Molecular cloning and characterization of chicken prostaglandin E receptor subtypes 2 and 4 (EP2 and EP4)

General and Comparative Endocrinology 157 (2008) 99–106

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Molecular cloning and characterization of chicken prostaglandin E receptor subtypes 2 and 4 (EP2 and EP4) Amy Ho Yan Kwok, Yajun Wang, Crystal Ying Wang, Frederick C. Leung * School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China

a r t i c l e

i n f o

Article history: Received 15 August 2007 Revised 20 March 2008 Accepted 1 April 2008 Available online 6 April 2008 Keywords: Chicken Prostaglandin E2 EP2 EP4 cAMP-PKA signaling pathway

a b s t r a c t Prostaglandin E2 (PGE2) is an important chemical mediator responsible for regulation of many vital physiological processes. Four receptor subtypes have been identified to mediate its biological actions. Among these subtypes, prostaglandin E receptor subtypes 2 and 4 (EP2 and EP4), both coupled to cAMP-protein kinase A (cAMP-PKA) signaling pathway, are proposed to play crucial roles under both physiological and pathological conditions. Though both receptors were extensively studied in mammals, little is known about their functionality and expression in non-mammalian species including chicken. In present study, the full-length cDNAs for chicken EP2 and EP4 receptors were first cloned from adult chicken ovary and testis, respectively. Chicken EP2 is 356 amino acids in length and shows high amino acid identity to that of human (61%), mouse (63%), and rat (61%). On the other hand, the full-length cDNA of EP4 gene encodes a precursor of 475 amino acids with a high degree of amino acid identity to that of mammals, including human (87%), mouse (86%), rat (84%), dog (85%), and cattle (83%), and a comparatively lower sequence identity to zebrafish (52%). RT-PCR assays revealed that EP2 mRNA was expressed in all tissues examined including the oviduct, while EP4 expression was detected only in a few tissues. Using the pGL3-CRE-luciferase reporter system, we also demonstrated that PGE2 could induce luciferase activity in DF-1 cells expressing EP2 and EP4 in dose-dependent manners (EC50: <1 nM), confirming that both receptors could be activated by PGE2 and functionally coupled to the cAMP-PKA signaling pathway. Together, our study establishes a molecular basis to understand the physiological roles of PGE2 in target tissues of chicken. Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction Belonging to the eicosanoids, prostaglandin E2 (PGE2) is an important chemical mediator regulating many vital physiological processes in vertebrates, including immune response (Goodwin and Ceuppens, 1983), gastrointestinal function (Dey et al., 2006), water and salt reabsorption (Breyer and Breyer, 2000), vascular homeostasis (McGiff et al., 1976; Vane and McGiff, 1975), bone resorption (Klein and Raisz, 1970), reproduction (Ainsworth et al., 1984; Evans et al., 1983; Labhsetwar, 1971, 1972; Patwardhan and Lanthier, 1981), and avian oviposition (Hertelendy, 1972; Hertelendy et al., 1974; Saito et al., 1987b; Wechsung and Houvenaghel, 1976). Arachidonic acid, a precursor molecule released from membrane phospholipids by phospholipase A2 (PLA2), is bis-oxygenated and reduced into prostaglandin G2 and H2 (PGG2; PGH2) successively by the rate-limiting enzymes, cyclooxygenases (COX; also called prostaglandin-endoperoxide synthases, PTGS) (Smith and Dewitt, 1996). PGE2, formed subsequently from PGH2 by PGE synthase, is then released outside the cell (Smith and Dewitt, 1996). Similar to other prostanoids, PGE2 is rapidly metabolized and thus believed * Corresponding author. Fax: +852 2857 4672. E-mail address: [email protected] (F.C. Leung). 0016-6480/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2008.04.001

to act as an autocrine/paracrine factor in the vicinity of its production site (Ferreira and Vane, 1967). Four receptor subtypes have been identified for PGE2 and they are named prostaglandin E receptor subtypes 1, 2, 3, and 4 (abbreviated as EP1, EP2, EP3 and EP4), respectively. Though they all belong to the G protein-coupled receptor (GPCR) superfamily, they are coupled to different G proteins which activate their own specific second messengers and signal transduction pathways. For instance, EP1 is believed to be coupled to Gq and causes elevation of intracellular Ca2+; EP3 couples to Gi and leads to inhibition of adenylyl cyclase (AC) and decline in intracellular cyclic AMP (cAMP); both EP2 and EP4 couple to Gs and results in AC stimulation and cAMP accumulation (Breyer et al., 2001; Narumiya et al., 1999). Variability has been reported in their ligand binding affinity and selectivity (Abramovitz et al., 2000; Kiriyama et al., 1997), and their susceptibility to receptor internalization and desensitization (Desai et al., 2000; Nishigaki et al., 1996). EP2 and EP4, both capable of activating downstream intracellular cAMP-protein kinase A (cAMP-PKA) signaling pathway, are proposed to be crucial mediators for PGE2 in normal physiological processes, such as closure of ductus arteriosus (Nguyen et al., 1997; Segi et al., 1998), bone resorption (Miyaura et al., 2000; Sakuma et al., 2000), ovulation and fertilization (Hizaki et al., 1999; Kennedy

100

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

et al., 1999), and pathophysiological processes, such as intestinal polyp formation (Sonoshita et al., 2001) and salt sensitive hypertension (Kennedy et al., 1999; Tilley et al., 1999), as revealed by recent knockout mice studies. Though both receptors were identified in mammals (Arosh et al., 2003; Bastien et al., 1994; Boie et al., 1997; Castleberry et al., 2001; Hibbs et al., 1999; Honda et al., 1993; Katsuyama et al., 1995; Regan et al., 1994) and zebrafish (Danio rerio) (Cha et al., 2006), their expression and functionality have not been characterized in other vertebrate species. In the present study, using chicken (Gallus gallus) as an experimental model, we have cloned the full-length cDNAs coding for EP2 and EP4, and the functional study confirmed that PGE2 could activate both receptors with high potencies (EC50: <1 nM). RT-PCR results showed that EP2 is expressed in all tissues and all parts of the oviduct from egg-laying hen examined, while EP4 was only detected in a few tissues. These findings provide invaluable information on elucidating the physiological roles of PGE2 in different chicken tissues, including ovary and oviduct. 2. Materials and methods 2.1. Animal tissues Adult chickens were provided by Kadoorie Agricultural Research Center (Hong Kong). Adult chickens of 25 weeks old were killed and 12 tissues (including brain, pituitary, lung, heart, liver, kidney, intestine, pancreas, breast muscle, spleen, ovary, and testis) and 5 parts of the oviducts (including infundibulum, magnum, isthmus, shell gland, vagina; obtained from egg-laying hen) were collected for total RNA extraction. Whole ovary was used in the present study, though the largest five preovulatory follicles (F5–F1) were removed due to difficulty encountered in RNA extraction. All experiments were performed under license from the Government of the Hong Kong Special Administrative Region and endorsed by the Animal Experimentation Ethics Committee of The University of Hong Kong. 2.2. Cloning the full-length cDNA of chicken prostaglandin E receptor subtypes 2 and 4 (EP2; EP4) Based on the predicted partial cDNA sequences for chicken EP2 and EP4 (GenBank accession Nos: XM_426485 and XM_424770), gene-specific primers were designed to amplify both the 50 and 30 cDNA ends of EP2 or 50 cDNA end of EP4 using SMART RACE kit (Clontech, Palo Alto, CA). The amplified fragments were cloned into pBluescript SK (+/) through T/A cloning (Stratagene, La Jolla, CA) followed by sequencing analysis (PerkinElmer, Foster City, CA). To obtain the full-length cDNAs of EP2 and EP4, new gene-specific primers flanking both start and stop codons were designed (Table 1). The full-length cDNAs for EP2 and EP4 were amplified from adult chicken ovary and testis, respectively using high-fidelity Taq DNA polymerase (Roche diagnostics, Basel, Switzerland). These cDNAs were cloned into pBluescript II SK (+/) (Stratagene). The full-length cDNAs were finally determined by sequencing (PerkinElmer) at least 3 independent clones containing whole open reading frames (ORFs). 2.3. RNA extraction and RT-PCR assay Total RNA was extracted from the 12 different adult tissues and the 5 parts of the oviduct using Tri Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer’s instructions. Reverse transcription was performed at 42 °C for Table 1 Primers useda Gene

Sense/Antisense

Primers for RT-PCR assay ep2 Sense Antisense ep4 Sense Antisense b-actin Sense Antisense

a

2.4. Functional characterization of the cloned cEP2 and cEP4 Based on the cloned cDNA sequences of cEP2 and cEP4, gene-specific primers with flanking restriction enzyme recognition sites were designed to amplify the complete open reading frame (ORF) regions of cEP2 and cEP4 with high-fidelity Taq DNA polymerase (Roche diagnostics) (Table 1). The amplified PCR products were first cloned into pBluescript SK(+/) vector (Stratagene) and subjected to sequencing analysis (PerkinElmer). Then the inserts of interest were released by restriction enzyme digestions and subcloned into pcDNA3.1(+) expression vector (Invitrogen). pGL3-CRE-luciferase reporter construct was constructed by inserting a promoter containing multiple cAMP-response element (CRE), released from the promoter region of pCRE-SEAP vector (Clontech, Palo Alto, CA), upstream of the luciferase reporter gene in the promoterless pGL3-Basic vector (Promega, Madison, WI) (Wang et al., 2007). Chicken DF-1 (Transformed Chicken Embryo Fibroblast Cells) cells were cultured in DMEM supplemented with high glucose, 10% (vol/ vol) fetal bovine serum (HyClone Logan, UT), 100 U/ml penicillin G, and 100 lg/ ml streptomycin (Life Technologies, Inc., Grand Island, NY) in a 90-cm culture dish (NUNC, Rochester, NY) and incubated at 37 °C with 5% CO2. Cells were then plated in a 6-well plate at a density of 3  105 cells per well one day before transfection. A mixture containing 700 ng of pGL3-CRE-luciferase reporter construct, 200 ng of pcDNA3.1 expression plasmids encoding either EP2 or EP4 (or empty vector), and 5 ll of Lipofectamine (Invitrogen, Carlsbad, CA) was prepared in 50 ll of PBS solution. Transfection was performed according to the manufacturer’s instructions when cells reached 70% confluency. After 24 h of culture, DF-1 cells were trypsinized and cultured in a 96-well plate at a density of 2  104 cells per well at 37 °C for 24 h before PGE2 treatment. Co-transfection of CRE-pGL3-luciferase construct with empty pcDNA3.1 vector was used as negative control. PGE2 (Cayman chemical, Ann Arbor, MI) was first dissolved in dimethyl sulfoxide (DMSO) and then diluted to the desired concentrations by serum-free DMEM. Following removal of medium from 96-well plate, 60 ll of PGE2-containing medium or drug-free medium (used as control) were added. The cells were incubated for an additional 6 h at 37 °C before being harvested for luciferase assay. After removal of culture medium, DF-1 cells were lysed by adding 50 ll of 1 Passive Lysis Buffer (Promega Corp., Madison, MI) per well, and the luciferase activity of 15 ll of cellular lysates was determined using luciferase assay reagent (Promega). 2.5. Data analysis The luciferase activities in each treatment group were expressed as relative fold increase as compared with the control group (without drug treatment). The data were analyzed by one-way ANOVA followed by Dunnett’s test using GraphPad Prism 4 (GraphPad Software, San Diego, CA). To validate our results, all experiments were repeated at least three times.

3. Results 3.1. Cloning of the full-length cDNAs for chicken EP2 and EP4

Primer sequencea

Size (bp)

TGCTCCTTGCCTCTGCTGGGCT GAATTCTCCTCCTGCGCCTACTG AAGCTTCCGGACCTGACATGACAG CAGAGCACCACAATAGCGATGAGGT CCCAGACATCAGGGTGTGATG GTTGGTGACAATACCGTGTTCAAT

617

Primers for constructing expression plasmidsb ep2 Sense AAGCTTGCGGCGGAGGGATGAACG Antisense GAATTCTCCTCCTGCGCCTACTG ep4 Sense AAGCTTAGCACGTGGGCGCCATGT Antisense GAATTCTATATACACTTCTCTGATA b

2 h in a total volume of 10 ll consisting of 2 lg of RNA, 1 PCR buffer, 10 mM dithiothreitol, 0.5 lM of each dNTP, 0.5 lg of oligo(dT), and 100 U of Superscript II (Invitrogen, Carlsbad, CA). One microliter of the first-strand cDNA was used as the template for each PCR reaction. According to our previously established methods (Wang and Ge, 2004; Wang et al., 2003, 2007), RT-PCR assays were performed to examine relative mRNA levels of EP2 and EP4 in the 12 tissues. PCR was performed under the following conditions: 2 min at 95 °C for denaturation, followed by 23 cycles (for b-actin: 30 s at 95 °C, 30 s at 62 °C, and 30 s at 72 °C), 35 cycles (for EP2: 30 s at 95 °C, 30 s at 64 °C, and 60 s at 72 °C), 40 cycles (for EP4: 30 s at 95 °C, 30 s at 58 °C, and 30 s at 72 °C) of reactions, ending with a 10-min extension at 72 °C. The primers used are listed in Table 1. The PCR products were electrophoresized in 2% agarose gels, stained with ethidium bromide, and visualized under UV illumination (Bio-Rad, Hercules, CA).

All primers were synthesized by Tech Dragon Ltd. (Hong Kong). Restriction sites added in the 50 -end of the primers are underlined.

294 123

1103 1453

The full-length cDNA of chicken EP2 (cEP2) is 1105 bp (GenBank accession No: EF200120) and encodes a precursor of 356 amino acids (Fig. 1). As expected, cEP2 shows high amino acid identity to that of human (Homo sapiens) (61%) (Regan et al., 1994), mouse (Mus musculus) (63%) (Katsuyama et al., 1995), rat (Rattus norvegicus) (61%) (Boie et al., 1997), dog (Canis lupus familiaris) (58%) (Hibbs et al., 1999), and cattle (Bos taurus) (59%) (Arosh et al., 2003) (Fig. 2), with the seven putative transmembrane domains being the most conserved. However, the striking difference in amino acid sequence of EP2 was also noted between chicken and mammals. Three highly variable regions, located in the intracellular loop 1, extracellular loop 2, and intracellular loop 3, respectively, were found in the ORF region of cEP2 (Fig. 2).

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

101

Fig. 1. Nucleotide and deduced amino acid sequence of chicken EP2. The full-length cDNA for EP2 is 1105 bp in length and encodes a precursor of 356 amino acids. The primer sequences for RT-PCR assay are shaded and underlined. Arrow head indicates the predicted location of an intron.

Fig. 2. Amino acid sequence alignment of chicken EP2 (cEP2: EF200120) to that of human (hEP2: NM_000956), mouse (mEP2: NM_008964), rat (rEP2: NM_031088), dog (dEP2: NM_001003170), and cattle (bEP2: NM_174588). The seven putative transmembrane domains (TMs) are shaded and labeled accordingly. Sequence underlined and in bold is the third intracellular loop (IC3). Three highly variable regions (I, II, and III) between chicken and mammals are boxed and labeled. Arrow head indicates the conserved threonine. The two cysteine residues for disulphide bond formation are boxed. Dots indicate amino acids identical to cEP2 and dashes represent gaps in the sequence.

102

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

The full-length cDNA for chicken EP4 (cEP4) is 1793 bp (Genbank accession No.: EF200121) and encodes a precursor of 475 amino acids (Fig. 3). cEP4 shows high sequence identity to that of human (87%) (Bastien et al., 1994), mouse (86%) (Honda et al., 1993), rat (84%) (Boie et al., 1997), dog (85%) (Castleberry et al., 2001), and cattle (83%) (Arosh et al., 2003) and a comparatively lower sequence identity to zebrafish (D. rerio) (52%) (Cha et al., 2006), as shown in Fig. 4. In spite of the high degree of amino acid sequence identity, remarkable difference was also noted in amino acid sequences of the 3rd intracellular loop and intracellular C-terminus between chicken and mammals, or between chicken and zebrafish (Fig. 4). Comparison of the cloned sequences to the chicken genome database (http://www.ensembl.org/Gallus_gallus) mapped cEP4 to chromosome Z, while cEP2 could not be located, possibly due to the gaps in the chicken genome database. cEP4 was found to consist of 3 exons separated by 2 introns, the first situated in its 50 untranslated region (50 UTR) and the second at the end of the 6th transmembrane domain (Fig. 3). With reference to the conserved exon–intron relationship between prostanoid receptors and across different species (Breyer et al., 2001; Narumiya et al., 1999), we predicted that an intron may also exist at the end of the sixth transmembrane domain (TM6) of cEP2 gene (Fig. 1). 3.2. Tissue distribution of EP2 and EP4 expression in chickens RT-PCR was performed to detect the mRNA expression of EP2 and EP4 in 12 adult chicken tissues, including brain, pituitary, lung, heart, liver, kidney, intestine, pancreas, breast muscle, spleen, ovary, and testis. EP2 was found to be widely expressed in all tissues examined (Fig. 5A). In contrast, EP4 was undetectable in most tissues. The strong PCR signal of EP4 was consistently detected in

the testis from different individuals, while weak PCR bands were only noted in several tissues including lung, pancreas, and pituitary (Fig. 5A). Negative controls were performed in each RT-PCR and no band was observed (data not shown). Prostaglandins are believed to be the major mediators for avian oviposition (Hertelendy, 1972, 1974; Saito et al., 1987b). PGE2, in particular, is shown to induce premature oviposition effectively in quail and chicken (Hertelendy, 1972, 1974; Wechsung and Houvenaghel, 1976). Thus, the expression of EP2 and EP4 in the oviduct of egg-laying hens were also examined in this study. EP2 was found consistently in all 5 parts of the chicken oviduct, including infundibulum, magnum, isthmus, shell gland, and vagina (Fig. 5B). In contrast, a weak PCR signal of EP4 was only detected in the vagina (Fig. 5B). 3.3. Activation of chicken EP2 and EP4 by prostaglandin E2 As a critical site for G-protein coupling of all GPCRs (Minneman, 2001; O’Dowd et al., 1988), the 3rd intracellular loop of both EP2 and EP4 differs significantly between chicken and mammals, hence led us to examine the functionality of the cloned chicken EP2 and EP4 (Figs. 2 and 4). To address this issue, chicken EP2 and EP4 receptors were expressed in vitro and subjected to treatment of its endogenous ligand, prostaglandin E2 (PGE2). As expected, PGE2 could stimulate luciferase activity in dose-dependent manners via activation of either EP2 or EP4. The high potencies of PGE2 on activating EP2 and EP4 (EP2, EC50: 0.406 nM; EP4, EC50: 0.075 nM) (Fig. 6) confirmed that both receptors are functional and able to couple to the cAMP-PKA signaling pathway. In contrast, no change in luciferase activity was observed in internal controls which were carried out by co-transfection of empty pcDNA3.1 vector and pGL3-CRE-luciferase construct into DF-1 cells (Fig. 6).

Fig. 3. Nucleotide and deduced amino acid sequence of chicken EP4. The full-length cDNA of cEP4 is 1793 in length and consists of three exons. The primer sequences for RTPCR assay are shaded and underlined. Arrows indicate the locations of two introns.

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

103

Fig. 4. Amino acid sequence alignment of chicken EP4 (cEP4: EF200121) to that of human (hEP4: NM_00958), mouse (mEP4: BC009023), rat (rEP4: NM_032076), dog (dEP4:NM_001003054), cattle (bEP4: NM_174589), and zebrafish (zEP4: BC127559). The seven putative transmembrane domains (TMs) are shaded and labeled accordingly. Sequence underlined and in bold represents the third intracellular loop (IC3). Two highly variable regions (I and II) of EP4 between chicken and other species are boxed. The two cysteine residues proposed to be important for disulphide bond formation are boxed. Arrow head indicates the conserved threonine residue of EP4. Dots indicate amino acids identical to cEP4 and dashes represent gaps in the sequence.

4. Discussion In the present study, the full-length cDNAs for prostaglandin E receptor subtypes 2 (cEP2) and 4 (cEP4) was cloned and functional studies confirmed that PGE2 could activate both receptors with high potencies (EC50 < 1 nM). Moreover, both receptors were also demonstrated to be differentially expressed in adult chicken tissues. To our knowledge, our study represents the first to report the functionality of EP2 and EP4 in the non-mammalian vertebrate species. Species alignment of EP2 and EP4 amino acid sequences shows that cEP2 and cEP4 both share high sequence identity with that of

mammals, including human (61%; 87%, respectively) (Bastien et al., 1994; Regan et al., 1994), mouse (63%; 86%) (Honda et al., 1993; Katsuyama et al., 1995), rat (61%; 84%) (Boie et al., 1997), dog (58%; 85%) (Castleberry et al., 2001; Hibbs et al., 1999), and cattle (59%; 83%) (Arosh et al., 2003) and relatively lower sequence identity to that of zebrafish (41%; 52%) (Cha et al., 2006), as shown in Figs. 2 and 4. Phylogenetic tree with bootstrap values for EP2 and EP4 was constructed by MEGA version 3.1 (Kumar et al., 2004) (Fig. 7), and it shows that both cEP2 and cEP4 are closely related to their corresponding counterparts in mammalian species and zebrafish, suggesting that the cloned receptors are the potential EP2 and EP4 in chickens. Amino acid sequence identity between

Testis

Spleen

Pituitary

Pancreas

Ovary

Muscle

Lung

Kidney

Heart

Brain

A

Liver

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

Small intestine

104

EP2(35) EP4(40)

Vagina

Shell gland

Isthmus

Magnum

B

Infundibulum

β-actin (23)

EP2 (35) EP4(40) β-actin (23) Fig. 5. Expression of prostaglandin E receptor subtypes 2 (EP2) and 4 (EP4) in adult chicken tissues (A) (upper and middle panel) and 5 parts of oviduct from egg-laying hens (B) (upper and middle panel). b-actin was amplified as an internal control for each sample (lower panels in A and B). Numbers in parentheses indicate the number of PCR cycle used. All negative controls are not shown.

Fig. 6. Functional characterization of chicken prostaglandin E receptor subtypes 2 (EP2) and 4 (EP4) upon prostaglandin E2 (PGE2; 1012 to 107 M, 6 h) treatment, monitored by a system of co-transfection of pGL3-CRE-luciferase reporter construct and chicken EP2 or EP4 expression plasmids in DF-1 cells. Each data point represents mean ± SEM of three replicates. Co-transfection of empty pcDNA3.1 vector and pGL3-CRE-luciferase reporter construct was used as an internal control.

cEP2 and cEP4 is only 32%, which is typical within the prostanoid receptor family (Breyer et al., 2001; Narumiya et al., 1999). Despite their limited sequence identity, the functionally similar cEP2 and cEP4, both mediating cAMP-PKA pathway, are closer to each other than to the functionally different PGE receptor subtypes, cEP3 and hEP1 (human EP1 was used because cEP1 was not cloned) (Fig. 7). This agrees with the prevailing molecular evolution model, in which an ancestral primitive PGE receptor gene was suggested to

Fig. 7. Phylogenetic tree (constructed by Neighbor-joining method) showing the evolutionary relationships between EP2 and EP4 in different species, including human (h), mouse (m), rat (r), dog (d), cattle (b), chicken (c) and zebrafish (z). hEP1 and cEP3 are only included to show the evolutionary relationship between the four PGE receptor subtypes. hEP1 is used because cEP1 is not cloned. Numbers adjacent to branch points indicate the bootstrap values.

evolve into the different subtypes to mediate different signal transduction pathways (Breyer et al., 2001; Narumiya et al., 1999; Toh et al., 1995). Belonging to the GPCR superfamily and subdivided into the rhodopsin-type receptor family, EP2 and EP4 share a number of characteristics. Each of them consists of an extracellular N-terminus, seven transmembrane domains and an intracellular C-terminus

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

(Figs. 2 and 4). The putative amino acid sequences for the later two regions in cEP2 and cEP4 are highlighted in Figs. 2 and 4, respectively. Two highly conserved cysteine residues among GPCRs (Dohlman et al., 1991) proposed to be involved in disulphide bond formation were located as Cys99 and Cys177 in cEP2, and Cys100 and Cys178 in cEP4 (Figs. 2 and 4). A threonine residue, conserved among EP2 and EP4 and suggested to be important for ligand binding (Stillman et al., 1998), was also found in the cloned receptors (Thr175 in cEP2; Thr176 in cEP4) (Figs. 2 and 4). Apart from these similarities, EP2 and EP4 have several distinctive differences. As in mammals (Narumiya et al., 1999), cEP4 is longer than cEP2 in length of amino acid sequence (475 a.a. vs. 356 a.a.), with the major difference lying in their lengths of 3rd intracellular loops and intracellular C-termini (Figs. 2 and 4). The longer C-terminus of EP4 hosts a higher number of putative phosphorylation sites and is believed to be important for the higher tendency of EP4 to undergo short term ligand-induced receptor internalization and desensitization, thus suggesting potential functional differences in signal transduction between EP2 and EP4 in response to their ligands (Desai et al., 2000; Neuschafer-Rube et al., 1999; Nishigaki et al., 1996). RT-PCR showed that cEP2 mRNA is widely expressed in adult chicken tissues including the ovary, while in contrast, cEP4 mRNA is undetectable in most tissues, except pancreas, pituitary, lung, and testis. The tissue distribution pattern in chickens is different from most findings in mammals, in which EP4 is found to be widely expressed across tissues and EP2 shows restricted expression in only a few tissues (Bastien et al., 1994; Honda et al., 1993; Katsuyama et al., 1995; Regan et al., 1994). This discrepancy, possibly due to species difference, suggests the different roles of EP2 and EP4 in different species. For instance, both EP2 and EP4 are expressed in mammalian ovaries (Hizaki et al., 1999; Kennedy et al., 1999), suggesting that they play an important role in follicular development and ovulation (Segi et al., 1998); however only EP2 is detected in abundance in chicken ovary (Fig. 5). PGE2 has been shown to play a role in oviposition in quails and chickens (Hertelendy, 1972, 1974; Saito et al., 1987a, b). Both in vivo and in vitro experiments dated as way back to the 1970s have provided evidences that PGE2 facilitates this process by inducing smooth muscle contraction in the uterus and relaxation in the vagina (Hertelendy, 1972, 1974; Hertelendy et al., 1974; Wechsung and Houvenaghel, 1976). The latter process is suggested to be the primary function of PGE2 to allow expulsion of eggs, possibly through accumulation of intracellular cAMP (Asem et al., 1987). Study by Wechsung and Houvenaghel has also suggested its possible involvement in regulation of ovum transport, as a major part of the hen oviduct preceding the shell gland, namely infundibulum, magnum, and isthmus, responds to administration of PGE2 in vitro by either contraction or relaxation (Wechsung and Houvenaghel, 1976). Using RT-PCR assay, our study also revealed that EP2 mRNA was expressed in all 5 parts of the chicken oviduct, including infundibulum, magnum, isthmus, shell gland and vagina (Fig. 5B), while weak expression of EP4 was only detected in the vagina (Fig. 5B). Their localizations, especially the wide distribution of EP2, along the oviduct further support the proposed involvement of PGE2 and its receptor(s) in chicken ovum transport and oviposition (Asem et al., 1987; Hertelendy, 1972, 1974; Saito et al., 1987a, b; Wechsung and Houvenaghel, 1976). Since both EP2 and EP4 also show remarkable sequence diversity between species, particularly in the 3rd intracellular loop which is a site responsible for G-protein coupling of all GPCRs (O’Dowd et al., 1988), therefore functional assays were carried out for cEP2 and cEP4 in this study. The assay system has been established in our laboratory as a mean to evaluate cAMP-induced luciferase activities promoted by receptors or factors which upon activation

105

cause accumulation of intracellular cAMP (Wang et al., 2007). As previously mentioned, EP2 and EP4 are coupled to Gs protein and, via activation of AC, believed to stimulate cAMP stimulation, thus the measured luciferase activities in response to their natural ligand, PGE2, reflect their capabilities in ligand binding and signaling property. As expected, both cEP2 and cEP4 were shown to stimulate luciferase activity upon ligand stimulation (Fig. 6), confirming the functionality of the cloned receptors. This finding paves the way to further elucidate the physiological roles of PGE2 in various chicken tissues. In summary, the full-length cDNAs for chicken prostaglandin E receptor subtypes 2 and 4 (EP2 and EP4) have been cloned in the present study. RT-PCR results show that EP2 is widely expressed in all tissues examined including the oviduct, while EP4 is undetectable in most tissues. Functional assays further demonstrate that both EP2 and EP4 can be activated by their natural ligand, prostaglandin E2 (PGE2). Taken together, our studies strongly suggest that the functional EP2 and/or EP4 could mediate the biological actions of PGE2 in a wide range of tissues in chickens, as has been demonstrated in mammals. Acknowledgments This work was supported by Research Grant Council of the Hong Kong Government HKU7345/03M and Seed Funding Program of the University of Hong Kong (200801159009). References Abramovitz, M., Adam, M., Boie, Y., Carriere, M., Denis, D., Godbout, C., Lamontagne, S., Rochette, C., Sawyer, N., Tremblay, N.M., Belley, M., Gallant, M., Dufresne, C., Gareau, Y., Ruel, R., Juteau, H., Labelle, M., Ouimet, N., Metters, K.M., 2000. The utilization of recombinant prostanoid receptors to determine the affinities and selectivities of prostaglandins and related analogs. Biochim. Biophys. Acta 1483, 285–293. Ainsworth, L., Tsang, B.K., Marcus, G.J., Downey, B.R., 1984. Prostaglandin production by dispersed granulosa and theca interna cells from porcine preovulatory follicles. Biol. Reprod. 31, 115–121. Arosh, J.A., Banu, S.K., Chapdelaine, P., Emond, V., Kim, J.J., MacLaren, L.A., Fortier, M.A., 2003. Molecular cloning and characterization of bovine prostaglandin E2 receptors EP2 and EP4: expression and regulation in endometrium and myometrium during the estrous cycle and early pregnancy. Endocrinology 144, 3076–3091. Asem, E.K., Todd, H., Hertelendy, F., 1987. In vitro effect of prostaglandins on the accumulation of cyclic AMP in the avian oviduct. Gen. Comp. Endocrinol. 66, 244–247. Bastien, L., Sawyer, N., Grygorczyk, R., Metters, K.M., Adam, M., 1994. Cloning, functional expression, and characterization of the human prostaglandin E2 receptor EP2 subtype. J. Biol. Chem. 269, 11873–11877. Boie, Y., Stocco, R., Sawyer, N., Slipetz, D.M., Ungrin, M.D., Neuschafer-Rube, F., Puschel, G.P., Metters, K.M., Abramovitz, M., 1997. Molecular cloning and characterization of the four rat prostaglandin E2 prostanoid receptor subtypes. Eur. J. Pharmacol. 340, 227–241. Breyer, M.D., Breyer, R.M., 2000. Prostaglandin E receptors and the kidney. Am. J. Physiol. Renal. Physiol. 279, F12–F23. Breyer, R.M., Bagdassarian, C.K., Myers, S.A., Breyer, M.D., 2001. Prostanoid receptors: subtypes and signaling. Annu. Rev. Pharmacol. Toxicol. 41, 661–690. Castleberry, T.A., Lu, B., Smock, S.L., Owen, T.A., 2001. Molecular cloning and functional characterization of the canine prostaglandin E2 receptor EP4 subtype. Prostaglandins Other Lipid Mediat. 65, 167–187. Cha, Y.I., Kim, S.H., Sepich, D., Buchanan, F.G., Solnica-Krezel, L., DuBois, R.N., 2006. Cyclooxygenase-1-derived PGE2 promotes cell motility via the G-proteincoupled EP4 receptor during vertebrate gastrulation. Genes Dev. 20, 77–86. Desai, S., April, H., Nwaneshiudu, C., Ashby, B., 2000. Comparison of agonist-induced internalization of the human EP2 and EP4 prostaglandin receptors: role of the carboxyl terminus in EP4 receptor sequestration. Mol. Pharmacol. 58, 1279– 1286. Dey, I., Lejeune, M., Chadee, K., 2006. Prostaglandin E2 receptor distribution and function in the gastrointestinal tract. Br. J. Pharmacol. 149, 611–623. Dohlman, H.G., Thorner, J., Caron, M.G., Lefkowitz, R.J., 1991. Model systems for the study of seven-transmembrane-segment receptors. Annu. Rev. Biochem. 60, 653–688. Evans, G., Dobias, M., King, G.J., Armstrong, D.T., 1983. Production of prostaglandins by porcine preovulatory follicular tissues and their roles in intrafollicular function. Biol. Reprod. 28, 322–328. Ferreira, S.H., Vane, J.R., 1967. Prostaglandins: their disappearance from and release into the circulation. Nature 216, 868–873.

106

A.H.Y. Kwok et al. / General and Comparative Endocrinology 157 (2008) 99–106

Goodwin, J.S., Ceuppens, J., 1983. Regulation of the immune response by prostaglandins. J. Clin. Immunol. 3, 295–315. Hertelendy, F., 1972. Prostaglandin-induced premature oviposition in the coturnix quail. Prostaglandins 2, 269–279. Hertelendy, F., 1974. Effects of prostaglandins, cyclic AMP, seminal plasma, indomethacin, and other factors on oviposition in the Japanese quail, Coturnix coturnix japonica. J. Reprod. Fertil. 40, 87–93. Hertelendy, F., Yeh, M., Biellier, H.V., 1974. Induction of oviposition in the domestic hen by prostaglandins. Gen. Comp. Endocrinol. 22, 529–531. Hibbs, T.A., Lu, B., Smock, S.L., Vestergaard, P., Pan, L.C., Owen, T.A., 1999. Molecular cloning and characterization of the canine prostaglandin E receptor EP2 subtype. Prostaglandins Other Lipid Mediat. 57, 133–147. Hizaki, H., Segi, E., Sugimoto, Y., Hirose, M., Saji, T., Ushikubi, F., Matsuoka, T., Noda, Y., Tanaka, T., Yoshida, N., Narumiya, S., Ichikawa, A., 1999. Abortive expansion of the cumulus and impaired fertility in mice lacking the prostaglandin E receptor subtype EP(2). Proc. Natl. Acad. Sci. USA 96, 10501–10506. Honda, A., Sugimoto, Y., Namba, T., Watabe, A., Irie, A., Negishi, M., Narumiya, S., Ichikawa, A., 1993. Cloning and expression of a cDNA for mouse prostaglandin E receptor EP2 subtype. J. Biol. Chem. 268, 7759–7762. Katsuyama, M., Nishigaki, N., Sugimoto, Y., Morimoto, K., Negishi, M., Narumiya, S., Ichikawa, A., 1995. The mouse prostaglandin E receptor EP2 subtype: cloning, expression, and northern blot analysis. FEBS Lett. 372, 151–156. Kennedy, C.R., Zhang, Y., Brandon, S., Guan, Y., Coffee, K., Funk, C.D., Magnuson, M.A., Oates, J.A., Breyer, M.D., Breyer, R.M., 1999. Salt-sensitive hypertension and reduced fertility in mice lacking the prostaglandin EP2 receptor. Nat. Med. 5, 217–220. Kiriyama, M., Ushikubi, F., Kobayashi, T., Hirata, M., Sugimoto, Y., Narumiya, S., 1997. Ligand binding specificities of the eight types and subtypes of the mouse prostanoid receptors expressed in Chinese hamster ovary cells. Br. J. Pharmacol. 122, 217–224. Klein, D.C., Raisz, L.G., 1970. Prostaglandins: stimulation of bone resorption in tissue culture. Endocrinology 86, 1436–1440. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150– 163. Labhsetwar, A.P., 1971. Luteolysis and ovulation induced by prostaglandin F2-a in the hamster. Nature 230, 528–529. Labhsetwar, A.P., 1972. Luteolytic and ovulation-inducing properties of prostaglandin F 2 in pregnant mice. J. Reprod. Fertil. 28, 451–452. McGiff, J.C., Malik, K.U., Terragno, N.A., 1976. Prostaglandins as determinants of vascular reactivity. Fed. Proc. 35, 2382–2387. Minneman, K.P., 2001. Splice variants of G protein-coupled receptors. Mol. Interv. 1, 108–116. Miyaura, C., Inada, M., Suzawa, T., Sugimoto, Y., Ushikubi, F., Ichikawa, A., Narumiya, S., Suda, T., 2000. Impaired bone resorption to prostaglandin E2 in prostaglandin E receptor EP4-knockout mice. J. Biol. Chem. 275, 19819–19823. Narumiya, S., Sugimoto, Y., Ushikubi, F., 1999. Prostanoid receptors: structures, properties, and functions. Physiol. Rev. 79, 1193–1226. Neuschafer-Rube, F., Oppermann, M., Moller, U., Boer, U., Puschel, G.P., 1999. Agonist-induced phosphorylation by G protein-coupled receptor kinases of the EP4 receptor carboxyl-terminal domain in an EP3/EP4 prostaglandin E(2) receptor hybrid. Mol. Pharmacol. 56, 419–428. Nguyen, M., Camenisch, T., Snouwaert, J.N., Hicks, E., Coffman, T.M., Anderson, P.A., Malouf, N.N., Koller, B.H., 1997. The prostaglandin receptor EP4 triggers remodelling of the cardiovascular system at birth. Nature 390, 78–81. Nishigaki, N., Negishi, M., Ichikawa, A., 1996. Two Gs-coupled prostaglandin E receptor subtypes, EP2 and EP4, differ in desensitization and sensitivity to the metabolic inactivation of the agonist. Mol. Pharmacol. 50, 1031–1037.

O’Dowd, B.F., Hnatowich, M., Regan, J.W., Leader, W.M., Caron, M.G., Lefkowitz, R.J., 1988. Site-directed mutagenesis of the cytoplasmic domains of the human b 2adrenergic receptor. Localization of regions involved in G protein-receptor coupling. J. Biol. Chem. 263, 15985–15992. Patwardhan, V.V., Lanthier, A., 1981. Prostaglandins PGE and PGF in human ovarian follicles: endogenous contents and in vitro formation by theca and granulosa cells. Acta Endocrinol. (Copenh) 97, 543–550. Regan, J.W., Bailey, T.J., Pepperl, D.J., Pierce, K.L., Bogardus, A.M., Donello, J.E., Fairbairn, C.E., Kedzie, K.M., Woodward, D.F., Gil, D.W., 1994. Cloning of a novel human prostaglandin receptor with characteristics of the pharmacologically defined EP2 subtype. Mol. Pharmacol. 46, 213–220. Saito, N., Sato, K., Shimada, K., 1987a. Prostaglandin levels in peripheral and follicular plasma, the isolated theca and granulosa layers of pre- and postovulatory follicles, and the myometrium and mucosa of the shell gland (uterus) during a midsequence-oviposition of the hen (Gallus domesticus). Biol. Reprod. 36, 89–96. Saito, N., Shimada, K., Koike, T.I., 1987b. Interrelationship between arginine vasotocin, prostaglandin, and uterine contractility in the control of oviposition in the hen (Gallus domesticus). Gen. Comp. Endocrinol. 67, 342–347. Sakuma, Y., Tanaka, K., Suda, M., Yasoda, A., Natsui, K., Tanaka, I., Ushikubi, F., Narumiya, S., Segi, E., Sugimoto, Y., Ichikawa, A., Nakao, K., 2000. Crucial involvement of the EP4 subtype of prostaglandin E receptor in osteoclast formation by proinflammatory cytokines and lipopolysaccharide. J. Bone Miner. Res. 15, 218–227. Segi, E., Sugimoto, Y., Yamasaki, A., Aze, Y., Oida, H., Nishimura, T., Murata, T., Matsuoka, T., Ushikubi, F., Hirose, M., Tanaka, T., Yoshida, N., Narumiya, S., Ichikawa, A., 1998. Patent ductus arteriosus and neonatal death in prostaglandin receptor EP4-deficient mice. Biochem. Biophys. Res. Commun. 246, 7–12. Smith, W.L., Dewitt, D.L., 1996. Prostaglandin endoperoxide H synthases-1 and -2. Adv. Immunol. 62, 167–215. Sonoshita, M., Takaku, K., Sasaki, N., Sugimoto, Y., Ushikubi, F., Narumiya, S., Oshima, M., Taketo, M.M., 2001. Acceleration of intestinal polyposis through prostaglandin receptor EP2 in Apc(Delta 716) knockout mice. Nat. Med. 7, 1048–1051. Stillman, B.A., Audoly, L., Breyer, R.M., 1998. A conserved threonine in the second extracellular loop of the human EP2 and EP4 receptors is required for ligand binding. Eur. J. Pharmacol. 357, 73–82. Tilley, S.L., Audoly, L.P., Hicks, E.H., Kim, H.S., Flannery, P.J., Coffman, T.M., Koller, B.H., 1999. Reproductive failure and reduced blood pressure in mice lacking the EP2 prostaglandin E2 receptor. J. Clin. Invest. 103, 1539–1545. Toh, H., Ichikawa, A., Narumiya, S., 1995. Molecular evolution of receptors for eicosanoids. FEBS Lett. 361, 17–21. Vane, J.R., McGiff, J.C., 1975. Possible contributions of endogenous prostaglandins to the control of blood pressure. Circ. Res. 36, 68–75. Wang, Y., Ge, W., 2004. Developmental profiles of activin bA, bB, and follistatin expression in the zebrafish ovary: evidence for their differential roles during sexual maturation and ovulatory cycle. Biol. Reprod. 71, 2056–2064. Wang, Y., Li, J., Wang, C.Y., Kwok, A.H., Leung, F.C., 2007. Identification of the endogenous ligands for chicken growth hormone-releasing hormone (GHRH) receptor: evidence for a separate gene encoding GHRH in submammalian vertebrates. Endocrinology 148, 2405–2416. Wang, Y., Wong, A.O., Ge, W., 2003. Cloning, regulation of messenger ribonucleic acid expression, and function of a new isoform of pituitary adenylate cyclaseactivating polypeptide in the zebrafish ovary. Endocrinology 144, 4799–4810. Wechsung, E., Houvenaghel, A., 1976. A possible role of prostaglandins in the regulation of ovum transport and oviposition in the domestic hen? Prostaglandins 12, 599–608.