- Email: [email protected]
Molecular cloning and characterization of a cDNA encoding extracellular signal-regulated kinase (ERK) from the blood clam Tegillarca granosa
Journal Pre-proof Molecular cloning and characterization of a cDNA encoding extracellular signalregulated kinase (ERK) from the blood clam Tegillarca granosa
Minghan Yang, Mingliang Chen, Guosheng Liu, Chunyan Yang, Zengpeng Li PII:
S0145-305X(19)30433-1
DOI:
https://doi.org/10.1016/j.dci.2019.103602
Reference:
DCI 103602
To appear in:
Developmental and Comparative Immunology
Received Date:
09 September 2019
Accepted Date:
27 December 2019
Please cite this article as: Minghan Yang, Mingliang Chen, Guosheng Liu, Chunyan Yang, Zengpeng Li, Molecular cloning and characterization of a cDNA encoding extracellular signalregulated kinase (ERK) from the blood clam Tegillarca granosa, Developmental and Comparative Immunology (2019), https://doi.org/10.1016/j.dci.2019.103602
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Journal Pre-proof Molecular cloning and characterization of a cDNA encoding extracellular signal-regulated kinase (ERK) from the blood clam Tegillarca granosa Minghan Yanga, 1, Mingliang Chena, b, *, 1, Guosheng Liua, Chunyan Yangc, **, Zengpeng Lia, ***
a
State Key Laboratory Breeding Base of Marine Genetic Resources, Third Institute of
Oceanography, Ministry of Natural Resources, Xiamen 361005, P.R. China b
Co-Innovation Center of Jiangsu Marine Bio-industry Technology, Huaihai Institute
of Technology, Lianyungang 222005, P.R. China c
School of Life Science, Xiamen University, Xiamen, 361005, P.R. China
1 These *
authors contributed equally to this work.
Corresponding author: Mingliang Chen
Email address: [email protected] Telephone: +86-592-2195393
** Corresponding
author: Chunyan Yang
Email address: [email protected] Telephone: +86-592-2185695
*** Corresponding
author: Zengpeng Li
Email address: [email protected] Telephone: +86-592-2195518
1/26
Journal Pre-proof Abstract The blood clam Tegillarca granosa is a member of the most economically important bivalve mollusk species in the Asia-Pacific region. T. granosa entirely depends on innate immunity for pathogen defense. However, there are very few reports on the immune responses of T. granosa to various pathogens. In our study, we cloned and characterized an ERK homolog from T. granosa, which was defined as TgERK. The full-length cDNA sequence of TgERK was 1,644 bp in length and encoded a conserved S_TKc domain (residues 21-309) in the N terminus. The TgERK mRNA was universally expressed in all examined tissues, with the highest expression level found in hemocytes. Lipopolysaccharide (LPS) and Vibrio alginolyticus challenges strongly enhanced the expression of ERK in T. granosa, which was consistent with the results of an in vitro challenge study with cultured T. granosa hemocytes. Pathogen invasion also upregulated the expression of downstream genes in the ERK signaling pathway, such as CREB, c-Fos and SIRT1. Moreover, TgERK knockdown resulted in decreased expression of these downstream genes. Inhibition of ERK by its inhibitor U0126 decreased T. granosa hemocyte viability in a dose-dependent manner. Taken together, our results demonstrated that TgERK was a crucial regulator of the immune response to pathogen invasion, which indicated new knowledge of hemocyte immunity in T. granosa and provided a novel key molecule in immune regulation for controlling diseases in T. granosa aquaculture.
Keywords: Tegillarca granosa; Hemocytes; ERK; LPS; Vibrio alginolyticus
2/26
Journal Pre-proof 1. Introduction Blood clams (Tegillarca granosa) are widely distributed in Indo-Pacific tropical and temperate estuaries, and this species is among the most economically important bivalve mollusk species in China and Southeast Asia (Fungesmith et al., 2012). However, the amount of wild T. granosa has been continuously decreasing over the last ten years because of overexploitation and environmental deterioration (Teng et al., 2018). Shellfish-related illness and death are mainly caused by Vibrio infection, and Vibrio alginolyticus is the most common species (Ripabelli et al., 1999). The major component of the Gram-negative bacterial outer membrane is LPS (Guha and Mackman, 2001), which induces the release of key proinflammatory cytokines to activate immune responses (Lu et al., 2008). Marine bivalve mollusks are species that survive in an aquatic environment among many microorganisms, such as bacteria, microalgae, protozoans, fungi and yeast (Bachere et al., 2010). In fact, these organisms, which lead to mortality and Vibrio infection a major impact on commercial aquaculture, limit marine bivalve mollusk culture (Carla et al., 2017).
There are two branches of the immune system, innate immunity and adaptive immunity, that were selected during evolution (Fearon and Locksley, 1996). It is now commonly accepted that the adaptive immune system is lacking in invertebrates, so the innate immune system is essential for invertebrate survival (Sadaaki and Bok Luel, 2005). Innate immunity plays a vital role as a first-line host defense (Ahne, 1971) that can limit infection as early as possible after exposure to infectious pathogens.
The mitogen-activated protein kinase (MAPK) signaling pathways are crucial for regulating gene expression (Yang et al., 2003), which include the JNK, ERK and p38 pathways (Lewis et al., 1998). In the ERK signaling pathway, ERKs act as effector kinases involved in various vital cellular processes. It has been well established in previous studies that ERKs participate in the immune response. For example, the ERK pathway is important to the immune response activated when Caenorhabditis elegans 3/26
Journal Pre-proof is infected by Microbacterium nematophilum (Nicholas and Hodgkin, 2004). ERK participates in T cell development by regulating the development of Th17 and Treg cells (Houpu et al., 2013). MEK inhibitors are useful not only in the response to traumatic injury in the mouse brain (Mori et al., 2002) but also in the inhibition of tumor growth (Hommes et al., 2003). However, there is no report on the function of the ERK pathway in T. granosa. In this study, we found that there was only one ERK homolog in T. granosa, while mammals and most other vertebrates contained at least two ERKs. In vivo and in vitro experiments showed that TgERK expression was upregulated after both LPS exposure and V. alginolyticus infection. Further data indicated that TgERK could regulate the expression of the downstream genes CREB, c-Fos and SIRT1 and inhibit T. granosa hemocyte viability. These results together showed that TgERK was an important molecule in the immune regulation of T. granosa. Understanding the molecular mechanism of the immune system from the perspective of signaling pathway regulation will help the study of the immune mechanism underlying host-pathogen interactions in T. granosa.
2. Materials and methods 2.1. Tegillarca granosa culture and immune challenge Healthy live blood clams, 3.1-3.5 cm long and 8.7-10.3 g in weight, were purchased from a local seafood market. The clams were cultured in seawater at 2627°C for three days and then exposed to LPS or V. alginolyticus for the indicated time points, as described in our previous study (Liu et al., 2017).
2.2. Cloning of TgERK cDNA According to the manufacturer's instructions, total RNA was isolated from T. granosa hemocytes using TRIzol reagent (Ambion, Austin, USA). Then, these RNA samples were reverse transcribed into cDNAs by using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian, China). According to the partial sequence of TgERK found in the transcriptome library, we designed TgERK-5RACE1, TgERK4/26
Journal Pre-proof 5RACE2 and TgERK-3RACE (Table 1) to obtain the missing 5′ and 3′ sequences. The SMART PCR technique was used to obtain the 5′-UTR of TgERK, and the missing 3′terminal sequence was acquired by the 3′-RACE method using the 3′-Full RACE Core Set with PrimeScript™ RTase (Takara). These PCR products were cloned into a pEASY-T1 vector (Transgen, Beijing, China) and confirmed by DNA sequencing. Table 1 Primers used in this study. Primer
Sequence (5′-3′)
For cDNA cloning and ORF cloning TgERK-5′ RACE1
GTCTGTGCACGGAGTATATCTTGA
TgERK-5′ RACE2
CACACATGGTCGTTACTGAGC
TgERK-3′ RACE
GTAGCATTGAAGGACAGGGTGGGGAGT
For protein expression PcDNA3.1-EGFP-TgERK-Fa
GGCGGAGGCGGATCAGGATCCATGGCGAGCAAGTCGAA
PcDNA3.1-EGFP-TgERK-R
CCCTCTAGACTCGAGTCAACGGACAGTACTCCCCA
a
For RNAi dsRNA-TgERK-F
CCCCCTTTGAACATCAGACA
dsRNA-T7-TgERK-R
b
dsRNA- TgERK-R
CCTGGAAACAGTGGTCGATT
dsRNA-T7-TgERK-F
b
dsRNA-GFP-F
CCCTGAAGTTCATCTGCACC
dsRNA-T7-GFP-R
b
dsRNA- GFP-R
GCTTCTCGTTGGGGTCTTT
dsRNA-T7-GFP-F
b
GATCACTAATACGACTCACTATAGGGCCTGGAAACAGTGGTCGATT
GATCACTAATACGACTCACTATAGGGCCCCCTTTGAACATCAGACA
GATCACTAATACGACTCACTATAGGGGCTTCTCGTTGGGGTCTTT
GATCACTAATACGACTCACTATAGGGCCCTGAAGTTCATCTGCACC
For qRT-PCR
a
TgERK-RT-F
ACTTAATGACAAGGCCAGAG
TgERK-RT-R
TGGGATAGTGACTGTTCTAC
TgCREB-RT-F
TGGCAACGTCAGGAACAC
TgCREB-RT-R
TCCACCTTCACTGTCACTGG
Tgc-Fos-RT-F
CAACTCCAAGCCTTACTCCA
Tgc-Fos-RT-R
ATCTTTCGGCTCCATTCG
TgSIRT1-RT-F
CCAGCCACTTGTTCTAAGGTATC
TgSIRT1-RT-R
TGGCAGTAGAGTTTCCCAATC
Tg18S rDNA-RT-F
CTTTCAAATGTCTGCCCTATCAACT
Tg18S rDNA-RT-R
TCCCGTATTGTTATTTTTCGTCACT
The sequences of restriction sites introduced for cloning are underlined.
b The
sequence of the T7 promoter is shown in bold.
2.3. Sequence analysis of TgERK 5/26
Journal Pre-proof The characteristic domain of TgERK was analyzed using the SMART analysis program (http://smart.embl-heidelberg.de/) (Schultz et al., 1998). The sequences of TgERK and its homologs were selected from the NCBI database. Multiple alignments of TgERK were analyzed utilizing the ClustalW program (Thompson et al., 1994). The neighbor-joining (NJ) algorithm was used to construct a phylogenetic tree (Saitou and Nei, 1987).
2.4. Subcellular localization of TgERK The primers pcDNA3.1-EGFP-TgERK-F and pcDNA3.1-EGFP-TgERK-R (Table 1), which contained BamH I and Xho I sites, were designed to subclone TgERKORF into the pcDNA3.1-EGFP vector. To detect whether the TgERK protein was functionally expressed, 2 µg pcDNA3.1-EGFP or pcDNA3.1-EGFP-TgERK were transiently transfected into HEK 293T cells in 60-mm cell culture dishes. At 24 h post transfection, these cells were collected for Western blot analysis by using an anti-EGFP monoclonal antibody (Transgen). To further detect the subcellular expression pattern of TgERK, HEK 293T cells and T. granosa hemocytes were cultured on 20-mm glass-bottom cell culture dishes (NEST, Jiangsu, China) overnight. For the 293T cells, 1 µg pcDNA3.1-EGFP-TgERK was transfected into cells. At 24 h post transfection, the cells were washed with PBS once for 5 min and then incubated with 4% paraformaldehyde for 15 min and 0.2% Triton X-100 for 5 min. For the T. granosa hemocytes, hemocytes were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.2% Triton X-100 for 5 min. Then, the hemocytes were incubated with 1% BSA for 1 h followed by incubation with an anti-phospho-ERK antibody (1:200 diluted in 1% BSA) (Cell Signaling, MA, USA) overnight. After washing three times, the hemocytes were incubated with a goat antirabbit secondary antibody conjugated with Cy3 (ABclonal, Wuhan, China). Then, both the HEK 293T cells and the T. granosa hemocytes were counterstained with DAPI (Sangon, Shanghai, China) for 5 min and washed three times. Finally, the subcellular 6/26
Journal Pre-proof localization was detected with a LeicaSP2 confocal microscope (Leica, Bannockburn, IL).
2.5. T. granosa hemocyte culture and immune challenge Hemocytes were extracted from three individual healthy T. granosa with a 1-mL sterile syringe and then cultured at 26°C with 4.5% CO2 in RPMI 1640 medium supplemented with 20% FBS. For the LPS-challenged group, 30 µL (1 mg/mL) LPS was added to the T. granosa hemocytes. For the V. alginolyticus-challenged group, V. alginolyticus was cultured overnight at 37°C and then harvested by centrifuging at 4,000 g at 4°C for 2 min. The bacterial pellets were resuspended in RPMI 1640 medium without serum, and then 1 mL bacterial suspensions were added to the T. granosa hemocytes. The MOI of this infection was 100 (Zhao et al., 2011). 2.6. RNAi assay According to the manufacturer's instructions, the dsRNA sequences for TgERK and GFP (dsTgERK and dsGFP) were synthesized with the T7 RiboMAX Express RNAi System (Promega, Madison, WI, USA). The primers used in this experiment are listed in Table 1. In the gene silencing study, the foot muscle of clams was injected with 20 µg dsRNA. At 24 h, these clams were injected with the dsRNA again to improve the RNAi efficiency. The hemocytes from three individuals were collected after another 12 h. Western blotting and qRT-PCR were used for analysis.
2.7. Western blot analysis T. granosa hemocytes collected at the indicated time points were subjected to centrifugation at 3,000 rpm for 2 min, and then 40 µL RIPA with PMSF (1:100) was added to the pellets. Then, the cell lysates were placed on ice for approximately 30 min, after which time the supernatants were collected using centrifugation at 10,000 rpm and 4°C for approximately 5 min. The supernatants were mixed with loading buffer and subjected to 12% SDS-PAGE, and then the proteins were transferred to 0.45-µm PVDF 7/26
Journal Pre-proof membranes. For blocking, the membranes were incubated with 5% BSA for approximately 90 min and then with anti-p44/42 ERK1/2, anti-phospho-ERK (Cell Signaling), and anti-α-tubulin (1:5000) (ABclonal, Wuhan, China) antibodies separately overnight, after which 20-mm glass-bottom cell culture dishes TBST was used to wash the membranes three times. Subsequently, the membranes were incubated with the corresponding secondary antibody for approximately 60 min at room temperature and then washed again. Signals were detected through an ECL chemiluminescence (Beyotime, Nantong, China) reaction. Each experiment was repeated three times.
2.8. Quantitative real-time PCR analysis To analyze the distribution of the TgERK mRNA transcript in different tissues, the hemocytes, the gill, the foot, the mantle, the adductor muscle and the visceral mass were collected from three individual T. granosa. For analysis of the expression patterns post stimulation, hemocytes were collected from three individual T. granosa that were challenged in the foot muscle with 40 µL LPS (0.1 mg/mL) or 20 µL V. alginolyticus suspended in PBS (2×108 CFU/mL) (Liu et al., 2017). To analyze the expression of the genes CREB, c-Fos and SIRT1, which are downstream of ERK, hemocytes were collected from three individual T. granosa that were injected with dsRNA. To minimize individual variation among clams, the tissues from three clams were pooled to compose a sample. Total RNA was obtained using the aforementioned method, and first-strand cDNA was synthesized. We chose SYBR® Premix Ex Taq™ reagent and a Quantagene q225 instrument (Kubotechnology, Beijing, China) to perform qRT-PCR. All primers used are shown in Table 1. The 18S rDNA gene was used for internal standardization. The total volume of the qRT-PCR reagent was 10 µL with 2 µL diluted first-strand cDNA, and the ratio of cDNA to reagent was 1:10. The reaction program was as follows: 95°C for 30 s; 40 cycles of 95°C for 10 s, 49°C for 15 s, and then 72°C for 15 s. Relative mRNA levels were calculated by the 2-ΔΔCt method (Livak and Schmittgen, 2001). Each experiment was repeated three times. 8/26
Journal Pre-proof
2.9. Cell counting kit-8 (CCK8) assay T. granosa hemocytes (2×103 cells per well in 100 μL RPMI 1640 medium) were plated in 96-well plates (three wells per group) and treated with the ERK inhibitor U0126 (MedChemExpress, NJ, USA) at various concentrations (0, 20, 40 and 100 μM) for 24 h, with DMSO used as a control. Then, the hemocytes were treated with 5 µL (1 mg/mL) LPS (Sigma, MO, USA) for 10 h. 10 μL CCK8 (Transgen) was added to each well for 2 h of incubation. The optical density (OD) was measured using a SpectraMax M5 (CA, USA) at 450 nm. Each experiment was repeated three times.
3. Results 3.1. cDNA cloning and sequence analysis of TgERK The cDNA sequence of TgERK was 1,664 bp long, the 5′-untranslated region (UTR) was 13 bp long, and the 3'-UTR was 571 bp long, which contained a typical AATAAA polyadenylation signal and poly A tail. The coding sequence of TgERK encoded a 359-aa protein with an S_TKc domain (residues 21-309) in the N terminus and a TEY motif that was significant for the MAPK pathway, and the calculated molecular mass was 41.44 kDa (Fig. 1). Multiple sequence alignments also revealed that the ERK subfamily was highly conserved among different species. There were three N-glycosylated sites, 1 conserved ATP binding site, 1 active site, a cAMP- and cGMP-dependent protein kinase phosphorylation site and a nucleotide binding site in TgERK. TgERK had the highest identity (90.34%) with the ERK homolog of Haliotis discus discus (Fig. 2). Phylogenetic analysis indicated that TgERK was closest to the homologs of mollusks such as Aplysia californica, Haliotis discus discus, Mizuhopecten yessoensis and Pinctada fucata (Fig. 3), and there was clear separation between ERK1 (MAPK3) and ERK2 (MAPK1), as observed between invertebrates and vertebrates.
9/26
Journal Pre-proof
Fig. 1. Nucleotide and deduced amino acid sequences of TgERK. Start (ATG) and stop (TGA, asterisk) codons are boxed. The S_TKc domain (residues 21-309) in the N terminus is shaded gray. The conserved TEY motif is indicated by a dotted line. The polyadenylation signal is in bold and underlined. 10/26
Journal Pre-proof
Fig. 2. TgERK and ERK homologs in other species. The red boxes indicate Nglycosylated sites, the green boxes indicate the cAMP- and cGMP-dependent protein kinase phosphorylation sites, the blue box indicates the nucleotide binding sites, the conserved DNA binding site is underlined in black, and the active site is underlined in green. The sequences are as follows: HsMAPK1: Homo sapiens MAPK 1 (NP_620407), 11/26
Journal Pre-proof MmMAPK1: Mus musculus MAPK1 (EDK97435.1), BtMAPK1: Bos taurus MAPK1 (NP_786987.1), GgMAPK1: Gallus gallus MAPK1 (NP_989481.1), DrMAPK1: Danio rerio MAPK1 (AAH65868.1), PvMAPK1-like: Penaeus vannamei MAPK1 (AGS38337.1), SpMAPK: Scylla paramamosain MAPK (ACX32460.1), HddMAPK1: Haliotis discus discus MAPK1 (XP_005108216.1), and AcMAPK1: Aplysia californica MAPK1 (XP_005108216.1).
Fig. 3. Phylogenetic tree of the amino acid sequences of ERK proteins from different species constructed by the neighbor-joining (NJ) algorithm using the MEGA 5.0 program.
3.2. Subcellular location of TgERK To determine whether TgERK is functionally expressed, we transfected the recombinant plasmid pcDNA3.1-EGFP-TgERK into HEK 293T cells. Western blotting 12/26
Journal Pre-proof was performed to confirm the expression of TgERK, and the results showed a band at approximately 70 kDa, which was in accordance with the predicted molecular mass of EGFP-TgERK (Fig. 4A). Humans contain two ERKs, ERKl and ERK2, which are mainly located in the cytoplasm (Chen et al., 1992). We further studied the subcellular localization of the TgERK protein in HEK 293T cells and T. granosa hemocytes by confocal microscopy. Our results showed that TgERK-EGFP was mainly aggregated in the cytoplasm (Fig. 4B). Consistently, the majority of the endogenous TgERK protein was also found in the cytoplasm of T. granosa hemocytes (Fig. 4C).
Fig. 4. Expression analysis of TgERK and its subcellular localization. (A) Overexpression of TgERK was confirmed by Western blotting. HEK 293T cells were transfected with the plasmid pcDNA3.1-EGFP or pcDNA3.1-EGFP-TgERK. Cells were harvested and resolved by 12% SDS-PAGE, and the fusion protein was analyzed 13/26
Journal Pre-proof by Western blotting. (B) Subcellular localization of TgERK in HEK 293T cells. Cells were observed at 24 h post transfection by confocal microscopy (scale bar = 5 μm). (C) Immunofluorescence analysis of the localization of TgERK in T. granosa hemocytes (scale bar = 1 μm).
3.3. Tissue distribution of TgERK We further performed qRT-PCR to detect the expression levels of TgERK in different tissues of T. granosa. The results revealed that TgERK mRNA was universally expressed in all examined tissues. The highest expression level was found in hemocytes, followed by the gill, which was reasonable since hemocytes and the gill are two major immune tissues responsible for pathogen defense in T. granosa. TgERK expression in the foot was slightly higher than that in the mantle, visceral mass and adductor muscle (Fig. 5).
Fig. 5. TgERK expression in different tissues of T. granosa, with the 18S rDNA gene acting as an internal standard. Different tissues including hemocytes (H), the gill (G), the foot (F), the mantle (M), the adductor muscle (A) and the visceral mass (V) were harvested from three individual T. granosa samples. The TgERK expression level in the mantle was used as the basal level. Data were analyzed by one-way ANOVA. Error bars represent the mean of three independent biological replicates. (* p < 0.05, *** p < 14/26
Journal Pre-proof 0.001).
3.4. TgERK was activated after stimulation To investigate the mRNA expression level of TgERK after pathogen challenge, T. granosa was treated with LPS or V. alginolyticus, and hemocytes were collected at different time points for qRT-PCR analysis. After LPS treatment, TgERK expression was slightly upregulated at 3 h and reached its highest level at 6 h, with a peak at a 2.39fold increase compared with the control (Fig. 6A). Similarly, the transcriptional level of TgERK in the V. alginolyticus group reached a maximum value (approximately 1.96fold increase) at 3 h post infection (Fig. 6B). These results indicated that TgERK quickly responded to pathogen invasion.
Fig. 6. mRNA expression of TgERK after challenge with LPS or V. alginolyticus in three individual T. granosa, with the 18S rDNA gene acting as an internal standard. (A) TgERK expression in hemocytes at different points post LPS challenge. (B) TgERK expression in hemocytes at different points post V. alginolyticus challenge. Data were analyzed by one-way ANOVA. Error bars represent the mean of three independent biological replicates (* p<0.05, ** p<0.01).
Western blotting was further employed to detect the protein level of TgERK after stimulation. Hemocytes collected from T. granosa were exposed to LPS or V. alginolyticus. Then, we detected changes in phosphorylated ERK levels. The results 15/26
Journal Pre-proof showed that the phosphorylated ERK level was significantly upregulated by 1.5-fold in the LPS-treated group and by 2.8-fold in the V. alginolyticus-treated group compared with the control group after 0.5 h of stimulation (Figs. 7A and 7B).
Fig. 7. Western blot analysis of the protein expression of TgERK in hemocytes (three individual healthy T. granosa in each group) under LPS or V. alginolyticus stimulation. (A) TgERK expression and phosphorylation after LPS exposure. (B) TgERK expression and phosphorylation after V. alginolyticus infection. Each experiment was repeated three times.
3.5. Effects of dsTgERK on downstream MAPK pathways in T. granosa CREB, c-Fos, and SIRT1 are common downstream genes in the ERK signaling pathway (Davis et al., 2000; Sun et al., 2015; You et al., 2016). To study whether TgERK regulates these downstream genes in T. granosa, we used RNAi to silence the TgERK gene. T. granosa were injected with dsTgERK, and dsGFP was used as a control. The efficiency of dsTgERK was tested using Western blotting and qRT-PCR. These two datasets both showed that the expression level of TgERK was significantly repressed in dsTgERK-treated T. granosa with an efficiency of approximately 77% at the mRNA level and 54% at the protein level compared with control T. granosa (Figs. 8A and B). At the same time, the transcriptional levels of CREB, c-Fos and SIRT1 were decreased by 3.87-, 10.64- and 5.48-fold in the dsTgERK-treated T. granosa compared with the control T. granosa (Fig. 8D). We also investigated the expression levels of these genes after clams were exposed to LPS for 6 h or V. alginolyticus for 3 h (Figs. 8E and F). The levels of CREB, c-Fos and SIRT1 were all upregulated at least 2.7-fold. 16/26
Journal Pre-proof Thus, the results clearly showed that TgERK could regulate the downstream genes CREB, c-Fos and SIRT1.
Fig. 8. Effects of TgERK on downstream genes. Hemocytes were extracted from three individual healthy T. granosa in each group. (A) Results of the efficiency experiment for TgERK knockdown in T. granosa analyzed by qRT-PCR, with 18S rDNA used as an internal control. Effects of TgERK on downstream genes. (B) Results of the efficiency experiment for TgERK knockdown in T. granosa analyzed by Western blotting, with α-tubulin used as an internal control. (C) Gray values of dsGFP and dsERK bands obtained using ImageJ software. The expression of the downstream genes CREB, c-Fos and SIRT1 assessed by qRT-PCR after dsRNA (D), LPS (E) or V. alginolyticus (F) was injected into T. granosa. Data were analyzed by a t-test. Error bars represent the mean of three independent biological replicates (* p<0.05, ** p<0.01).
3.6. Cell viability inhibition T. granosa hemocyte viability was measured when cells were exposed to various concentrations of U0126 (0-100 μM) for 24 h. As shown in Fig. 9, compared to control treatment with DMSO, U0126 inhibited T. granosa hemocyte viability by 12.9%, 35.4% and 51.4% at the concentrations of 20 µM, 40 µM and 100 µM, respectively. This indicated that the cell viability of U0126-treated hemocytes decreased in a dosedependent manner. 17/26
Journal Pre-proof
Fig. 9. Effect of U0126 on the cell viability of T. granosa hemocytes. Hemocytes were treated with U0126 at various concentrations (20, 40 or 100 μM) for 24 h, with DMSO used as a control. Then, a CCK-8 assay was performed to measure cell viability. Data were analyzed by one-way ANOVA. Error bars represent the mean of three independent biological replicates (** p<0.01, *** p<0.001).
4. Discussion The ERK signaling cascade is crucial in proliferation, differentiation, survival, and memory formation. There is no consensus on whether ERK1 and ERK2 are different or redundant in specific functional roles (Buscà et al., 2016). They both are ubiquitously expressed and provide ERK activity (Renaud et al., 2009). There is only an overall difference of 17% in the amino acid sequences of ERK1 and ERK2, and the patterns of subcellular localization, regulation and substrate phosphorylation are very similar (Chuderland and Seger, 2005). The functional domains of ERK1 and ERK2 are conserved (Buscà et al., 2015). One obvious difference between them is that the ERK2 protein is significantly larger than the ERK1 protein (sizes calculated from the corresponding ORF sequences) in mammals (Buscà et al., 2016). Moreover, ERK2 has higher expression than ERK1 in most cell lines and tissues of mice (Frémin et al., 2015). There is a hypothesis that this higher expression, not a functional difference, is the only 18/26
Journal Pre-proof reason for the apparently dominant role of ERK2 (Buscà et al., 2015). Knocking down ERK2 expression in mice results in embryonic lethality, which suggests that ERK2 is crucial for embryonic development (Saba-El-Leil et al., 2003). Mice lacking ERK1 are both viable and fertile, but they have defective thymocyte maturation (Pag et al., 1999). Compared with that of normal thymocytes, the proliferation of thymocytes in ERK1null mice is decreased by 60-70%. Therefore, ERK-2 cannot completely compensate for ERK1-mediated functions (Yao et al., 2003). On the other hand, overexpression of ERK1 can completely rescue ERK2-deficient mice (Frémin et al., 2015).
In our study, we cloned and characterized TgERK in T. granosa and found that T. granosa had only one ERK homolog, which was similar to the results of a study of Drosophila melanogaster. In Drosophila melanogaster, this homolog is named rolled (gene) or Rolled (protein) and is involved in several important cellular activities (Kimihiko et al., 2006). Only one kind of ERK has been reported in all invertebrates to date. After vertebrates evolved from invertebrates, two kinds of ERK emerged in all teleost fishes. Most amphibians, reptiles and all mammals that evolved after teleosts have at least two kinds of ERK, which is likely caused by vertebrate-specific wholegenome duplication (WGD) (Buscà et al., 2016). However, cartilaginous fishes and birds have only one ERK, which is more homologous to ERK2 than to ERK1 (Buscà et al., 2015). A possible reason is that after a round of WGD, if there are no new functions shown among paralogs, gene duplicates are generally lost during evolution. ERK2 retains ancestral and core ERK functions; therefore, its expression is strongly required and much higher than that of ERK1. The phylogenetic tree (Fig. 3) revealed that TgERK was a member of MAPK1 (ERK2), and functional study of TgERK was essential for understanding how the ancient ERK pathway works.
TgERK was mainly distributed in the cytoplasm (Fig. 4), which resembled the distribution of ERK in mammals, indicating that extracellular signals can be transmitted to the nucleus by TgERK, causing changes in gene expression, and involved in 19/26
Journal Pre-proof physiological processes such as cell growth and differentiation. The SMART search predicted that TgERK contained an S_TKc domain (residues 21-309) in the N terminus. We also found a
181Thr-Glu-183Tyr
(TEY) motif in TgERK, which is the most basic
feature of ERK distinguishing it from other MAPKs, revealing that TgERK is a functional homolog of known ERKs. The mRNA expression of TgERK was universal in all examined tissues with high expression in hemocytes and the gill (Fig. 5), suggesting that TgERK may be involved in immune regulation.
A previous study showed that when bivalve mollusks were infected with pathogens, the hemocytes acted as important immune cells that eliminated the pathogen directly (Aton et al., 2006). There are several different types of immune cells in hemocytes, and they are crucial in the innate immune response (Sansonetti, 2001). Therefore, for both in vivo and in vitro experiments, we chose hemocytes to study the role of TgERK in innate immunity. We detected the relative mRNA levels of TgERK when clams were injected with LPS or V. alginolyticus in an in vivo experiment (Figs. 6A and B). Both LPS and V. alginolyticus stimulation upregulated TgERK expression, which indicates that TgERK is vital in the immune response of T. granosa. In an in vitro experiment (Fig. 7A and B), the expression of the TgERK protein was upregulated after stimulation with LPS or V. alginolyticus, which confirms that TgERK is important in host defense against bacteria in T. granosa. A report showed that in snail hemocytes, an ERK inhibitor could remarkably inhibit hemocyte phagocytosis, aggregation and spreading (Zelck et al., 2007). In addition, ERK repairs lysosomal damage. Lysosomes are involved in the phagocytosis of hemocytes in shellfish and are also involved in humoral immunity by secreting hydrolase into the extracellular space (Lowe D M, 1995). Therefore, when T. granosa is infected with pathogens, TgERK is activated and possibly enhances the phagocytic and antibacterial activities of hemocytes to improve their immune response to the pathogens, which is important for the elimination of the pathogens.
20/26
Journal Pre-proof To further explore the molecular mechanism of TgERK under pathogen stimulation, we knocked down TgERK expression in T. granosa and investigated three genes downstream of ERK that have important functions in innate immunity, CREB, c-Fos and SIRT1. In macrophages, the antiapoptotic survival signal is promoted by CREB. As a result, the host immune response is enhanced (Wen et al., 2010). C-Fos is an important factor that mediates cAMP immunosuppression by inducing cytokines (such as IL-1b and IL-2) to participate in immune activation. A particular immune disorder can be modulated by c-Fos (Yoshida et al., 2012). SIRT1 is a crucial immune regulator that regulates immune cell responses (Yang et al., 2015). Inhibiting ERK can downregulate the expression of these genes in mammals (Davis et al., 2000; Sun et al., 2015; You et al., 2016). In our study, the expression of CREB, c-Fos and SIRT1 was downregulated by dsTgERK (Fig. 8D), which is consistent with studies in mammals. Moreover, the expression of these downstream genes was upregulated after exposure to LPS or V. alginolyticus (Figs. 8E and F). Knocking down TgERK expression resulted in inhibition of the activity of the above transcription factors, thereby inhibiting the transcription of the corresponding target genes and affecting the transmission of ERK signals to the nucleus, ultimately inhibiting cell proliferation and differentiation. Therefore, we used a CCK8 assay to detect cell viability, and the results (Fig. 9) clearly showed that U0126 could inhibit T. granosa hemocyte viability. Therefore, a better understanding of the immune mechanism of TgERK could provide a new means for investigating the immune response. In addition, it is well known that ERK is associated with cancer. CREB, c-Fos and SIRT1, as downstream genes of ERK, are also involved in the development of cancer, affecting the signal transduction pathway, and dsTgERK can reduce the expression of these genes, thereby achieving the purpose of treating diseases.
In conclusion, our study reveals that TgERK is an important regulator involved in the innate immune response in T. granosa. In future research, we will focus on the
21/26
Journal Pre-proof molecular mechanism underlying cell proliferation and apoptosis that involves the TgERK signaling pathway.
Conflict of interests The authors declare that they have no competing interests.
Acknowledgement This work was supported by COMRA (DY135-B2-08, DY135-E2-1-03); the Scientific Research Foundation of the Third Institute of Oceanography, Ministry of Natural Resources (2017005, 2018016); the Beihai Pilot City Program for the National Innovative Development of the Marine Economy (BHSFS002); National Natural Science Foundation of China (41606160); Excellent Youth Foundation of Fujian Scientific Committee (F180304); and Xiamen Ocean Development Institute Founding (K170302).
Credit Author Statement Mingliang Chen: Conceptualization, Funding acquisition, Methodology, Writing original draft, and Writing - review & editing. Minghan Yang: Data curation, Investigation, Formal analysis, and Writing-original draft. Guosheng Liu: Formal analysis, Investigation, Resources, and Validation. Chunyan Yang: Project administration and Writing - review & editing. Zengpeng Li: Conceptualization, Project administration, and Writing - review & editing.
References Ahne, W., 1971. Invertebrate Immunology. Science. 172, 1122-1122. https://doi.org/10.1007/978-3-642-79735-4. Aton, E., Renault, T., Gagnaire, B., Thomas-Guyon, H., Cognard, C., Imbert, N., 2006. A flow cytometric approach to study intracellular-free Ca in Crassostrea gigas haemocytes. Fish Shellfish Immunol. 20, 493-502. https://doi.org/10.1016/j.fsi.2005.06.008. 22/26
Journal Pre-proof Bachere, E., Gueguen, Y.M., De, L.J., Garnier, J., Romestand, B., 2010. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunological Reviews. 198, 149-168. https://doi.org/10.1111/j.0105-2896.2004.00115.x. Buscà, R., Christen, R., Lovern, M., Clifford, A.M., Yue, J.X., Goss, G.G., Pouysségur, J., Lenormand, P., 2015. ERK1 and ERK2 present functional redundancy in tetrapods despite higher evolution rate of ERK1. Bmc Evolutionary Biology. 15, 179. https://doi.org/10.1186/s12862-015-0450-x. Buscà, R., Pouysségur, J., Lenormand, P., 2016. ERK1 and ERK2 Map Kinases: Specific Roles or Functional Redundancy? Frontiers in Cell & Developmental Biology. 4, 53. https://doi.org/10.3389/fcell.2016.00053. Carla, Z., Francesco, M., Francesca, M., Gianluigi, F., Veronica, F., Marilena, G., Giorgio, T.P., Massimiliano, G., 2017. Microbial Diseases of Bivalve Mollusks: Infections, Immunology and Antimicrobial Defense. Marine Drugs. 15, 182. https://doi.org/10.3390/md15060182. Chen, R.H., Sarnecki, C., Blenis, J., 1992. Nuclear localization and regulation of erkand rsk-encoded protein kinases. Molecular & Cellular Biology. 12, 915-927. https://doi.org/10.1128/MCB.12.3.915. Chuderland, D., Seger, R., 2005. Protein-protein interactions in the regulation of the extracellular signal-regulated kinase. Molecular Biotechnology. 29, 57. https://doi.org/10.1385/mb:29:1:57. Davis, S., Vanhoutte, P., Pages, C., Caboche, J., Laroche, S., 2000. The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience. 20, 4563-4572. https://doi.org/10.1523/jneurosci.20-12-04563.2000. Fearon, D.T., Locksley, R.M., 1996. The instructive role of innate immunity in the acquired immune response. Science. 272, 50-53. https://doi.org/10.1126/science.272.5258.50. Frémin, C., Saba-El-Leil, M., Lévesque, K., Ang, S.L., Meloche, S., 2015. Functional Redundancy of ERK1 and ERK2 MAP Kinases during Development. Cell Reports. 12, 913-921. https://doi.org/10.1016/j.celrep.2015.07.011. Fungesmith, S., Briggs, M., Miao, W., 2012. Regional overview of fisheries and aquaculture in Asia and the Pacific 2012. Food and Agriculture Organization of the United Nations, Regional Office for Asia and the Pacific, RAP Publication 26, Bangkok, Thailand. Guha, M., Mackman, N., 2001. LPS induction of gene expression in human monocytes. Cellular Signalling. 13, 85-94. https://doi.org/10.1016/j.cellsig.2017.07.019. Hommes, D.W., Peppelenbosch, M.P., Deventer, S.J.H., Van, 2003. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut. 52, 144-151. https://doi.org/10.1136/gut.52.1.144. Houpu, L., Suxia, Y., Dann, S.M., Hongwei, Q., Elson, C.O., Yingzi, C., 2013. ERK differentially regulates Th17- and Treg-cell development and contributes to the pathogenesis of colitis. European Journal of Immunology. 43, 1716-1726. 23/26
Journal Pre-proof https://doi.org/10.1002/eji.201242889. Kimihiko, O., Konstantin, G., Srinivasan, K., Kenichi, K., In-Kyong, K., Huiwen, Y., Ursula, W., Perkins, L.A., Marco, T., Marek, M., 2006. Transgenic Drosophila models of Noonan syndrome causing PTPN11 gain-of-function mutations. Human Molecular Genetics. 15, 543-553. https://doi.org/10.1093/hmg/ddi471. Lewis, T.S., Shapiro, P.S., Ahn, N.G., 1998. Signal Transduction through MAP Kinase Cascades. Advances in Cancer Research. 74, 49-139. https://doi.org/10.1016/S0065-230X(08)60765-4. Liu, G., Chen, M., Yu, C., Wang, W., Yang, L., Li, Z., Wang, W., Chen, J., 2017. Molecular cloning. characterization and functional analysis of a putative mitogenactivated protein kinase kinase kinase 4 (MEKK4) from blood clam Tegillarca granosa. Fish & Shellfish Immunology. 66, 372-381. https://doi.org/10.1016/j.fsi.2017.05.012. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408. https://doi.org/10.1006/meth.2001. Lowe D M, F.V.U., Depledge M H, 1995. Contaminant-induced lysosomal membrane damage in blood cells of mussels Mytilus galloprovincialis from the Venice Lagoon: an in vitro study. Marine Ecology Progress Series. 129, 189-196. https://doi.org/10.3354/meps129189. Lu, Y.C., Yeh, W.-C., Ohashi, P.S., 2008. LPS/TLR4 signal transduction pathway. Cytokine. 42, 0-151. https://doi.org/10.1016/j.cyto.2008.01.006. Mori, T., Wang, X., Jung, J.-C., Sumii, T., Singhal, A.B., Fini, M.E., Dixon, C.E., Alessandrini, A., Lo, E.H., 2002. Mitogen-activated protein kinase inhibition in traumatic brain injury: in vitro and in vivo effects. Journal of Cerebral Blood Flow & Metabolism. 22, 444-452. https://doi.org/10.1097/00004647-200204000-00008. Nicholas, H.R., Hodgkin, J., 2004. The ERK MAP Kinase Cascade Mediates Tail Swelling and a Protective Response to Rectal Infection in C. elegans. Current Biology. 14, 1256-1261. https://doi.org/10.1016/j.cub.2004.07.022. Pag, egrave, S, G., 1999. Defective Thymocyte Maturation in p44 MAP Kinase (Erk 1) Knockout Mice. Science. 286, 1374-1377. https://doi.org/10.1126/science.286.5443.1374. Renaud, L., Jacques, P., Philippe, L., 2009. Total ERK1/2 activity regulates cell proliferation. Cell Cycle. 8, 705-711. https://doi.org/10.4161/cc.8.5.7734. Ripabelli, G., Sammarco, M.L., Grasso, G.M., Fanelli, I., Caprioli, A., Luzzi, I., 1999. Occurrence of Vibrio and other pathogenic bacteria in Mytilus galloprovincialis (mussels) harvested from Adriatic Sea, Italy. International Journal of Food Microbiology. 49, 43-48. https://doi.org/10.1016/S0168-1605(99)00056-2. Saba-El-Leil, M.K., Vella, F.B., Voisin, L., Chen, L., Labrecque, N., 2003. An essential function of the mitogen-activated protein kinase Erk2 in mouse trophoblast development. Embo Journal. 4, 964-968. https://doi.org/10.1038/sj.embor.embor939. Sadaaki, I., Bok Luel, L., 2005. Recent advances in the innate immunity of invertebrate animals. Journal of Biochemistry & Molecular Biology. 38, 128-150. 24/26
Journal Pre-proof https://doi.org/10.5483/BMBRep.2005.38.2.128. Saitou, N., Nei, M., 1987. The Neighbor-Joining Method - a New Method for Reconstructing Phylogenetic Trees. Mol Biol Evol. 4, 406-425. https://doi.org/10.1093/oxfordjournals.molbev.a040454. Sansonetti, P., 2001. Phagocytosis of bacterial pathogens: implications in the host response. Seminars in Immunology. 13, 381-390. https://doi.org/10.1006/smim.2001.0335. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple modular architecture research tool: Identification of signaling domains. 95, 5857-5864. https://doi.org/10.1186/gb-2000-1-1-reports234. Sun, Y., Liu, W.Z., Liu, T., Feng, X., Yang, N., Zhou, H.F., 2015. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduct Res. 35, 600-604. https://doi.org/10.3109/10799893.2015.1030412. Teng, S., Lin, X., Fang, J., Chai, X., Xiao, G., 2018. Characterization of 108 novel expressed sequence tag-derived single-nucleotide polymorphism markers in the blood clam Tegillarca granosa using a transcriptome database. Journal of Genetics. 97, 1-11. https://doi.org/10.1007/s12041-018-0884-1. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research. 22. 4673-4680. https://doi.org/10.1093/nar/22.22.4673. Wen, A.Y., Sakamoto, K.M., Miller, L.S., 2010. The role of the transcription factor CREB in immune function. Journal of Immunology. 185, 6413-6419. https://doi.org/10.4049/jimmunol.1001829. Yang, H., Bi, Y., Xue, L., Wang, J., Lu, Y., Zhang, Z., Chen, X., Chu, Y., Yang, R., Wang, R., 2015. Multifaceted Modulation of SIRT1 in Cancer and Inflammation. Critical Reviews in Oncogenesis. 20, 49-64. https://doi.org/10.1615/CritRevOncog.2014012374. Yang, S.-H., Sharrocks, A.D., Whitmarsh, A.J., 2003. Transcriptional regulation by the MAP kinase signaling cascades. Gene. 320, 3-21. https://doi.org/10.1016/s03781119(03)00816-3. Yao, Y., Wei, L., Junwei, W., Germann, U.A., Su, M.S.S., Keisuke, K., Boucher, D.M., 2003. Extracellular signal-regulated kinase 2 is necessary for mesoderm differentiation. Proceedings of the National Academy of Sciences of the United States of America. 100, 12759-12764. https://doi.org/10.1073/pnas.2134254100. Yoshida, R., Suzuki, M., Sakaguchi, R., Hasegawa, E., Kimura, A., Shichita, T., Sekiya, T., Shiraishi, H., Shimoda, K., Yoshimura, A., 2012. Forced expression of stabilized c-Fos in dendritic cells reduces cytokine production and immune responses in vivo. Biochemical & Biophysical Research Communications. 423, 247-252. https://doi.org/10.1016/j.bbrc.2012.05.097. You, L., Ren, X., Du, Y., Zhao, W., Cui, M., Chen, G., Zhao, Y., 2016. c-Fos/ERK promotes the progression from pancreatic intraepithelial neoplasia to pancreatic ductal adenocarcinoma. Oncology reports. 36, 3413-3420. 25/26
Journal Pre-proof https://doi.org/10.3892/or.2016.5169. Zelck, U.E., Gege, B.E., Schmid, S., 2007. Specific inhibitors of mitogen-activated protein kinase and PI3-K pathways impair immune responses by hemocytes of trematode intermediate host snails. Developmental and comparative immunology. 31, 321-331. https://doi.org/10.1016/j.dci.2006.06.006. Zhao, Z., Zhang, L., Ren, C., Zhao, J., Chen, C., Jiang, X., Luo, P., Hu, C.Q., 2011. Autophagy is induced by the type III secretion system of Vibrio alginolyticus in several mammalian cell lines. Archives of Microbiology. 193, 53-61. https://doi.org/10.1007/s00203-010-0646-9.
26/26
Journal Pre-proof Highlights
TgERK is highly conversed with its homologues of other species.
TgERK is universally expressed in various tissues of blood clam.
LPS and Vibrio alginolyticus challenges strongly enhanced the expression of TgERK.
TgERK knockdown resulted in decreased expression of CREB, c-Fos and SIRT1.
Inhibition of ERK decreased T. granosa hemocyte viability.
Minghan Yang, Mingliang Chen, Guosheng Liu, Chunyan Yang, Zengpeng Li PII:
S0145-305X(19)30433-1
DOI:
https://doi.org/10.1016/j.dci.2019.103602
Reference:
DCI 103602
To appear in:
Developmental and Comparative Immunology
Received Date:
09 September 2019
Accepted Date:
27 December 2019
Please cite this article as: Minghan Yang, Mingliang Chen, Guosheng Liu, Chunyan Yang, Zengpeng Li, Molecular cloning and characterization of a cDNA encoding extracellular signalregulated kinase (ERK) from the blood clam Tegillarca granosa, Developmental and Comparative Immunology (2019), https://doi.org/10.1016/j.dci.2019.103602
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Journal Pre-proof Molecular cloning and characterization of a cDNA encoding extracellular signal-regulated kinase (ERK) from the blood clam Tegillarca granosa Minghan Yanga, 1, Mingliang Chena, b, *, 1, Guosheng Liua, Chunyan Yangc, **, Zengpeng Lia, ***
a
State Key Laboratory Breeding Base of Marine Genetic Resources, Third Institute of
Oceanography, Ministry of Natural Resources, Xiamen 361005, P.R. China b
Co-Innovation Center of Jiangsu Marine Bio-industry Technology, Huaihai Institute
of Technology, Lianyungang 222005, P.R. China c
School of Life Science, Xiamen University, Xiamen, 361005, P.R. China
1 These *
authors contributed equally to this work.
Corresponding author: Mingliang Chen
Email address: [email protected] Telephone: +86-592-2195393
** Corresponding
author: Chunyan Yang
Email address: [email protected] Telephone: +86-592-2185695
*** Corresponding
author: Zengpeng Li
Email address: [email protected] Telephone: +86-592-2195518
1/26
Journal Pre-proof Abstract The blood clam Tegillarca granosa is a member of the most economically important bivalve mollusk species in the Asia-Pacific region. T. granosa entirely depends on innate immunity for pathogen defense. However, there are very few reports on the immune responses of T. granosa to various pathogens. In our study, we cloned and characterized an ERK homolog from T. granosa, which was defined as TgERK. The full-length cDNA sequence of TgERK was 1,644 bp in length and encoded a conserved S_TKc domain (residues 21-309) in the N terminus. The TgERK mRNA was universally expressed in all examined tissues, with the highest expression level found in hemocytes. Lipopolysaccharide (LPS) and Vibrio alginolyticus challenges strongly enhanced the expression of ERK in T. granosa, which was consistent with the results of an in vitro challenge study with cultured T. granosa hemocytes. Pathogen invasion also upregulated the expression of downstream genes in the ERK signaling pathway, such as CREB, c-Fos and SIRT1. Moreover, TgERK knockdown resulted in decreased expression of these downstream genes. Inhibition of ERK by its inhibitor U0126 decreased T. granosa hemocyte viability in a dose-dependent manner. Taken together, our results demonstrated that TgERK was a crucial regulator of the immune response to pathogen invasion, which indicated new knowledge of hemocyte immunity in T. granosa and provided a novel key molecule in immune regulation for controlling diseases in T. granosa aquaculture.
Keywords: Tegillarca granosa; Hemocytes; ERK; LPS; Vibrio alginolyticus
2/26
Journal Pre-proof 1. Introduction Blood clams (Tegillarca granosa) are widely distributed in Indo-Pacific tropical and temperate estuaries, and this species is among the most economically important bivalve mollusk species in China and Southeast Asia (Fungesmith et al., 2012). However, the amount of wild T. granosa has been continuously decreasing over the last ten years because of overexploitation and environmental deterioration (Teng et al., 2018). Shellfish-related illness and death are mainly caused by Vibrio infection, and Vibrio alginolyticus is the most common species (Ripabelli et al., 1999). The major component of the Gram-negative bacterial outer membrane is LPS (Guha and Mackman, 2001), which induces the release of key proinflammatory cytokines to activate immune responses (Lu et al., 2008). Marine bivalve mollusks are species that survive in an aquatic environment among many microorganisms, such as bacteria, microalgae, protozoans, fungi and yeast (Bachere et al., 2010). In fact, these organisms, which lead to mortality and Vibrio infection a major impact on commercial aquaculture, limit marine bivalve mollusk culture (Carla et al., 2017).
There are two branches of the immune system, innate immunity and adaptive immunity, that were selected during evolution (Fearon and Locksley, 1996). It is now commonly accepted that the adaptive immune system is lacking in invertebrates, so the innate immune system is essential for invertebrate survival (Sadaaki and Bok Luel, 2005). Innate immunity plays a vital role as a first-line host defense (Ahne, 1971) that can limit infection as early as possible after exposure to infectious pathogens.
The mitogen-activated protein kinase (MAPK) signaling pathways are crucial for regulating gene expression (Yang et al., 2003), which include the JNK, ERK and p38 pathways (Lewis et al., 1998). In the ERK signaling pathway, ERKs act as effector kinases involved in various vital cellular processes. It has been well established in previous studies that ERKs participate in the immune response. For example, the ERK pathway is important to the immune response activated when Caenorhabditis elegans 3/26
Journal Pre-proof is infected by Microbacterium nematophilum (Nicholas and Hodgkin, 2004). ERK participates in T cell development by regulating the development of Th17 and Treg cells (Houpu et al., 2013). MEK inhibitors are useful not only in the response to traumatic injury in the mouse brain (Mori et al., 2002) but also in the inhibition of tumor growth (Hommes et al., 2003). However, there is no report on the function of the ERK pathway in T. granosa. In this study, we found that there was only one ERK homolog in T. granosa, while mammals and most other vertebrates contained at least two ERKs. In vivo and in vitro experiments showed that TgERK expression was upregulated after both LPS exposure and V. alginolyticus infection. Further data indicated that TgERK could regulate the expression of the downstream genes CREB, c-Fos and SIRT1 and inhibit T. granosa hemocyte viability. These results together showed that TgERK was an important molecule in the immune regulation of T. granosa. Understanding the molecular mechanism of the immune system from the perspective of signaling pathway regulation will help the study of the immune mechanism underlying host-pathogen interactions in T. granosa.
2. Materials and methods 2.1. Tegillarca granosa culture and immune challenge Healthy live blood clams, 3.1-3.5 cm long and 8.7-10.3 g in weight, were purchased from a local seafood market. The clams were cultured in seawater at 2627°C for three days and then exposed to LPS or V. alginolyticus for the indicated time points, as described in our previous study (Liu et al., 2017).
2.2. Cloning of TgERK cDNA According to the manufacturer's instructions, total RNA was isolated from T. granosa hemocytes using TRIzol reagent (Ambion, Austin, USA). Then, these RNA samples were reverse transcribed into cDNAs by using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian, China). According to the partial sequence of TgERK found in the transcriptome library, we designed TgERK-5RACE1, TgERK4/26
Journal Pre-proof 5RACE2 and TgERK-3RACE (Table 1) to obtain the missing 5′ and 3′ sequences. The SMART PCR technique was used to obtain the 5′-UTR of TgERK, and the missing 3′terminal sequence was acquired by the 3′-RACE method using the 3′-Full RACE Core Set with PrimeScript™ RTase (Takara). These PCR products were cloned into a pEASY-T1 vector (Transgen, Beijing, China) and confirmed by DNA sequencing. Table 1 Primers used in this study. Primer
Sequence (5′-3′)
For cDNA cloning and ORF cloning TgERK-5′ RACE1
GTCTGTGCACGGAGTATATCTTGA
TgERK-5′ RACE2
CACACATGGTCGTTACTGAGC
TgERK-3′ RACE
GTAGCATTGAAGGACAGGGTGGGGAGT
For protein expression PcDNA3.1-EGFP-TgERK-Fa
GGCGGAGGCGGATCAGGATCCATGGCGAGCAAGTCGAA
PcDNA3.1-EGFP-TgERK-R
CCCTCTAGACTCGAGTCAACGGACAGTACTCCCCA
a
For RNAi dsRNA-TgERK-F
CCCCCTTTGAACATCAGACA
dsRNA-T7-TgERK-R
b
dsRNA- TgERK-R
CCTGGAAACAGTGGTCGATT
dsRNA-T7-TgERK-F
b
dsRNA-GFP-F
CCCTGAAGTTCATCTGCACC
dsRNA-T7-GFP-R
b
dsRNA- GFP-R
GCTTCTCGTTGGGGTCTTT
dsRNA-T7-GFP-F
b
GATCACTAATACGACTCACTATAGGGCCTGGAAACAGTGGTCGATT
GATCACTAATACGACTCACTATAGGGCCCCCTTTGAACATCAGACA
GATCACTAATACGACTCACTATAGGGGCTTCTCGTTGGGGTCTTT
GATCACTAATACGACTCACTATAGGGCCCTGAAGTTCATCTGCACC
For qRT-PCR
a
TgERK-RT-F
ACTTAATGACAAGGCCAGAG
TgERK-RT-R
TGGGATAGTGACTGTTCTAC
TgCREB-RT-F
TGGCAACGTCAGGAACAC
TgCREB-RT-R
TCCACCTTCACTGTCACTGG
Tgc-Fos-RT-F
CAACTCCAAGCCTTACTCCA
Tgc-Fos-RT-R
ATCTTTCGGCTCCATTCG
TgSIRT1-RT-F
CCAGCCACTTGTTCTAAGGTATC
TgSIRT1-RT-R
TGGCAGTAGAGTTTCCCAATC
Tg18S rDNA-RT-F
CTTTCAAATGTCTGCCCTATCAACT
Tg18S rDNA-RT-R
TCCCGTATTGTTATTTTTCGTCACT
The sequences of restriction sites introduced for cloning are underlined.
b The
sequence of the T7 promoter is shown in bold.
2.3. Sequence analysis of TgERK 5/26
Journal Pre-proof The characteristic domain of TgERK was analyzed using the SMART analysis program (http://smart.embl-heidelberg.de/) (Schultz et al., 1998). The sequences of TgERK and its homologs were selected from the NCBI database. Multiple alignments of TgERK were analyzed utilizing the ClustalW program (Thompson et al., 1994). The neighbor-joining (NJ) algorithm was used to construct a phylogenetic tree (Saitou and Nei, 1987).
2.4. Subcellular localization of TgERK The primers pcDNA3.1-EGFP-TgERK-F and pcDNA3.1-EGFP-TgERK-R (Table 1), which contained BamH I and Xho I sites, were designed to subclone TgERKORF into the pcDNA3.1-EGFP vector. To detect whether the TgERK protein was functionally expressed, 2 µg pcDNA3.1-EGFP or pcDNA3.1-EGFP-TgERK were transiently transfected into HEK 293T cells in 60-mm cell culture dishes. At 24 h post transfection, these cells were collected for Western blot analysis by using an anti-EGFP monoclonal antibody (Transgen). To further detect the subcellular expression pattern of TgERK, HEK 293T cells and T. granosa hemocytes were cultured on 20-mm glass-bottom cell culture dishes (NEST, Jiangsu, China) overnight. For the 293T cells, 1 µg pcDNA3.1-EGFP-TgERK was transfected into cells. At 24 h post transfection, the cells were washed with PBS once for 5 min and then incubated with 4% paraformaldehyde for 15 min and 0.2% Triton X-100 for 5 min. For the T. granosa hemocytes, hemocytes were fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.2% Triton X-100 for 5 min. Then, the hemocytes were incubated with 1% BSA for 1 h followed by incubation with an anti-phospho-ERK antibody (1:200 diluted in 1% BSA) (Cell Signaling, MA, USA) overnight. After washing three times, the hemocytes were incubated with a goat antirabbit secondary antibody conjugated with Cy3 (ABclonal, Wuhan, China). Then, both the HEK 293T cells and the T. granosa hemocytes were counterstained with DAPI (Sangon, Shanghai, China) for 5 min and washed three times. Finally, the subcellular 6/26
Journal Pre-proof localization was detected with a LeicaSP2 confocal microscope (Leica, Bannockburn, IL).
2.5. T. granosa hemocyte culture and immune challenge Hemocytes were extracted from three individual healthy T. granosa with a 1-mL sterile syringe and then cultured at 26°C with 4.5% CO2 in RPMI 1640 medium supplemented with 20% FBS. For the LPS-challenged group, 30 µL (1 mg/mL) LPS was added to the T. granosa hemocytes. For the V. alginolyticus-challenged group, V. alginolyticus was cultured overnight at 37°C and then harvested by centrifuging at 4,000 g at 4°C for 2 min. The bacterial pellets were resuspended in RPMI 1640 medium without serum, and then 1 mL bacterial suspensions were added to the T. granosa hemocytes. The MOI of this infection was 100 (Zhao et al., 2011). 2.6. RNAi assay According to the manufacturer's instructions, the dsRNA sequences for TgERK and GFP (dsTgERK and dsGFP) were synthesized with the T7 RiboMAX Express RNAi System (Promega, Madison, WI, USA). The primers used in this experiment are listed in Table 1. In the gene silencing study, the foot muscle of clams was injected with 20 µg dsRNA. At 24 h, these clams were injected with the dsRNA again to improve the RNAi efficiency. The hemocytes from three individuals were collected after another 12 h. Western blotting and qRT-PCR were used for analysis.
2.7. Western blot analysis T. granosa hemocytes collected at the indicated time points were subjected to centrifugation at 3,000 rpm for 2 min, and then 40 µL RIPA with PMSF (1:100) was added to the pellets. Then, the cell lysates were placed on ice for approximately 30 min, after which time the supernatants were collected using centrifugation at 10,000 rpm and 4°C for approximately 5 min. The supernatants were mixed with loading buffer and subjected to 12% SDS-PAGE, and then the proteins were transferred to 0.45-µm PVDF 7/26
Journal Pre-proof membranes. For blocking, the membranes were incubated with 5% BSA for approximately 90 min and then with anti-p44/42 ERK1/2, anti-phospho-ERK (Cell Signaling), and anti-α-tubulin (1:5000) (ABclonal, Wuhan, China) antibodies separately overnight, after which 20-mm glass-bottom cell culture dishes TBST was used to wash the membranes three times. Subsequently, the membranes were incubated with the corresponding secondary antibody for approximately 60 min at room temperature and then washed again. Signals were detected through an ECL chemiluminescence (Beyotime, Nantong, China) reaction. Each experiment was repeated three times.
2.8. Quantitative real-time PCR analysis To analyze the distribution of the TgERK mRNA transcript in different tissues, the hemocytes, the gill, the foot, the mantle, the adductor muscle and the visceral mass were collected from three individual T. granosa. For analysis of the expression patterns post stimulation, hemocytes were collected from three individual T. granosa that were challenged in the foot muscle with 40 µL LPS (0.1 mg/mL) or 20 µL V. alginolyticus suspended in PBS (2×108 CFU/mL) (Liu et al., 2017). To analyze the expression of the genes CREB, c-Fos and SIRT1, which are downstream of ERK, hemocytes were collected from three individual T. granosa that were injected with dsRNA. To minimize individual variation among clams, the tissues from three clams were pooled to compose a sample. Total RNA was obtained using the aforementioned method, and first-strand cDNA was synthesized. We chose SYBR® Premix Ex Taq™ reagent and a Quantagene q225 instrument (Kubotechnology, Beijing, China) to perform qRT-PCR. All primers used are shown in Table 1. The 18S rDNA gene was used for internal standardization. The total volume of the qRT-PCR reagent was 10 µL with 2 µL diluted first-strand cDNA, and the ratio of cDNA to reagent was 1:10. The reaction program was as follows: 95°C for 30 s; 40 cycles of 95°C for 10 s, 49°C for 15 s, and then 72°C for 15 s. Relative mRNA levels were calculated by the 2-ΔΔCt method (Livak and Schmittgen, 2001). Each experiment was repeated three times. 8/26
Journal Pre-proof
2.9. Cell counting kit-8 (CCK8) assay T. granosa hemocytes (2×103 cells per well in 100 μL RPMI 1640 medium) were plated in 96-well plates (three wells per group) and treated with the ERK inhibitor U0126 (MedChemExpress, NJ, USA) at various concentrations (0, 20, 40 and 100 μM) for 24 h, with DMSO used as a control. Then, the hemocytes were treated with 5 µL (1 mg/mL) LPS (Sigma, MO, USA) for 10 h. 10 μL CCK8 (Transgen) was added to each well for 2 h of incubation. The optical density (OD) was measured using a SpectraMax M5 (CA, USA) at 450 nm. Each experiment was repeated three times.
3. Results 3.1. cDNA cloning and sequence analysis of TgERK The cDNA sequence of TgERK was 1,664 bp long, the 5′-untranslated region (UTR) was 13 bp long, and the 3'-UTR was 571 bp long, which contained a typical AATAAA polyadenylation signal and poly A tail. The coding sequence of TgERK encoded a 359-aa protein with an S_TKc domain (residues 21-309) in the N terminus and a TEY motif that was significant for the MAPK pathway, and the calculated molecular mass was 41.44 kDa (Fig. 1). Multiple sequence alignments also revealed that the ERK subfamily was highly conserved among different species. There were three N-glycosylated sites, 1 conserved ATP binding site, 1 active site, a cAMP- and cGMP-dependent protein kinase phosphorylation site and a nucleotide binding site in TgERK. TgERK had the highest identity (90.34%) with the ERK homolog of Haliotis discus discus (Fig. 2). Phylogenetic analysis indicated that TgERK was closest to the homologs of mollusks such as Aplysia californica, Haliotis discus discus, Mizuhopecten yessoensis and Pinctada fucata (Fig. 3), and there was clear separation between ERK1 (MAPK3) and ERK2 (MAPK1), as observed between invertebrates and vertebrates.
9/26
Journal Pre-proof
Fig. 1. Nucleotide and deduced amino acid sequences of TgERK. Start (ATG) and stop (TGA, asterisk) codons are boxed. The S_TKc domain (residues 21-309) in the N terminus is shaded gray. The conserved TEY motif is indicated by a dotted line. The polyadenylation signal is in bold and underlined. 10/26
Journal Pre-proof
Fig. 2. TgERK and ERK homologs in other species. The red boxes indicate Nglycosylated sites, the green boxes indicate the cAMP- and cGMP-dependent protein kinase phosphorylation sites, the blue box indicates the nucleotide binding sites, the conserved DNA binding site is underlined in black, and the active site is underlined in green. The sequences are as follows: HsMAPK1: Homo sapiens MAPK 1 (NP_620407), 11/26
Journal Pre-proof MmMAPK1: Mus musculus MAPK1 (EDK97435.1), BtMAPK1: Bos taurus MAPK1 (NP_786987.1), GgMAPK1: Gallus gallus MAPK1 (NP_989481.1), DrMAPK1: Danio rerio MAPK1 (AAH65868.1), PvMAPK1-like: Penaeus vannamei MAPK1 (AGS38337.1), SpMAPK: Scylla paramamosain MAPK (ACX32460.1), HddMAPK1: Haliotis discus discus MAPK1 (XP_005108216.1), and AcMAPK1: Aplysia californica MAPK1 (XP_005108216.1).
Fig. 3. Phylogenetic tree of the amino acid sequences of ERK proteins from different species constructed by the neighbor-joining (NJ) algorithm using the MEGA 5.0 program.
3.2. Subcellular location of TgERK To determine whether TgERK is functionally expressed, we transfected the recombinant plasmid pcDNA3.1-EGFP-TgERK into HEK 293T cells. Western blotting 12/26
Journal Pre-proof was performed to confirm the expression of TgERK, and the results showed a band at approximately 70 kDa, which was in accordance with the predicted molecular mass of EGFP-TgERK (Fig. 4A). Humans contain two ERKs, ERKl and ERK2, which are mainly located in the cytoplasm (Chen et al., 1992). We further studied the subcellular localization of the TgERK protein in HEK 293T cells and T. granosa hemocytes by confocal microscopy. Our results showed that TgERK-EGFP was mainly aggregated in the cytoplasm (Fig. 4B). Consistently, the majority of the endogenous TgERK protein was also found in the cytoplasm of T. granosa hemocytes (Fig. 4C).
Fig. 4. Expression analysis of TgERK and its subcellular localization. (A) Overexpression of TgERK was confirmed by Western blotting. HEK 293T cells were transfected with the plasmid pcDNA3.1-EGFP or pcDNA3.1-EGFP-TgERK. Cells were harvested and resolved by 12% SDS-PAGE, and the fusion protein was analyzed 13/26
Journal Pre-proof by Western blotting. (B) Subcellular localization of TgERK in HEK 293T cells. Cells were observed at 24 h post transfection by confocal microscopy (scale bar = 5 μm). (C) Immunofluorescence analysis of the localization of TgERK in T. granosa hemocytes (scale bar = 1 μm).
3.3. Tissue distribution of TgERK We further performed qRT-PCR to detect the expression levels of TgERK in different tissues of T. granosa. The results revealed that TgERK mRNA was universally expressed in all examined tissues. The highest expression level was found in hemocytes, followed by the gill, which was reasonable since hemocytes and the gill are two major immune tissues responsible for pathogen defense in T. granosa. TgERK expression in the foot was slightly higher than that in the mantle, visceral mass and adductor muscle (Fig. 5).
Fig. 5. TgERK expression in different tissues of T. granosa, with the 18S rDNA gene acting as an internal standard. Different tissues including hemocytes (H), the gill (G), the foot (F), the mantle (M), the adductor muscle (A) and the visceral mass (V) were harvested from three individual T. granosa samples. The TgERK expression level in the mantle was used as the basal level. Data were analyzed by one-way ANOVA. Error bars represent the mean of three independent biological replicates. (* p < 0.05, *** p < 14/26
Journal Pre-proof 0.001).
3.4. TgERK was activated after stimulation To investigate the mRNA expression level of TgERK after pathogen challenge, T. granosa was treated with LPS or V. alginolyticus, and hemocytes were collected at different time points for qRT-PCR analysis. After LPS treatment, TgERK expression was slightly upregulated at 3 h and reached its highest level at 6 h, with a peak at a 2.39fold increase compared with the control (Fig. 6A). Similarly, the transcriptional level of TgERK in the V. alginolyticus group reached a maximum value (approximately 1.96fold increase) at 3 h post infection (Fig. 6B). These results indicated that TgERK quickly responded to pathogen invasion.
Fig. 6. mRNA expression of TgERK after challenge with LPS or V. alginolyticus in three individual T. granosa, with the 18S rDNA gene acting as an internal standard. (A) TgERK expression in hemocytes at different points post LPS challenge. (B) TgERK expression in hemocytes at different points post V. alginolyticus challenge. Data were analyzed by one-way ANOVA. Error bars represent the mean of three independent biological replicates (* p<0.05, ** p<0.01).
Western blotting was further employed to detect the protein level of TgERK after stimulation. Hemocytes collected from T. granosa were exposed to LPS or V. alginolyticus. Then, we detected changes in phosphorylated ERK levels. The results 15/26
Journal Pre-proof showed that the phosphorylated ERK level was significantly upregulated by 1.5-fold in the LPS-treated group and by 2.8-fold in the V. alginolyticus-treated group compared with the control group after 0.5 h of stimulation (Figs. 7A and 7B).
Fig. 7. Western blot analysis of the protein expression of TgERK in hemocytes (three individual healthy T. granosa in each group) under LPS or V. alginolyticus stimulation. (A) TgERK expression and phosphorylation after LPS exposure. (B) TgERK expression and phosphorylation after V. alginolyticus infection. Each experiment was repeated three times.
3.5. Effects of dsTgERK on downstream MAPK pathways in T. granosa CREB, c-Fos, and SIRT1 are common downstream genes in the ERK signaling pathway (Davis et al., 2000; Sun et al., 2015; You et al., 2016). To study whether TgERK regulates these downstream genes in T. granosa, we used RNAi to silence the TgERK gene. T. granosa were injected with dsTgERK, and dsGFP was used as a control. The efficiency of dsTgERK was tested using Western blotting and qRT-PCR. These two datasets both showed that the expression level of TgERK was significantly repressed in dsTgERK-treated T. granosa with an efficiency of approximately 77% at the mRNA level and 54% at the protein level compared with control T. granosa (Figs. 8A and B). At the same time, the transcriptional levels of CREB, c-Fos and SIRT1 were decreased by 3.87-, 10.64- and 5.48-fold in the dsTgERK-treated T. granosa compared with the control T. granosa (Fig. 8D). We also investigated the expression levels of these genes after clams were exposed to LPS for 6 h or V. alginolyticus for 3 h (Figs. 8E and F). The levels of CREB, c-Fos and SIRT1 were all upregulated at least 2.7-fold. 16/26
Journal Pre-proof Thus, the results clearly showed that TgERK could regulate the downstream genes CREB, c-Fos and SIRT1.
Fig. 8. Effects of TgERK on downstream genes. Hemocytes were extracted from three individual healthy T. granosa in each group. (A) Results of the efficiency experiment for TgERK knockdown in T. granosa analyzed by qRT-PCR, with 18S rDNA used as an internal control. Effects of TgERK on downstream genes. (B) Results of the efficiency experiment for TgERK knockdown in T. granosa analyzed by Western blotting, with α-tubulin used as an internal control. (C) Gray values of dsGFP and dsERK bands obtained using ImageJ software. The expression of the downstream genes CREB, c-Fos and SIRT1 assessed by qRT-PCR after dsRNA (D), LPS (E) or V. alginolyticus (F) was injected into T. granosa. Data were analyzed by a t-test. Error bars represent the mean of three independent biological replicates (* p<0.05, ** p<0.01).
3.6. Cell viability inhibition T. granosa hemocyte viability was measured when cells were exposed to various concentrations of U0126 (0-100 μM) for 24 h. As shown in Fig. 9, compared to control treatment with DMSO, U0126 inhibited T. granosa hemocyte viability by 12.9%, 35.4% and 51.4% at the concentrations of 20 µM, 40 µM and 100 µM, respectively. This indicated that the cell viability of U0126-treated hemocytes decreased in a dosedependent manner. 17/26
Journal Pre-proof
Fig. 9. Effect of U0126 on the cell viability of T. granosa hemocytes. Hemocytes were treated with U0126 at various concentrations (20, 40 or 100 μM) for 24 h, with DMSO used as a control. Then, a CCK-8 assay was performed to measure cell viability. Data were analyzed by one-way ANOVA. Error bars represent the mean of three independent biological replicates (** p<0.01, *** p<0.001).
4. Discussion The ERK signaling cascade is crucial in proliferation, differentiation, survival, and memory formation. There is no consensus on whether ERK1 and ERK2 are different or redundant in specific functional roles (Buscà et al., 2016). They both are ubiquitously expressed and provide ERK activity (Renaud et al., 2009). There is only an overall difference of 17% in the amino acid sequences of ERK1 and ERK2, and the patterns of subcellular localization, regulation and substrate phosphorylation are very similar (Chuderland and Seger, 2005). The functional domains of ERK1 and ERK2 are conserved (Buscà et al., 2015). One obvious difference between them is that the ERK2 protein is significantly larger than the ERK1 protein (sizes calculated from the corresponding ORF sequences) in mammals (Buscà et al., 2016). Moreover, ERK2 has higher expression than ERK1 in most cell lines and tissues of mice (Frémin et al., 2015). There is a hypothesis that this higher expression, not a functional difference, is the only 18/26
Journal Pre-proof reason for the apparently dominant role of ERK2 (Buscà et al., 2015). Knocking down ERK2 expression in mice results in embryonic lethality, which suggests that ERK2 is crucial for embryonic development (Saba-El-Leil et al., 2003). Mice lacking ERK1 are both viable and fertile, but they have defective thymocyte maturation (Pag et al., 1999). Compared with that of normal thymocytes, the proliferation of thymocytes in ERK1null mice is decreased by 60-70%. Therefore, ERK-2 cannot completely compensate for ERK1-mediated functions (Yao et al., 2003). On the other hand, overexpression of ERK1 can completely rescue ERK2-deficient mice (Frémin et al., 2015).
In our study, we cloned and characterized TgERK in T. granosa and found that T. granosa had only one ERK homolog, which was similar to the results of a study of Drosophila melanogaster. In Drosophila melanogaster, this homolog is named rolled (gene) or Rolled (protein) and is involved in several important cellular activities (Kimihiko et al., 2006). Only one kind of ERK has been reported in all invertebrates to date. After vertebrates evolved from invertebrates, two kinds of ERK emerged in all teleost fishes. Most amphibians, reptiles and all mammals that evolved after teleosts have at least two kinds of ERK, which is likely caused by vertebrate-specific wholegenome duplication (WGD) (Buscà et al., 2016). However, cartilaginous fishes and birds have only one ERK, which is more homologous to ERK2 than to ERK1 (Buscà et al., 2015). A possible reason is that after a round of WGD, if there are no new functions shown among paralogs, gene duplicates are generally lost during evolution. ERK2 retains ancestral and core ERK functions; therefore, its expression is strongly required and much higher than that of ERK1. The phylogenetic tree (Fig. 3) revealed that TgERK was a member of MAPK1 (ERK2), and functional study of TgERK was essential for understanding how the ancient ERK pathway works.
TgERK was mainly distributed in the cytoplasm (Fig. 4), which resembled the distribution of ERK in mammals, indicating that extracellular signals can be transmitted to the nucleus by TgERK, causing changes in gene expression, and involved in 19/26
Journal Pre-proof physiological processes such as cell growth and differentiation. The SMART search predicted that TgERK contained an S_TKc domain (residues 21-309) in the N terminus. We also found a
181Thr-Glu-183Tyr
(TEY) motif in TgERK, which is the most basic
feature of ERK distinguishing it from other MAPKs, revealing that TgERK is a functional homolog of known ERKs. The mRNA expression of TgERK was universal in all examined tissues with high expression in hemocytes and the gill (Fig. 5), suggesting that TgERK may be involved in immune regulation.
A previous study showed that when bivalve mollusks were infected with pathogens, the hemocytes acted as important immune cells that eliminated the pathogen directly (Aton et al., 2006). There are several different types of immune cells in hemocytes, and they are crucial in the innate immune response (Sansonetti, 2001). Therefore, for both in vivo and in vitro experiments, we chose hemocytes to study the role of TgERK in innate immunity. We detected the relative mRNA levels of TgERK when clams were injected with LPS or V. alginolyticus in an in vivo experiment (Figs. 6A and B). Both LPS and V. alginolyticus stimulation upregulated TgERK expression, which indicates that TgERK is vital in the immune response of T. granosa. In an in vitro experiment (Fig. 7A and B), the expression of the TgERK protein was upregulated after stimulation with LPS or V. alginolyticus, which confirms that TgERK is important in host defense against bacteria in T. granosa. A report showed that in snail hemocytes, an ERK inhibitor could remarkably inhibit hemocyte phagocytosis, aggregation and spreading (Zelck et al., 2007). In addition, ERK repairs lysosomal damage. Lysosomes are involved in the phagocytosis of hemocytes in shellfish and are also involved in humoral immunity by secreting hydrolase into the extracellular space (Lowe D M, 1995). Therefore, when T. granosa is infected with pathogens, TgERK is activated and possibly enhances the phagocytic and antibacterial activities of hemocytes to improve their immune response to the pathogens, which is important for the elimination of the pathogens.
20/26
Journal Pre-proof To further explore the molecular mechanism of TgERK under pathogen stimulation, we knocked down TgERK expression in T. granosa and investigated three genes downstream of ERK that have important functions in innate immunity, CREB, c-Fos and SIRT1. In macrophages, the antiapoptotic survival signal is promoted by CREB. As a result, the host immune response is enhanced (Wen et al., 2010). C-Fos is an important factor that mediates cAMP immunosuppression by inducing cytokines (such as IL-1b and IL-2) to participate in immune activation. A particular immune disorder can be modulated by c-Fos (Yoshida et al., 2012). SIRT1 is a crucial immune regulator that regulates immune cell responses (Yang et al., 2015). Inhibiting ERK can downregulate the expression of these genes in mammals (Davis et al., 2000; Sun et al., 2015; You et al., 2016). In our study, the expression of CREB, c-Fos and SIRT1 was downregulated by dsTgERK (Fig. 8D), which is consistent with studies in mammals. Moreover, the expression of these downstream genes was upregulated after exposure to LPS or V. alginolyticus (Figs. 8E and F). Knocking down TgERK expression resulted in inhibition of the activity of the above transcription factors, thereby inhibiting the transcription of the corresponding target genes and affecting the transmission of ERK signals to the nucleus, ultimately inhibiting cell proliferation and differentiation. Therefore, we used a CCK8 assay to detect cell viability, and the results (Fig. 9) clearly showed that U0126 could inhibit T. granosa hemocyte viability. Therefore, a better understanding of the immune mechanism of TgERK could provide a new means for investigating the immune response. In addition, it is well known that ERK is associated with cancer. CREB, c-Fos and SIRT1, as downstream genes of ERK, are also involved in the development of cancer, affecting the signal transduction pathway, and dsTgERK can reduce the expression of these genes, thereby achieving the purpose of treating diseases.
In conclusion, our study reveals that TgERK is an important regulator involved in the innate immune response in T. granosa. In future research, we will focus on the
21/26
Journal Pre-proof molecular mechanism underlying cell proliferation and apoptosis that involves the TgERK signaling pathway.
Conflict of interests The authors declare that they have no competing interests.
Acknowledgement This work was supported by COMRA (DY135-B2-08, DY135-E2-1-03); the Scientific Research Foundation of the Third Institute of Oceanography, Ministry of Natural Resources (2017005, 2018016); the Beihai Pilot City Program for the National Innovative Development of the Marine Economy (BHSFS002); National Natural Science Foundation of China (41606160); Excellent Youth Foundation of Fujian Scientific Committee (F180304); and Xiamen Ocean Development Institute Founding (K170302).
Credit Author Statement Mingliang Chen: Conceptualization, Funding acquisition, Methodology, Writing original draft, and Writing - review & editing. Minghan Yang: Data curation, Investigation, Formal analysis, and Writing-original draft. Guosheng Liu: Formal analysis, Investigation, Resources, and Validation. Chunyan Yang: Project administration and Writing - review & editing. Zengpeng Li: Conceptualization, Project administration, and Writing - review & editing.
References Ahne, W., 1971. Invertebrate Immunology. Science. 172, 1122-1122. https://doi.org/10.1007/978-3-642-79735-4. Aton, E., Renault, T., Gagnaire, B., Thomas-Guyon, H., Cognard, C., Imbert, N., 2006. A flow cytometric approach to study intracellular-free Ca in Crassostrea gigas haemocytes. Fish Shellfish Immunol. 20, 493-502. https://doi.org/10.1016/j.fsi.2005.06.008. 22/26
Journal Pre-proof Bachere, E., Gueguen, Y.M., De, L.J., Garnier, J., Romestand, B., 2010. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunological Reviews. 198, 149-168. https://doi.org/10.1111/j.0105-2896.2004.00115.x. Buscà, R., Christen, R., Lovern, M., Clifford, A.M., Yue, J.X., Goss, G.G., Pouysségur, J., Lenormand, P., 2015. ERK1 and ERK2 present functional redundancy in tetrapods despite higher evolution rate of ERK1. Bmc Evolutionary Biology. 15, 179. https://doi.org/10.1186/s12862-015-0450-x. Buscà, R., Pouysségur, J., Lenormand, P., 2016. ERK1 and ERK2 Map Kinases: Specific Roles or Functional Redundancy? Frontiers in Cell & Developmental Biology. 4, 53. https://doi.org/10.3389/fcell.2016.00053. Carla, Z., Francesco, M., Francesca, M., Gianluigi, F., Veronica, F., Marilena, G., Giorgio, T.P., Massimiliano, G., 2017. Microbial Diseases of Bivalve Mollusks: Infections, Immunology and Antimicrobial Defense. Marine Drugs. 15, 182. https://doi.org/10.3390/md15060182. Chen, R.H., Sarnecki, C., Blenis, J., 1992. Nuclear localization and regulation of erkand rsk-encoded protein kinases. Molecular & Cellular Biology. 12, 915-927. https://doi.org/10.1128/MCB.12.3.915. Chuderland, D., Seger, R., 2005. Protein-protein interactions in the regulation of the extracellular signal-regulated kinase. Molecular Biotechnology. 29, 57. https://doi.org/10.1385/mb:29:1:57. Davis, S., Vanhoutte, P., Pages, C., Caboche, J., Laroche, S., 2000. The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience. 20, 4563-4572. https://doi.org/10.1523/jneurosci.20-12-04563.2000. Fearon, D.T., Locksley, R.M., 1996. The instructive role of innate immunity in the acquired immune response. Science. 272, 50-53. https://doi.org/10.1126/science.272.5258.50. Frémin, C., Saba-El-Leil, M., Lévesque, K., Ang, S.L., Meloche, S., 2015. Functional Redundancy of ERK1 and ERK2 MAP Kinases during Development. Cell Reports. 12, 913-921. https://doi.org/10.1016/j.celrep.2015.07.011. Fungesmith, S., Briggs, M., Miao, W., 2012. Regional overview of fisheries and aquaculture in Asia and the Pacific 2012. Food and Agriculture Organization of the United Nations, Regional Office for Asia and the Pacific, RAP Publication 26, Bangkok, Thailand. Guha, M., Mackman, N., 2001. LPS induction of gene expression in human monocytes. Cellular Signalling. 13, 85-94. https://doi.org/10.1016/j.cellsig.2017.07.019. Hommes, D.W., Peppelenbosch, M.P., Deventer, S.J.H., Van, 2003. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut. 52, 144-151. https://doi.org/10.1136/gut.52.1.144. Houpu, L., Suxia, Y., Dann, S.M., Hongwei, Q., Elson, C.O., Yingzi, C., 2013. ERK differentially regulates Th17- and Treg-cell development and contributes to the pathogenesis of colitis. European Journal of Immunology. 43, 1716-1726. 23/26
Journal Pre-proof https://doi.org/10.1002/eji.201242889. Kimihiko, O., Konstantin, G., Srinivasan, K., Kenichi, K., In-Kyong, K., Huiwen, Y., Ursula, W., Perkins, L.A., Marco, T., Marek, M., 2006. Transgenic Drosophila models of Noonan syndrome causing PTPN11 gain-of-function mutations. Human Molecular Genetics. 15, 543-553. https://doi.org/10.1093/hmg/ddi471. Lewis, T.S., Shapiro, P.S., Ahn, N.G., 1998. Signal Transduction through MAP Kinase Cascades. Advances in Cancer Research. 74, 49-139. https://doi.org/10.1016/S0065-230X(08)60765-4. Liu, G., Chen, M., Yu, C., Wang, W., Yang, L., Li, Z., Wang, W., Chen, J., 2017. Molecular cloning. characterization and functional analysis of a putative mitogenactivated protein kinase kinase kinase 4 (MEKK4) from blood clam Tegillarca granosa. Fish & Shellfish Immunology. 66, 372-381. https://doi.org/10.1016/j.fsi.2017.05.012. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408. https://doi.org/10.1006/meth.2001. Lowe D M, F.V.U., Depledge M H, 1995. Contaminant-induced lysosomal membrane damage in blood cells of mussels Mytilus galloprovincialis from the Venice Lagoon: an in vitro study. Marine Ecology Progress Series. 129, 189-196. https://doi.org/10.3354/meps129189. Lu, Y.C., Yeh, W.-C., Ohashi, P.S., 2008. LPS/TLR4 signal transduction pathway. Cytokine. 42, 0-151. https://doi.org/10.1016/j.cyto.2008.01.006. Mori, T., Wang, X., Jung, J.-C., Sumii, T., Singhal, A.B., Fini, M.E., Dixon, C.E., Alessandrini, A., Lo, E.H., 2002. Mitogen-activated protein kinase inhibition in traumatic brain injury: in vitro and in vivo effects. Journal of Cerebral Blood Flow & Metabolism. 22, 444-452. https://doi.org/10.1097/00004647-200204000-00008. Nicholas, H.R., Hodgkin, J., 2004. The ERK MAP Kinase Cascade Mediates Tail Swelling and a Protective Response to Rectal Infection in C. elegans. Current Biology. 14, 1256-1261. https://doi.org/10.1016/j.cub.2004.07.022. Pag, egrave, S, G., 1999. Defective Thymocyte Maturation in p44 MAP Kinase (Erk 1) Knockout Mice. Science. 286, 1374-1377. https://doi.org/10.1126/science.286.5443.1374. Renaud, L., Jacques, P., Philippe, L., 2009. Total ERK1/2 activity regulates cell proliferation. Cell Cycle. 8, 705-711. https://doi.org/10.4161/cc.8.5.7734. Ripabelli, G., Sammarco, M.L., Grasso, G.M., Fanelli, I., Caprioli, A., Luzzi, I., 1999. Occurrence of Vibrio and other pathogenic bacteria in Mytilus galloprovincialis (mussels) harvested from Adriatic Sea, Italy. International Journal of Food Microbiology. 49, 43-48. https://doi.org/10.1016/S0168-1605(99)00056-2. Saba-El-Leil, M.K., Vella, F.B., Voisin, L., Chen, L., Labrecque, N., 2003. An essential function of the mitogen-activated protein kinase Erk2 in mouse trophoblast development. Embo Journal. 4, 964-968. https://doi.org/10.1038/sj.embor.embor939. Sadaaki, I., Bok Luel, L., 2005. Recent advances in the innate immunity of invertebrate animals. Journal of Biochemistry & Molecular Biology. 38, 128-150. 24/26
Journal Pre-proof https://doi.org/10.5483/BMBRep.2005.38.2.128. Saitou, N., Nei, M., 1987. The Neighbor-Joining Method - a New Method for Reconstructing Phylogenetic Trees. Mol Biol Evol. 4, 406-425. https://doi.org/10.1093/oxfordjournals.molbev.a040454. Sansonetti, P., 2001. Phagocytosis of bacterial pathogens: implications in the host response. Seminars in Immunology. 13, 381-390. https://doi.org/10.1006/smim.2001.0335. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple modular architecture research tool: Identification of signaling domains. 95, 5857-5864. https://doi.org/10.1186/gb-2000-1-1-reports234. Sun, Y., Liu, W.Z., Liu, T., Feng, X., Yang, N., Zhou, H.F., 2015. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduct Res. 35, 600-604. https://doi.org/10.3109/10799893.2015.1030412. Teng, S., Lin, X., Fang, J., Chai, X., Xiao, G., 2018. Characterization of 108 novel expressed sequence tag-derived single-nucleotide polymorphism markers in the blood clam Tegillarca granosa using a transcriptome database. Journal of Genetics. 97, 1-11. https://doi.org/10.1007/s12041-018-0884-1. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research. 22. 4673-4680. https://doi.org/10.1093/nar/22.22.4673. Wen, A.Y., Sakamoto, K.M., Miller, L.S., 2010. The role of the transcription factor CREB in immune function. Journal of Immunology. 185, 6413-6419. https://doi.org/10.4049/jimmunol.1001829. Yang, H., Bi, Y., Xue, L., Wang, J., Lu, Y., Zhang, Z., Chen, X., Chu, Y., Yang, R., Wang, R., 2015. Multifaceted Modulation of SIRT1 in Cancer and Inflammation. Critical Reviews in Oncogenesis. 20, 49-64. https://doi.org/10.1615/CritRevOncog.2014012374. Yang, S.-H., Sharrocks, A.D., Whitmarsh, A.J., 2003. Transcriptional regulation by the MAP kinase signaling cascades. Gene. 320, 3-21. https://doi.org/10.1016/s03781119(03)00816-3. Yao, Y., Wei, L., Junwei, W., Germann, U.A., Su, M.S.S., Keisuke, K., Boucher, D.M., 2003. Extracellular signal-regulated kinase 2 is necessary for mesoderm differentiation. Proceedings of the National Academy of Sciences of the United States of America. 100, 12759-12764. https://doi.org/10.1073/pnas.2134254100. Yoshida, R., Suzuki, M., Sakaguchi, R., Hasegawa, E., Kimura, A., Shichita, T., Sekiya, T., Shiraishi, H., Shimoda, K., Yoshimura, A., 2012. Forced expression of stabilized c-Fos in dendritic cells reduces cytokine production and immune responses in vivo. Biochemical & Biophysical Research Communications. 423, 247-252. https://doi.org/10.1016/j.bbrc.2012.05.097. You, L., Ren, X., Du, Y., Zhao, W., Cui, M., Chen, G., Zhao, Y., 2016. c-Fos/ERK promotes the progression from pancreatic intraepithelial neoplasia to pancreatic ductal adenocarcinoma. Oncology reports. 36, 3413-3420. 25/26
Journal Pre-proof https://doi.org/10.3892/or.2016.5169. Zelck, U.E., Gege, B.E., Schmid, S., 2007. Specific inhibitors of mitogen-activated protein kinase and PI3-K pathways impair immune responses by hemocytes of trematode intermediate host snails. Developmental and comparative immunology. 31, 321-331. https://doi.org/10.1016/j.dci.2006.06.006. Zhao, Z., Zhang, L., Ren, C., Zhao, J., Chen, C., Jiang, X., Luo, P., Hu, C.Q., 2011. Autophagy is induced by the type III secretion system of Vibrio alginolyticus in several mammalian cell lines. Archives of Microbiology. 193, 53-61. https://doi.org/10.1007/s00203-010-0646-9.
26/26
Journal Pre-proof Highlights
TgERK is highly conversed with its homologues of other species.
TgERK is universally expressed in various tissues of blood clam.
LPS and Vibrio alginolyticus challenges strongly enhanced the expression of TgERK.
TgERK knockdown resulted in decreased expression of CREB, c-Fos and SIRT1.
Inhibition of ERK decreased T. granosa hemocyte viability.