. The cDNA and encoded amino acid sequence of Py-MSTN in Yesso scallop. The canonical start (ATG) and stop (TAA) codons are shown in underlines. The 5’UTR and 3’UTR sequences are displayed in lower cases. The proteolytic processing site (RSKR) is marked in the green box. The asterisk indicates the stop codon. Three polyadenylation signal peptides (AATAAA) are enclosed in red boxes at the 3′ downstream region. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

fibers (30 fibers × 5 images × 3 scallops; Fig. 8, t-test: p < .01), a significantly larger average cross-sectional area of muscle fibers was observed in the dsRNA injection group (240.97 ± 5.86 μm2), compared to that in the control group (155.59 ± 7.30 μm2). A significantly increase in the average fiber number in the given area was also found in

3.5. Muscle histological analysis and gene expression after dsRNA injection The morphology and distribution of striated muscle fibers and cell nuclei in the dsRNA injection and control group were displayed in Fig. 7. According to the quantification data from 450 strips of muscle 5

Aquaculture 520 (2020) 734982

X. Sun, et al.

(caption on next page)

6

Aquaculture 520 (2020) 734982

X. Sun, et al.

Fig. 2. Multiple sequence alignment of the amino acid sequence for MSTN among 9 bivalves. The identical residues are shown as the white letters with red background, while the similar residues are boxed without any background. The predicted secondary structure of Py-MSTN is shown at the top of the aligned sequences. α: α-helix; β: β-sheet; η: coil; T: turn. The 9 conserved cysteines in bivalves are marked by the asterisk at the bottom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

cleavage by furin family enzymes removes the 24-amino acid signal peptide necessary for targeting the protein to the secretory pathway, while the second cleavage by BMP1/Tolloid matrix metalloproteinase occurs at an RSRR (Arg-Ser-Arg-Arg) site to produce mature myostatin (Lee, 2004). In contrast to vertebrates, bivalve species have a relatively shorter (19–23 amino acids) and non-conservative signal peptide sequences at the N-terminus (Fig. 2). Since the efficiency of protein secretion is strongly affected by the signal peptides, the high conservation of 19-amino-acid signal peptides in scallops suggests the similar efficiency of protein secretion during the first cleavage. Similar to what has been revealed in this study, most of the studied bivalves have the second cleavage sites of RSKR or RRKR, which match with the consensus RXXR sequence in the TGF-β family (Rodgers and Weber, 2001; Zhong et al., 2008). Strikingly, the two proteolytic processing sites RSKR and RRKR were highly conservative across the scallops, suggesting that the myostatin activation in scallops requires the same proteolytic cleavages of the precursor protein. Furthermore, the 9 conserved cysteines at the C-terminus of MSTN are consistent in bivalves and vertebrates, suggesting that their functions are conserved in the muscle growth regulation across the animal kingdom (Ko et al., 2007; Delgado et al., 2008; Guo et al., 2012; Morelos et al., 2015). For eucaryotes, alternate polyadenylation affects mRNA expression, and produces mature transcripts with 3′ ends of variable length, having a polyadenylation signal sequence of AATAAA or ATTAAA (Beaudoing and Gautheret, 2001). As evidenced from vertebrates, the choice of alternate polyadenylation sites in 3’-UTRs region may strongly affect the final expression of the gene, because the 3’-UTRs region may contain regulatory elements affecting mRNA stability or translation efficiency (Colgan and Manley, 1997; Zhang et al., 2005; Moore, 2005). Like most eukaryotic genes, Py-MSTN in this study has three common polyadenylation sites (AATAAA) in the long 3’-UTRs region. In contrast, the polyadenylation signal peptide of AATAAA is not exclusive in bay scallop Argopecten irradians, and the alternate polyadenylation signals of ATTAAA are also found at the end of the 3’-UTRs region. The polyadenylation signal of ATTAAA of MSTN 3’-UTRs region is consistently

the dsRNA injection group (53.93 ± 1.78) than in the control group (44.10 ± 2.06; Fig. 8, t-test: p < .05). Additionally, a two-fold increase in nuclei numbers was detected in the dsRNA injection group (14.00 ± 0.67) compared with that in the control group (7.00 ± 1.04; t-test: p < .01). The morphology and distribution of smooth muscle fibers and cell nuclei were showed in Fig. 9. In contrast to the observation in striated muscle, no significant difference in the fiber area of smooth muscle was found between the control and dsRNA injection group (773.04 ± 6.47 vs. 783.55 ± 17.85 μm2; Fig. 10, t-test: p > .05). Moreover, there was no significant difference in either the fiber numbers or nuclei number between the two groups (p > .05). For qPCR results, the fold changes of the target genes relative to the reference sample in control and dsRNA groups were displayed in Fig. 11. As indicated, the relative expression of py-MSTN was significantly inhibited by the dsRNA injection in the striated muscle, but not in the smooth part. For the striated muscle, the relative expression of MHC in the treatment group was significantly higher than that in the control group (P < .01). In contrast, no significant difference in relative expression of MHC was found in the smooth muscle. For both of striated and smooth muscles, however, no significant difference between the control and treatment groups was detected by real-time quantitative PCR analysis in other muscle genes, such as tropomodulin, filamin, D-titin, paramyosin, RLC and ELC. 4. Discussion 4.1. Characterization of the Py-MSTN sequence The coding region for Py-MSTN in this study is found to have the typical features of TGF-β family members, which includes an N-terminal signal peptide, a propeptide domain and a conserved C-terminal mature TGF-β peptide (Lee, 2016). In vertebrates, myostatin activation requires two proteolytic cleavages of the precursor protein in order to generate the biologically active molecule (Huang et al., 2011). The first

Fig. 3. The phylogenetic analysis of MSTN genes by the neighbor-joining (NJ) method among 17 molluscan species. The used species and their accession numbers are as follows: Azumapecten farreri ABJ09581.2, Mimachlamys nobilis AUF82996.1, Nodipecten subnodosus AHA14663.1, Argopecten irradians ADL60139.1, Argopecten purpuratus, AGO15291.1, Tegillarca granosa ALG64475.1, Crassostrea gigas EKC29862.1, Crassostrea virginica XP_022310109.1, Pinctada fucata AJI44425.1, Pinctada imbricate AIA98698.1, Mytilus chilensis AGU13048.1, Haliotis discus hannai AVW85484.1, Sinonovacula constricta AHH32929.1, Onchidium struma nom. Nud. AOR06340.1, Branchiostoma floridae XP_002599461.1, Pomacea canaliculata XP_025094789.1, Biomphalaria glabrata XP_013068893.1, and Aplysia californica XP_005093969.1.

7

Aquaculture 520 (2020) 734982

X. Sun, et al.

Fig. 4. Quantitative expression of Py-MSTN in different tissues of Yesso scallop. The improved method to calculate the fold changes relative to the reference sample using the corrected PCR efficiency (Rao et al., 2013). The PCR amplification efficiencies of PyMSTN and UBQ (internal control) were calculated by the eq. E = 10(−1/slope) for each sample. Smooth adductor muscle (BS), striated adductor muscle (BL), digestive gland (He), sexual gland (Sex), mantle tissue (Man), foot, and gill. Different lower-case letters represent the significantly expressed levels among tissues.

or developmental stage-specific manner (Edwaldsgilbert et al., 1997). The alternative polyadenylation is an important process involved not only in the modulation of miRNA regulation, but also in the control of the stem cell function and the determination of stem cell heterogeneity

found in the Pacific Lion-Paw scallop Nodipecten subnodosus and the bay scallop A. irradians (Morelos et al., 2015). The small changes in a polyadenylation site may result in overall RNA processing efficiency and serve as an important control point for gene expression in a tissue

Fig. 5. Cellular location of Py-MSTN expression in the striated (A) and smooth (B) adductor muscles indicated by in situ hybridization using anti-sense RNA probes. The results of sense RNA probes were used as the negative control for the striated (C) and smooth muscle (D). Scale bar = 100 μm. 8

Aquaculture 520 (2020) 734982

X. Sun, et al.

Fig. 6. Location of Py-MSTN expression during embryo-larval developmental stages by whole amount in situ hybridization. Multicellular stage (A), blastula (B), gastrula (C), trochophore (D) and D-veliger (E), umbo larvae (F).

2002). In the bay scallop Argopecten irradians, ten canonical E-box motifs in the upstream sequences of MSTN were predicted to be the regulatory elements (Guo et al., 2012). Consistently, two canonical Ebox motifs have been detected in the 5’-UTR of MSTN in this study, which may serve as the candidate binding sites for the basic helix-loophelix myogenic regulatory factors. However, the mechanism of the specific gene regulation via E-box motif is largely unknown in bivalves.

(Sandberg et al., 2008; Boutet et al., 2012). Although we reveal the sequence conservation of MSTN between bivalves and vertebrates, the functional consequence of alternative polyadenylation in aquatic invertebrates needs to be characterized in future studies. In vertebrates, 5′ flanking sequences of muscle genes usually contain the canonical E-box motif (CANNTG), which are proved to play an important role in the regulation of the muscle-specific genes (Apone and Hauschka, 1995). E-box sites, present in the promoters and enhancers of muscle-specific genes, are the binding sites for the basic helix-loop-helix myogenic regulatory factors during muscle cell specification and differentiation (Apone and Hauschka, 1995; Spiller et al.,

Fig. 7. The morphology and distribution of the striated muscle fibers and myofiber nuclei in the control (A) and dsRNA treatment (B) groups. Scale bar = 20 μm. 9

Aquaculture 520 (2020) 734982

X. Sun, et al.

Fig. 8. The statistic data of muscle cellularity (average fiber areas, fiber numbers, and nuclear numbers) for the striated muscle in the dsRNA treatment and control groups. The level of statistical significance was set at P < .05.

Fig. 9. The morphology and distribution of the smooth muscle fibers and myofiber nuclei in the control (A) and dsRNA treatment (B) groups. Scale bar = 20 μm.

Fig. 10. The statistic data of muscle cellularity (average fiber areas, fiber numbers, and nuclear numbers) for the smooth muscle in the dsRNA treatment and control groups. The level of statistical significance was set at P < .05.

adductor muscle of bivalve molluscs, e.g. Yesso scallop (this study), the bay scallop (Guo et al., 2012), and Zhikong scallop Chlamys farreri (Hu et al., 2010). Consistently, the MSTN transcripts in the Pacific Lion-Paw scallop N. subnodosus were mainly located in sarcomeres and around the nucleus of striated muscle fibers by in situ hybridization (Morelos et al., 2015). As reported, the increasing expression of MSTN in the scallop N. subnodosus was significantly associated with the loss of muscle weight (decrease in muscle fiber sizes and total fiber numbers) during summer (Morelos et al., 2015). Therefore, the negative correlation between MSTN gene expression and adductor muscle growth suggests an important role of muscle growth regulation in the striated adductor muscle of scallops.

4.2. Expression pattern of Py-MSTN in different tissues and developmental stages Myostatin is well characterized in vertebrates during last two decades, which negatively regulates muscle growth by controlling myoblast cell cycle progression (Lee, 2004; Huang et al., 2011). It is widely evidenced that the inhibition of myostatin activity by a variety of approaches has improved the muscle growth of vertebrate animals, both in the number of muscle fibers (hyperplasia) and in the size of the fibers (hypertrophy) (Poncelet, 1997; Xu et al., 2003; Rebhan and Funkenstein, 2008; Sang et al., 2010; Lee et al., 2012). As expected, the predominant expression of MSTN mRNA has been detected in the

10

Aquaculture 520 (2020) 734982

X. Sun, et al.

Fig. 11. Quantitative expression of eight muscle genes in the smooth adductor muscle (BS) and striated adductor muscle (BL) of control and dsRNA treatment groups. The fold changes of target mRNA expression relative to the reference sample and reference gene (actin) were determined using the corrected PCR efficiency (Pfaffl, 2004). The PCR amplification efficiencies were calculated by the eq. E = 10(−1/slope) for each sample and gene. The significantly expressed levels of muscle genes between control and dsRNA treatment groups were indicated as the asterisks. RLC, myosin regulatory light chain; ELC, myosin essential light chain; MHC, myosin heavy chain.

For fish muscles, the mosaic area is often found in a hyperplastic growth region under the superficial monolayer (Rowlerson and Veggetti, 2001; Patruno et al., 2008). As a result of the hyperplastic growth throughout the muscle tissue, small-diameter fibers appear to be visible between large-diameter fibers giving rise to the typical mosaic appearance (Patruno et al., 1998; Patruno et al., 2008; Santis et al., 2012). In this study, MSTN expression in the scallop muscles takes place in the widespread distribution of small-diameter fibers, and this is similar to the mosaic appearance observed in fish muscles (Patruno et al., 2008). Therefore, it is speculated that the proliferation of myogenic cells in the scallop adductor muscle was not restricted to some limited zones, but occurred in the entire muscle tissues. The spatial expression

pattern of Py-MSTN in this study suggests its potential role in the regulation of scallop muscle growth. For molluscs, embryonic developmental stages mainly include cleavage, blastula, gastrulae, trochophore, veliger, and post-metamorphic stages (Chantler, 2016). The functional muscle is considered to be formed at the trochophore stage, and starts differentiating from the early veliger (Cragg, 1985; Sun et al., 2019). The velum muscles, which are the most characteristic organ of veligers, develop during the transition from trochophore to veliger (Cragg, 1985). The larvae become capable of rapidly withdrawing the velum within the shell valves at the early veliger stage (Cragg, 1985). The developmental process of velum retractor muscles is a milestone for larval swimming and feeding 11

Aquaculture 520 (2020) 734982

X. Sun, et al.

(Chantler, 2016). The rim of the velum is profusely ciliated, with five bands or rings of cilia extending right around the rim (Cragg, 1989). The cells of the velum rim are large, which have numerous large mitochondria and an extensive ciliary rootlet system (Cragg, 1989). In the present study, the positive signals of MSTN mRNA were initially detected at the trochophore stage, and were located around the rim of velum at the early veliger stage. At the later stage of veliger, ten positive signals took place extending along the rim of velum, probably because cirri from upper b1 and lower b2 rings are out of register with each other (Cragg, 1989). The pattern of MSTN expression is highly consistent with the discrete features of profusely ciliated rim of the velum. We therefore conclude that MSTN expression may play an important role in the development of larval musculature, especially in velum retractor muscles.

spat stage (Audino et al., 2015; Sun et al., 2019). In contrast, the smooth part only accounts for < 10% of the adductor muscle in scallop adults (Sun et al., 2018). The variation of muscle fiber proportion suggests that scallop adductor muscle may undergo a gradual change in the composition of myofibrillar proteins post-metamorphic stages. For scallop adductor muscles, MHC II thick filaments are the core component in the striated part, whereas paramyosin is arranged as a central core in thick filaments of the smooth part (Chantler, 2016; Sun et al., 2018). In the present study, the significant change in muscle celluarity after the interference of MSTN suggests that MSTN may act directly on the MHC II striated myofibers, rather than paramyosin-rich smooth myofibers. This process may involve the synthesis of myofibrillar proteins and contractile filaments related to striated muscle fibers as indicated in fruit fly Drosophila melanogaster, such as MHC (myosin heavy chain), RLC (myosin regulatory light chain), TnT (troponin T), ELC (myosin essential light chain) and D-titin (Zhang et al., 2000; Vigoreaux, 2006). In this study, the selected muscle genes for qPCR analysis, including MHC, RLC, ELC, tropomodulin, filamin, titin, paramyosin, are main components of scallop muscle structure (Sun et al., 2018). For instance, scallop adductor myosin possesses the necessary machinery, which is composed of two heads with MHC, followed by a neck domain ELC and RLC (Chantler, 2016). Filamin may be involved in reorganizing the cytoskeleton at the Z-disk in scallop muscles, whereas titin is an exceptionally large protein linking filamin and αactinin together in the Z-line or dense bodies (Labeit et al., 2006). Paramyosin may play a direct role in the maintenance of catch and formation of a rigid network of inter-myofilament connections (Galler, 2008). Therefore, the present results of the relative expression in these muscle genes have confirmed the changes of muscle cell morphology and distribution at mRNA level. As indicated, the significant change in gene expression was only found in MHC, but not in tropomodulin, filamin, titin, paramyosin, RLC and ELC. These findings suggest that the cellular targets of myostatin in scallop muscle growth may be regulated through signaling directly to myofibers, especially on MHC. As reported, the cellular mechanism of muscle growth in fish is attributable to the divisions of muscle stem cell populations, which are mainly controlled by a balance between proliferation and differentiation signals (Johnston, 1999). Counts of myofiber nuclei with respect to fiber area in muscle tissues indicate that fibers acquire additional nuclei as they grow, which will maintain a fairly constant ratio of nuclear to cytoplasmic volume (Johnston, 1999; Amthor et al., 2009; Lee et al., 2012). For vertebrates, the new nuclei are usually supplied by a population of muscle satellite cells, which can fuse with existing muscle fibers during muscle hypertrophy (Figeac et al., 2007; Wang and Mcpherron, 2012; Buckingham and Rigby, 2014). In contrast, there is no evidence of satellite cells in nematode Caenorhabditis elegans and Drosophila adult muscles (Piccirillo et al., 2014; Bar-Lavan et al., 2016). In Drosophila, adult muscle precursors (AMPs) are formed by the fusion of founder cells and fusion-competent myoblasts, which are expected to have a similar function with vertebrate satellite cells (Taylor, 2006; Figeac et al., 2007). Therefore, our present findings raise the possibility that RNA interference of MSTN expression in the striated muscle of scallops may be involved in activating potential adult muscle precursors in marine bivalves. Although the fundamental role of myostatin in negatively regulating muscle growth has been extensively studied in model species, there is a considerable debate on whether their cellular targets are satellite cells or myofibers (Lee and Mcpherron, 2001; Amthor et al., 2009). For instance, inhibition of myostatin and its pathway in mice has induced satellite cell proliferation, as well as an increased proportion of satellite cells in an activated state (McCroskery et al., 2003; Zhou et al., 2010). In contrast, more and more recent studies have found that MSTN is capable of acting directly on the myofibers themselves, by inhibiting protein synthesis, reducing myotube diameter, and modulating turnover of structural muscle fiber proteins (Taylor et al., 2001; Amthor et al., 2009; Trendelenburg et al., 2009). In the present study, our

4.3. Muscle growth mechanisms in scallops The number and size of muscle fibers, also known as muscle cellularity, is thought to be an important determinant of the flesh texture and meat quality (Hurling et al., 1996). In contrast to mammals, lower vertebrates and invertebrates have quite different cellular mechanisms of post-embryonic muscle growth (Rowlerson and Veggetti, 2001; Ozernyuk, 2004; Vogt, 2012; Piccirillo et al., 2014). In many fish, muscle fiber hypertrophy (increase in size) and hyperplasia (increase in number) both play important roles in muscle growth even after juvenile stages, whereas post-natal muscle growth only involves the hypertrophy of the fibers formed in mammals (Stickland, 1983; Johnston, 1999; Glass, 2005; Khalil et al., 2017). Bivalve molluscs belong to evolutionarily successful aquatic invertebrate groups, which have the life-long growth without fixed limits (eg. indeterminate growth; Vogt, 2012). In contrast to mammals, aquatic invertebrates usually have their stem cell systems, which are capable to differentiate into multipotent progenitor cells and enlarge their organs even in adult stage (Vogt, 2012). Unfortunately, the population of muscle stem cells was poorly characterized in bivalve molluscs, although muscle cells were identified in the primary cells of mussel larvae (Odintsova et al., 2010; Vogt, 2012; Chantler, 2016). In the present study, we found that the number and size of striated muscle fibers were significantly increased with the MSTN dsRNA treatment compared to that in the control group, showing muscle hyperplasia (22.30% increase in the fiber number) and hypertrophy (54.88% increase in the muscle fiber area). The phenotype variation of striated muscle fibers indicate that in vitro interference of MSTN expression may not only be involved in muscle fiber hypertrophy, but also participates in muscle fiber hyperplasia during scallop muscle growth. Similarly, the muscles of MSTN null mice weighed approximately 2–3 times more than those of wild-type as a result of a combination of muscle fiber hyperplasia and hypertrophy (McPherron et al., 1997). The same phenomenon found in this study suggests that absence or blockade of myostatin in vivo could consistently induce skeletal/striated muscle hyperplasia and hypertrophy in mammals and bivalve molluscs. Notably, it suggests that the function of myostatin as a powerful inhibitor of muscle growth is highly conserved among a wide range of animals, including mammals and some marine invertebrates. For both vertebrates and invertebrates, specific proteins for muscle tissues are synthesized at the final stage of myogenesis. The muscle structural genes usually appear in a great diversity of isoforms at different developmental stages, which are regulated by selective expression of different gene isoforms (nematode and vertebrates), or alternative splicing of the same gene in Drosophila and scallop (Nyitray et al., 1994; Ozernyuk, 2004; Piccirillo et al., 2014). Many myofibrillar proteins exist as specific isoforms in developmental stages, which lead to a gradual change in the composition of myofibrillar proteins during their ontogeny (Johnston, 1999; Jackson and Ingham, 2013; Buckingham and Rigby, 2014; Sun et al., 2019). Scallop adductor muscles are usually composed of both striated and smooth muscle fibers, which appear to have approximately equal volume even after the 12

Aquaculture 520 (2020) 734982

X. Sun, et al.

References

results indicate that RNA interference of Py-MSTN in the striated muscle has not only acted directly on the MHC II myofibers, but also seems to have induced the proliferation of satellite cells or muscle progenitor cells, since two-fold increase of nuclei numbers in the dsRNA treatment group. Indeed, inhibition of myostatin pathway may influence satellite cell function through the release of secondary signals that act directly on activated satellite cells or by making the myofibers more permissive for satellite cell fusion (Lee et al., 2012). For vertebrates, muscle satellite cells (eg. pax7) have been identified as the principal source of new muscle tissue during muscle growth and regeneration, whereas there is still no appropriate biochemical marker available for stem cell homologues in invertebrates (Koumans et al., 1990; Odintsova et al., 2010; Vogt, 2012). Despite this, the significant increase of nuclei numbers found in this study is more likely to be supplied by a population of muscle satellite cells or muscle stem cell-like adult muscle precursors (AMPs), because myosatellite cells or AMPs are expected to be the source of new muscle fiber nuclei (Rowlerson and Veggetti, 2001; Figeac et al., 2007; Piccirillo et al., 2014). Another possible explanation for the present results is that the mode of hypertrophy induced by the MSTN interference is due to multiple phase model of increased myofibrillar protein synthesis followed by the activation of satellite cells or adult muscle precursors (Wang and Mcpherron, 2012). In summary, our findings reveal that the RNA interference of MSTN could induce cellular hyperplasia and hypertrophy in the adductor muscle of scallops, specifically on the MHC II striated muscle, which may also involve the proliferation of adult muscle precursors. In conclusion, the identification and characterization of complete cDNA sequence of the Py-MSTN gene in P. yessoensis reveal the high sequence identity among scallops. Gene expression at developmental stages revealed by whole-mount in situ hybridization indicates that myostatin is mainly expressed on the profusely ciliated rim of velum in veligers. The significant increase in muscle cellularity induced by RNA interference of MSTN can be explained as a result of a combination of hyperplasia and hypertrophy of MHC II striated myofibers, rather than paramyosin-rich smooth myofibers. The new additional nuclei are potentially supplied by a population of satellite cells which may fuse with existing muscle fibers during muscle hypertrophy. The present findings will not only provide useful information on the regulation of muscle growth in bivalve molluscs, but also suggest the potential to manipulate muscle cellularity to produce cultured bivalves with desirable muscle traits. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2020.734982.

Acosta, J., Carpio, Y., Borroto, I., Gonzalez, O., Estrada, M.P., 2005. Myostatin gene silenced by RNAi show a zebrafish giant phenotype. J. Biotechnol. 119, 324–331. Amthor, H., Otto, A., Vulin, A., Rochat, A., Dumonceaux, J., Garcia, L., et al., 2009. Muscle hypertrophy driven by myostatin blockade does not require stem/precursorcell activity. Proc. Natl. Acad. Sci. U. S. A. 106, 7479–7484. Apone, S., Hauschka, S.D., 1995. Muscle gene E-box control elements. J. Biol. Chem. 270, 21420–21427. Audino, J.A., Marian, J.E.A.R., Kristof, A., Wanninger, A., 2015. Inferring muscular ground patterns in bivalvia: myogenesis in the scallop Nodipecten nodosus. Front. Zool. 12, 34. Bar-Lavan, Y., Shemesh, N., Dror, S., Ofir, R., Yeger-Lotem, E., Ben-Zvi, A., 2016. A differentiation transcription factor establishes muscle-specific proteostasis in Caenorhabditis elegans. PLoS Genet. 12, e1006531. Beaudoing, E., Gautheret, D., 2001. Identification of alternate polyadenylation sites and analysis of their tissue distribution using EST data. Genome Res. 11, 1520–1526. Boutet, S., Cheung, T., Quach, N., Liu, L., Prescott, S.L., Edalati, A., Iori, K., Rando, T.A., 2012. Alternative polyadenylation mediates microRNA regulation of muscle stem cell function. Cell Stem Cell 10, 327–336. Buckingham, M., Rigby, P.J., 2014. Gene regulatory networks and transcriptional mechanisms that control myogenesis. Dev. Cell 28, 225–238. Chantler, P.D., 2016. Chapter 4 scallop adductor muscles : structure and function. Dev. Aquac. Fish. Sci. 40, 161–218. Clop, A., Marcq, F., Takeda, H., Pirottin, D., Tordoir, X., Bibé, B., et al., 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 38, 813–818. Colgan, D.F., Manley, J.L., 1997. Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11, 2755–2766. Cragg, S.M., 1985. The adductor and retractor muscles of the veliger of Pecten maximus (L.) (Bivalvia). J. Molluscan Stud. 51, 276–283. Cragg, S.M., 1989. The ciliated rim of the velum of larvae of Pecten maximus (Bivalvia: Pectinidae). J. Molluscan Stud. 55, 497–508. Delgado, I., Fuentes, E., Escobar, S., Navarro, C., Corbeaux, T., Reyes, A.E., et al., 2008. Temporal and spatial expression pattern of the myostatin gene during larval and juvenile stages of the Chilean flounder (paralichthys adspersus). Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 151, 197–202. Edwaldsgilbert, G., Veraldi, K.L., Milcarek, C., 1997. Alternative poly(a) site selection in complex transcription units: means to an end? Nucleic Acids Res. 25, 2547–2561. Figeac, N., Daczewska, M., Marcelle, C., Jagla, K., 2007. Muscle stem cells and model systems for their investigation. Dev. Dyn. 236, 3332–3342. Galler, S., 2008. Molecular basis of the catch state in molluscan smooth muscles: a catchy challenge. J. Muscle Res. Cell Motil. 29, 7399. Garikipati, D.K., Rodgers, B.D., 2012. Myostatin stimulates myosatellite cell differentiation in a novel model system: evidence for gene subfunctionalization. Am. J. Phys. Regul. Integr. Comp. Phys. 302, R1059. Glass, D.J., 2005. Skeletal muscle hypertrophy and atrophy signaling pathways. Int. J. Biochem. Cell Biol. 37, 1974–1984. Grobet, L., Poncelet, D., Royo, L.J., Brouwers, B., Pirottin, D., Michaux, C., et al., 1998. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mamm. Genome 9, 210–213. Guo, L., Li, L., Zhang, S., Zhang, G., 2012. Molecular cloning and characterization of the myostatin gene in a cultivated variety of bay scallop, Argopecten irradians. Aquaculture 350-353, 192–199. Hu, X., Guo, H., He, Y., Wang, S., Zhang, L., Wang, S., et al., 2010. Molecular characterization of myostatin gene from Zhikong scallop Chlamys farreri (Jones et Preston 1904). Genes Genet. Syst. 85, 207–218. Huang, Z., Chen, X., Chen, D., 2011. Myostatin: a novel insight into its role in metabolism, signal pathways, and expression regulation. Cell. Signal. 23, 1441–1446. Hurling, R., Rodell, J.B., Hunt, H.D., 1996. Fibre diameter and fish texture. J. Texture Stud. 27, 679–685. Jackson, H.E., Ingham, P.W., 2013. Control of muscle fibre-type diversity during embryonic development: the zebrafish paradigm. Mech. Dev. 130, 447–457. Johnston, I.A., 1999. Muscle development and growth: potential implications for flesh quality in fish. Aquaculture 177, 99–115. Kambadur, R., Sharma, M., Smith, T.P.L., Bass, J.J., 1997. Mutations in myostatin (GDF8) in double-muscled Belgian blue and Piedmontese cattle. Genome Res. 7, 910–916. Khalil, K., Elayat, M., Khalifa, E., Daghash, S., Elaswad, A., Miller, M., et al., 2017. Generation of myostatin gene-edited channel catfish (Ictalurus punctatus) via zygote injection of Crispr/Cas9 system. Sci. Rep. 7, 7301. Ko, C.F., Chiou, T.T., Chen, T.T., Wu, J.L., Chen, J.C., Lu, J.K., 2007. Molecular cloning of myostatin gene and characterization of tissue-specific and developmental stage-specific expression of the gene in orange spotted grouper, Epinephelus coioides. Mar. Biotechnol. 9, 20–32. Koumans, J.T.M., Akster, H.A., Dulos, G.J., Osse, J.W.M., 1990. Myosatellite cells of Cyprinus carpio (Teleostei) in vitro: isolation, recognition and differentiation. Cell Tissue Res. 261, 173–181. Labeit, S., Lahmers, S., Burkart, C., Chi, F., Mcnabb, M., Witt, S., et al., 2006. Expression of distinct classes of titin isoforms in striated and smooth muscles by alternative splicing, and their conserved interaction with filamins. J. Mol. Biol. 362, 664–681. Lee, S.B., Kim, J.H., Jin, D.H., Jin, H.J., Kim, Y.S., 2016. Myostatin inhibitory region of fish (Paralichthys olivaceus) myostatin-1 propeptide. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 194, 65–70. Lee, S.J., 2004. Regulation of muscle mass by myostatin. Annu. Rev. Cell Dev. Biol. 20, 61–86.

Author contributions XS, ZL and AY conceived the project and designed the experiment. XS, LL, LZ, BW and DZ performed the experiment. XS and LL fixed and collected the larval samples. XS, ZL and JT analyzed the data. XS wrote the manuscript. All authors have read and approved the final manuscript for publication. Declaration of Competing Interest The authors declare that they have no competing interest. Acknowledgements This study was supported by research grants from the National Key R&D Program of China (2018YFD0900104), and the National Natural Science Foundation of China (31602153). This work is also supported by the Central Public-interest Scientific Institution Basal Research Fund, YSFRI, CAFS (No. 20603022019005), Natural Science Foundation of Shandong Province (ZR2016CQ32), and Qingdao people's livelihood science and technology project (18-6-1-110-nsh). 13

Aquaculture 520 (2020) 734982

X. Sun, et al.

Sandberg, R., Neilson, J.R., Sarma, A., Sharp, P.A., Burge, C.B., 2008. Proliferating cells express mRNAs with shortened 3’untranslated regions and fewer microRNA target sites. Science 320, 1643–1647. Sang, B.L., Yong, S.K., Oh, M.Y., Jeong, I.H., Seong, K.B., Jin, H.J., 2010. Improving rainbow trout (Oncorhynchus mykiss), growth by treatment with a fish (Paralichthys olivaceus), myostatin prodomain expressed in soluble forms in E. coli. Aquaculture 302, 270–278. Santis, C.D., Gomes, G.B., Jerry, D.R., 2012. Abundance of myostatin gene transcripts and their correlation with muscle hypertrophy during the development of barramundi, Lates calcarifer. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 163, 101–107. Spiller, M.P., Kambadur, R., Jeanplong, F., Thomas, M., Martyn, J.K., Bass, J.J., et al., 2002. The myostatin gene is a downstream target gene of basic helix-loop-helix transcription factor myod. Mol. Cell. Biol. 22, 7066. Stickland, N.C., 1983. Growth and development of muscle fibers in the rainbow trout (Salmo gairdneri). J. Anat. 137, 323–333. Stolz, L.E., 2004. Myostatin mutation associated with gross muscle hypertrophy in a child. N. Engl. J. Med. 350, 2682–2688. Sun, X., Yang, A., Wu, B., Zhou, L., Liu, Z., 2015. Characterization of the mantle transcriptome of Yesso scallop (Patinopecten yessoensis): identification of genes potentially involved in biomineralization and pigmentation. PLoS One 10, e0122967. Sun, X., Liu, Z., Wu, B., Zhou, L., Wang, Q., Wu, W., Yang, A., 2018. Differences between fast and slow muscles in scallops revealed through proteomics and transcriptomics. BMC Genomics 19, 377. Sun, X., Zheng, Y., Yu, T., Wu, B., Liu, Z., Zhou, L., et al., 2019. Developmental dynamics of myogenesis in Yesso Scallop Patinopecten yessoensis. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 228, 51–60. Taylor, M.V., 2006. Comparison of muscle development in Drosophila and vertebrates. In: Muscle Development in Drosophila. Springer, New York, NY, pp. 169–203. Taylor, W.E., Bhasin, S., Artaza, J., Byhower, F., Azam, M., Willard, D.H., et al., 2001. Myostatin inhibits cell proliferation and protein synthesis in C2C12 muscle cells. Am. J. Physiol. Endocrinol. Metab. 280, E221–E228. Terova, G., Rimoldi, S., Bernardini, G., Saroglia, M., 2013. Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery. Mol. Biotechnol. 54, 673–684. Trendelenburg, A.U., Meyer, A., Rohner, D., Boyle, J., Hatakeyama, S., Glass, D.J., 2009. Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size. Am. J. Phys. Cell Phys. 296, C1258–C1270. Vigoreaux, J.O., 2006. Molecular basis of muscle structure. In: Muscle Development in Drosophila. Springer, New York, NY, pp. 143–156. Vogt, G., 2012. Hidden treasures in stem cells of indeterminately growing bilaterian invertebrates. Stem Cell Rev. Rep. 8, 305–317. Wang, Q., Mcpherron, A.C., 2012. Myostatin inhibition induces muscle fibre hypertrophy prior to satellite cell activation. J. Physiol. 590, 2151–2165. Xin, L., Zhang, H., Du, X., Li, Y., Li, M., Wang, L., et al., 2016. The systematic regulation of oyster CgIL17-1 and CgIL17-5 in response to air exposure. Dev. Comp. Immunol. 63, 144–155. Xu, C., Wu, G., Zohar, Y., Du, S.J., 2003. Analysis of myostatin gene structure, expression and function in zebrafish. J. Exp. Biol. 206, 4067–4079. Xu, R., Li, Q., Yu, H., Kong, L., 2018. Oocyte maturation and origin of the germline as revealed by the expression of Nanos-like in the Pacific oyster Crassostrea gigas. Gene 663, 41–50. Yang, Y., Peng, K., Liu, X., Zhao, D., Duan, J., Hu, W., et al., 2012. Effects of sex steroids on expression of myostatin in rare minnow, Gobiocypris rarus. Aquaculture 350353, 1–7. Zhang, Y., Featherstone, D., Davis, W., Rushton, E., Broadie, K., 2000. Drosophila D-titin is required for myoblast fusion and skeletal muscle striation. J. Cell Sci. 113, 3103–3115. Zhang, H., Ju, Y.L., Tian, B., 2005. Biased alternative polyadenylation in human tissues. Genome Biol. 6, R100. Zheng, L., Liu, Z., Wu, B., Dong, Y., Zhou, L., Tian, J., Sun, X., Yang, A., 2016. Ferritin has an important immune function in the ark shell Scapharca broughtonii. Dev. Comp. Immunol. 59, 15–24. Zhong, Q., Zhang, Q., Chen, Y., Sun, Y., Jie, Q., Wang, Z., et al., 2008. The isolation and characterization of myostatin gene in Japanese flounder (Paralichthys olivaceus): ubiquitous tissue expression and developmental specific regulation. Aquaculture 280, 247–255. Zhou, X., Wang, J.L., Lu, J., Song, Y., Kwak, K.S., Jiao, Q., et al., 2010. Reversal of cancer cachexia and muscle wasting by ActRIIB antagonism leads to prolonged survival. Cell 142, 531–543.

Lee, S.J., Mcpherron, A.C., 2001. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. U. S. A. 98, 9306–9311. Lee, S., Kim, Y.S., Miyong, O., Inhak, J., Kibaik, S., Jin, H.J., 2010. Improving rainbow trout (Oncorhynchus mykiss) growth by treatment with a fish (Paralichthys olivaceus) myostatin prodomain expressed in soluble forms in E. coli. Aquaculture 302, 270–278. Lee, S.J., Huynh, T.V., Lee, Y.S., Sebald, S.M., Wilcoxadelman, S.A., Iwamori, N., et al., 2012. Role of satellite cells versus myofibers in muscle hypertrophy induced by inhibition of the myostatin/activin signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 109, 2353–2360. Manceau, M., Gros, J., Savage, K., Thomé, V., Mcpherron, A., Paterson, B., et al., 2008. Myostatin promotes the terminal differentiation of embryonic muscle progenitors. Genes Dev. 22, 668–681. McCroskery, S., Thomas, M., Maxwell, L., Sharma, M., Kambadur, R., 2003. Myostatin negatively regulates satellite cell activation and self-renewal. J. Cell Biol. 162, 1135–1147. McPherron, A.C., Lawler, A.M., Lee, S.J., 1997. Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member. Nature 387, 83–90. Moore, M.J., 2005. From birth to death: the complex lives of eukaryotic mRNAs. Science 309, 1514–1518. Morelos, R.M., Ramírez, J.L., García-Gasca, A., Ibarra, A.M., 2015. Expression of the myostatin gene in the adductor muscle of the Pacific lion-paw scallop Nodipecten subnodosus in association with growth and environmental conditions. J. Exp. Zool. A Ecol. Genet. Physiol. 323, 239–255. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., et al., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 3, e79. Mumby, H.S., Chapman, S.N., Crawley, J.A., Mar, K.U., Htut, W., Soe, A.T., et al., 2015. Distinguishing between determinate and indeterminate growth in a long-lived mammal. BMC Evol. Biol. 15, 214. Nyitray, L., Jancso, A., Ochiai, Y., Szent-Gyorgyi, G.A.G., 1994. Scallop striated and smooth muscle myosin heavy-chain isoforms are produced by alternative RNA splicing from a single gene. Proc. Natl. Acad. Sci. U. S. A. 91, 12686–12690. Odintsova, N.A., Dyachuk, V.A., Nezlin, L.P., 2010. Muscle and neuronal differentiation in primary cell culture of larval Mytilus trossulus (Mollusca: bivalvia). Cell Tissue Res. 339, 625–637. Øivind, S., Louro, A., Duncan, P.F., 2016. European aquaculture. In: Shumway, S.E., Parsons, G.J. (Eds.), Scallops: Biology, Ecology, Aquaculture, and Fisheries, 3rd edition. Elsevier, Amsterdam, pp. 859–890 Chapter 20. Ozernyuk, N.D., 2004. Comparative properties of myogenesis in invertebrates and in lower and higher vertebrates. Russ. J. Dev. Biol. 35, 360–369. Patruno, M., Radaelli, G., Mascarello, F., Candia Carnevali, M.D., 1998. Muscle growth in response to changing demands of functions in the teleost Sparus aurata (L.) during development from hatching to juvenile. Anat. Embryol. 198, 487–504. Patruno, M., Sivieri, S., Poltronieri, C., Sacchetto, R., Maccatrozzo, L., Martinello, T., et al., 2008. Real-time polymerase chain reaction, in situ hybridization and immunohistochemical localization of insulin-like growth factor-I and myostatin during development of Dicentrarchus labrax (Pisces: osteichthyes). Cell Tissue Res. 331, 643–658. Pfaffl, M.W., 2004. Quantification strategies in real-time PCR. In: AZ of Quantitative PCR. 1. pp. 89–113. Piccirillo, R., Demontis, F., Perrimon, N., Goldberg, A.L., 2014. Mechanisms of muscle growth and atrophy in mammals and Drosophila. Dev. Dyn. 243, 201–215. Poncelet, D., 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat. Genet. 17, 71. Rao, X., Huang, X., Zhou, Z., Lin, X., 2013. An improvement of the 2ˆ (−delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinformatics Biomath. 3, 71–85. Rebhan, Y., Funkenstein, B., 2008. Inhibition of fish myostatin activity by recombinant fish follistatin and myostatin prodomain: potential implications for enhancing muscle growth in farmed fish. Aquaculture 284, 231–238. Robert, X., Gouet, P., 2014. Deciphering key features in protein structures with the new endscript server. Nucleic Acids Res. 42, W320. Rodgers, B.D., Weber, G.M., 2001. Sequence conservation among fish myostatin orthologues and the characterization of two additional cDNA clones from Morone saxatilis, and Morone americana. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 129, 597–603. Rowlerson, A., Veggetti, A., 2001. Cellular mechanisms of postembryonic muscle growth in aquaculture species. In: Johnston, I.A. (Ed.), Muscle Development and Growth. Fish Physiology. 18. Academic Press, San Diego, pp. 103–140.

14