Molecular characterization, tissue distribution patterns and nutritional regulation of IGFBP-1, -2, -3 and -5 in yellowtail, Seriola quinqueradiata

General and Comparative Endocrinology 161 (2009) 344–353

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Molecular characterization, tissue distribution patterns and nutritional regulation of IGFBP-1, -2, -3 and -5 in yellowtail, Seriola quinqueradiata Fiona L. Pedroso a,b, Haruhisa Fukada b,*, Toshiro Masumoto b a b

United Graduate School of Agricultural Sciences, Ehime University, 3-5-7 Tarumi, Matsuyama, Ehime, Japan Laboratory of Fish Nutrition, Faculty of Agriculture, Kochi University, 200 Monobe, Nankoku, Kochi 783-8502, Japan

a r t i c l e

i n f o

Article history: Received 30 September 2008 Revised 20 January 2009 Accepted 21 January 2009 Available online 31 January 2009 Keywords: cDNA cloning Insulin-like growth factor-I IGF-binding proteins Yellowtail Tissue distribution Starvation

a b s t r a c t Insulin-like growth factor-binding proteins (IGFBPs) play a vital role in regulating the biological activities of IGFs. In this study, we cloned and determined full-length cDNA sequences of yellowtail IGFBP-1, -2, -3 and -5. Their tissue distribution was determined by real-time quantitative RT-PCR, which revealed that IGFBP-1, -2, -3 and -5 are widely distributed in yellowtail tissues. In yellowtail, both IGFBP-1 and –2 are highly expressed in the liver, IGFBP-3 is predominantly expressed in the heart and skin, with the lowest expression in the liver, and IGFBP-5 is highly expressed in the liver and kidneys. The widespread tissue expression of the yellowtail IGFBPs suggests that they may act in an autocrine and/or paracrine manner in the regulation of IGF activity. The effects of nutritional deprivation on yellowtail IGFBPs and IGF-I were also examined. During a 15-day starvation period, significant elevation was observed in hepatic yellowtail IGFBP-1. Refeeding restored its level to that of the control. No significant change was observed in the hepatic yellowtail IGFBP-2 mRNA levels in starved fish compared with control fish during the starvation period. Interestingly, during the early period of food deprivation, a significant increase was observed in hepatic yellowtail IGFBP-3 and -5 mRNA levels, concomitant to the significant elevation in hepatic IGF-I mRNA from day 3 to day 9. The unexpected increase in growth stimulatory IGFBPs and IGF-I during nutritional deprivation may represent a species-specific response to changes in nutritional condition. Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction The IGF (insulin-like growth factor) system plays a pivotal role in growth, development and metabolic regulation in vertebrates. Its key components are IGFs (IGF-I and -II), cell surface receptors (IGF-1R and IGF-2R) and IGF-binding proteins (IGFBP-1 to -6). IGF-I and IGF-II are potent mitogens (Ferry et al., 1999), primarily synthesized in the liver and expressed in various non-hepatic tissues. The ubiquity of their distribution pattern suggests that they exert their action in an autocrine and/or paracrine manner in addition to the classical endocrine fashion (Thissen et al., 1994). IGF-I is primarily important in postnatal growth and mediates most of the anabolic actions of growth hormone (GH) in the peripheral tissues, whereas IGF-II plays a crucial role during embryonic development. IGFs exert their biological function through cell surface receptors, mainly through IGF-1R. In biological fluids, majority of IGFs bind with IGFBPs to form binary complexes. This extends the half-lives of IGFs by preventing their proteolytic degradation (Kajimura and Duan, 2007). Apart from acting as a vehicle for transporting IGFs, IGFBPs also regulate free IGF-I plasma concentration (Hwa et al., * Corresponding author. Fax: +81 88 864 5156. E-mail address: [email protected] (H. Fukada). 0016-6480/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2009.01.010

1999), and prevent the hypoglycaemic effect of the high IGF concentration in circulation (Duan, 2002; Bauchat et al., 2001). Six IGFBP members have been identified in mammalian species (Clemmons, 1992; Duan, 2002; Duan and Xu, 2005). They are synthesized in different levels by various mammalian cells and tissues, suggesting a vital role in regulation of local actions of IGFs (Duan, 2002). Although structurally related, each IGFBPs has unique properties and performs different functions (Schneider et al., 2002), including stimulation or inhibition of the biological activities of IGFs. The differences in their function are influenced by postranscriptional modifications, such as glycosylation, phosphorylation and proteolysis, as well as by cell surface associations (Firth and Baxter, 2002). In teleosts, several reports have shown the presence of one or more IGFBPs in various tissues (Fukazawa et al., 1995; Siharath et al., 1995; Kamangar et al., 2006), and at least three major IGFBPs exist around 20–25, 30 and 40–45 kDa in fish serum (Kelly et al., 1992; Anderson et al., 1993; Niu and LeBail, 1993; Park et al., 2000). Over the past few years, full-length cDNA of IGFBPs has been cloned and identified in several fish species, IGFBP-1, -2, -3 and -5 in zebrafish (Danio rerio)(Maures and Duan, 2002; Duan et al., 1999; Chen et al., 2004; Ding and Duan, unpublished, Genbank Accession No. AY100478); IGFBP-1 in chinook salmon (Oncorhynchus tshawytscha)

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

(Shimizu et al., 2005); IGFBP-2 in red seabream (Pagrus major) (Funkenstein et al., 2002) and IGFBP-3 in tilapia (Oreochromis mossambicus) (Cheng et al., 2002). More recently, cDNA clones for all six rainbow trout (Oncorhynchus mykiss) IGFBP homologues have been characterized (Kamangar et al., 2006). However, the recently identified trout IGFBP-3 homologue, classified into the IGFBP-2 clade, may be an additional IGFBP-2 paralog (Rodgers et al., 2008). A plethora of experimental studies have shown that IGF-I levels are affected by nutritional changes (see reviews of Moriyama et al., 2000; Duan, 1998). Like IGF-I, levels of IGFBPs are also regulated by food intake (Thissen et al., 1994). Despite growing scientific information on the IGF system, the molecular mechanism underlying its nutritional regulation remains elusive (Wood et al., 2005). Furthermore, the specific role of each IGFBP on metabolic regulation in some teleost species remains unknown. Thus far, no information is available on the endocrine mechanism of growth regulation in yellowtail, Seriola quinqueradiata, an economically important marine fish cultured in Japan. For several years, considerable attention has been given and effort has been made to accelerate its growth and improve its production (Masumoto, 2002). In this study, we cloned and identified four IGFBPs in yellowtail. Herein, we report full-length cDNA sequences of IGFBP-1, -2, -3 and -5, examine their tissue distribution and investigate the effects of nutritional deprivation on the IGF system.

345

size was extracted and purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Then ligated and inserted into pGEMT Easy vector (Promega) and transformed into Escherichia coli DH5a cells. The plasmid DNA was extracted from bacterial cells using SNAP Mini-Prep Plasmid Purification System (Invitrogen). Nucleotide sequencing was performed in both forward and reverse directions for every clone using ABI 7300 DNA Sequencer (Applied Biosystem Inc., Foster City, CA). 2.2. Structural and phylogenetic analyses Sequence alignments were performed using clustalW (http:// www.ddbj.nig.ac.jp) and Genedoc Multiple Sequence alignment Editor and Shading Utility (http://www.pse.edu/biomed/genedoc). Phylogenetic analysis was performed using the distance method in MEGA (ver. 4.0). For distance analysis, the Kimura 2-parameter model was used to construct the distance matrix and the tree was inferred from this using the Neighbour-Joining approach. Bootstrap re-sampling (1000 replicates; seed = 64,238) was performed to assess the degree of support for groupings on the tree. Predictions of potential N-glycosylation and phosphorylation sites were performed using the prediction server of the Center for Biological Sequence Analysis (http://www.cbs.dtu.dk) based on the deduced amino acid sequences. 2.3. Tissue distribution

2. Materials and methods 2.1. Molecular cloning of yellowtail IGFBP-1, -2, -3 and -5 cDNAs The yellowtail IGFBP-1, -2 and -5 cDNAs were cloned from liver tissues. However, yellowtail liver expresses very low levels of IGFBP-3 transcript. We therefore used gill tissues for cDNA synthesis and amplification to obtain yellowtail IGFBP-3. The liver and gill tissues were collected from juvenile yellowtail, and immediately frozen in liquid nitrogen and stored at 80 °C until use. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. First-strand cDNA was reverse transcribed from 3 lg of total RNA using oligo-(dT)12–18 primer and M-MuLV reverse transcriptase (Promega, Madison, WI). Primers used for PCR are listed in Table 1. The design of the degenerate primers to amplify the internal regions of yellowtail IGFBP-1, -2, -3 and -5 were based on the conserved amino acid sequences of the known vertebrate IGFBPs available in the Genbank database. PCR was performed using 12.5 ll Go taq green master mix (Promega), 2 ll each of sense and antisense primers (final concentration of 0.4 lM), 1 ll of first-strand cDNA as a template and sterile water to attain a final reaction volume of 25 ll. Thermal cycling conditions were as follows: hot start at 95 °C for 2 min; 35 cycles of amplification, each cycle consisted of, 30 s denaturation (95 °C), 30 s primer annealing (50 °C), 1 min primer extension (72 °C) and a final extension of 7 min at 72 °C. We cloned the 50 - and 30 -ends of yellowtail IGFBPs cDNAs using the rapid amplification of cDNA ends (RACE) method by Frohman (1990). Gene-specific sense and anti-sense primers (Table 1) were synthesized based on the known nucleotide sequences of the yellowtail IGFBP-1, -2, -3 and -5 cDNAs. The 50 -RACE system kit (ver. 2.0; Invitrogen) was used to clone the 50 -ends of yellowtail IGFBP-1, -2, -3 and -5 cDNAs. The abridged anchor primer provided in the kit and two gene-specific antisense primers (Table 1) were used for reverse transcription and PCR. Their 30 -ends were cloned using gene-specific sense primer (Table 1) and NotI-d(T)18 bifunctional primer as the antisense primer. The PCR conditions were as above mentioned. The PCR products were separated on 1.2% agarose gels and visualized by ethidium bromide staining. The PCR product of expected

Juvenile yellowtail of approximately 35–45 g were sampled. The fish were anesthetized with 2-phenoxyethanol, following which the pituitary, brain, eyes, skin, gills, muscle, intestines, pyloric ceca, kidneys, heart, liver and spleen were collected, and immediately frozen in liquid nitrogen. The tissues were stored at 80 °C until analysis. 2.4. Fasting experiment Four units of 500-l circular tanks were prepared and provided with a continuous flow of fresh seawater (water temperature, 24–25 °C). Thirty juvenile yellowtail (body weight, 45–50 g) were randomly stocked in each tank. Two tanks were used for control groups, one for the starved and one for the refed group. Before beginning the experiment, the fish were allowed to acclimatize to tank conditions for 7 days. During the acclimatization period, the fish were fed once daily at 15:00 h with a commercial diet (crude protein, 50%; crude lipid, 10%; Been’s Nutra, Skretting, Fukuoka, Japan) until satiation. Over the course of the experiment, the control group were fed once daily at 15:00 h with Skretting commercial diet until satiation. The other group (starved group) was not fed for 15 days. After the 15-day starvation period, the starved group was refed for 6 days with the same feed diets as the control group until satiation. The samples were obtained from 6 fish per group at the start of the experiment (initial samples), 3, 6, 9, 12 and 15 days of starvation and 3 and 6 days after refeeding. Liver samples were immediately placed in RNAlater solution (Ambion, Applied Biosystems) and stored at 30 °C until analysis. 2.5. RNA isolation and reverse transcription Total RNA was isolated from tissues using RNAiso reagent (Takara, Kyoto, Japan) according to the manufacturer’s protocol. The concentration of total RNA was estimated by measuring the absorbance at 260 nm and the purity was verified from the 260/280-nm absorption ratio. The samples with values that ranged from 1.7 to 2.0 were used in reverse transcription reaction. For IGF-I, IGFBP-1, IGFBP-2 and IGFBP-5 real-time PCR assay, 300 ng total RNA was used for first-strand cDNA synthesis with the following reverse transcription reaction mixture: 37.5 U M-MuLV reverse transcriptase (Promega),

346

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

Table 1 Primers for cloning yellowtail IGFBP-1, -2, -3, and -5. Primers for cloning the internal region (sequence from 30 to 50 ) IGFBP-1 dgF IGFBP-1 dgR IGFBP-2 dgF IGFBP-2 dgR IGFBP-3 dgF IGFBP-3 dgR IGFBP-5 dgF IGFBP-5 dgR

CA(AG)GA(AG)CC(ATC)AT(ATC)(AC)GITG(CT)GC(ATC)CC(ATC)TG CC(AG)TTCCA(ACGT)GA(ACGT)GA(ACGT)AC(AG)CACCA(AG)CA TG(CT)GG(ACGT)GT(ACGT)TA(CT)AC(ACGT)CC(ACGT) CA(CT)TG(CT)TT(ACGT)AG(AG)TT(AG)TA(CT) GC(ACGT)CT(ACGT)CT(ACGT)GA(AG)GG(ACGT)CG(ACGT)GG(ACGT) TG(ACGT)CC(AG)TA(CT)TT(AG)TC(ACGT)AC(AG)CACCA(AG)CA GA(AG)CC(ACGT)AT(ATC)(AC)G(ACGT)TG(CT)GC(ACGT)CC(ACGT)TG(CT) CC(AG)TTCCA(ACGT)GA(ACGT)GA(ACGT)AC(AG)CACCA(AG)CA

Primers for cloning 50 -enda (sequence from 30 to 50 ) IGFBP-1 IGFBP-1 IGFBP-2 IGFBP-2 IGFBP-3 IGFBP-3 IGFBP-5 IGFBP-5

R1 R2 R1 R2 R1 R2 R1 R2

GACTCACACTGCTTGGCCTTGTACA GAGAGTTGGCTATCATGTCCAGTGC GGCACACATTGGACAGCAACCACAGCC GCAACCACAGCCTGGACTCTCTCACG CACGGACTCCACCTTGTAGCTCTGCG GTGCAGCGTAGGCCTGGTGTCTATCG AGTTGGGGAGGTACAAAGACAAGAGC CTGTAATCTCTGTGGTCATGGTGTC

Primers for cloning 30 -endb (sequence from 30 to 50 ) IGFBP-1 IGFBP-1 IGFBP-2 IGFBP-2 IGFBP-3 IGFBP-3 IGFBP-5 IGFBP-5

F1 F2 F1 F2 F1 F2 F1 F2

GCATCAAGGCCAAGGTCAACGCTATCCG AAGGCCAAGCAGTGTGAGTCCTCTCTGG GTTATGGCAGGAGTCGGCCAGGCAGCAG GTGCCTGTCAGACGGAGTTGGACAAGG TGGTCCGATGCGAGCCGTGCGA TCCGGCTTGACCTGCCAGCACC GGATGAAGGACGCTTCTCGTGTAATGGC GGATGAAGGACGCTTCTCGTGTAATGGC

a b

The abridged anchor provided in the 50 RACE kit was used as forward primer. NotI-d(T)18 bifunctional primer was used as reverse primer.

1 RT buffer, 0.5 mM dNTPs, 112.5 ng random hexamers. For IGFBP3 assay, the first-strand cDNA template that was used contained 3 lg total RNA. This was reverse transcribed using 200 U M-MuLV reverse transcriptase (Promega), 1 RT buffer, 1.0 mM dNTPs and 0.2 lg random hexamers. Reverse transcription was performed at 25 °C for 10 min, followed by 42 °C for 60 min and a final incubation step at 95 °C for 5 min. 2.6. Real-time quantitative RT-PCR Primer sequences used in real-time quantitative RT-PCR assays are shown in Table 2. Their design was based on the primer sequence output of the ABI primer express program, ver. 3.0. The design of the primer used for each assay spans the predicted intron/intron boundary to avoid the amplification of genomic DNA (Pierce et al., 2004). The specificity of the PCR products was determined by dissociation curve analysis. A real-time quantitative RT-PCR was performed in ABI 7300 Sequence Detection System (Applied Biosystems) using Power SYBR green PCR Master Mix kit (Applied Biosystems). The kit contained 2 concentration of premix reagent that includes SYBR dye

I, AmpliTaq Gold DNA polymerase, dNTPs with dUTP/dTTP blend, passive reference dye and buffer components. The 20-ll PCR mixture contained 10 ll Power SYBR green PCR master mix, 1.0 ll each of 10 lM sense and anti-sense primers, 2 ll cDNA template and sterile water. For IGFBP-1, -2, -3 and -5 assays, the reaction conditions were as follows: 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. For IGF-I assay, the following cycling conditions were used: 50 °C for 2 min, 95 °C for 10 min, followed by 35 cycles of 95 °C for 15 s, 60 °C for 10 s 72 °C for 31 s. For normalization of the data, 18S rRNA gene was used. The design of 18S primers was derived from a consensus of fish 18S sequences (Tom et al., 2004). The 18S primer pair used in the present study has been standardized and validated for yellowtail real-time quantitative RT-PCR assay based on the reports of Murashita et al. (2006, 2007). The expression of 18S showed stable values during our assay. A serial dilution of sample cDNA was run to generate a standard curve. The efficiency (E) of PCR was calculated from the regression slope of the assay (E = 101/slope). Steady-state IGFBP-1, -2, -3, -5 and IGF-I mRNA levels were calculated relative to the 18S rRNA gene following the method of Pfaffl (2001).

Table 2 Primers used in real-time quantitative RT-PCR. Primer

Source *Genbank Accession No.

Primer sequence(from 50 to 30 )

Analysis

IGFBP-1 IGFBP-1 IGFBP-2 IGFBP-2 IGFBP-3 IGFBP-3 IGFBP-5 IGFBP-5 IGF-I F IGF-I R 18S F 18S R

*

CCCTTTGACCACCATGACACT GGGTCCCTGTTGTTCCAGTTT TCCAGGGTTTAGGTCGATGTG GTTGCCTGGTGGTCCAGACT CCGAGAGGCTTCCGCATA ACGGCACTGTTTTTTCTTGTAGAA GCCCATCGACAAGCATGAT CGTCCTTCATCCCCTGAATG GATGTCTTCAAGAGTGCGATGTG CCGTCGGAGTCAGGGTGAGG TACCACATCCAAAGAAGGCA TCGATCCCGAGATCCAACTA

Tissue dist. and Tissue dist. and Tissue dist. and Tissue dist. and Tissue dist. and Tissue dist. and Tissue dist. and Tissue dist. and Nutritional reg. Nutritional reg. Tissue dist. and Tissue dist. and

F R F R F R F R

EU650626 * EU650626 * EU652919 * EU652919 * EU652920 * EU652920 * EU652921 * EU652921 * AB439208 * AB439208 Tom et al. (2004) Tom et al. (2004)

Nutritional Nutritional Nutritional Nutritional Nutritional Nutritional Nutritional Nutritional

reg. reg. reg. reg. reg. reg. reg. reg.

Nutritional reg. Nutritional reg.

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

2.7. Statistical analysis The fasting experiment was analyzed using Student’s t test. Tissue mRNA levels were analyzed using a one-way ANOVA followed by Tukey–Kramer’s test. Results were considered statistically significant at p < 0.05. 3. Results 3.1. Cloning of yellowtail IGFBP-1, -2, -3 and -5 Using degenerate RT-PCR and 30 - and 50 -RACE methods, we cloned and characterized four IGFBP cDNAs in yellowtail. Their cDNA sequences were submitted and deposited in GenBank database with the following accession numbers: IGFBP-1 (EU650626), IGFBP-2 (EU652919), IGFBP-3 (EU652920) and IGFBP-5 (EU652921).

347

contains 18 cysteine residues at its N- and C-terminal domains (Fig. 1). The Arg-Gly-Asp (RGD) sequence present in the C-terminal domain in other known teleosts and mammalian IGFBP-2 is also conserved in yellowtail. The entire yellowtail IGFBP-2 protein is 72%, 59%, 55%, 54% and 53% identical to sea bream, rainbow trout BP-2 paralog 2, salmon, rainbow trout BP-2 paralog 1 and zebrafish, respectively. It exhibits 41–42% sequence identity to higher vertebrates (e.g. chicken, mouse, human). It is 29%, 28% and 31% identical to yellowtail IGFBP-1, -3 and -5, respectively. Based on phylogenetic tree analysis, yellowtail IGFBP-2 was classified into the IGFBP-2 clade (Fig. 2). 3.4. Yellowtail IGFBP-3

Yellowtail IGFBP-1 cDNA was cloned from yellowtail liver. It is 1372 base pairs (bp) long and the complete open reading frame of 738 bp encodes a protein of 246 amino acids with a putative signal peptide of 23 amino acids. It contains 18 cysteine residues clustered at N- and C-terminal domains (Fig. 1). The Arg-Gly-Asp (RGD) sequence present in mammalian IGFBP-I is absent in yellowtail. The corresponding sequence in yellowtail is LGD. The overall sequence identity of the entire yellowtail IGFBP-1 protein to those of salmon, rainbow trout and zebrafish is 72%, 71% and 57%, respectively. It has 40% identity to mammalian IGFBP-1. Its sequence identities to yellowtail IGFBP-2, -3 and -5 are 29%, 31% and 30%, respectively. Phylogenetic analysis showed that yellowtail IGFBP-1 was grouped into the IGFBP-1 clade with a very high bootstrap support value (Fig. 2).

Yellowtail IGFBP-3 was cloned from gill tissues. It is 1278 bp in length with an open-reading frame of 861 bp that codes for a 286amino acid-long protein with signal peptide of 21 amino acids. Examination of the primary sequence mature protein of yellowtail IGFBP-3 indicates the presence of 18 cysteine residues in its N- and C-terminal domain and one extra cysteine residue in the non-conserved L-domain (Fig. 1). One potential phosphorylation site, SerLeu-Glu (SLE), was found within its L-domain at residues 196– 198, and two potential glycosylation sites, Asn-Val-Thr (NVT) and Asn-Phe-Ser (NFS), located at residues 134–136 and 196–198, respectively. Heparin-binding motif (YKKKQCRP) and two putative nuclear localization signals (KKGFYKKK and PSKGRRR) exist within the C-terminal domain of the peptide. The entire amino acid sequence of yellowtail IGFBP-3 shares 61% identity with zebrafish IGFBP-3, and 49–52% with its mammalian counterpart. It is 31%, 28% and 41% identical to yellowtail IGFBP-1, -2 and -5, respectively. Yellowtail IGFBP-3 is also classified in IGFBP-3 clade with high bootstrap support value, and is distinct from other IGFBPs (Fig. 2).

3.3. Yellowtail IGFBP-2

3.5. Yellowtail IGFBP-5

Yellowtail IGFBP-2 cDNA was also obtained from the liver. Its full-length cDNA sequence is 938-bp-long with an open-reading frame of 807 bp, which encodes a protein of 269 amino acids with a putative signal peptide of 25 amino acids. The mature protein

Yellowtail IGFBP-5 cloned from the liver is 1331-bp-long. It has an open-reading frame of 798 bp that encodes a protein of 266 amino acids with a putative signal peptide of 20 amino acids. The mature protein is characterized by the presence of 18 cysteine

3.2. Yellowtail IGFBP-1

Fig. 1. Amino acid sequence alignment of yellowtail IGFBPs. The conserved cystein residues are indicated by asterisk (), the GCGCCXXC and CWCV motifs are boxed. Black blocks represent the residues conserved in all yellowtail IGFBPs and gray blocks indicate the residues conserved in 80% of the yellowtail IGFBPs.

348

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

YELLOWTAIL IGFBP2

100 87

seabream IGFBP2 rainbowtrout IGFBP2 paralog 2 ( IGFBP-3, Kamangar et al., 2006)

99

zebrafish IGFBP2 salmon IGFBP2

100

100

100

rainbowtrout IGFBP2 paralog 1

chicken IGFBP2 mouse IGFBP2

100 99

human IGFBP2 rat IGFBP1

57 100

cow IGFBP1 human IGFBP1 zebrafish IGFBP1

96

YELLOWTAIL IGFBP1

100

salmon IGFBP1

91 100

rainbowtrout IGFBP1

cow IGFBP3

58 100

human IGFBP3 mouse IGFBP3

99

YELLOWTAIL IGFBP3 zebrafish IGFBP3

99 100

100

mouse IGFBP5 human IGFBP5 YELLOWTAIL IGFBP5

100

rainbowtrout IGFBP5

100 54

zebrafish IGFBP5

0.1 Fig. 2. A phylogenetic tree constructed by the Neighbour-Joining method (1000 bootstrap) for amino acid sequences of IGFBPs. Bootstrap values are shown at the branch points. Scale bar indicates the number of changes inferred as having occurred along each branch. Accession numbers for IGFBP-1; yellowtail (EU650626), salmon (EF432856), zebrafish (NM_173283), rat (NM_013144), cow (X54979), human (NM_000596). Accession numbers for IGFBP-2; yellowtail (EU652919), salmon (ABO36532), rainbow trout (ABA33956), zebrafish (AAF23123), seabream (AAL57278), chicken (NP_990690), mouse (AAH12724), human (AAH71967). Accession numbers for IGFBP-3; yellowtail (EU652920), zebrafish (NP_991314), mouse (NP_032369), cow (NP_776981), human (AAH64987). Accession numbers for IGFBP-5; yellowtail (EU652921), zebrafish AAM51549, rainbow trout (ABA55021), mouse (NP_034648), human (AAH11453).

residues in N- and C-terminal domains (Fig. 1). It contains a heparin-binding motif (FKRKQCRP) as well as two potential nuclear localization signals (RKGFYKRK and PSRGRKR) in its C-terminal domain. One potential phosphorylation site, Ser-Arg-Glu (SRE), is present in its L-domain at residues 115–117. The yellowtail IGFBP-5 peptide shows high sequence identity to IGFBP-5 of rainbow trout (89%), zebrafish (81%) as well as to its mammalian counterpart (55–56%), whereas its sequence identities to yellowtail IGFBP-1, -2, and -3 are 30%, 31% and 41%, respectively. Based on the result of the phylogenetic analysis performed, yellowtail IGFBP-5 belongs to the IGFBP-5 clade (Fig. 2). 3.6. Tissue distribution The distribution pattern of yellowtail IGFBP-1, -2, -3 and -5 in pituitary, brain, eye, skin, gills, muscle, intestine, pyloric ceca, kidney, heart, liver and spleen were examined by real-time quantitative RT-PCR. Both yellowtail IGFBP-1 (Fig. 3A) and -2 (Fig. 3B) were predominantly expressed in the liver. They were also expressed in other tissues examined, but at very low levels. Yellowtail IGFBP-3 was detected in all the tissues analyzed, it is highly expressed in

the skin and the heart, but the lowest expression was found in the liver (Fig. 3C). Yellowtail IGFBP-5 was also ubiquitously expressed in all the tissues and it is highly expressed in the kidney and liver (Fig. 3D). 3.7. Nutritional regulation During starvation, the hepatic yellowtail IGFBP-1 mRNA level was significantly higher compared with control group from day 3 till the end of the starvation period (day 15) (Fig. 4A). Its levels were restored to those of the control during refeeding. In contrast, hepatic yellowtail IGFBP-2 mRNA levels were not significantly different between the starved and the control group (Fig. 4B). Furthermore, significantly higher hepatic mRNA levels of yellowtail IGFBP3 (Fig. 4C) and -5 (Fig. 4D) were observed in the starved group compared with those of the control from day 3 to day 9 of starvation. However, from day 12 to day 15 of food deprivation, no significant difference was observed in yellowtail IGFBP-3 and -5 mRNA levels between the starved and control groups. A similar trend was also observed in the hepatic yellowtail IGF-I mRNA levels during the starvation period. A significant elevation in IGF-I mRNA

349

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

16 12 8

a

aa

a

a

a

a

4 2

a

0

a

a

aa

a

a

aa

a

a

a

e t lo in ric e c K eca id ne y H ea rt Li ve Sp r le en

s

Py

In t

es

cl us

M

in

0

ill

es

In t

Py

a

1

G

e t lo in ric e c K eca id ne y H ea rt Li ve Sp r le en

s

cl

in

e

ill

us

M

G

Sk

in

Ey

ita

ra B

tu Pi

a

a

e

a

0

ab

a

2

Sk

1

a

in

a

Ey

a

ra

a

a

ry

a

ab

ab

3

ita

a

2

4

B

ab

ab

relative expression

3

tu

4

b b

5

Pi

b

b

a

a

D6

5

ry

relative expression

C

6

tu i

tu i Pi

a

a

ta ry ra in Ey e Sk in G ill M s us In cle t Py es lo tin ric e c K eca id ne y H ea rt Li ve Sp r le en

0

a

a

8

Pi

4

b

10

ta ry ra in Ey e Sk in G ill M s us In cle t Py es lo tin ric e c K eca id ne y H ea rt Li ve Sp r le en

20

B

b

B

relative expression

24

relative expression

B12

A

Fig. 3. Tissue distribution of yellowtail (A) IGFBP-1, (B) IGFBP-2, (C) IGFBP-3 and (D) IGFBP-5 measured by real-time quantitative RT-PCR assay. Data were normalized using 18S as the reference gene, and are expressed relative to the average liver expression level for each yellowtail IGFBP. Bars with a different letter superscript differ significantly (Tukey–Kramer’s test, p < 0.05). Vertical lines represent SEM (n = 6).

levels (Fig. 4E) was observed during the early part of starvation, from day 3 to day 9. Although IGF-I mRNA levels in the starved group tend to decline on day 12 with reference to day 9, no significant difference was observed between the starved and control groups from day 12 to day 15 of food deprivation. During the refeeding period, no significant difference was observed in IGFBP-2, -3, -5 and IGF-I between the control and refed groups. Nutritional conditions has no significant effect on the liver 18S values as shown in Fig 4F. The 18S values remain stable and constant throughout the experiment. 4. Discussion 4.1. Characterization of yellowtail IGFBP-1, -2, -3 and -5 cDNA sequences We identified and characterized the full-length cDNA sequences of yellowtail IGFBP-1, -2, -3 and -5 through molecular cloning. Phylogenetic analysis based on their primary sequences segregated each yellowtail IGFBP into its corresponding clade with very high bootstrap support values. Like other vertebrate IGFBPs, sequence alignment (Fig. 1) of the four known yellowtail IGFBPs reveal a common domain organization: the conserved N-terminal domain, the variable central L-domain and the conserved C-terminal domain. The 12 cysteine residues found in the N-terminal domain and six cysteine residues in C-terminal domain are conserved in yellowtail IGFBP-1, -2, -3 and -5. These cysteine residues are involved in intradomain disulphide bond formation (Hwa et al., 1999). Within the N-terminal domain, a local motif (GCGCCXXC) is also well conserved among yellowtail IGFBPs. It is hypothesized that this motif has an important role in interactions with IGFs (Hwa et al., 1999). Yellowtail IGFBPs have a highly divergent central L-domain. The similarity among yellowtail IGFBPs in this mid-protein segment is

6–10%, except between yellowtail IGFBP-3 and -5, which is slightly high (23%). This mid-domain is believed to act as a structural hinge between the N- and C-terminal domains (Hwa et al., 1999). Cysteine residues were found to be absent in the L-domain of yellowtail IGFBP-1, -2 and -5, whereas one cysteine residue is present in the non-conserved region of yellowtail IGFBP-3. However, due to its sole presence in this region, it can be presumed that it is not involved in the disulphide bond formation. Post-translational modifications, such as glycosylation and phosphorylation sites, are usually found in this mid-region. The primary sequence of the mature protein of yellowtail IGFBP-3 indicates the presence of two potential glycosylation and one phosphorylation sites in its L-domain. In addition, one potential phosphorylation site is also present in yellowtail IGFBP-5. It has been suggested that phosphorylation might influence the interaction between IGFBP and extracellular matrix (Vilmos et al., 2001), while glycosylation of IGFBPs may aid in correct folding, conformation and intracellular localization of the protein (Firth and Baxter, 1999). The C-terminal domain is highly conserved among yellowtail IGFBPs, they share a similarity of 32–36%. The C-terminal was found to be essential in high-affinity and stable IGF-binding (Schneider et al., 2002). In addition, the sequence of the C-terminal domain of yellowtail IGFBPs shows close similarity to the thyroglobin domain type-1, characterized by the presence of six cysteine residues and the conserved CWCV motif. It is hypothesized that the thyroglobin sequence motif might have an important part in the binding of IGFBPs to IGFs and extracellular matrix. Furthermore, all mammalian IGFBP-1 and -2 contain RGD motifs at their C-terminal. This motif was shown to interact with integrins, a family of cell adhesion receptors that is involved in cell-to-cell interaction and intracellular matrix association (Hwa et al., 1999). It was reported that the binding of human IGFBP-1 to a5b1 integrin through its RGD motif stimulates cell migration (Jones et al., 1993; Duan and Xu, 2005). However, as in the case of other teleosts

350

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

relative expression

refed

* 1.5 1

* *

0.5 0

C

0

3

6

9

12

Days

refed

15

18

control

2

Starved & refed refed

1.5

refed

1 0.5 0 0

21

3

6

9

3

*

*

*

0

refed

6

9

12

15

18

refed

1

21

refed refed

*

0.6

*

0.4 0.2 0

21

0

3

6

9

12

15

18

21

Days

F

0.24 0.2 0.16 0.12 0.08 0.04 0

*

*

*

refed

refed

18

21

Ct

relative expression

18

15

*

0.8

Days

E

12

Days

D

45 40 35 30 25 20 15 10 5 0

relative expression

*

*

relative expression

B

2

relative expression

A

0

3

6

9

12

15

Days

16 14 12 10 8 6 4 2 0 0

3

6

9

12

15

18

21

Days

Fig. 4. Effect of fasting and refeeding on hepatic (A) IGFBP-1, (B) IGFBP-2, (C) IGFBP-3, (D) IGFBP-5, (E) IGF-I mRNA levels, and (F) 18S Ct values. Data of IGFBP-1, -2, -3 and IGF-I mRNAs were normalized using 18S as the reference gene, mRNA levels are expressed relative to the liver expression level of the fed fish. Significant differences (t-test, p < 0.05) are marked with asterisk. Vertical lines represent SEM (n = 6).

IGFBP-1, the RGD motif is absent in the C-terminal region of yellowtail IGFBP-1. The acquisition of the RGD motif in mammalian IGFBP-1 may have occurred after the divergence of teleosts from the rest of the vertebrate species (Kamangar et al., 2006; Maures and Duan, 2002), whereas the RGD motif present in mammalian, avian and other known teleost IGFBP-2 is also conserved in yellowtail IGFBP-2. Another prominent motif found in the C-terminal domains of yellowtail IGFBP-3 and -5 is the heparin-binding motif. This motif is also present in mammalian IGFBP-3, -5 and -6. Studies have shown that the heparin-binding sequences can associate with glycosaminoglycans, resulting in reduction in affinity of IGFBPs for IGFs (Arai et al., 1994, 1996). This enhances the ability of IGFs to localize to the cell-surface receptor, thus promoting the biological actions of IGF. In addition, yellowtail IGFBP-3 and -5 contain a nuclear localization signal (NLS) in the basic region of their C-terminal segments. However, the biological importance of NLS is still unclear, although it is suggested that it aids the IGFBP molecule in localizing inside the nucleus where it can exert its ligand-independent action (Duan and Xu, 2005). 4.2. Tissue distribution In yellowtail, IGFBP-1 is predominantly expressed in the liver with very low levels in other tissues. This is also consistent with the observation in other species that the liver is the major site of

IGFBP-1 expression. Among other teleost species, IGFBP-1 is present at low levels in the muscles of salmon (Shimizu et al., 2005), gut and kidney of zebrafish (Maures and Duan, 2002), and the brain of rainbow trout (Kamangar et al., 2006). Yellowtail IGFBP-2 has almost the same tissue distribution pattern as yellowtail IGFBP-1, which shows the highest expression in the liver and very low levels in other tissues. This observation also conforms to the expression of IGFBP-2 found in mammalian and other fish species, where it is ubiquitously expressed in various tissues and high levels are observed in the liver. The existence of two IGFBP-2 paralogs were found in rainbow trout (Kamangar et al., 2006; Rodgers et al., 2008). One of these IGFBP-2 paralog, which was misnamed as IGFBP-3 (Rodgers et al., 2008), has similar tissue distribution pattern and has close similarity to yellowtail IGFBP-2. A 41-kDA IGFBP, the main IGFBP present in circulation of Chinook salmon (Shimizu et al., 2003) is also closely related to yellowtail IGFBP-2 based on its partial sequence. Just recently, presence of two IGFBP-2 genes were also identified and characterized from zebrafish and four other teleost species (Zhou et al., 2008), thus, there might be a possibility of the existence of another IGFBP2 paralog in yellowtail. Duplicate genes are usually common among teleosts due to a genome wide duplication event that happened in the early period of their evolution (Rodgers et al., 2008).

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

Yellowtail IGFBP-3 is expressed in various tissues; high levels were found in the skin and heart and the lowest level was detected in the liver. In mammals, IGFBP-3 is the most abundant IGFBP in circulation. Almost 90% of the IGFs that circulate in the blood are associated with IGFBP-3. IGFBP-3 is produced by a variety of mammalian tissues and the liver shows the highest expression, suggesting that it is the main source of circulating IGFBP-3. However, in yellowtail, very low expression of IGFBP-3 was observed in the liver, even if a well-fed fish was sampled. In addition, higher concentrations of total RNA at 3 lg were needed for reverse-transcription to detect the presence of IGFBP-3 in yellowtail liver tissues, whereas only 300 ng of total RNA for cDNA synthesis was needed to determine the expression pattern of other yellowtail IGFBPs. Based on these findings, the tissue expression pattern of yellowtail IGFBP-3 is quite unique compared to mammalian IGFBP-3. The very low expression of IGFBP-3 in the liver may indicate that it is not the main carrier protein of IGFs in yellowtail. Yellowtail IGFBP-5 is expressed in all tissues, with high levels in the liver and kidneys. In mammals, IGFBP-5 is expressed by a wide variety of tissues at various developmental stages (Green et al., 1994). In rainbow trout, the presence of IGFBP-5 mRNA was also observed in almost all the tissues examined (Kamangar et al., 2006). Our result shows that yellowtail IGFBPs are widely distributed in various tissues. Similarly, both IGF-I and IGF-II are expressed in hepatic and various non-hepatic tissues. Together, these results support the concept that IGFBPs play important paracrine and/or autocrine roles in the regulation of IGF actions. Although there is some variability observed in the presence and abundance of specific IGFBP members in certain tissues between organisms, these inconsistencies may depend on species or developmental stage as well as physiological conditions prior to sampling (Shimizu et al., 2005). 4.3. Nutritional regulation The IGF system has an important role in metabolic regulation in teleosts. Changes in the nutritional status profoundly affect some components of the IGF system (Duan, 2002). Several reports have shown that the typical endocrine response of mammals and fish during sustained nutritional deprivation is reduced hepatic mRNA and plasma levels of IGF-I and IGFBP-3, possibly due to the impairment of GH signalling in the liver, and this is also associated with increased hepatic mRNA and plasma IGFBP-1 and IGFBP-2 levels. Interestingly, we observed a significant increase in hepatic IGF-I mRNA levels in yellowtail, which occurred in the early period of starvation from day 3 to day 9. The exact mechanism underlying this early increase in IGF-I mRNA levels during starvation is not known. Although this kind of response was also reported in rabbitfish (Siganus guttatus), wherein a significant increase in hepatic IGF-I mRNA levels was observed from day 3 to day 6 of food deprivation prior to its significant reduction at day 15 (Ayson et al., 2007). However, in the present study, we did not observe any significant reduction in IGF-I mRNA levels during the 15-day starvation period. Perhaps a longer starvation period is necessary to observe a down regulatory effect of fasting on IGF-I mRNA level in yellowtail. The unexpected increase in IGF-I mRNA may represent speciesspecific response to adapt to certain changes in nutritional condition. This may be due to the different regulatory mechanisms of the hepatic GH sensitivity that exists in this species. Although only the mRNA levels of IGF-I was measured in the present study it would be reasonable to speculate that circulating levels IGF-I may correlate to its hepatic IGF-I levels. At present we are at the initial stages of developing an immunoassay to measure IGF-I plasma levels in yellowtail. Confirmation of the correlation

351

of both hepatic mRNA and circulating IGF-I levels in yellowtail especially during the early stages of catabolic condition will be addressed in our future research work. The hepatic mRNA levels for IGFBP-3 and IGFBP-5 in yellowtail increased significantly, concomitant to the early elevation of IGF-I mRNA levels from day 3 to day 9 of starvation. The physiological significance of the elevation of IGFBP-3 and IGFBP-5 levels in the liver during starvation is largely unknown, but the rise in IGF-I mRNA levels may have stimulated their synthesis at early part of starvation. It was suggested that synthesis of the IGFBPs in various tissues is under partial control of IGF-I (Kiepe et al., 2005). Increase synthesis of IGFBP-3 and IGFBP-5 mRNAs was observed in addition of IGF-I cells grown in culture (Conover, 1996). In vivo studies have shown that IGF-I administration induced the synthesis of IGFBP-3 expression in the liver (Gosteli-Peter et al., 1994) and stimulates the levels of IGFBP-3 in the bloodstream (Clemmons et al., 1989; Zapf et al., 1989; Fielder et al., 1996). Thus, these suggest that IGF-I may directly regulate the synthesis of its carrier. In the present study, no significant difference was observed in IGFBP-3 and IGFBP-5 mRNA levels between the starved and control group from day 12 to day 15, which also correlates to the results of IGF-I mRNA levels, where no significant change in its levels was observed during this period. In yellowtail, 15-day starvation period does not significantly alter the hepatic IGFBP-2 gene expression. IGFBP-2 is known to have an inhibitory effect on IGF-I actions during catabolic conditions such as fasting and protein restriction. In mammals, it has been demonstrated that nutrition is a weak regulator of IGFBP-2 gene expression (Clemmons, 1997). In starved rodents, it takes several days for the hepatic IGFBP-2 levels to show a significant increase (Clemmons et al., 1991). In teleosts such as zebrafish, 3 weeks of fasting are necessary to observe a major change in the hepatic IGFBP-2 levels (Maures and Duan, 2002). It might be possible that a 15-day starvation period is enough to observe a major change in hepatic IGFBP-2 levels in yellowtail. However, in rainbow trout, 30-day starvation has no significant effect in its two IGFBP-2 paralogs (Gabillard et al., 2006). It can also be presumed that nutritional status such food deprivation is not the key regulator of the expression of IGFBP-2 mRNA in the liver of some teleost species. Nevertheless, we observed a significant increase in the hepatic IGFBP-1 mRNA levels in yellowtail from day 3 to day 15 of the starvation period. Refeeding restored the levels to those of the control. Numerous in vitro and in vivo studies have shown that IGFBP-1 has an inhibitory effect on IGF-I activities, mainly by competing with IGF-I in binding to IGF-IR (Kajimura and Duan, 2007). In catabolic situations such as fasting, the increased level of IGFBP-1 may serve as a protective mechanism in controlling the availability of IGFs to their receptors, thus, this effectively mobilized the limited energy sources away from growth and development to support the metabolic processes needed for survival (Kajimura and Duan, 2007). During nutritional rehabilitation, such as refeeding, restoration of IGFBP1 to the basal level may serve to modulate the metabolic action of IGF-I that would promote nutrient utilization in favor of growth (Frystyk et al., 1999; Binoux, 1996). In summary, we have determined the full-length cDNA sequences of yellowtail IGFBP-1, -2, -3 and -5. Based on their primary sequences, they show a high degree of structural similarity. Their wide tissue distribution patterns suggest autocrine and/or paracrine roles in regulating IGF actions. During nutritional deprivation, IGFBP-1 elevated significantly, a typical response of this growth inhibitory protein during catabolic condition, while refeeding restored it to its basal levels rapidly. In this study, it is interesting to note that during the early period of starvation, significant elevation of hepatic IGFBP-3 and -5 mRNA levels was observed concomitant to a significant increase

352

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353

in hepatic IGF-I mRNA levels, although the exact mechanism for this increase remains unknown and awaits thorough investigation. Acknowledgments We are very grateful to Daiji Tadokoro, Takahiro Furutani, and Kenji Yasuda for their help during sampling. F.L. Pedroso expresses her gratitude to Josette Bangcaya-Gonzaga for her invaluable suggestions and advice. References Anderson, T.A., Bennette, L.R., Conlon, M.A., Owens, P.C., 1993. Immunoreactive and receptor-active insulin-like growth factor-I and IGF-binding protein in blood plasma from the freshwater fish Macquaria ambigua (golden perch). J. Endocrinol. 136, 191–198. Arai, T., Parker, A., Busby, W.H., Clemmons, D.R., 1994. Heparin, heparin sulfate, and dermatan sulfate regulate formation of insulin-like growth factor-I and insulin-like growth factor-binding complexes. J. Biol. Chem. 269, 20388– 20393. Arai, T., Clarke, J., Parker, A., Busby, W., Nam, T., Clemmons, D.R., 1996. Substitution of specific amino acids in insulin-like growth factor (IGF) binding protein 5 alters heparin binding and its change in affinity for IGF-I response to heparin. J. Biol. Chem. 269, 6099–6106. Ayson, F.G., de Jesus-Ayson, E.G.T., Takemura, A., 2007. MRNa expression patterns for GH, PRL, SL, IGF-I, and IGF-II during altered feeding status in rabbitfish, Siganus guttatus. Gen. Comp. Endocrinol. 150, 196–204. Bauchat, J.R., Busby Jr., W.H., Garmong, A., Swanson, P., Moore, J., Lin, M., Duan, C., 2001. Biochemical and functional analysis of a conserved IGF-binding protein isolated from rainbow trout (Oncorhynchus mykiss) hepatoma cells. J. Endocrinol. 170, 619–628. Binoux, M., 1996. Insulin-like growth factor binding proteins (IGFBPs): physiological and clinical implications. J. Pediatric Endocrinol. Metab. 9, 285–288. Chen, J.Y., Chen, J.C., Huang, W.T., Liu, C.W., Hui, C.F., Chen, T.T., Wu, J.L., 2004. Molecular cloning and tissue-specific, developmental stage specific, and hormonal regulation of IGFBP3 gene in zebrafish. Mar. Biotechnol. 6, 1–7. Cheng, R., Chang, K.M., Wu, J.L., 2002. Different temporal expressions of tilapia (Oreochromis mossambicus) insulin-like growth factor-I and IGF binding protein3 after growth hormone induction. Mar. Biotechnol. 4, 218–225. Clemmons, D.R., 1992. IGF binding proteins: regulation of cellular actions. Growth Reg. 2, 80–87. Clemmons, D.R., 1997. Insulin-like growth factor binding proteins and their role in controlling IGF actions. Cytokine Growth Factor Rev. 8, 45–62. Clemmons, D.R., Thissen, J.P., Maes, M., Ketelsleger, J.M., Underwood, L.E., 1989. Insulin-like growth factor-I (IGF-I) infusion into hypophysectomized or protein deprived rats induces specific IGF-binding proteins in serum. Endocrinology 125, 2967–2972. Clemmons, D.R., Busby, W.H., Snyder, D.K., 1991. Variables controlling the secretion of insulin-like growth factor binding protein-2 in normal human subjects. J. Clin. Endocr. Metab. 73, 727–733. Conover, C.A., 1996. Regulation and physiological role of insulin-like growth factor binding proteins. Endocr. J. 43 (Suppl.), S43–S48. Duan, C., 1998. Nutritional and developmental regulation of insulin-like growth factors in fish. J. Nutr. 128, 306S–314S. Duan, C., 2002. Specifying the cellular responses to IGF signals: roles of IGF binding proteins. J. Endocrinol. 175, 41–54. Duan, C., Xu, Q., 2005. Roles of insulin-like growth factor (IGF) binding proteins in regulating IGF actions. Gen. Comp. Endocrinol. 142, 44–52. Duan, C., Ding, J., Li, Q., Tsai, W., Pozois, K., 1999. Insulin-like growth factor binding protein 2 is a growth inhibitory protein conserved in zebrafish. Proc. Natl. Acad. Sci. USA 96, 15274–15279. Ferry, J.R., Cerri, R.W., Cohen, P., 1999. Insulin-like growth factor binding proteins: new proteins, new functions. Horm. Res. 51, 53–67. Fielder, P.J., Mortensen, D.L., Mallet, P., Carlsson, B., Baxter, R.C., Clark, R.G., 1996. Differential long-term effects of insulin-like growth factor-I (IGF-I), growth hormone (GH), and IGF-I plus GH on body growth and IGF binding proteins in hypophysectomized rats. Endocrinology 137, 1913–1920. Firth, S.M., Baxter, R.C., 1999. Characterization of recombinant glycosylation variants of insulin-like growth factor binding protein-3. J. Endocrinol. 160, 379–387. Firth, S.M., Baxter, R.C., 2002. Cellular action of the insulin-like growth factor binding proteins. Endocr. Rev. 23, 824–854. Frohman, M.A., 1990. RACE: rapid amplification of cDNA ends. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Application. Academic Press, San Diego, pp. 28–38. Frystyk, J., Delhanty, J.D., Skjaebaek, C., Baxter, R.C., 1999. Changes in the circulating IGF system during short-term fasting and refeeding in rats. Am. J. Physiol. 277, E245–E252. Fukazawa, Y., Siharath, K., Iguchi, T., Bern, H.A., 1995. In vitro secretion of insulinlike growth factor binding proteins from liver of striped bass, Morone saxatilis. Gen. Comp. Endocrinol. 99, 239–247.

Funkenstein, B., Tsai, W., Maures, T., Duan, C., 2002. Ontogeny, tissue distribution, and hormonal regulation of insulin-like growth factor binding protein-2 (IGFBP2) in a marine fish, Sparus aurata. Gen. Comp. Endocrinol. 128, 112–122. Gabillard, J.-C., Kamangar, B.B., Montserrat, N., 2006. Coordinated regulation of the GH/IGF system genes during refeeding in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 191, 15–24. Gosteli-Peter, M.A., Winterhalter, K.H., Schmid, C., Froesch, E.R., Zapf, J., 1994. Expression and regulation of insulin-like growth factor-I (IGF-I) and IGFbinding protein messenger ribonucleic acid levels in tissues of hypophysectomized rats infused with IGF-I and growth hormone. Endocrinology 135, 2558–2567. Green, B.N., Jones, S.B., Streck, R.D., Wood, T.L., Rotwein, P., Pintar, J.E., 1994. Distinct expression patterns of insulin-like growth factor binding proteins 2 and 5 during fetal and postnatal development. Endocrinology 134, 954–962. Hwa, V., Oh, Y., Rosenfeld, R.G., 1999. The insulin-like growth factor-binding protein (IGFBP) superfamily. Endocr. Rev. 20 (6), 761–787. Jones, J.I., Gockerman, A., Busby, W.H., Wright, G., Clemmons, D.R., 1993. Insulin-like growth factor binding protein-1 stimulates cell migration and binds to the a5b1 integrins by means of its ARG-GLY-ASP sequence. Proc. Natl. Acad. Sci. USA 90, 10553–10557. Kajimura, S., Duan, C., 2007. Insulin-like growth factor-binding protein-I: an evolutionary conserved fine tuner of insulin-like growth factor action under catabolic and stressful conditions. J. Fish Biol. 71, 309–325. Kamangar, B.B., Gabillard, J.C., Bobe, J., 2006. Insulin-like growth factor-binding protein (IGFBP)-1, -2, -3, -4, -5, and -6, and IGFBP-related protein 1 during rainbow trout postvitellogenesis and oocyte maturation: molecular characterization, expression profiles, and hormonal regulation. Endocrinology 147, 2399–2410. Kelly, K.M., Siharath, K., Bern, H.A., 1992. Identification of insulin-like growth factorbinding proteins in the circulation of four teleost fish species. J. Exp. Zool. 263, 220–224. Kiepe, D., Ciarmatori, S., Hoeflich, A., Wolf, E., Tonshoff, B., 2005. Insulin-like growth factor (IGF)-I stimulates cell proliferation and induces IGF binding protein (IGFBP)-3 and IGFBP-5 gene expression in cultured growth plate chondrocytes via distinct signaling pathways. Endocrinology 146, 3096–3104. Masumoto, T., 2002. Yellowtail (Seriola quinqueradiata). In: Lim, C. (Ed.), Webster CD, ‘‘Nutrient Requirements and Feeding of Finfish for Aquaculture”. CABI Publishing, New York, pp. 131–146. Maures, T.J., Duan, C., 2002. Structure, developmental expression, and physiological regulation of zebrafish IGF binding protein-1. Endocrinology 143, 2722–2731. Moriyama, S., Ayson, F.G., Kawauchi, H., 2000. Growth regulation by insulin-like growth factor-I in fish. Biosci. Biotechnol. Biochem. 64, 1553–1562. Murashita, K., Fukada, H., Hosokawa, H., Masumoto, T., 2006. Cholecystokinin and peptide Y in yellowtail (Seriola quinqueradiata): molecular cloning, real-time quantitative RT-PCR, and response to feeding and fasting. Gen. Comp. Endocrinol. 145, 287–297. Murashita, K., Fukada, H., Hosokawa, H., Masumoto, T., 2007. Changes in cholecystokinin and peptide Y gene expression with feeding in yellowtail (Seriola quinqueradiata): relation to pancreatic exocrine regulation. Comp. Biochem. Physiol. 146, 318–325. Niu, P.-D., LeBail, P.Y., 1993. Presence of insulin-like growth factor binding protein (IGF-BP) in rainbow trout (Oncorhynchus mykiss) serum. J. Exp. Zool. 265, 627– 636. Park, R., Shepherd, B.S., Nishioka, R.S., Grau, E.G., Bern, H.A., 2000. Effects of homologous pituitary hormone treatment on serum insulin-like growth-factorbinding proteins (IGBPs) in hypophysectomized tilapia, Oreochromis mossambicus, with special reference to a novel 20-kDa IGFBP. Gen. Comp. Endocrinol. 117, 404–412. Pfafll, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acid Res. 29, 2002–2007. Pierce, A.L., Dickey, J.T., Larsen, D.A., Fukada, H., Swanson, P., Dickhoff, W.W., 2004. A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of GH regulation of IGF-I gene expression in primary culture of salmon hepatocytes. Gen. Comp. Endocrinol. 135, 401–411. Rodgers, B.D., Roalson, E.R., Thompson, T., 2008. Phylogenetic analysis of the insulin-like growth factor binding protein (IGFBP) and IGFBP-related protein gene families. Gen. Comp. Endocrinol. 155, 201–207. Schneider, M.R., Wolf, E., Hoeflich, A., Lahm, H., 2002. IGF-binding protein-5: flexible player in the IGF system and affector on its own. J. Endocrinol. 172, 423–440. Shimizu, M., Swanson, P., Hara, A., Dickhoff, W.W., 2003. Purification of a 41-kDa insulin-like growth factor binding protein from serum of Chinook salmon, Oncorhynchus tshawytscha. Gen. Comp. Endocrinol. 132, 103–111. Shimizu, M., Dickey, J.T., Fukada, H., Dickhoff, W.W., 2005. Salmon serum 22 kDa insulin-like growth factor-binding protein (IGFBP) is IGFBP-1. J. Endocrinol. 184, 267–276. Siharath, K., Nishioka, R.S., Bern, H.A., 1995. In vitro production of IGF-binding proteins (IGFBP) by various organs of the striped bass, Morone saxatilis. Aquaculture 135, 195–202. Thissen, J.-P., Ketelsleger, J.-M., Underwood, L.E., 1994. Nutritional regulation of the insulin-like growth factors. Endocr. Rev. 15, 80–101. Tom, M., Chen, N., Segev, M., Herut, B., Rinkevich, B., 2004. Quantifying fish metallothionein transcript by real time PCR for its utilization as environmental biomarker. Mar. Pollut. Bull. 48, 705–710. Vilmos, P., Gaudenz, K., Hegedus, Z., Marsh, J.L., 2001. The twisted gastrulation family of proteins, together with the IGFBP and CCN families, comprise the TIC

F.L. Pedroso et al. / General and Comparative Endocrinology 161 (2009) 344–353 superfamily of cysteine rich secreted factors. J. Clin. Pathol. Mol. Pathol. 54, 317–323. Wood, A.W., Duan, C., Bern, H.A., 2005. Insulin-like growth factor signaling in fish. Int. Rev. Cytol. 243, 215–285. Zapf, J., Hauri, C., Waldvogel, M., Futo, E., Hasler, H., Binz, K., Guler, H.P., Schmid, C., Froesch, E.R., 1989. Recombinant human insulin-like growth factor induces its

353

specific carrier protein in hypophysectomized and diabetic rats. Proc. Natl. Acad. Sci. USA 86, 3813–3817. Zhou, J., Li, W., Kamei, H., Duan, C., 2008. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence. PLoS ONE 3 (12), 1–11.